Chemoproteomic Profiling of Kinases in Live Cells Using Electrophilic
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
OXSR1 (A-4): Sc-271707
SANTA CRUZ BIOTECHNOLOGY, INC. OXSR1 (A-4): sc-271707 BACKGROUND APPLICATIONS Oxidative stress-responsive 1 protein (OXSR1), a protein of 527 amino acids, OXSR1 (A-4) is recommended for detection of OXSR1 of mouse, rat and belongs to the STE20 subfamily. OXSR1 is one of two human homologs of human origin by Western Blotting (starting dilution 1:100, dilution range Fray, a serine/threonine kinase expressed in Drosophila. OXSR1 binds to and 1:100-1:1000), immunoprecipitation [1-2 µg per 100-500 µg of total protein phosphorylates p21-activated protein kinase (PAK1) and regulates downstream (1 ml of cell lysate)], immunofluorescence (starting dilution 1:50, dilution kinases in response to environmental stress. Endogenous OXSR1 is activated range 1:50-1:500) and solid phase ELISA (starting dilution 1:30, dilution only by osmotic stresses, notably sorbitol and to a lesser extent NaCl. OXSR1 range 1:30-1:3000). may also play a role in regulating the Actin cytoskeleton. The chloride channel Suitable for use as control antibody for OXSR1 siRNA (h): sc-61273, OXSR1 proteins SLC12A1, SLC12A2 and SLC12A6 isoform 2 interact with OXSR1, siRNA (m): sc-61274, OXSR1 shRNA Plasmid (h): sc-61273-SH, OXSR1 but SLC12A4 and SLC12A7 do not. The WNK1 and WNK4 protein kinases shRNA Plasmid (m): sc-61274-SH, OXSR1 shRNA (h) Lentiviral Particles: activate OXSR1 by phosphorlating its T-loop. The OXSR1 protein is widely sc-61273-V and OXSR1 shRNA (m) Lentiviral Particles: sc-61274-V. expressed in mammalian tissues. Molecular Weight of OXSR1: 58 kDa. REFERENCES Positive Controls: OXSR1 (h3): 293 Lysate: sc-158793, HeLa whole cell lysate: 1. -
(MMP-9) in Oral Cancer Squamous Cells—Are There Therapeutical Hopes?
materials Article Lutein Treatment Effects on the Redox Status and Metalloproteinase-9 (MMP-9) in Oral Cancer Squamous Cells—Are There Therapeutical Hopes? 1 2,3 4 1 Dan Alexandru Enăs, escu , Mihaela Georgeta Moisescu , Marina Imre , Maria Greabu , Alexandra Ripszky Totan 1,* , Iulia Stanescu-Spinu 1, Marian Burcea 5, Crenguta Albu 6,* and Daniela Miricescu 1 1 Department of Biochemistry, Faculty of Dental Medicine, University of Medicine and Pharmacy Carol Davila, 8 Eroii Sanitari Blvd., Sector 5, 050474 Bucharest, Romania; [email protected] (D.A.E.); [email protected] (M.G.); [email protected] (I.S.-S.); [email protected] (D.M.) 2 Department Biophysics and Cellular Biotechnology, University of Medicine and Pharmacy Carol Davila, 8 Eroii Sanitari Blvd., Sector 5, 050474 Bucharest, Romania; [email protected] 3 Excellence Centre for Research in Biophysics and Cellular Biotechnology, University of Medicine and Pharmacy Carol Davila, 8 Eroii Sanitari Blvd., Sector 5, 050474 Bucharest, Romania 4 Department of Complete Denture, Faculty of Dental Medicine, Carol Davila University of Medicine and Pharmacy, 8 Eroii Sanitari Blvd., Sector 5, 050474 Bucharest, Romania; [email protected] 5 Department of Ophthalmology, Faculty of General Medicine, University of Medicine and Pharmacy Carol Davila, 8 Eroilor Sanitari Blvd., 050474 Bucharest, Romania; [email protected] 6 Department of Genetics, Faculty of General Medicine, University of Medicine and Pharmacy Carol Davila, 8 Eroilor Sanitari Blvd., 050474 Bucharest, Romania * Correspondence: [email protected] (A.R.T.); [email protected] (C.A.) Citation: En˘as, escu, D.A.; Moisescu, M.G.; Imre, M.; Greabu, M.; Ripszky Totan, A.; Stanescu-Spinu, I.; Burcea, Abstract: Carotenoids loaded in nanoparticles should be regarded as a promising way to increase M.; Albu, C.; Miricescu, D. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
