PEER-REVIEWED ARTICLE Dongryeoul Bae,1 Ronald D. Smiley,2 3 1* Food Protection Trends, Vol 36, No. 5, p.357–361 Ezat H. Mezal and Ashraf A. Khan Copyright© 2016, International Association for Food Protection 6200 Aurora Ave., Suite 200W, Des Moines, IA 50322-2864 1*Division of Microbiology, National Center for Toxicological Research, U.S. Food and Drug Administration, Jefferson, AR 72079, USA 2Arkansas Regional Laboratory, Office of Regulatory Affairs, U.S. Food and Drug Administration, Jefferson, AR 72079, USA 3Dept. of Biology, University of Thi-Qar, Thi-Qar, Iraq Food Products and Processing Facilities Linked to Recent Outbreaks of Listeriosis in the US Frozen Vegetables (2016, WA) Cheeses (2013, WI) Raw Milk Caramel Apples Soy Products (2016, PA) (2014 – 2015, CA) (2014, IL) Packaged Salads Dairy Products (2016, OH) (2014, DE) Caramel Apples (2014 – 2015, MO) Soft Cheese Ice Cream (2015, CA) (2015, OK) Ice Cream (2015, AL) Ice Cream Product (2015, TX) Soft Cheese (2014, FL) Data source: Centers for Disease Control and Prevention www.cdc.gov/listeria/outbreaks/index,html Characterization and Antimicrobial Resistance of Listeria monocytogenes Isolated from Food-related Environments ABSTRACT streptomycin and tetracycline. No strain was resist- The purpose of this study was to determine the ant to 3 or more antimicrobial classes. All tetracy- diversity and antimicrobial resistance of Listeria cline-resistant strains were serotype 1/2a, and only monocytogenes strains isolated from food-related tetM was amplified from the chromosomal DNA. This environments in the United States. Nineteen unre- study, which reports the genetic diversity and anti- lated strains of L. monocytogenes were recovered microbial resistance of foodborne L. monocytogenes, from approximately 1300 food and food processing may be useful in food safety control programs to environmental samples collected from 2007 to 2011 reduce the risk of transmission of L. monocytogenes as part of the U.S. Food and Drug Administration to food products. pathogen surveillance program. The L. monocyto- genes environmental isolates were characterized by INTRODUCTION serotyping, subtyping, and identification of antimicro- Listeria monocytogenes, a Gram-positive, facultatively bial resistance determinants. The serovars of intracellular foodborne bacterial pathogen that causes L. monocytogenes were 1/2a, 4b, and 1/2b. PFGE human listeriosis (6, 13), is widely distributed in the using AscI digested total DNA showed genetic natural environment and foods. L. monocytogenes has been diversity; there were 10 PFGE pulse-types and 5 recognized as a major human foodborne pathogen ever PFGE groups. All strains except one strain were since a large Listeria outbreak occurred in 1983 in the susceptible to ampicillin, erythromycin, vancomycin, United States (U.S.) from improperly pasteurized milk ciprofloxacin, and chloramphenicol but resistant to (13). The hospitalization (91.0%) and mortality (19.5%) extended-spectrum cephalosporins (ESC). The envi- rates due to listeriosis are estimated to be the highest ronmental strains were predominantly resistant to among those caused by foodborne pathogens in the U.S. *Corresponding author: Phone: +1 870.543.7601; Fax: +1 870.543.7307; E-mail: [email protected] September/October Food Protection Trends 357 (4, 18). Higher mortality rates are typically associated Bacterial cultivation and pulsed-field gel electrophoresis with immunocompromised persons, the elderly, pregnant (PFGE) women, and neonates (9). L. monocytogenes isolates were cultured in BHI broth Of the recognized Listeria species, only L. monocytgenes is (Difco Laboratories, Detroit, MI). Turbidity measurements associated with human listeriosis outbreaks, with serotype and PFGE analysis for subtyping were based on the CDC 4b being the most commonly implicated serotype (2). standard protocol (http://www.cdc.gov/pulsenet/protocols/ Although serotypes 1/2a and 1/2b are more frequently pulsenet_listeria_protocol%20.pdf) as modified for a isolated from food products, serotype 4b is more frequently previous study (1). The restriction enzymesAsc I and ApaI isolated from clinical specimens (8). Hence, serotyping and were used to digest the DNA plugs. subtyping of L. monocytogenes isolates are epidemiologically important steps in identification and classification of this Antimicrobial susceptibility assays and MIC pathogen during human listeriosis outbreaks as well as in determination routine regulatory surveillance. Antimicrobial susceptibility was determined according L. monocytogenes in food products is believed to be to the Clinical and Laboratory Standards Institute (CLSI) derived from the food processing environment despite guidelines (http://www.microbiolab-bg.com/CLSI. a lack of direct evidence linking a specific foodborne pdf). Broth microdilution