Cytogenetics

Scope

The Atlas of Genetics and Cytogenetics in Oncology and Haematology is a peer reviewed on-line journal in open access, devoted to genes, cytogenetics, and clinical entities in cancer, and cancer-prone diseases. It presents structured review articles ("cards") on genes, leukaemias, solid tumours, cancer-prone diseases, more traditional review articles on these and also on surrounding topics ("deep insights"), case reports in hematology, and educational items in the various related topics for students in Medicine and in Sciences.

Editorial correspondance

Jean-Loup Huret Genetics, Department of Medical Information, University Hospital F-86021 Poitiers, France tel +33 5 49 44 45 46 or +33 5 49 45 47 67 [email protected] or [email protected]

Staff Mohammad Ahmad, Mélanie Arsaban, Mikael Cordon, Isabelle Dabin, Marie-Christine Jacquemot-Perbal, Maureen Labarussias, Anne Malo, Catherine Morel-Pair, Laurent Rassinoux, Sylvie Yau Chun Wan - Senon, Alain Zasadzinski. Philippe Dessen is the Database Director, and Alain Bernheim the Chairman of the on-line version (Gustave Roussy Institute – Villejuif – France).

The Atlas of Genetics and Cytogenetics in Oncology and Haematology (ISSN 1768-3262) is published 12 times a year by ARMGHM, a non profit organisation, and by the INstitute for Scientific and Technical Information of the French National Center for Scientific Research (INIST-CNRS) since 2008.

The Atlas is hosted by INIST-CNRS (http://www.inist.fr)

http://AtlasGeneticsOncology.org

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5)

Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL AT INIST-CNRS

Scope

Editorial correspondance

Jean-Loup Huret Genetics, Department of Medical Information, University Hospital F-86021 Poitiers, France tel +33 5 49 44 45 46 or +33 5 49 45 47 67 [email protected] or [email protected]

The Atlas is hosted by INIST-CNRS (http://www.inist.fr)

http://AtlasGeneticsOncology.org

The PDF version of the Atlas of Genetics and Cytogenetics in Oncology and Haematology is a reissue of the original articles published in collaboration with the Institute for Scientific and Technical Information (INstitut de l’Information Scientifique et Technique - INIST) of the French National Center for Scientific Research (CNRS) on its electronic publishing platform I-Revues. Online and PDF versions of the Atlas of Genetics and Cytogenetics in Oncology and Haematology are hosted by INIST-CNRS.

Atlas of Genetics and Cytogenetics

in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS

Editor

Jean-Loup Huret (Poitiers, France) Editorial Board

Sreeparna Banerjee (Ankara, Turkey) Solid Tumours Section Alessandro Beghini (Milan, Italy) Genes Section Anne von Bergh (Rotterdam, The Netherlands) Genes / Leukaemia Sections Judith Bovée (Leiden, The Netherlands) Solid Tumours Section Vasantha Brito-Babapulle (London, UK) Leukaemia Section Charles Buys (Groningen, The Netherlands) Deep Insights Section Anne Marie Capodano (Marseille, France) Solid Tumours Section Fei Chen (Morgantown, West Virginia) Genes / Deep Insights Sections Antonio Cuneo (Ferrara, Italy) Leukaemia Section Paola Dal Cin (Boston, Massachussetts) Genes / Solid Tumours Section Louis Dallaire (Montreal, Canada) Education Section Brigitte Debuire (Villejuif, France) Deep Insights Section François Desangles (Paris, France) Leukaemia / Solid Tumours Sections Enric Domingo-Villanueva (London, UK) Solid Tumours Section Ayse Erson (Ankara, Turkey) Solid Tumours Section Richard Gatti (Los Angeles, California) Cancer-Prone Diseases / Deep Insights Sections Ad Geurts van Kessel (Nijmegen, The Netherlands) Cancer-Prone Diseases Section Oskar Haas (Vienna, Austria) Genes / Leukaemia Sections Anne Hagemeijer (Leuven, Belgium) Deep Insights Section Nyla Heerema (Colombus, Ohio) Leukaemia Section Jim Heighway (Liverpool, UK) Genes / Deep Insights Sections Sakari Knuutila (Helsinki, Finland) Deep Insights Section Lidia Larizza (Milano, Italy) Solid Tumours Section Lisa Lee-Jones (Newcastle, UK) Solid Tumours Section Edmond Ma (Hong Kong, China) Leukaemia Section Roderick McLeod (Braunschweig, Germany) Deep Insights / Education Sections Cristina Mecucci (Perugia, Italy) Genes / Leukaemia Sections Yasmin Mehraein (Homburg, Germany) Cancer-Prone Diseases Section Fredrik Mertens (Lund, Sweden) Solid Tumours Section Konstantin Miller (Hannover, Germany) Education Section Felix Mitelman (Lund, Sweden) Deep Insights Section Hossain Mossafa (Cergy Pontoise, France) Leukaemia Section Stefan Nagel (Braunschweig, Germany) Deep Insights / Education Sections Florence Pedeutour (Nice, France) Genes / Solid Tumours Sections Elizabeth Petty (Ann Harbor, Michigan) Deep Insights Section Susana Raimondi (Memphis, Tennesse) Genes / Leukaemia Section Mariano Rocchi (Bari, Italy) Genes Section Alain Sarasin (Villejuif, France) Cancer-Prone Diseases Section Albert Schinzel (Schwerzenbach, Switzerland) Education Section Clelia Storlazzi (Bari, Italy) Genes Section Sabine Strehl (Vienna, Austria) Genes / Leukaemia Sections Nancy Uhrhammer (Clermont Ferrand, France) Genes / Cancer-Prone Diseases Sections Dan Van Dyke (Rochester, Minnesota) Education Section Roberta Vanni (Montserrato, Italy) Solid Tumours Section Franck Viguié (Paris, France) Leukaemia Section José Luis Vizmanos (Pamplona, Spain) Leukaemia Section Thomas Wan (Hong Kong, China) Genes / Leukaemia Sections

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5)

