DOCSLIB.ORG

1 Supplementary Table 1 – Short Hairpin RNA Sequences. Gene

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
1 Supplementary Table 1 – Short Hairpin RNA Sequences. Gene Supplementary Table 1 – Short Hairpin RNA Sequences. Gene Construct Sequence Position TOP2A TOP2A#7 GCCTGATTTGTCTAAGTTTAA ORF: nt 660-680 TOP2A TOP2A#8 GCTCCAAATCAATATGTGATT ORF: nt 2707-2727 PTK7 PTK7#5 CACAGGGTTAATGAGTCTCTT 3’ UTR PTK7 PTK7#7 CCACAGCACAAGTGATAAGAT ORF: nt 2521-2541 CHEK1 CHEK1#1 CTGCAAATAGTAGTTCCTGAA 3’ UTR CHEK1 CHEK1#4 GTGGTTTATCTGCATGGTATT ORF: nt 531-551 None SCR CAACAAGATGAAGAGCACCAA none 1 Supplementary Table 2 – Genes from the 588-gene predictor in each of the top ten canonical pathways via Ingenuity Pathway Analysis. Gene Pathway Symbol Gene Name Function Mitotic Role CCNB1* Cyclin B1 G2/M cell cycle regulation of Polo-Like CCNB2* Cyclin B2 G2/M cell cycle regulation Kinase CDC2* Cell division cycle 2, G1 to S and G2 G1/S and G2/M cell cycle regulation to M CDC7 Cell division cycle 7 homolog (S. G1/S cell cycle regulation cerevisiae) CDC20 Cell division cycle 20 homolog (S. Spindle assembly checkpoint cerevisiae) KIF11 Kinesin family member 11 Spindle formation in mitosis KIF23 Kinesin family member 23 Chromosome division in mitosis PLK1* Polo-like kinase 1 (Drosophila) Cell cleavage during mitosis PLK4 Polo-like kinase 4 (Drosophila) Regulation of centriole duplication PPP2R1B Protein phosphatase 2 (formerly 2A), Cell cycle checkpoint control and regulatory subunit A, beta isoform inhibition of nuclear telomerase activity PRC1 Protein regulator of cytokinesis 1 Microtubule bundling for central spindle assembly PTTG1 Pituitary tumor-transforming 1 Spindle assembly checkpoint Pyruvate ACACB Acetyl-Coenzyme A carboxylase beta Fatty acid oxidation Metabolism ACAT1 Acetyl-Coenzyme A acetyltransferase 1 Cholesterol synthesis ACOT9 Acyl-CoA thioesterase 9 Unknown ACSL1* Acyl-CoA synthetase long-chain family Lipid biosynthesis and fatty acid member 1 degradation ACYP1* Acylphosphatase 1, erythrocyte Hydrolysis of carboxyl-phosphate (common) type bond of acylphosphates ALDH1A1 Aldehyde dehydrogenase 1 family, Alcohol metabolism * member A1 ME3 Malic enzyme 3, NADP(+)-dependent, Aerobic glycolysis mitochondrial PCK1 Phosphoenolpyruvate carboxykinase 1 Gluconeogenesis regulation (soluble) PKM2* Pyruvate kinase, muscle Glycolysis G2/M DNA CCNB1* Cyclin B1 G2/M cell cycle regulation Damage CCNB2* Cyclin B2 G2/M cell cycle regulation Checkpoint CDC2* Cell division cycle 2, G1 to S and G2 G1/S and G2/M cell cycle regulation Regulation to M CDKN2A* Cyclin-dependent kinase inhibitor 2A G1/S cell cycle regulation (melanoma, p16, inhibits CDK4) CHEK1* CHK1 checkpoint homolog (S. pombe) G2/M cell cycle regulation PLK1* Polo-like kinase 1 (Drosophila) Cell cleavage during mitosis TOP2A Topoisomerase (DNA) II alpha 170kDa DNA topologic state alteration 2 p53 Signaling BAX* BCL2-associated X protein Apoptosis activator BIRC5 Baculoviral IAP repeat-containing 5 Apoptosis inhibitor CABC1 Chaperone, ABC1 activity of bc1 P53 mediated apoptosis complex homolog (S. pombe) CCND2* Cyclin D2 G1/S cell cycle regulation CDK2* Cyclin-dependent kinase 2 