OXSR1 Mouse Monoclonal Antibody [Clone ID: OTI1F3] Product Data
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for TA500392 OXSR1 Mouse Monoclonal Antibody [Clone ID: OTI1F3] Product data: Product Type: Primary Antibodies Clone Name: OTI1F3 Applications: IHC, WB Recommended Dilution: WB 1:1000, IHC 1:150 Reactivity: Human, Monkey, Mouse, Rat, Dog Host: Mouse Isotype: IgG1 Clonality: Monoclonal Immunogen: Full-length protein expressed in 293T cell transfected with human OXSR1 expression vector Formulation: PBS (pH 7.3) containing 1% BSA, 50% glycerol and 0.02% sodium azide. Concentration: 1.28 mg/ml Purification: Purified from mouse ascites fluids or tissue culture supernatant by affinity chromatography (protein A/G) Conjugation: Unconjugated Storage: Store at -20°C as received. Stability: Stable for 12 months from date of receipt. Predicted Protein Size: 57.8 kDa Gene Name: oxidative stress responsive kinase 1 Database Link: NP_005100 Entrez Gene 108737 MouseEntrez Gene 316064 RatEntrez Gene 607809 DogEntrez Gene 696362 MonkeyEntrez Gene 9943 Human O95747 Background: The product of this gene belongs to the Ser/Thr protein kinase family of proteins. It regulates downstream kinases in response to environmental stress, and may play a role in regulating the actin cytoskeleton.Regulates downstream kinases in response to environmental stress. May also have a function in regulating the actin cytoskeleton Synonyms: OSR1 This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 OXSR1 Mouse Monoclonal Antibody [Clone ID: OTI1F3] – TA500392 Protein Families: Druggable Genome, Protein Kinase Product images: HEK293T cells were transfected with the pCMV6- ENTRY control (Cat# [PS100001], Left lane) or pCMV6-ENTRY OXSR1 (Cat# [RC200396], Right lane) cDNA for 48 hrs and lysed. -
4-6 Weeks Old Female C57BL/6 Mice Obtained from Jackson Labs Were Used for Cell Isolation
Methods Mice: 4-6 weeks old female C57BL/6 mice obtained from Jackson labs were used for cell isolation. Female Foxp3-IRES-GFP reporter mice (1), backcrossed to B6/C57 background for 10 generations, were used for the isolation of naïve CD4 and naïve CD8 cells for the RNAseq experiments. The mice were housed in pathogen-free animal facility in the La Jolla Institute for Allergy and Immunology and were used according to protocols approved by the Institutional Animal Care and use Committee. Preparation of cells: Subsets of thymocytes were isolated by cell sorting as previously described (2), after cell surface staining using CD4 (GK1.5), CD8 (53-6.7), CD3ε (145- 2C11), CD24 (M1/69) (all from Biolegend). DP cells: CD4+CD8 int/hi; CD4 SP cells: CD4CD3 hi, CD24 int/lo; CD8 SP cells: CD8 int/hi CD4 CD3 hi, CD24 int/lo (Fig S2). Peripheral subsets were isolated after pooling spleen and lymph nodes. T cells were enriched by negative isolation using Dynabeads (Dynabeads untouched mouse T cells, 11413D, Invitrogen). After surface staining for CD4 (GK1.5), CD8 (53-6.7), CD62L (MEL-14), CD25 (PC61) and CD44 (IM7), naïve CD4+CD62L hiCD25-CD44lo and naïve CD8+CD62L hiCD25-CD44lo were obtained by sorting (BD FACS Aria). Additionally, for the RNAseq experiments, CD4 and CD8 naïve cells were isolated by sorting T cells from the Foxp3- IRES-GFP mice: CD4+CD62LhiCD25–CD44lo GFP(FOXP3)– and CD8+CD62LhiCD25– CD44lo GFP(FOXP3)– (antibodies were from Biolegend). In some cases, naïve CD4 cells were cultured in vitro under Th1 or Th2 polarizing conditions (3, 4). -