Atlas of Genetics and Cytogenetics in Oncology and Haematology

OPEN ACCESS JOURNAL AT INIST-CNRS

Volume 13, Number 5, May 2009

Table of contents

Gene Section

DENR (density-regulated protein) 336 Line S Reinert, Ronald B Gartenhaus FBXO31 (F-box protein 31) 338 Anthony J Bais FOXP3 (forkhead box P3) 343 Yang Liu, Lizhong Wang FRAP1 (FK506 binding protein 12-rapamycin associated protein 1) 348 Deborah A Altomare, Joseph R Testa GPA33 (glycoprotein A33 (transmembrane)) 354 Tania Tabone, Joan K Heath KLK5 (Kallikrein-related peptidase 5) 357 George M Yousef, Eleftherios P Diamandis MIR10B (microRNA 10b) 360 Begum Akman, Ayse Elif Erson RSPO1 (R-spondin homolog (Xenopus laevis)) 364 Diana Blaydon UBE2C (ubiquitin-conjugating enzyme E2C) 367 Pierlorenzo Pallante, Maria Teresa Berlingieri, Alfredo Fusco WNT5A (wingless-type MMTV integration site family, member 5A) 371 Masaru Katoh

Leukaemia Section

Nasal T cell lymphoma 374 Antonio Cuneo, Francesco Cavazzini, Gian Matteo Rigolin t(14;14)(q11;q32) CEBPE/IGH, inv(14)(q11q32) CEBPE/IGH 376 Jean-Loup Huret t(14;19)(q32;q13) IGH/CEBPA 378 Jean-Loup Huret t(2;4)(p22;q12) 381 Jean-Loup Huret t(5;14)(q35;q32.2) 383 Stefan Nagel, Roderick AF MacLeod t(8;14)(q11;q32) 388 Jean-Loup Huret

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5)

Atlas of Genetics and Cytogenetics

in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS

Solid Tumour Section

Liver tumors: an overview 391 Munechika Enjoji

Cancer Prone Disease Section

McCune Albright syndrome 395 Margaret Zacharin

Case Report Section

Dic(1;15)(p11;p11) as a non-random abnormality in essential thrombocytemia 399 Olivier Theisen, Steven Richebourg, Jean-Luc Lai, Catherine Roche-Lestienne Dic(1;15)(p11;p11) as a non-random abnormality in Myelodysplasic syndrome 401 Olivier Theisen, Steven Richebourg, Jean-Luc Lai, Catherine Roche-Lestienne

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) Atlas of Genetics and Cytogenetics

in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS

Gene Section Review

DENR (density-regulated protein) Line S Reinert, Ronald B Gartenhaus University of Maryland Greenebaum Cancer Center, 9-011 BRB, 655 West Baltimore Street, Baltimore, MD 21201, USA (LSR, RBG)

Published in Atlas Database: June 2008 Online updated version : http://AtlasGeneticsOncology.org/Genes/DENRID40295ch12q24.html DOI: 10.4267/2042/44465 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2009 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Identity Localisation Predominantly in the cytoplasm of 3T3 cells. Other names: DRP; DRP1; SMAP-3 Function HGNC (Hugo): DENR Until recently there was little published data regarding Location: 12q24.31 DENR function. Reinert et al. showed that the oncogene MCT-1 interacts with DENR in vivo and in DNA/RNA vitro. DENR contains a SUI1 domain which is also Description found in translation initiation factor eIF1, where the SUI1 domain is involved in recognition of the The gene encompasses 18583 bp DNA and contains 8 translation initiation codon (Yoon and Donahue, 1992). exons (e.g. NCBI: NC_000012). Interestingly, DENR together with MCT-1 sediment in Transcription the translation initiation complex fraction in both 2766 bp mRNA. human embryonic kidney cell cultures and lymphoid The 3'-untranslated region (3' UTR) of DENR was cell lines. This complex was shown to interact with the found to have a high number of uracyl (U)- and adenine cap complex and to alter the mRNA translational (A)-rich sequences (AREs) (Mazan-Mamczarz and profile of a subset of cancer-related mRNAs. This Gartenhaus, 2007). supports a model where MCT-1 exerts it ongogenic function, at least in part by recruiting the SUI1 domain Protein containing DENR to the translation initiation complex, thereby modulating the translational profile (Reinert et Description al., 2006). Size: 198 amino acids; 22092 Da. Homology Expression The SUI1 domain present in DENR is homologous to DENR is expressed in variety of tissues, with the the SUI-1 domain found in eIF1. The SUI1 domain highest quantity in skeletal and cardiac muscle. The contains a secondary structure fold corresponding to protein level of DENR is up regulated in parallel with that found in a number of ribosomal proteins and RNA- increasing cell density (Deyo et al., 1998). Very binding domains. recently, it was found that this up regulation is controlled by the AUF-1 protein which binds to the Implicated in 3'UTR of DENR mRNA and in a cell density- Lymphoma oncogene dependent manner (Mazan-Mamczarz and Gartenhaus, 2007). Furthermore, Oh JJ. et al. showed that DENR Note expression is increased in association with HER-2 The MCT-1 oncogene protein modifies mRNA overexpression in ovarian and breast cancers (Oh et al., translational profiles through its interaction with DENR 1999). which contains an SUI1 domain involved in

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 336 DENR (density-regulated protein) Reinert LS, Gartenhaus RB

recognition of the translation initiation codon (Yoon Oh JJ, Grosshans DR, Wong SG, Slamon DJ. Identification of and Donahue, 1992; Reinert et.al., 2006). differentially expressed genes associated with HER-2/neu overexpression in human breast cancer cells. Nucleic Acids Ovarian cancer and Breast cancer Res. 1999 Oct 15;27(20):4008-17 Disease Reinert LS, Shi B, Nandi S, Mazan-Mamczarz K, Vitolo M, Bachman KE, He H, Gartenhaus RB. MCT-1 protein interacts DENR expression is increased in association with with the cap complex and modulates messenger RNA HER-2 overexpression in ovarian and breast cancers translational profiles. Cancer Res. 2006 Sep 15;66(18):8994- (Oh. et al., 1999). 9001 Mazan-Mamczarz K, Gartenhaus RB. Post-transcriptional References control of the MCT-1-associated protein DENR/DRP by RNA- binding protein AUF1. Cancer Genomics Proteomics. 2007 Yoon HJ, Donahue TF. The suil suppressor locus in May-Jun;4(3):233-9 Saccharomyces cerevisiae encodes a translation factor that functions during tRNA(iMet) recognition of the start codon. Mol This article should be referenced as such: Cell Biol. 1992 Jan;12(1):248-60 Reinert LS, Gartenhaus RB. DENR (density-regulated protein). Deyo JE, Chiao PJ, Tainsky MA. drp, a novel protein Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5):336-337. expressed at high cell density but not during growth arrest. DNA Cell Biol. 1998 May;17(5):437-47

