1 Supplementary Table 1 – Short Hairpin RNA Sequences. Gene

Supplementary Table 1 – Short Hairpin RNA Sequences.

Gene Construct Sequence Position TOP2A TOP2A#7 GCCTGATTTGTCTAAGTTTAA ORF: nt 660-680 TOP2A TOP2A#8 GCTCCAAATCAATATGTGATT ORF: nt 2707-2727 PTK7 PTK7#5 CACAGGGTTAATGAGTCTCTT 3’ UTR PTK7 PTK7#7 CCACAGCACAAGTGATAAGAT ORF: nt 2521-2541 CHEK1 CHEK1#1 CTGCAAATAGTAGTTCCTGAA 3’ UTR CHEK1 CHEK1#4 GTGGTTTATCTGCATGGTATT ORF: nt 531-551 None SCR CAACAAGATGAAGAGCACCAA none

1 Supplementary Table 2 – Genes from the 588-gene predictor in each of the top ten canonical pathways via Ingenuity Pathway Analysis.

Gene Pathway Symbol Gene Name Function Mitotic Role CCNB1* Cyclin B1 G2/M cell cycle regulation of Polo-Like CCNB2* Cyclin B2 G2/M cell cycle regulation Kinase CDC2* Cell division cycle 2, G1 to S and G2 G1/S and G2/M cell cycle regulation to M CDC7 Cell division cycle 7 homolog (S. G1/S cell cycle regulation cerevisiae) CDC20 Cell division cycle 20 homolog (S. Spindle assembly checkpoint cerevisiae) KIF11 Kinesin family member 11 Spindle formation in mitosis KIF23 Kinesin family member 23 Chromosome division in mitosis PLK1* Polo-like kinase 1 (Drosophila) Cell cleavage during mitosis PLK4 Polo-like kinase 4 (Drosophila) Regulation of centriole duplication PPP2R1B Protein phosphatase 2 (formerly 2A), Cell cycle checkpoint control and regulatory subunit A, beta isoform inhibition of nuclear telomerase activity PRC1 Protein regulator of cytokinesis 1 Microtubule bundling for central spindle assembly PTTG1 Pituitary tumor-transforming 1 Spindle assembly checkpoint Pyruvate ACACB Acetyl-Coenzyme A carboxylase beta Fatty acid oxidation Metabolism ACAT1 Acetyl-Coenzyme A acetyltransferase 1 Cholesterol synthesis ACOT9 Acyl-CoA thioesterase 9 Unknown ACSL1* Acyl-CoA synthetase long-chain family Lipid biosynthesis and fatty acid member 1 degradation ACYP1* Acylphosphatase 1, erythrocyte Hydrolysis of carboxyl-phosphate (common) type bond of acylphosphates ALDH1A1 Aldehyde dehydrogenase 1 family, Alcohol metabolism * member A1 ME3 Malic enzyme 3, NADP(+)-dependent, Aerobic glycolysis mitochondrial PCK1 Phosphoenolpyruvate carboxykinase 1 Gluconeogenesis regulation (soluble) PKM2* Pyruvate kinase, muscle Glycolysis G2/M DNA CCNB1* Cyclin B1 G2/M cell cycle regulation Damage CCNB2* Cyclin B2 G2/M cell cycle regulation Checkpoint CDC2* Cell division cycle 2, G1 to S and G2 G1/S and G2/M cell cycle regulation Regulation to M CDKN2A* Cyclin-dependent kinase inhibitor 2A G1/S cell cycle regulation (melanoma, p16, inhibits CDK4) CHEK1* CHK1 checkpoint homolog (S. pombe) G2/M cell cycle regulation PLK1* Polo-like kinase 1 (Drosophila) Cell cleavage during mitosis TOP2A Topoisomerase (DNA) II alpha 170kDa DNA topologic state alteration