G1/S cell cycle regulation CDKN2A* Cyclin-dependent kinase inhibitor 2A G1/S cell cycle regulation (melanoma, p16, inhibits CDK4) CHEK1* CHK1 checkpoint homolog (S. pombe) G2/M cell cycle regulation PMAIP1 Phorbol-12-myristate-13-acetate- Antagonist of proapoptotic genes (Bcl- induced protein 1 2 and Bcl-xl) THBS1 Thrombospondin 1 Mediation of cell-cell, cell-matrix interaction WT1 Wilms tumor 1 Tumor suppressor Aryl ALDH1A1 Aldehyde dehydrogenase 1 family, Alcohol metabolism Hydrocarbon * member A1 Receptor BAX* BCL2-associated X protein Apoptosis activator Signaling CCNA2 Cyclin A2 G1/S and G2/M cell cycle regulation CCND2* Cyclin D2 G1/S cell cycle regulation CCNE2* Cyclin E2 G1/S cell cycle regulation CDK2* Cyclin-dependent kinase 2 G1/S cell cycle regulation CDKN2A* Cyclin-dependent kinase inhibitor 2A G1/S cell cycle regulation (melanoma, p16, inhibits CDK4) CHEK1* CHK1 checkpoint homolog (S. pombe) G2/M cell cycle regulation HSPB1 Heat shock 27kDa protein 1 Apoptosis, cell migration NFIB Nuclear factor I/B Transcription factor NQO1 NAD(P)H dehydrogenase, quinone 1 Reduction of quinones POLA Polymerase (DNA directed), alpha 1, DNA replication catalytic subunit SLC35A2 Solute carrier family 35 (UDP- Protein transport galactose transporter), member A2 Factors BMP1 Bone morphogenetic protein 1 Cartilage formation Promoting CCNE2* Cyclin E2 G1/S cell cycle regulation Cardiogenesis CDC6 Cell division cycle 6 homolog (S. G1/S cell cycle regulation in Vertebrates cerevisiae) CDK2* Cyclin-dependent kinase 2 G1/S cell cycle regulation FZD1 Frizzled homolog 1 (Drosophila) Wnt signaling FZD2 Frizzled homolog 2 (Drosophila) Wnt signaling FZD4 Frizzled homolog 4 (Drosophila) Wnt signaling PRKCA* Protein kinase C, alpha G2/M cell cycle regulation Role of BARD1 BRCA1 associated RING domain 1 BRCA1 tumor suppression BRCA1 in CHEK1* CHK1 checkpoint homolog (S. pombe) G2/M cell cycle regulation DNA Damage PLK1* Polo-like kinase 1 (Drosophila) Cell cleavage during mitosis Response RBBP8 Retinoblastoma binding protein 8 G2/M cell cycle regulation RFC5 Replication factor C (activator 1) 5, DNA replication 3 36.5kDa SMARCA2 SWI/SNF related, matrix associated, DNA replication actin dependent regulator of chromatin, subfamily a, member 2 Glycolysis - ACSL1* Acyl-CoA synthetase long-chain family Lipid biosynthesis and fatty acid Gluconeogene member 1 degradation sis ACYP1* Acylphosphatase 1, erythrocyte Hydrolysis of carboxyl-phosphate (common) type bond of acylphosphates ADH1B Alcohol dehydrogenase 1B (class I), Alcohol metabolism beta polypeptide ALDH1A1 Aldehyde dehydrogenase 1 family, Alcohol metabolism * member A1 ENO2 Enolase 2 (gamma, neuronal) Catalysis of interconversion between 2PG and PEP PFKP Phosphofructokinase, platelet Catalysis of conversion of fructose-6- phosphate to fructose-1,6- bisphosphate PGM3 Phosphoglucomutase 3 Catalysis of interconversion of glucose-1-phosphate and glucose-6- phosphate PKM2* Pyruvate kinase, muscle ATP and pyruvate generation ATM CCNB1* Cyclin B1 G2/M cell cycle regulation Signaling CCNB2* Cyclin B2 G2/M cell cycle regulation CDC2* Cell division cycle 2, G1 to S and G2 G1/S and G2/M cell cycle regulation to