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 337 Atlas of Genetics and Cytogenetics

in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS

Gene Section Review

FBXO31 (F-box protein 31) Anthony J Bais Immunogene Therapy Surgical Research Division, Boston University School of Medicine, Roger Williams Medical Center, 825 Chalkstone Avenue, Providence, RI 02908, USA (AJB)

Published in Atlas Database: June 2008 Online updated version : http://AtlasGeneticsOncology.org/Genes/FBXO31ID44280ch16q24.html DOI: 10.4267/2042/44466 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2009 Atlas of Genetics and Cytogenetics in Oncology and Haematology

2.48-kb located within and five prime to the 350-bp Identity exon 1. Other names: FBX14; Fbx31; FBX31; FBXO14; The FBXO31 transcript has and an uncharacteristically DKFZP434B027; DKFZp434J1815; FLJ22477; short 23-bp five prime untranslated region. MGC15419; MGC9527; pp2386 Pseudogene HGNC (Hugo): FBXO31 None identified. Location 16q24.2 Protein Local order: Telomere; centromeric to JPH3 and telomeric to FOXL1. Description FBXO31 contains no significant homology to other DNA/RNA known proteins apart from a characteristic 40 amino acid F-box domain at the COOH-terminal end. Description The F-box motif first described in cyclin F consists of FBXO31 encodes one mRNA transcript, published approximately 50 amino acids that define an expanding analyses have not reordered alternative five prime family of eukaryotic proteins. There are currently three transcript or start sequences. subdivisions of the F-box protein family based on the FBXO31 is 3,635-bp in length, composed of 9 exons (1 type of carboxy terminal motifs present in the protein to 9) spanning approximately 55-kb of genomic DNA, sequences. Following proposed patterns the and has an ORF of 1,620-bp encoding a protein of 539 nomenclature adopted by HUGO denotes F-boxes that amino acids with a predicted mass of 61-kDa. contain LRRs as FBXL, those containing WD repeats Alternative five prime transcripts may exist. as FBXW, and those lacking all known protein- Homologous mouse cDNA sequences extending further interaction domains as FBXO. five prime have been used for RT-PCR to identify FBXO31 forms part of the FBXO class of F-box putative translation start sites and established that proteins. Comparison of FBXO31 with the F-box alternatively spliced five prime exons result in short domain of functionally demonstrated F-box proteins and long isoforms. The short isoform is 3,635-bp in (i.e. Fbx1, Fbx2, Fbw1a, Fbw1b and Fbl1) indicates length (i.e. approximately with poly A), and is the that FBXO31 matches the F-box consensus more predicted primary transcript. The long isoform is 3,725- closely than recognized F-box proteins from each of the bp in length, contains an additional five prime exon of three classes. Most F-box proteins notated as FBXO do 87-bp and has an ORF of 1,707-bp encoding a protein not have recognizable substrate binding domains. In of 568 amino acids. An additional smaller isoform of one instance Fbx7 has been shown to contain a proline- 3,099-bp with an ORF of 1,104-bp and 367 amino rich region that functions with SCF complexes in acids was predicted in GenBank. regulating Cdk1 - cyclin B - phosphorylated hepatoma FBXO31 contains a moderate density C + G rich region up-regulated protein (HURP) proteolysis. This proline- (66% G + G with 9% CpG) spanning approximately rich region has been found in other FBXO proteins.

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 338 FBXO31 (F-box protein 31) Bais AJ

The COOH-terminal end of FBXO31 contains a 175-aa components of the SCF complex by binding the core glycine and arginine rich region with possible similar SCF component Skp1. This motif is generally found in function. the amino half of the proteins and is often coupled with FBXO31 contains six minimal D-box (RxxL) motifs. other protein domains in the variable carboxy terminus Proteins with RxxL motifs are often degraded via the of the protein. The most common carboxy terminal APC/C (Cdh1) ubiquitin ligase. domains include leucine-rich repeats (LRRs) and WD- Expression 40 domains. Regions rich in glycine and arginine have also been implicated as protein binding domains, FBXO31 is widely expressed as a 3.6-kb transcript at although such domains contain a more definitive repeat similar levels in breast, testis, ovary, liver, uterus, region than present in FBXO31. prostate, colon, stomach, bladder, spinal cord, pancreas, F-box SCF ubiquitin ligase complexes are involved in trachea, kidney and thyroid. High expression is found proteolysis pathways critical to diverse cellular in brain and low expression in bone marrow. FBXO31 functions including muscle atrophy, DNA metabolism, is represented by the unigene cluster Hs.567582. cDNA ER-associated degradation, desmin-related myopathy, clones from Hs.567582 express in the adrenal gland, signal transduction, control of G1-S progression and blood, colon, germ cells, heart, kidney, liver, lung, orderly execution of cell cycle. Skp1, Cul1 and Rbx1 muscle, placenta, synovial membrane, tonsil, cervix, are invariant proteins of the SCF complex while the F- lymph tissue, skin, mammary gland, testis, ovary, box proteins that bind to Skp1 are the components that uterus, prostate, stomach, bladder, spinal cord, impart functional specificity. For instance Skp2 pancreas, thyroid and brain. specifically binds phosphorylated p27 resulting in its Localisation degradation and control of S phase entry in the cell cycle. Co-immunoprecipitation experiments indicate that the carboxy terminal domain of FBXO31 associates with Homology the Skp1, Roc-1 and Cullin-1 proteins. Immuno- F-box domain containing no other significant localization studies demonstrate that ectopic expression homology. of FBXO31 causes a change of Skp1 localization from the nucleus to the cytoplasm. The Skp1 protein returns Mutations to a nuclear localization when co-expressed with a FBXO31 protein with a deleted F-box domain. Note Function None recorded. FBXO31 is associated with the Skp1, Roc-1 and Implicated in Cullin-1 proteins through its substrate F-box recognition domain and forms part of an SCF Neurodegenerative disorders and ubiquitination complex. cancer The ubiquitin-dependant proteasome degradation pathway regulates protein abundance and the function Note of oncogenes, tumor suppressors, transcription factors Aberrant ubiquitin-dependant proteasome degradation and other signaling molecules. Ubiquitination begins in neurodegenerative disorders and cancer. with the addition of ubiquitin moieties to target proteins Precedence for disruption in neurodegenerative and follows a multi-step process, the end point being disorders. The Parkin gene functions as an E3 ubiquitin proteolysis of polyubiquitinated substrates by a 26S ligase often mutated in inherited forms of Parkinson's multi-protein complex. Ubiquitination of substrates disease. In Alzheimer's disease defective ubiquitination targeted for degradation requires 3 classes of enzymes; of cerebral proteins has been identified. The Von the ubiquitin-activating enzymes (E1), the ubiquitin Hippel-Lindau (VHL) tumor suppressor protein is part conjugating enzymes (E2) and the ubiquitin ligases of a complex that functions as a ubiquitin-protein ligase (E3). E3 proteins participate in cell cycle progression. E3. VHL associates the ligase complex to target SCF complexes (a class of E3 ligases) regulate the G1- proteins such as HIF1aand VDU1 (VHL interacting S phase transition. A wide variety of SCF targets deubiquitinating enzyme 1). HIF-a has been shown to include G1 phase cyclins, cyclin-dependant kinase regulate genes involved in tumor angiogenesis; VDU1 inhibitors, DNA replication factors and transcription has deubiquitinating activity. factors that promote cell cycle progression. Aberrant ubiquitin-dependant proteasome degradation F-box containing proteins act as substrate recognition of SCF-FBXO31 complexes has been proposed as a components of the SCF ubiquitin-ligase complexes in mechanism for tumor progression. FBXO31 would the ubiquitin-dependant proteasome degradation function as a tumor suppressor by mediating generation pathway. These complexes contain four components; of SCF-FBXO31 complexes that compete and balance Skp1, Cullin, Rbx-Rocl-Hrtl and an F-box protein. The levels of other SCF complexes normally targeted to F-box motif tethers the F-box protein to other degradation proteins required to maintain cell