OSR1 (Phospho Thr185) Antibody Cat
OSR1 (phospho Thr185) Antibody Cat. No.: 79-859 OSR1 (phospho Thr185) Antibody Immunohistochemical analysis of paraffin-embedded human breast carcinoma tissue using OSR1 (Phospho-Thr185) antibody (left) or the same antibody preincubated with blocking peptide (right). Specifications HOST SPECIES: Rabbit SPECIES REACTIVITY: Human, Mouse OSR1 (phospho Thr185) antibody was raised against a peptide sequence around IMMUNOGEN: phosphorylation site of threonine185 (R-K-T (p)-F-V) derived from Human OSR1. TESTED APPLICATIONS: IHC, WB APPLICATIONS: Western Blot: 1:500~1:1000, Immunohistochemistry: 1:50~1:100 The antibody detects endogenous levels of OSR1 only when phosphorylated at threonine SPECIFICITY: 185. PREDICTED MOLECULAR 65 kDa WEIGHT: September 29, 2021 1 https://www.prosci-inc.com/osr1-phospho-thr185-antibody-79-859.html Properties PURIFICATION: Antibodies were purified by affinity-chromatography using epitope-specific peptide. CLONALITY: Polyclonal ISOTYPE: IgG CONJUGATE: Unconjugated PHYSICAL STATE: Liquid Antibody supplied in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM BUFFER: NaCl, 0.02% sodium azide and 50% glycerol. CONCENTRATION: 1 mg/mL STORAGE CONDITIONS: Store antibody at -20˚C for up to one year. Additional Info OFFICIAL SYMBOL: OXSR1 ALTERNATE NAMES: OXSR1, kinase OSR1, Oxidative-stress responsive 1 ACCESSION NO.: NP_005100.1 PROTEIN GI NO.: 4826878 GENE ID: 9943 Background and References Oxidative-stress responsive 1 gene is located in the vicinity of three others genes - GOLGA4, ITGA9 and HYA22 on chromosome 3. These four genes are considered to be BACKGROUND: candidate tumor suppressors. Oxidative-stress responsive 1 protein has similarity to human Ste20/oxidant stress response kinase-1 and is thought to be involved in the response to oxidative stress REFERENCES: 1) Tamari M., J. -
Human OXSR1 / OSR1 (1-527, His-Tag) - Purified
OriGene Technologies, Inc. OriGene Technologies GmbH 9620 Medical Center Drive, Ste 200 Schillerstr. 5 Rockville, MD 20850 32052 Herford UNITED STATES GERMANY Phone: +1-888-267-4436 Phone: +49-5221-34606-0 Fax: +1-301-340-8606 Fax: +49-5221-34606-11 [email protected] [email protected] AR51668PU-N Human OXSR1 / OSR1 (1-527, His-tag) - Purified Alternate names: KIAA1101, Oxidative stress-responsive 1 protein, Serine/threonine-protein kinase OSR1 Quantity: 0.5 mg Concentration: 0.5 mg/ml (determined by Bradford assay) Background: OXSR1 is a member of the neuronal calcium sensor gene family, which encode calcium-binding proteins expressed predominantly in neurons. This protein regulates G protein-coupled receptor phosphorylation in a calcium-dependent manner and can substitute for calmodulin. It is associated with secretory granules and modulates synaptic transmission and synaptic plasticity. Multiple transcript variants encoding different isoforms have been found for this gene. Uniprot ID: O95747 NCBI: NP_005100 GeneID: 9943 Species: Human Source: E. coli Format: State: Liquid purified protein Purity: >85% by SDS - PAGE Buffer System: 1 X Phosphate Buffered Saline (pH7.4) containing 30% glycerol, 1mM DTT. Description: Recombinant human OXSR1 protein, fused to His-tag at N-terminus, was expressed in E.coli and purified by using conventional chromatography techniques. AA Sequence: MGSSHHHHHH SSGLVPRGSH MGSMSEDSSA LPWSINRDDY ELQEVIGSGA TAVVQAAYCA