M CDK2* Cyclin-dependent kinase 2 G1/S cell cycle regulation CHEK1* CHK1 checkpoint homolog (S. pombe) G2/M cell cycle regulation H2AFX H2A histone family, member X Compaction of DNA into chromatin Mechanism of ACTC Actin, alpha, cardiac muscle 1 Myocardial contraction Viral Exit LMNB1 Lamin B1 Maintenance of functional plasticity of from Host nucleoli Cells LMNB2 Lamin B2 Development of nuclear envelope NEDD4 Neural precursor cell expressed, Protein sorting and viral budding developmentally down-regulated 4 PRKCA* Protein kinase C, alpha G2/M cell cycle regulation * Genes involved in more than one of the top ten pathways. 4 Supplementary Table 3 – Fold increase in expression of TOP2A, PTK7, and CHEK1 in liposarcomas compared to normal fat. Gene Symbol LS Subtype Fold Increase FDR TOP2A Well-differentiated 4.4 6.8·10-5 Dedifferentiated 42.0 8.1·10-19 Myxoid 7.9 2.7·10-9 Round Cell 28.2 1.2·10-15 Pleomorphic 84.7 3.6·10-22 PTK7 Well-differentiated 2.1 0.001 Dedifferentiated 6.9 2.9·10-12 Myxoid 3.9 1.1·10-6 Round Cell 3.6 2.9·10-7 Pleomorphic 4.0 6.9·10-7 CHEK1 Well-differentiated 1.1 0.225 Dedifferentiated 1.4 1.9·10-9 Myxoid 1.1 0.027 Round Cell 1.2 0.003 Pleomorphic 1.6 1.5·10-13 5.
Load more

Recommended publications
  • Deregulated Gene Expression Pathways in Myelodysplastic Syndrome Hematopoietic Stem Cells
    Leukemia (2010) 24, 756–764 & 2010 Macmillan Publishers Limited All rights reserved 0887-6924/10 $32.00 www.nature.com/leu ORIGINAL ARTICLE Deregulated gene expression pathways in myelodysplastic syndrome hematopoietic stem cells A Pellagatti1, M Cazzola2, A Giagounidis3, J Perry1, L Malcovati2, MG Della Porta2,MJa¨dersten4, S Killick5, A Verma6, CJ Norbury7, E Hellstro¨m-Lindberg4, JS Wainscoat1 and J Boultwood1 1LRF Molecular Haematology Unit, NDCLS, John Radcliffe Hospital, Oxford, UK; 2Department of Hematology Oncology, University of Pavia Medical School, Fondazione IRCCS Policlinico San Matteo, Pavia, Italy; 3Medizinische Klinik II, St Johannes Hospital, Duisburg, Germany; 4Division of Hematology, Department of Medicine, Karolinska Institutet, Stockholm, Sweden; 5Department of Haematology, Royal Bournemouth Hospital, Bournemouth, UK; 6Albert Einstein College of Medicine, Bronx, NY, USA and 7Sir William Dunn School of Pathology, University of Oxford, Oxford, UK To gain insight into the molecular pathogenesis of the the World Health Organization.6,7 Patients with refractory myelodysplastic syndromes (MDS), we performed global gene anemia (RA) with or without ringed sideroblasts, according to expression profiling and pathway analysis on the hemato- poietic stem cells (HSC) of 183 MDS patients as compared with the the French–American–British classification, were subdivided HSC of 17 healthy controls. The most significantly deregulated based on the presence or absence of multilineage dysplasia. In pathways in MDS include interferon signaling, thrombopoietin addition, patients with RA with excess blasts (RAEB) were signaling and the Wnt pathways. Among the most signifi- subdivided into two categories, RAEB1 and RAEB2, based on the cantly deregulated gene pathways in early MDS are immuno- percentage of bone marrow blasts.