2 p53 Signaling BAX* BCL2-associated X protein Apoptosis activator BIRC5 Baculoviral IAP repeat-containing 5 Apoptosis inhibitor CABC1 Chaperone, ABC1 activity of bc1 P53 mediated apoptosis complex homolog (S. pombe) CCND2* Cyclin D2 G1/S cell cycle regulation CDK2* Cyclin-dependent kinase 2 G1/S cell cycle regulation CDKN2A* Cyclin-dependent kinase inhibitor 2A G1/S cell cycle regulation (melanoma, p16, inhibits CDK4) CHEK1* CHK1 checkpoint homolog (S. pombe) G2/M cell cycle regulation PMAIP1 Phorbol-12-myristate-13-acetate- Antagonist of proapoptotic genes (Bcl- induced protein 1 2 and Bcl-xl) THBS1 Thrombospondin 1 Mediation of cell-cell, cell-matrix interaction WT1 Wilms tumor 1 Tumor suppressor Aryl ALDH1A1 Aldehyde dehydrogenase 1 family, Alcohol metabolism Hydrocarbon * member A1 Receptor BAX* BCL2-associated X protein Apoptosis activator Signaling CCNA2 Cyclin A2 G1/S and G2/M cell cycle regulation CCND2* Cyclin D2 G1/S cell cycle regulation CCNE2* Cyclin E2 G1/S cell cycle regulation CDK2* Cyclin-dependent kinase 2 G1/S cell cycle regulation CDKN2A* Cyclin-dependent kinase inhibitor 2A G1/S cell cycle regulation (melanoma, p16, inhibits CDK4) CHEK1* CHK1 checkpoint homolog (S. pombe) G2/M cell cycle regulation HSPB1 Heat shock 27kDa protein 1 Apoptosis, cell migration NFIB Nuclear factor I/B Transcription factor NQO1 NAD(P)H dehydrogenase, quinone 1 Reduction of quinones POLA Polymerase (DNA directed), alpha 1, DNA replication catalytic subunit SLC35A2 Solute carrier family 35 (UDP- Protein transport galactose transporter), member A2 Factors BMP1 Bone morphogenetic protein 1 Cartilage formation Promoting CCNE2* Cyclin E2 G1/S cell cycle regulation Cardiogenesis CDC6 Cell division cycle 6 homolog (S. G1/S cell cycle regulation in Vertebrates cerevisiae) CDK2* Cyclin-dependent kinase 2 G1/S cell cycle regulation FZD1 Frizzled homolog 1 (Drosophila) Wnt signaling FZD2 Frizzled homolog 2 (Drosophila) Wnt signaling FZD4 Frizzled homolog 4 (Drosophila) Wnt signaling PRKCA* Protein kinase C, alpha G2/M cell cycle regulation Role of BARD1 BRCA1 associated RING domain 1 BRCA1 tumor suppression BRCA1 in CHEK1* CHK1 checkpoint homolog (S. pombe) G2/M cell cycle regulation DNA Damage PLK1* Polo-like kinase 1 (Drosophila) Cell cleavage during mitosis Response RBBP8 Retinoblastoma binding protein 8 G2/M cell cycle regulation RFC5 Replication factor C (activator 1) 5, DNA replication

3 36.5kDa SMARCA2 SWI/SNF related, matrix associated, DNA replication actin dependent regulator of chromatin, subfamily a, member 2 Glycolysis - ACSL1* Acyl-CoA synthetase long-chain family Lipid biosynthesis and fatty acid Gluconeogene member 1 degradation sis ACYP1* Acylphosphatase 1, erythrocyte Hydrolysis of carboxyl-phosphate (common) type bond of acylphosphates ADH1B Alcohol dehydrogenase 1B (class I), Alcohol metabolism beta polypeptide ALDH1A1 Aldehyde dehydrogenase 1 family, Alcohol metabolism * member A1 ENO2 Enolase 2 (gamma, neuronal) Catalysis of interconversion between 2PG and PEP PFKP Phosphofructokinase, platelet Catalysis of conversion of fructose-6- phosphate to fructose-1,6- bisphosphate PGM3 Phosphoglucomutase 3 Catalysis of interconversion of glucose-1-phosphate and glucose-6- phosphate PKM2* Pyruvate kinase, muscle ATP and pyruvate generation ATM CCNB1* Cyclin B1 G2/M cell cycle regulation Signaling CCNB2* Cyclin B2 G2/M cell cycle regulation CDC2* Cell division cycle 2, G1 to S and G2 G1/S and G2/M cell cycle regulation to M CDK2* Cyclin-dependent kinase 2 G1/S cell cycle regulation CHEK1* CHK1 checkpoint homolog (S. pombe) G2/M cell cycle regulation H2AFX H2A histone family, member X Compaction of DNA into chromatin Mechanism of ACTC Actin, alpha, cardiac muscle 1 Myocardial contraction Viral Exit LMNB1 Lamin B1 Maintenance of functional plasticity of from Host nucleoli Cells LMNB2 Lamin B2 Development of nuclear envelope NEDD4 Neural precursor cell expressed, Protein sorting and viral budding developmentally down-regulated 4 PRKCA* Protein kinase C, alpha G2/M cell cycle regulation * Genes involved in more than one of the top ten pathways.

4 Supplementary Table 3 – Fold increase in expression of TOP2A, PTK7, and CHEK1 in liposarcomas compared to normal fat.

Gene Symbol LS Subtype Fold Increase FDR TOP2A Well-differentiated 4.4 6.8·10-5 Dedifferentiated 42.0 8.1·10-19 Myxoid 7.9 2.7·10-9 Round Cell 28.2 1.2·10-15 Pleomorphic 84.7 3.6·10-22 PTK7 Well-differentiated 2.1 0.001 Dedifferentiated 6.9 2.9·10-12 Myxoid 3.9 1.1·10-6 Round Cell 3.6 2.9·10-7 Pleomorphic 4.0 6.9·10-7 CHEK1 Well-differentiated 1.1 0.225 Dedifferentiated 1.4 1.9·10-9 Myxoid 1.1 0.027 Round Cell 1.2 0.003 Pleomorphic 1.6 1.5·10-13