PKKEKVAIKR INLEKCQTSM DELLKEIQAM SQCHHPNIVS YYTSFVVKDE LWLVMKLLSG GSVLDIIKHI VAKGEHKSGV LDESTIATIL REVLEGLEYL HKNGQIHRDV KAGNILLGED GSVQIADFGV SAFLATGGDI TRNKVRKTFV GTPCWMAPEV MEQVRGYDFK ADIWSFGITA IELATGAAPY HKYPPMKVLM LTLQNDPPSL ETGVQDKEML KKYGKSFRKM ISLCLQKDPE KRPTAAELLR HKFFQKAKNK EFLQEKTLQR APTISERAKK VRRVPGSSGR LHKTEDGGWE WSDDEFDEES EEGKAAISQL RSPRVKESIS NSELFPTTDP VGTLLQVPEQ ISAHLPQPAG QIATQPTQVS LPPTAEPAKT AQALSSGSGS QETKIPISLV LRLRNSKKEL NDIRFEFTPG RDTAEGVSQE LISAGLVDGR DLVIVAANLQ KIVEEPQSNR SVTFKLASGV EGSDIPDDGK LIGFAQLSIS Molecular weight: 60.4. -
Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase -
Pi4k2a (BC022127) Mouse Tagged ORF Clone – MG207674 | Origene
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MG207674 Pi4k2a (BC022127) Mouse Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Pi4k2a (BC022127) Mouse Tagged ORF Clone Tag: TurboGFP Symbol: Pi4k2a Synonyms: MGC37783, Pi4k2 Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 Pi4k2a (BC022127) Mouse Tagged ORF Clone – MG207674 ORF Nucleotide >MG207674 representing BC022127 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGACGAGACGAGCCCGCTAGTGTCCCCCGAGCGGGCCCAACCCCCGGAGTACACCTTCCCGTCGGGCT CCGGAGCTCACTTTCCGCAAGTACCGGGGGGCGCGGTCCGCGTGGCGGCGGCGGCCGGCTCCGGCCCGTC ACCGCCGTGCTCGCCCGGCCACGACCGGGAGCGGCAGCCCCTGCTGGACCGGGCCCGGGGCGCGGCGGCG CAGGGCCAGACCCACACGGTGGCGGTGCAGGCCCAGGCCCTGGCCGCCCAGGCGGCCGTGGCGGCGCACG CCGTTCAGACCCACCGCGAGCGGAACGACTTCCCGGAGGACCCCGAGTTCGAGGTGGTGGTGCGGCAGGC CGAGGTTGCCATCGAGTGCAGCATCTATCCCGAGCGCATCTACCAGGGCTCCAGTGGAAGCTACTTCGTC AAGGACTCTCAGGGGAGAATCGTTGCTGTCTTCAAACCCAAGAATGAAGAGCCATATGGGCACCTTAACC CTAAGTGGACCAAGTGGCTGCAGAAGCTATGCTGCCCCTGCTGCTTCGGCCGAGACTGCCTTGTTCTCAA CCAGGGCTATCTCTCAGAGGCAGGGGCTAGCCTGGTGGACCAAAAACTGGAACTCAACATTGTACCACGT -
Mouse Models for Hereditary Spastic Paraplegia Uncover a Role Of
University of Dundee Mouse models for hereditary spastic paraplegia uncover a role of PI4K2A in autophagic lysosome reformation Khundadze, Mukhran; Ribaudo, Federico; Hussain, Adeela; Stahlberg, Henry; Brocke- Ahmadinejad, Nahal; Franzka, Patricia Published in: Autophagy DOI: 10.1080/15548627.2021.1891848 Publication date: 2021 Licence: CC BY Document Version Publisher's PDF, also known as Version of record Link to publication in Discovery Research Portal Citation for published version (APA): Khundadze, M., Ribaudo, F., Hussain, A., Stahlberg, H., Brocke-Ahmadinejad, N., Franzka, P., Varga, R-E., Zarkovic, M., Pungsrinont, T., Kokal, M., Ganley, I. G., Beetz, C., Sylvester, M., & Hübner, C. A. (2021). Mouse models for hereditary spastic paraplegia uncover a role of PI4K2A in autophagic lysosome reformation. Autophagy. https://doi.org/10.1080/15548627.2021.1891848 General rights Copyright and moral rights for the publications made accessible in Discovery Research Portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognise and abide by the legal requirements associated with these rights. • Users may download and print one copy of any publication from Discovery Research Portal for the purpose of private study or research. • You may not further distribute the material or use it for any profit-making activity or commercial gain. • You may freely distribute the URL identifying the publication in the public portal. Take down policy If you believe that this document breaches -
Download Tool