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 339 FBXO31 (F-box protein 31) Bais AJ

proliferation. An example is SCF complexes resulting Disease in SCF-Skp2 E3 ligases that mediate ubiquitination and 16q22-qter LOH is detected in bilateral breast cancer subsequent degradation of the CDK-inhibitor p27. and ductal lavage, in rare inflammatory breast cancer, Ectopic expression of FBXO31 would lower SCF-Skp2 and in several other cancers, including central nervous complexes resulting in increased p27 and inhibition of system neuroectodermal ependymoma and primary transition from G1-S phase. This model corroborates ependymomas, colorectal liver metastases, gastric with studies showing that high levels of Skp2 were tumor cancer, head and neck squamous cell carcinoma, associated with reduced levels of p27 in several hepatocellular carcinoma, lung tumor, nasopharyngeal cancers. tumor, ovarian tumor, rhabdomyosarcoma, and Wilms' Abnormal protein tumor. 16q22-qter LOH in ovarian, hepatocellular and None recorded. particularly breast and prostate cancers, exhibit similar SROs, suggesting common molecular pathways are Breast cancer, Prostate cancer, and affected. several other cancers Note References Loss of heterozygosity (LOH) of 16q22-qter in breast Carter BS, Ewing CM, Ward WS, Treiger BF, Aalders TW, cancer, prostate cancer, and several other cancers. Schalken JA, Epstein JI, Isaacs WB. Allelic loss of This region is frequently deleted in several human chromosomes 16q and 10q in human prostate cancer. Proc cancers causing loss of heterozygosity. The 16q24.3 Natl Acad Sci U S A. 1990 Nov;87(22):8751-5 region including FBXO31 spans approximately 3-Mb Carter BS, Ewing CM, Ward WS, Treiger BF, Aalders TW, from the marker D16S498 to the telomere and contains Schalken JA, Epstein JI, Isaacs WB. Allelic loss of chromosomes 16q and 10q in human prostate cancer. Proc at least two smallest regions of overlap (SROs). These Natl Acad Sci U S A. 1990 Nov;87(22):8751-5 SROs are most frequently deleted in early and late stage breast cancer and in prostate cancer. Loss of Tsuda H, Zhang WD, Shimosato Y, Yokota J, Terada M, Sugimura T, Miyamura T, Hirohashi S. Allele loss on normal function of FBXO31 may be a key event in the chromosome 16 associated with progression of human early stage of breast cancer. LOH on the whole 16q22- hepatocellular carcinoma. Proc Natl Acad Sci U S A. 1990 qter region is frequently detected in breast and prostate Sep;87(17):6791-4 cancer. Micro-cell mediated transfer experiments with Zhang WD, Hirohashi S, Tsuda H, Shimosato Y, Yokota J, 16q22-qter fragments (the 360-kb YAC clone 792E1 at Terada M, Sugimura T. Frequent loss of heterozygosity on D16S476 and D16S498 and the 85-kb BAC clone chromosomes 16 and 4 in human hepatocellular carcinoma. 346J21 at D16S3048 and D16S3063) have been shown Jpn J Cancer Res. 1990 Feb;81(2):108-11 to induce senescence in human and rat breast tumor cell Sato T, Akiyama F, Sakamoto G, Kasumi F, Nakamura Y. lines. FBXO31 encompasses the 792E1 clone and a Accumulation of genetic alterations and progression of primary breast cancer. Cancer Res. 1991 Nov 1;51(21):5794-9 partial region of 346J21, has been shown to induce senescence in the breast cancer cell line MCF-7 and is Thomas GA, Raffel C. Loss of heterozygosity on 6q, 16q, and regarded as the cellular senescence gene. FBXO31 is a 17p in human central nervous system primitive neuroectodermal tumors. Cancer Res. 1991 Jan 15;51(2):639- potential tumor suppressor shown to be down-regulated 43 in breast cancer cell lines relative to normal breast Maw MA, Grundy PE, Millow LJ, Eccles MR, Dunn RS, Smith expression and cause G1 phase cell cycle arrest of the PJ, Feinberg AP, Law DJ, Paterson MC, Telzerow PE. A third MDA-MB-468 cell line. Wilms' tumor locus on chromosome 16q. Cancer Res. 1992 Quantitative gene expression analysis of 78 genes in Jun 1;52(11):3094-8 the 16q24.3 region demonstrated that FBXO31 was one Sakai K, Nagahara H, Abe K, Obata H. Loss of heterozygosity of two genes including CYBA with a moderately on chromosome 16 in hepatocellular carcinoma. J aberrant expression profile. Expression of FBXO31 Gastroenterol Hepatol. 1992 May-Jun;7(3):288-92 was reduced 100 to 200-fold in MDA-MB-134 and SK- Bai C, Sen P, Hofmann K, Ma L, Goebl M, Harper JW, Elledge BR-3 and moderately reduced in the other cell lines. 68 SJ. SKP1 connects cell cycle regulators to the ubiquitin other genes displayed normal expression, one displayed proteolysis machinery through a novel motif, the F-box. Cell. significantly aberrant expression (CBFA2T3), six 1996 Jul 26;86(2):263-74 displayed mildly aberrant expression (DPEP1, CDH15, Hochstrasser M. Ubiquitin-dependent protein degradation. Hs.17074, Hs.189419, SLC7A5 and AA994450), and Annu Rev Genet. 1996;30:405-39 one gene displayed excessively reduced expression Suzuki H, Komiya A, Emi M, Kuramochi H, Shiraishi T, Yatani (CA5A). From microarray analysis FBXO31 was one R, Shimazaki J. Three distinct commonly deleted regions of of the 70-gene classifiers down-regulated in association chromosome arm 16q in human primary and metastatic prostate cancers. Genes Chromosomes Cancer. 1996 with tumors of a favorable prognosis. The prognostic Dec;17(4):225-33 association between down-regulated FBXO31 and Godfrey TE, Cher ML, Chhabra V, Jensen RH. Allelic breast tumors corroborates with other studies imbalance mapping of chromosome 16 shows two regions of demonstrating that LOH of chromosome 16q is common deletion in prostate adenocarcinoma. Cancer Genet associated with tumors of favorable prognosis. Cytogenet. 1997 Oct 1;98(1):36-42