assays were used to determine L. monocytogenes strain to the food processing plant the minimum inhibitory concentration (MIC) of each environment (7, 19). Listeria species that persist in the antimicrobial: ampicillin, cephalothin, cefoxitin, ceftriaxone, food processing environment may develop resistance to cefepime, gentamicin, kanamycin, streptomycin, tetracycline, chemicals used in cleaning and sanitation (3, 11, 14). erythromycin, vancomycin, rifampicin, ciprofloxacin, Therefore, persistent monitoring of this pathogen in food- sulfamethoxazole-trimethoprim, and chloramphenicol. related environments is important to prevent or minimize Antibiotic diffusion disks (BD, Franklin Lakes, NJ) were contamination of the final food product. In addition, used to confirm antimicrobial resistance of all strains. microbiological environmental monitoring provides Staphylococcus aureus (ATCC 25923) and L. monocytogenes useful information for food safety control programs such EGD-e were used as reference strains (1). as Hazard Analysis Critical Control Point (HACCP) and good manufacturing practices (GMPs) (5). Detection of genes involved in antimicrobial resistance The National Antimicrobial Resistance Monitoring The polymerase chain reaction (PCR) was used to detect System (NARMS) has monitored the antimicrobial resis- genes conferring aminoglycoside, ß-lactam, or tetracycline tance of all of the major foodborne pathogens, except resistance. Primers used in this study are shown in Table L. monocytogenes, since 1996. L. monocytogenes is asso- 1. Genomic DNA was extracted from resistant strains by ciated with high hospitalization and mortality rates, and use of the Qiagen DNeasy Blood and Tissue kit (Qiagen, antimicrobial resistance appears to be increasing (4, 15, Valencia, CA), or plasmid DNA was extracted by a previously 18). The contamination of food products by L. monocy- described method (12). Amplification reactions were done togenes is a major concern to regulatory agencies and the with the Taq PCR Master Mix Kit (Qiagen) and 400 nM food industry, both of which seek to minimize consumer primers (Table 1) by use of an Applied Biosystem Veriti™ 96 exposure to this organism. Therefore, the purpose of this well thermal cycler (Life Technologies: Grand Island, NY, study was to genotypically and phenotypically character- USA). PCR for tetM was performed under the following ize food-related environmental L. monocytogenes isolates conditions: initially incubated at 95°C for 10 min, then and determine their antimicrobial resistance. subjected to 35 cycles of 95°C for 15 sec, 56°C for 15 sec, and 72°C for 30 sec, with a final extension at 72°C for 5 min. MATERIALS AND METHODS PCR conditions for other antimicrobial-resistance genes were Isolation and identification of Listeria spp. strains published previously (15). The samples were collected from food processing facilities in the U.S. during 2007 to 2011 by the Pacific RESULTS AND DISCUSSION Regional Laboratory-Southwest of the FDA (PRL, Irvine, Phenotypic and genotypic diversity of L. monocytogenes CA), using FDA guidance. The guidance is available isolates at http://www.fda.gov/Food/GuidanceRegulation/ Nineteen L. monocytogenes strains were recovered from GuidanceDocumentsRegulatoryInformation/ food-processing environments in the U.S.: nine, six, and four FoodProcessingHACCP/ucm073110.htm#app4. strains of serotypes 1/2a, 4b, and 1/2b, respectively. Nineteen L. monocytogenes strains were recovered, L. monocytogenes isolates were grouped into 10 pulse-types by identified, and serotyped as described in the U.S. Food dendrogram analysis of the PFGE banding patterns fromAsc I and Drug Administration Bacteriological Analytical restriction enzyme digestion of total DNA, using a threshold of Manual (BAM) and in previous studies (1, 10). > 90% genetic similarity among the strains within each pulse- 358 Food Protection Trends September/October Table 1. Primer sequences used in the study Primer Squences (5'-3') Gene Forward Reverse Size (bp) Reference aad6 AGAAGATGTAATAATATAG CTGTAATCACTGTTCCCGCCT 978 (15) dfrD AGAGTAATCGGCAAGGATAACG AATGGGCAATTTCACAATCC 199 (15) tet(K) CGATAGGAACAGCAGTATGG TTAGCCCACCAGAAAACAAACC 614 (15) tet(L) CCACCTGCGAGTACAAACTGG TCGGCAGTACTTAGCTGGTGA 739 (15) tet(M) CATTCACATCGAAGTGCCGC ACACCGAGCAGGGATTTCTC 463 This study tet(S) ATCAAGATATTAAGGAC TTCTCTATGTGGTAATC 589 (15) Figure 1. Analysis of PFGE profiles by AscI-digestion and descriptions of L. monocytogenes isolated from food-related environments. A total of 19 L. monocytogenes environmental isolates were classified by more than 90% similarity of PFGE band pattern among the strains. Edemiological data show detection year, serotype and
Details
-
File Typepdf
-
Upload Time-
-
Content LanguagesEnglish
-
Upload UserAnonymous/Not logged-in
-
File Pages5 Page
-
File Size-