    [Show full text]
  • Funkce CDK12 a CDK13 V Regulaci Transkripce Hana Paculová
    MASARYKOVA UNIVERZITA PŘÍRODOVĚDECKÁ FAKULTA ÚSTAV BIOCHEMIE Funkce CDK12 a CDK13 v regulaci transkripce Disertační práce Hana Paculová Školitel: Mgr. Jiří Kohoutek, Ph.D Brno 2018 Bibliogra cký záznam Autorka: Mgr. Hana Paculová Prrodovedecáá aaául,a鏈 Maaarkáova unvverv,a Úa,av bvochemve Název práce: Funáce CDK12 a CDK13 v regulacv ,ranaárvpce Studijní program: Bvochemve Studijní obor: Bvochemve Školitel: Mgr. Jvr Kohou,eá鏈 Ph.D Akademický rok: 2017/2018 Po et stran: 89 Klí ová slova: Ckálvn-dependen,n ávnaaa鏈 CDK12鏈 ,ranaárvpce鏈 RNA polkmeraaa II鏈 raáovvna vaječnáů鏈 CHK1 Bibliographic entry Author: Mgr. Hana Paculová Facul,k oa acvence鏈 Maaarká unvverav,k Department of Biochemistry Title oF dissertation: CDK12 and CDK13 aunc,von vn ,ranacrvp,von regula,von Degree programme: Bvochemva,rk Field oF study: Bvochemva,rk Supervisor: Mgr. Jvr Kohou,eá鏈 Ph.D Academic year: 2017/2018 Number oF pages: 89 Keywords: Ckclvn-dependen ávnaae鏈 CDK12鏈 ,ranacrvp,von鏈 RNA polkmeraae II鏈 ovarvan cancer鏈 CHK1 Abstrakt Ckálvn-dependen,n ávnaaa 12 (CDK12) je ,ranaárvpčn ávnaaa鏈 á,erá rd expreav avých clových genů ,m鏈 že aoaaorkluje RNA polkmeraau II v průbehu elongačn aáe ,ranaárvpce. CDK12 je apojena do neáolváa bunečných preceaů鏈 což ahrnuje odpoveď na pošáoen DNA鏈 vývoj a bunečnou dvaerencvacv a aea,rvh mRNA. CDK12 bkla popaána jaáo jeden genů鏈 á,eré jaou čaa,o mu,ovánk v hvgh-grade aerónm ovarválnm áarcvnomu鏈 nvcméne vlvv ,ech,o mu,ac na aunácv CDK12 a jejvch role v áarcvnogenev dopoaud nebkla a,anovena. Zjva,vlv jame鏈 že ve,švna mu,ac CDK12鏈 á,eré bklk naleenk v nádorech鏈 brán vk,voren áomplexu CDK12 a Ckálvnem K a vnhvbuj ávnaaovou aá,vvv,u CDK12.
    [Show full text]
  • A Key Genomic Signature Associated with Lymphovascular Invasion in Head and Neck Squamous Cell Carcinoma
    A key genomic signature associated with lymphovascular invasion in head and neck squamous cell carcinoma Jian Zhang Aliated Cancer hospital & Institute of Guangzhou Medical University Huali Jiang Aliated Donghua Hospital of Sun Yat-sen University Tao Xie Aliated Cancer Hospital of Guangzhou Medical University Baiyao Wang Aliated Cancer Hospital of Guangzhou Medical Unversity Xiaoting Huang Aliated Cancer Hospital & Institute of Guangzhou Medical University Jie Lin Aliated Cancer Hospital & Institute of Guangzhou Medical University Anan Xu Aliated Cancer Hospital of Guangzhou Medical University Rong Li Aliated Cancer Hospital & Institute of Guangzhou Medical University Yawei Yuan ( [email protected] ) Guangzhou Medical University Aliated Cancer Hospital Research article Keywords: lymphovascular invasion, head and neck squamous cell carcinoma, hub genes, TCGA, weighted gene co-expression network analysis Posted Date: January 16th, 2020 DOI: https://doi.org/10.21203/rs.2.18349/v2 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/24 Abstract Objective: Lymphovascular invasion (LOI), a key pathological feature of head and neck squamous cell carcinoma (HNSCC), predicts poor survival. However, the associated clinical characteristics remain uncertain, and the molecular mechanisms are largely unknown. Methods: Weighted gene co-expression network analysis was performed to construct gene co-expression networks and investigate the relationship between modules and LOI clinical trait. Functional enrichment and KEGG pathway enrichment analysis were performed for differentially expressed genes using DAVID database. The protein-protein interaction network was constructed using Cytoscape software, and module analysis was performed using MCODE. Prognosis role and expression analysis was further validated by survival analysis, GEPIA analysis and HPA database.