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 342 FBXO31 (F-box protein 31) Bais AJ

Haas AL, Siepmann TJ. Pathways of ubiquitin conjugation. von Hippel-Lindau tumor suppressor protein. J Biol Chem. FASEB J. 1997 Dec;11(14):1257-68 2000 Aug 18;275(33):25733-41 Latil A, Cussenot O, Fournier G, Driouch K, Lidereau R. Loss Friesen WJ, Dreyfuss G. Specific sequences of the Sm and of heterozygosity at chromosome 16q in prostate Sm-like (Lsm) proteins mediate their interaction with the spinal adenocarcinoma: identification of three independent regions. muscular atrophy disease gene product (SMN). J Biol Chem. Cancer Res. 1997 Mar 15;57(6):1058-62 2000 Aug 25;275(34):26370-5 Visser M, Sijmons C, Bras J, Arceci RJ, Godfried M, Valentijn Gramantieri L, Trerè D, Pession A, Piscaglia F, Masi L, Gaiani LJ, Voûte PA, Baas F. Allelotype of pediatric S, Mazziotti A, Bolondi L. Allelic imbalance on 16q in small, rhabdomyosarcoma. Oncogene. 1997 Sep;15(11):1309-14 unifocal hepatocellular carcinoma: correlation with HBV and HCV infections and cellular proliferation rate. Dig Dis Sci. 2000 Baumeister W, Walz J, Zühl F, Seemüller E. The proteasome: Feb;45(2):306-11 paradigm of a self-compartmentalizing protease. Cell. 1998 Feb 6;92(3):367-80 Kipreos ET, Pagano M. The F-box protein family. Genome Biol. 2000;1(5):REVIEWS3002 Chou YH, Chung KC, Jeng LB, Chen TC, Liaw YF. Frequent allelic loss on chromosomes 4q and 16q associated with Launonen V, Mannermaa A, Stenbäck F, Kosma VM, Puistola human hepatocellular carcinoma in Taiwan. Cancer Lett. 1998 U, Huusko P, Anttila M, Bloigu R, Saarikoski S, Kauppila A, Jan 16;123(1):1-6 Winqvist R. Loss of heterozygosity at chromosomes 3, 6, 8, 11, 16, and 17 in ovarian cancer: correlation to clinicopathological Hershko A, Ciechanover A. The ubiquitin system. Annu Rev variables. Cancer Genet Cytogenet. 2000 Oct 1;122(1):49-54 Biochem. 1998;67:425-79 López Salon M, Morelli L, Castaño EM, Soto EF, Pasquini JM. Peters JM. SCF and APC: the Yin and Yang of cell cycle Defective ubiquitination of cerebral proteins in Alzheimer's regulated proteolysis. Curr Opin Cell Biol. 1998 Dec;10(6):759- disease. J Neurosci Res. 2000 Oct 15;62(2):302-10 68 Ohh M, Park CW, Ivan M, Hoffman MA, Kim TY, Huang LE, Sato M, Mori Y, Sakurada A, Fukushige S, Ishikawa Y, Pavletich N, Chau V, Kaelin WG. Ubiquitination of hypoxia- Tsuchiya E, Saito Y, Nukiwa T, Fujimura S, Horii A. inducible factor requires direct binding to the beta-domain of Identification of a 910-kb region of common allelic loss in the von Hippel-Lindau protein. Nat Cell Biol. 2000 Jul;2(7):423- chromosome bands 16q24.1-q24.2 in human lung cancer. 7 Genes Chromosomes Cancer. 1998 May;22(1):1-8 Reddy DE, Keck CL, Popescu N, Athwal RS, Kaur GP. Spataro V, Norbury C, Harris AL. The ubiquitin-proteasome Identification of a YAC from 16q24 carrying a senescence pathway in cancer. Br J Cancer. 1998;77(3):448-55 gene for breast cancer cells. Oncogene. 2000 Jan Adeyinka A, Mertens F, Idvall I, Bondeson L, Pandis N. 13;19(2):217-22 Multiple polysomies in breast carcinomas: preferential gain of Semenza GL. HIF-1: using two hands to flip the angiogenic chromosomes 1, 5, 6, 7, 12, 16, 17, 18, and 19. Cancer Genet switch. Cancer Metastasis Rev. 2000;19(1-2):59-65 Cytogenet. 