by Submitted in partial satisfaction of the requirements for degree of in in the GRADUATE DIVISION of the UNIVERSITY OF CALIFORNIA, SAN FRANCISCO Approved: ______________________________________________________________________________ Chair ______________________________________________________________________________ ______________________________________________________________________________ ______________________________________________________________________________ ______________________________________________________________________________ Committee Members Copyright 2019 by Adolfo Cuesta ii Acknowledgements For me, completing a doctoral dissertation was a huge undertaking that was only possible with the support of many people along the way. First, I would like to thank my PhD advisor, Jack Taunton. He always gave me the space to pursue my own ideas and interests, while providing thoughtful guidance. Nearly every aspect of this project required a technique that was completely new to me. He trusted that I was up to the challenge, supported me throughout, helped me find outside resources when necessary. I remain impressed with his voracious appetite for the literature, and ability to recall some of the most subtle, yet most important details in a paper. Most of all, I am thankful that Jack has always been so generous with his time, both in person, and remotely. I’ve enjoyed our many conversations and hope that they will continue. I’d also like to thank my thesis committee, Kevan Shokat and David Agard for their valuable support, insight, and encouragement throughout this project. My lab mates in the Taunton lab made this such a pleasant experience, even on the days when things weren’t working well. I worked very closely with Tangpo Yang on the mass spectrometry aspects of this project. Xiaobo Wan taught me almost everything I know about protein crystallography. Thank you as well to Geoff Smith, Jordan Carelli, Pat Sharp, Yazmin Carassco, Keely Oltion, Nicole Wenzell, Haoyuan Wang, Steve Sethofer, and Shyam Krishnan, Shawn Ouyang and Qian Zhao. -
UC San Diego UC San Diego Electronic Theses and Dissertations
UC San Diego UC San Diego Electronic Theses and Dissertations Title Insights from reconstructing cellular networks in transcription, stress, and cancer Permalink https://escholarship.org/uc/item/6s97497m Authors Ke, Eugene Yunghung Ke, Eugene Yunghung Publication Date 2012 Peer reviewed|Thesis/dissertation eScholarship.org Powered by the California Digital Library University of California UNIVERSITY OF CALIFORNIA, SAN DIEGO Insights from Reconstructing Cellular Networks in Transcription, Stress, and Cancer A dissertation submitted in the partial satisfaction of the requirements for the degree Doctor of Philosophy in Bioinformatics and Systems Biology by Eugene Yunghung Ke Committee in charge: Professor Shankar Subramaniam, Chair Professor Inder Verma, Co-Chair Professor Web Cavenee Professor Alexander Hoffmann Professor Bing Ren 2012 The Dissertation of Eugene Yunghung Ke is approved, and it is acceptable in quality and form for the publication on microfilm and electronically ________________________________________________________________ ________________________________________________________________ ________________________________________________________________ ________________________________________________________________ Co-Chair ________________________________________________________________ Chair University of California, San Diego 2012 iii DEDICATION To my parents, Victor and Tai-Lee Ke iv EPIGRAPH [T]here are known knowns; there are things we know we know. We also know there are known unknowns; that is to say we know there