    [Show full text]
  • Anti-EGFR Monoclonal Antibodies and EGFR Tyrosine Kinase Inhibitors As Combination Therapy for Triple-Negative Breast Cancer
    www.impactjournals.com/oncotarget/ Oncotarget, Vol. 7, No. 45 Research Paper Anti-EGFR monoclonal antibodies and EGFR tyrosine kinase inhibitors as combination therapy for triple-negative breast cancer Abderrahim El Guerrab1,2, Mahchid Bamdad2,3, Fabrice Kwiatkowski1, Yves-Jean Bignon1,2,*, Frédérique Penault-Llorca1,2,*, Corinne Aubel1,2 1Centre Jean Perrin - ERTICa-EA4677, BP392, 63011 Clermont-Ferrand Cedex, France 2Clermont Université - Université d’Auvergne - ERTICa-EA4677, Faculté de Médecine, BP38, 63001 Clermont-Ferrand Cedex, France 3Clermont Université - Université d’Auvergne - ERTICa-EA4677, Institut Universitaire de Technologie, Département Génie Biologique, Ensemble Universitaire des Cézeaux, BP86, 63172 Aubière Cedex, France *These authors have contributed equally to this work Correspondence to: Yves-Jean Bignon, email: [email protected] Keywords: triple-negative breast cancer, epidermal growth factor receptor, anti-EGFR targeted therapy, cytotoxicity, cell cycle Received: November 09, 2015 Accepted: August 22, 2016 Published: September 15, 2016 ABSTRACT Triple-negative breast cancer (TNBC) is characterized by overexpression of epidermal growth factor receptor (EGFR) and activation of its downstream signaling pathways. Dual targeting of EGFR using one monoclonal antibody (mAb; cetuximab or panitumumab) and one tyrosine kinase inhibitor (EGFR-TKI; gefitinib or erlotinib) is a potential therapeutic approach. We investigated the effect of these therapies in EGFR-expressing TNBC cell lines that do or do not harbor the main activating mutations of EGFR pathways. Cell lines were sensitive to EGFR-TKIs, whereas mAbs were active only in MDA-MB-468 (EGFR amplification) and SUM-1315 (KRAS and PTEN wild-type) cells. MDA-MB-231 (KRAS mutated) and HCC-1937 (PTEN deletion) cells were resistant to mAbs.
    [Show full text]
  • Nerve Growth Factor Induces Transcription of the P21 WAF1/CIP1 and Cyclin D1 Genes in PC12 Cells by Activating the Sp1 Transcription Factor
    The Journal of Neuroscience, August 15, 1997, 17(16):6122–6132 Nerve Growth Factor Induces Transcription of the p21 WAF1/CIP1 and Cyclin D1 Genes in PC12 Cells by Activating the Sp1 Transcription Factor Guo-Zai Yan and Edward B. Ziff Howard Hughes Medical Institute, Department of Biochemistry, Kaplan Cancer Center, New York University Medical Center, New York, New York 10016 The PC12 pheochromocytoma cell line responds to nerve in which the Gal4 DNA binding domain is fused to the Sp1 growth factor (NGF) by gradually exiting from the cell cycle and transactivation domain, indicating that this transactivation do- differentiating to a sympathetic neuronal phenotype. We have main is regulated by NGF. Epidermal growth factor, which is a shown previously (Yan and Ziff, 1995) that NGF induces the weak mitogen for PC12, failed to induce any of these promoter expression of the p21 WAF1/CIP1/Sdi1 (p21) cyclin-dependent constructs. We consider a model in which the PC12 cell cycle kinase (Cdk) inhibitor protein and the G1 phase cyclin, cyclin is arrested as p21 accumulates and attains inhibitory levels D1. In this report, we show that induction is at the level of relative to Cdk/cyclin complexes. Sustained activation of p21 transcription and that the DNA elements in both promoters that expression is proposed to be a distinguishing feature of the are required for NGF-specific induction are clusters of binding activity of NGF that contributes to PC12 growth arrest during sites for the Sp1 transcription factor. NGF also induced a differentiation synthetic
    [Show full text]
  • Apoptotic Genes As Potential Markers of Metastatic Phenotype in Human Osteosarcoma Cell Lines