1999 Jun;111(2):144-8 Shimura H, Hattori N, Kubo S, Mizuno Y, Asakawa S, Carrano AC, Eytan E, Hershko A, Pagano M. SKP2 is required Minoshima S, Shimizu N, Iwai K, Chiba T, Tanaka K, Suzuki T. for ubiquitin-mediated degradation of the CDK inhibitor p27. Familial Parkinson disease gene product, parkin, is a ubiquitin- Nat Cell Biol. 1999 Aug;1(4):193-9 protein ligase. Nat Genet. 2000 Jul;25(3):302-5 Cenciarelli C, Chiaur DS, Guardavaccaro D, Parks W, Vidal M, Zheng PP, Pang JC, Hui AB, Ng HK. Comparative genomic Pagano M. Identification of a family of human F-box proteins. hybridization detects losses of chromosomes 22 and 16 as the Curr Biol. 1999 Oct 21;9(20):1177-9 most common recurrent genetic alterations in primary Iwai K, Yamanaka K, Kamura T, Minato N, Conaway RC, ependymomas. Cancer Genet Cytogenet. 2000 Oct Conaway JW, Klausner RD, Pause A. Identification of the von 1;122(1):18-25 Hippel-lindau tumor-suppressor protein as part of an active E3 Gomes MD, Lecker SH, Jagoe RT, Navon A, Goldberg AL. ubiquitin ligase complex. Proc Natl Acad Sci U S A. 1999 Oct Atrogin-1, a muscle-specific F-box protein highly expressed 26;96(22):12436-41 during muscle atrophy. Proc Natl Acad Sci U S A. 2001 Dec Mori Y, Matsunaga M, Abe T, Fukushige S, Miura K, 4;98(25):14440-5 Sunamura M, Shiiba K, Sato M, Nukiwa T, Horii A. Yakicier MC, Legoix P, Vaury C, Gressin L, Tubacher E, Chromosome band 16q24 is frequently deleted in human Capron F, Bayer J, Degott C, Balabaud C, Zucman-Rossi J. gastric cancer. Br J Cancer. 1999 May;80(3-4):556-62 Identification of homozygous deletions at chromosome 16q23 Reddy DE, Sandhu AK, DeRiel JK, Athwal RS, Kaur GP. in aflatoxin B1 exposed hepatocellular carcinoma. Oncogene. Identification of a gene at 16q24.3 that restores cellular 2001 Aug 23;20(37):5232-8 senescence in immortal mammary tumor cells. Oncogene. Yan J, Fang Y, Liang Q, Huang Y, Zeng Y. Novel 1999 Sep 9;18(36):5100-017 chromosomal alterations detected in primary nasopharyngeal Wang X, Gleich L, Pavelic ZP, Li YQ, Gale N, Hunt S, carcinoma by comparative genomic hybridization. Chin Med J Gluckman JL, Stambrook PJ. Cervical metastases of head and (Engl). 2001 Apr;114(4):418-21 neck squamous cell carcinoma correlate with loss of Hansen LL, Jensen LL, Dimitrakakis C, Michalas S, Gilbert F, heterozygosity on chromosome 16q. Int J Oncol. 1999 Barber HR, Overgaard J, Arzimanoglou II.. Allelic imbalance in Mar;14(3):557-61 selected chromosomal regions in ovarian cancer. Cancer Winston JT, Koepp DM, Zhu C, Elledge SJ, Harper JW. A Genet Cytogenet 2002 Nov;139:1-8. family of mammalian F-box proteins. Curr Biol. 1999 Oct Kim J, Kim JH, Lee SH, Kim DH, Kang HY, Bae SH, Pan ZQ, 21;9(20):1180-2 Seo YS. The novel human DNA helicase hFBH1 is an F-box Cockman ME, Masson N, Mole DR, Jaakkola P, Chang GW, protein. J Biol Chem. 2002 Jul 5;277(27):24530-7 Clifford SC, Maher ER, Pugh CW, Ratcliffe PJ, Maxwell PH. Lerebours F, Bertheau P, Bieche I, Driouch K, De The H, Hypoxia inducible factor-alpha binding and ubiquitylation by the Hacene K, Espie M, Marty M, Lidereau R. Evidence of

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 341 FBXO31 (F-box protein 31) Bais AJ

chromosome regions and gene involvement in inflammatory 8p, 10q, and 16q deletions in prostate cancer. Prostate. 2003 breast cancer. Int J Cancer. 2002 Dec 20;102(6):618-22 Feb 1;54(2):103-11 Powell JA, Gardner AE, Bais AJ, Hinze SJ, Baker E, Whitmore Reed SI. Ratchets and clocks: the cell cycle, ubiquitylation and S, Crawford J, Kochetkova M, Spendlove HE, Doggett NA, protein turnover. Nat Rev Mol Cell Biol. 2003 Nov;4(11):855-64 Sutherland GR, Callen DF, Kremmidiotis G. Sequencing, transcript identification, and quantitative gene expression Safford SD, Goyeau D, Freemerman AJ, Bentley R, Everett profiling in the breast cancer loss of heterozygosity region ML, Grundy PE, Skinner MA. Fine mapping of Wilms' tumors 16q24.3 reveal three potential tumor-suppressor genes. with 16q loss of heterozygosity localizes the putative tumor Genomics. 2002 Sep;80(3):303-10 suppressor gene to a region of 6.7 megabases. Ann Surg Oncol. 2003 Mar;10(2):136-43 Signoretti S, Di Marcotullio L, Richardson A, Ramaswamy S, Isaac B, Rue M, Monti F, Loda M, Pagano M. Oncogenic role Alkarain A, Jordan R, Slingerland J. p27 deregulation in breast of the ubiquitin ligase subunit Skp2 in human breast cancer. J cancer: prognostic significance and implications for therapy. J Clin Invest. 2002 Sep;110(5):633-41 Mammary Gland Biol Neoplasia. 2004 Jan;9(1):67-80 van 't Veer LJ, Dai H, van de Vijver MJ, He YD, Hart AA, Mao Bashir T, Dorrello NV, Amador V, Guardavaccaro D, Pagano M, Peterse HL, van der Kooy K, Marton MJ, Witteveen AT, M. Control of the SCF(Skp2-Cks1) ubiquitin ligase by the Schreiber GJ, Kerkhoven RM, Roberts C, Linsley PS, Bernards APC/C(Cdh1) ubiquitin ligase. Nature. 2004 Mar R, Friend SH. Gene expression profiling predicts clinical 11;428(6979):190-3 outcome of breast cancer. Nature. 2002 Jan Hsu JM, Lee YC, Yu CT, Huang CY. Fbx7 functions in the SCF 31;415(6871):530-6 complex regulating Cdk1-cyclin B-phosphorylated hepatoma Yoshida Y, Chiba T, Tokunaga F, Kawasaki H, Iwai K, Suzuki up-regulated protein (HURP) proteolysis by a proline-rich T, Ito Y, Matsuoka K, Yoshida M, Tanaka K, Tai T. E3 ubiquitin region. J Biol Chem. 2004 Jul 30;279(31):32592-602 ligase that recognizes sugar chains. Nature. 2002 Jul Wang ZC, Lin M, Wei LJ, Li C, Miron A, Lodeiro G, Harris L, 25;418(6896):438-42 Ramaswamy S, Tanenbaum DM, Meyerson M, Iglehart JD, Zur A, Brandeis M. Timing of APC/C substrate degradation is Richardson A. Loss of heterozygosity and its correlation with determined by fzy/fzr specificity of destruction boxes. EMBO J. expression profiles in subclasses of invasive breast cancers. 2002 Sep 2;21(17):4500-10 Cancer Res. 2004 Jan 1;64(1):64-71 Bloom J, Pagano M. Deregulated degradation of the cdk Härkönen P, Kyllönen AP, Nordling S, Vihko P. Loss of inhibitor p27 and malignant transformation. Semin Cancer Biol. heterozygosity in chromosomal region 16q24.3 associated with 2003 Feb;13(1):41-7 progression of prostate cancer. Prostate. 2005 Feb 15;62(3):267-74 den Engelsman J, Keijsers V, de Jong WW, Boelens WC. The small heat-shock protein alpha B-crystallin promotes FBX4- Kaur GP, Reddy DE, Zimonjic DB, de Riel JK, Athwal RS. dependent ubiquitination. J Biol Chem. 2003 Feb Functional identification of a BAC clone from 16q24 carrying a 14;278(7):4699-704 senescence gene SEN16 for breast cancer cells. Oncogene. 2005 Jan 6;24(1):47-54 Diep CB, Parada LA, Teixeira MR, Eknaes M, Nesland JM, Johansson B, Lothe RA. Genetic profiling of colorectal cancer Yonekura Y, Yamamoto D, Okugawa H, Tanaka K, Kamiyama liver metastases by combined comparative genomic Y. Loss of heterozygosity in ductal lavage for breast tumor and hybridization and G-banding analysis. Genes Chromosomes the contralateral breast. Oncol Rep. 2005 Apr;13(4):739-43 Cancer. 2003 Feb;36(2):189-97 This article should be referenced as such: Matsuyama H, Pan Y, Yoshihiro S, Kudren D, Naito K, Bergerheim US, Ekman P. Clinical significance of chromosome Bais AJ. FBXO31 (F-box protein 31). Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5):338-342.

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 342 Atlas of Genetics and Cytogenetics

in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS

Gene Section Review

FOXP3 (forkhead box P3) Yang Liu, Lizhong Wang Division of Immunotherapy, Department of Surgery Co-leader of Cancer Immunology Program, UMCCC Program of Molecular Mechanism of Diseases University of Michigan BSRB 2059, 109 Zina Pitcher Place, Ann Arbor, MI 48109, USA (YL, LW)

Published in Atlas Database: June 2008 Online updated version : http://AtlasGeneticsOncology.org/Genes/FOXP3ID44129chXp11.html DOI: 10.4267/2042/44467 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2009 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Identity Other names: AIID; DIETER; IPEX; JM2; MGC141961; MGC141963; PIDX; SCURFIN; XPID HGNC (Hugo): FOXP3 Location: Xp11.23 Local order: Xp telomere 3'- FOXP3 -5' centromere.

The location and orientation of FOXP3 gene on X chromosome. The X-linked gene FOXP3 is a member of the forkhead-box/winged-helix transcription factor family. It was identified during position cloning of Scurfin, a gene responsible for X-linked autoimmune diseases in mice and humans (Chatila et al., 2000; Brunkow et al., 2001; Bennett et al., 2001; Wildin et al., 2001). Note: ChrX 48994354-49008232 bps.

DNA/RNA Pseudogene None. Note Some Gene Database only showed 11 coding exons and Protein the first exon is not contained. Description Note None. 12 exons; the first exon, 5' part of exon 2 and 3' part of exon 12 are non-coding. Description Transcription The FOXP3 protein is 431-amino acid long and its molecular weight is 47.25 kilodaltons. It contains four 1869 bps mRNA; transcribed in a centromeric to potential functional domains including the repressor, telomeric orientation. Alternative splicing: we have ZF, LZ and fork-head (FKH) domains. identified two isoforms in both normal breast and prostate cell lines and tissues, but thirteen isoforms were found in breast, prostate, and pancreas cell lines.

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 343 FOXP3 (forkhead box P3) Liu Y, Wang L

Figure a: Schematic diagram of the FOXP3 gene and protein. ZF: zinc finger domain, LZ: leucine zipper domain, and FKH fork-head domain. Figure b: Alternatively spliced transcript variants encoding different isoforms have been identified. The two isoforms 1 and 2 is shown in the deletion of exon 3 and exon 3 with 5' part of exon 4, respectively. Other splice variant lacking both exons 3 and 8 was also reported (Smith et al., 2006).