    17-31 10/12/07 14:53 Page 17 INTERNATIONAL JOURNAL OF ONCOLOGY 32: 17-31, 2008 17 Apoptotic genes as potential markers of metastatic phenotype in human osteosarcoma cell lines CINZIA ZUCCHINI1, ANNA ROCCHI2, MARIA CRISTINA MANARA2, PAOLA DE SANCTIS1, CRISTINA CAPANNI3, MICHELE BIANCHINI1, PAOLO CARINCI1, KATIA SCOTLANDI2 and LUISA VALVASSORI1 1Dipartimento di Istologia, Embriologia e Biologia Applicata, Università di Bologna, Via Belmeloro 8, 40126 Bologna; 2Laboratorio di Ricerca Oncologica, Istituti Ortopedici Rizzoli; 3IGM-CNR, Unit of Bologna, c/o Istituti Ortopedici Rizzoli, Via di Barbiano 1/10, 40136 Bologna, Italy Received May 29, 2007; Accepted July 19, 2007 Abstract. Metastasis is the most frequent cause of death among malignant primitive bone tumor, usually developing in children patients with osteosarcoma. We have previously demonstrated and adolescents, with a high tendency to metastasize (2). in independent experiments that the forced expression of Metastases in osteosarcoma patients spread through peripheral L/B/K ALP and CD99 in U-2 OS osteosarcoma cell lines blood very early and colonize primarily the lung, and later markedly reduces the metastatic ability of these cancer cells. other skeleton districts (3). Since disseminated hidden micro- This behavior makes these cell lines a useful model to assess metastases are present in 80-90% of OS patients at the time the intersection of multiple and independent gene expression of diagnosis, the identification of markers of invasiveness signatures concerning the biological problem of dissemination. and metastasis forms a target of paramount importance in With the aim to characterize a common transcriptional profile planning the treatment of osteosarcoma lesions and enhancing reflecting the essential features of metastatic behavior, we the prognosis.
    [Show full text]
  • Profiling Microdissected Epithelium and Stroma to Model Genomic Signatures for Cervical Carcinogenesis Accommodating for Covariates
    Research Article Profiling Microdissected Epithelium and Stroma to Model Genomic Signatures for Cervical Carcinogenesis Accommodating for Covariates David Gius,1 Margo C. Funk,2 Eric Y. Chuang,1 Sheng Feng,3 Phyllis C. Huettner,4 Loan Nguyen,2 C. Matthew Bradbury,1 Mark Mishra,1 Shuping Gao,1 Barbara M. Buttin,2 David E. Cohn,2 Matthew A. Powell,2 Neil S. Horowitz,2 Bradford P. Whitcomb,2 and JanetS. Rader 2 1Radiation Oncology Branch, Center for Cancer Research, National Cancer Institute, NIH, Bethesda, Maryland and 2Division of Gynecologic Oncology, Department of Obstetrics and Gynecology; 3Division of Biostatistics; and 4Lauren V. Ackerman Laboratory of Surgical Pathology, Washington University School of Medicine, St. Louis, Missouri Abstract (CIN 1–3) and finally to squamous cell carcinoma antigen (SCCA) This study is the first comprehensive, integrated approach to have been well characterized. Histologically, CIN 1 consists of examine grade-specific changes in gene expression along the immature basal-type cells involving the lower third of the entire neoplastic spectrum of cervical intraepithelial neoplasia epithelium. In CIN 2, these immature basal-type cells involve more (CIN) in the process of cervical carcinogenesis. This was than the lower third, whereas CIN 3 involves the full thickness of the accomplished by identifying gene expression signatures of epithelium. In addition, higher CIN grades exhibit nuclear crowding, disease progression using cDNA microarrays to analyze RNA pleomorphism, loss of cell polarity, and increased mitotic activity from laser-captured microdissected epithelium and underlying (1). These transitions seemto be well conserved and, as such, stroma from normal cervix, graded CINs, cancer, and patient- provide an intriguing systemto use genomicsto identify the early matched normal cervical tissues.
    [Show full text]
  • Role of Cyclin-Dependent Kinase 1 in Translational Regulation in the M-Phase
    cells Review Role of Cyclin-Dependent Kinase 1 in Translational Regulation in the M-Phase Jaroslav Kalous *, Denisa Jansová and Andrej Šušor Institute of Animal Physiology and Genetics, Academy of Sciences of the Czech Republic, Rumburska 89, 27721 Libechov, Czech Republic; [email protected] (D.J.); [email protected] (A.Š.) * Correspondence: [email protected] Received: 28 April 2020; Accepted: 24 June 2020; Published: 27 June 2020 Abstract: Cyclin dependent kinase 1 (CDK1) has been primarily identified as a key cell cycle regulator in both mitosis and meiosis. Recently, an extramitotic function of CDK1 emerged when evidence was found that CDK1 is involved in many cellular events that are essential for cell proliferation and survival. In this review we summarize the involvement of CDK1 in the initiation and elongation steps of protein synthesis in the cell. During its activation, CDK1 influences the initiation of protein synthesis, promotes the activity of specific translational initiation factors and affects the functioning of a subset of elongation factors. Our review provides insights into gene expression regulation during the transcriptionally silent M-phase and describes quantitative and qualitative translational changes based on the extramitotic role of the cell cycle master regulator CDK1 to optimize temporal synthesis of proteins to sustain the division-related processes: mitosis and cytokinesis. Keywords: CDK1; 4E-BP1; mTOR; mRNA; translation; M-phase 1. Introduction 1.1. Cyclin Dependent Kinase 1 (CDK1) Is a Subunit of the M Phase-Promoting Factor (MPF) CDK1, a serine/threonine kinase, is a catalytic subunit of the M phase-promoting factor (MPF) complex which is essential for cell cycle control during the G1-S and G2-M phase transitions of eukaryotic cells.
    [Show full text]
  • The Biological Effects of Simple Tandem Repeats: Lessons from the Repeat Expansion Diseases
    Downloaded from genome.cshlp.org on September 26, 2021 - Published by Cold Spring Harbor Laboratory Press Review The biological effects of simple tandem repeats: Lessons from the repeat expansion diseases Karen Usdin1 Section on Gene Structure and Disease, Laboratory of Molecular and Cellular Biology, National Institute of Diabetes, Digestive and Kidney Diseases, National Institutes of Health, Bethesda, Maryland 20892-0830, USA Tandem repeats are common features of both prokaryote and eukaryote genomes, where they can be found not only in intergenic regions but also in both the noncoding and coding regions of a variety of different genes. The repeat expansion diseases are a group of human genetic disorders caused by long and highly polymorphic tandem repeats. These disorders provide many examples of the effects that such repeats can have on many biological processes. While repeats in the coding sequence can result in the generation of toxic or malfunctioning proteins, noncoding repeats can also have significant effects including the generation of chromosome fragility, the silencing of the genes in which they are located, the modulation of transcription and translation, and the sequestering of proteins involved in processes such as splicing and cell architecture. Tandem repeats are a ubiquitous feature of the genomes of many also known that involve an expanded amino acid tract generated organisms, and the human genome database is replete with ex- by insertion or duplication of an imperfect trinucleotide repeat. amples of repeat tracts of different sequence and repeat number These diseases differ in key ways from “classic” members of the in different genomic locations (Riggins et al.
    [Show full text]
  • A Dissertation Entitled the Androgen Receptor
    A Dissertation entitled The Androgen Receptor as a Transcriptional Co-activator: Implications in the Growth and Progression of Prostate Cancer By Mesfin Gonit Submitted to the Graduate Faculty as partial fulfillment of the requirements for the PhD Degree in Biomedical science Dr. Manohar Ratnam, Committee Chair Dr. Lirim Shemshedini, Committee Member Dr. Robert Trumbly, Committee Member Dr. Edwin Sanchez, Committee Member Dr. Beata Lecka -Czernik, Committee Member Dr. Patricia R. Komuniecki, Dean College of Graduate Studies The University of Toledo August 2011 Copyright 2011, Mesfin Gonit This document is copyrighted material. Under copyright law, no parts of this document may be reproduced without the expressed permission of the author. An Abstract of The Androgen Receptor as a Transcriptional Co-activator: Implications in the Growth and Progression of Prostate Cancer By Mesfin Gonit As partial fulfillment of the requirements for the PhD Degree in Biomedical science The University of Toledo August 2011 Prostate cancer depends on the androgen receptor (AR) for growth and survival even in the absence of androgen. In the classical models of gene activation by AR, ligand activated AR signals through binding to the androgen response elements (AREs) in the target gene promoter/enhancer. In the present study the role of AREs in the androgen- independent transcriptional signaling was investigated using LP50 cells, derived from parental LNCaP cells through extended passage in vitro. LP50 cells reflected the signature gene overexpression profile of advanced clinical prostate tumors. The growth of LP50 cells was profoundly dependent on nuclear localized AR but was independent of androgen. Nevertheless, in these cells AR was unable to bind to AREs in the absence of androgen.
    [Show full text]
  • Targeted Mass Spectrometry Enables Quantification of Novel
    cancers Article Targeted Mass Spectrometry Enables Quantification of Novel Pharmacodynamic Biomarkers of ATM Kinase Inhibition Jeffrey R. Whiteaker 1 , Tao Wang 1, Lei Zhao 1, Regine M. Schoenherr 1, Jacob J. Kennedy 1, Ulianna Voytovich 1, Richard G. Ivey 1, Dongqing Huang 1, Chenwei Lin 1, Simona Colantonio 2, Tessa W. Caceres 2, Rhonda R. Roberts 2, Joseph G. Knotts 2, Jan A. Kaczmarczyk 2, Josip Blonder 2, Joshua J. Reading 2, Christopher W. Richardson 2, Stephen M. Hewitt 3, Sandra S. Garcia-Buntley 2, William Bocik 2, Tara Hiltke 4, Henry Rodriguez 4, Elizabeth A. Harrington 5, J. Carl Barrett 5, Benedetta Lombardi 5, Paola Marco-Casanova 5, Andrew J. Pierce 5 and Amanda G. Paulovich 1,* 1 Fred Hutchinson Cancer Research Center, Clinical Research Division, Seattle, WA 98109, USA; [email protected] (J.R.W.); [email protected] (T.W.); [email protected] (L.Z.); [email protected] (R.M.S.); [email protected] (J.J.K.); [email protected] (U.V.); [email protected] (R.G.I.); [email protected] (D.H.); [email protected] (C.L.) 2 Cancer Research Technology Program, Antibody Characterization Lab, Frederick National Laboratory for Cancer Research, Frederick, MD 21701, USA; [email protected] (S.C.); [email protected] (T.W.C.); [email protected] (R.R.R.); [email protected] (J.G.K.); [email protected] (J.A.K.); [email protected] (J.B.); [email protected] (J.J.R.); [email protected] (C.W.R.); [email protected] (S.S.G.-B.); [email protected] (W.B.) 3 Experimental Pathology Laboratory, Laboratory of Pathology, Center for Cancer Research, National Cancer Citation: Whiteaker, J.R.; Wang, T.; Institute, National Institute of Health, Bethesda, MD 20892, USA; [email protected] Zhao, L.; Schoenherr, R.M.; Kennedy, 4 Office of Cancer Clinical Proteomics Research, National Cancer Institute, Bethesda, MD 20892, USA; J.J.; Voytovich, U.; Ivey, R.G.; Huang, [email protected] (T.H.); [email protected] (H.R.) D.; Lin, C.; Colantonio, S.; et al.
    [Show full text]
  • Plasma Cells in Vitro Generation of Long-Lived Human
    Downloaded from http://www.jimmunol.org/ by guest on September 24, 2021 is online at: average * The Journal of Immunology , 32 of which you can access for free at: 2012; 189:5773-5785; Prepublished online 16 from submission to initial decision 4 weeks from acceptance to publication November 2012; doi: 10.4049/jimmunol.1103720 http://www.jimmunol.org/content/189/12/5773 In Vitro Generation of Long-lived Human Plasma Cells Mario Cocco, Sophie Stephenson, Matthew A. Care, Darren Newton, Nicholas A. Barnes, Adam Davison, Andy Rawstron, David R. Westhead, Gina M. Doody and Reuben M. Tooze J Immunol cites 65 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription http://www.jimmunol.org/content/suppl/2012/11/16/jimmunol.110372 0.DC1 This article http://www.jimmunol.org/content/189/12/5773.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2012 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 24, 2021. The Journal of Immunology In Vitro Generation of Long-lived Human Plasma Cells Mario Cocco,*,1 Sophie Stephenson,*,1 Matthew A.
    [Show full text]