The repressor domain is localized to the N-terminal function of regulatory T (Treg) cells (Fontenot et al., region of FOXP3 and is required to repress NFAT- 2003; Hori et al., 2003; Khattri et al., 2003). mediated transcriptional activity (Bettelli et al., 2005; Nevertheless, there is still a controversy as to whether Lopes et al., 2006; Wu et al., 2006). The mutant LZ defect Treg alone explains the lethal autoimmune domain impairs both dimerization and suppressive diseases observed in the mutant mouse and man (Chang function of FoxP3 in T cells (Chae et al., 2006). The et al., 2005; Godfrey et al., 1991). Moreover, FOXP3 FKH domain is critical for both DNA binding and as the first X-linked tumor suppressor directly targets nuclear localization (Ziegler, 2006). The FKH domain two critical oncogenes HER2/ErbB2 and SKP2 and is the most frequent target in immunodysregulation represses their transcription activity to inhibit cell polyendocrinopathy enteropathy X-linked syndrome growth in breast cancer (Zuo et al., 2007a; Zuo et al., (IPEX) patients. 2007b). Expression Homology FOXP3 locus is transcribed in the regulatory T cell. We FOXP1, FOXP2, and FOXP3 all have the FKH domain used the Rag2 (-/-) and the Rag2 (-/-) mice with the and may interact with cytokine gene transactivators Scurfy (sf) mutation (FoxP3 (sf/Y) or FoxP3 (sf/sf)) to NFkappaB and NFAT to regulate several cytokine gene evaluate FoxP3 expression outside of the lymphoid transcription in T cells (Bettelli et al., 2005; Tone et al., system. Immunohistochemistry and real-time PCR 2008; Wu et al., 2006). However, their functional roles revealed FoxP3 expression in breast epithelial cells, are alterative in different T cells. lung respiratory epithelial cells, and prostate epithelial cells, although not in liver, heart, and intestine (Chen et Mutations al., 2008). Using mice with a green fluorescence protein open reading frame knocked into the 3' Note untranslated region of the FoxP3 locus, we showed that The somatic mutations but not germline mutations in the locus is transcribed broadly in epithelial cells of breast cancer patients. multiple organs (Chen et al., 2008). In human, FOXP3 Germinal is expressed in normal human breast epithelial cells but In mice, a Foxp3 frameshift mutation in the forkhead is silenced in most human breast cancers (Zuo et al., domain results in lethality in hemizygous males 16 to 2007b). 25 days after birth (Brunkow et al., 2001). The Localisation mutation in some human IPEX patients is analogous as Predominately nuclear. they cause frameshift and early termination of Function translation (Chatila, 2000; Brunkow, 2001; Bennett, 2001; Wildin, 2001). Foxp3 is a member of the forkhead/winged-helix family of transcriptional regulators and functions as the Somatic master regulator in the development and In breast cancer patients, a total of 27 somatic mutations in all 11 coding exons and intron-exon

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 344 FOXP3 (forkhead box P3) Liu Y, Wang L

Somatic mutation of the FOXP3 gene in breast cancer samples: summary of sequencing data from 65 cases, including 50 formalin-fixed samples and 15 frozen samples. Genomic DNA was isolated from matched normal and cancerous tissues from the same patients and amplified with primers for individual exons and intron-exon boundary regions. Somatic mutations were identified by comparing sequences from normal and cancerous samples from the same patients. The data are from either bulk sequencing of PCR products or from the sequencing of 5-10 clones from PCR products. Only those mutations that were observed in multiple clones were scored. Mutations identified from 50 cases of formalin-fixed samples are marked in black, while those identified from 15 cases of frozen tissue samples are marked in red. boundary regions have been identified in 36% of 65 samples and correlated significantly with HER- patients by PCR (Zuo et al., 2007b). In these mutations, 2/ErbB2 over-expression, regardless of the status of there are 18 nonsynonymous mutations, 3 synonymous HER-2 amplification. FOXP3 is an X-linked breast mutations and 6 mutations in the intron-exon junction cancer suppressor gene and an important regulator of 12 (Zuo et al. 2007b). Interestingly, the mutations are the HER-2/ErbB2 and SKP2 oncogenes in breast not randomly distributed in FOXP3 gene and the cancer development. overwhelming majority of the mutations were either in Prognosis the functional domains or within intron 11 which can None affect the forkhead domain sequence (Zuo et al. 2007b). Cytogenetics In fluorescence in situ hybridization (FISH) analysis, Implicated in the FOXP3 gene is frequently deleted in the breast cancer samples. Out of 223 informative samples, we Breast cancer observed 28 cases (12.6%) with FXOP3 deletion. FOXP3 is likely within the minimal region of deletion Note in the Xp11 region studied. Although all deletions were None. heterozygous, the FOXP3 protein was undetectable in Disease 26 out of 28 cases. Thus, it appears that for the majority In majority of the mammary cancers, Foxp3 allele was of the breast cancer samples, LOH alone was sufficient inactivated and HER-2/ErbB2 and SKP2 are to inactivate the locus, perhaps due to X-chromosomal overexpressed and repressed the HER-2/ErbB2 and inactivation. The two cases with both deletion and SKP2 promoters. Deletion, functionally significant FOXP3 expression had X polysomy with three and four somatic mutations, and down-regulation of the FOXP3 X chromosomes, respectively. gene are commonly found in human breast cancer

X-chromosomal deletion pattern in breast cancer. TMA samples were probed with 3 markers for X-chromosome as marked. The deletion of each probe was scored independently and summarized in the colour bars, each bar representing one case. Note that the FOXP3 locus encompasses the minimal deletion in the 10MB area of the X-chromosome. A typical FISH for the CEPX (green) and FOXP3 (orange) probes is shown.

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 345 FOXP3 (forkhead box P3) Liu Y, Wang L

Hybrid/Mutated gene mutations in the FOXP3 gene are identified in breast None. cancer and most of the mutations resulted in the non- Abnormal protein conservative replacement of amino acids, and the deletions and mutations of the FOXP3 locus None corresponded to increased HER-2 and SKP2 levels. Oncogenesis Third, approximate 80% breast cancers have a down- Mice with the Foxp3 heterozygous mutation regulation of FOXP3 in tumor tissues compared to spontaneously developed mammary cancer at a high normal breast tissues. These data indicated that FOXP3 rate (Zuo et al., 2007b). Foxp3 mutation have a is an X-Linked mammary tumor suppressor gene. comparably higher incidence of human mammary cancer and is likely responsible for the increased rate of To be noted breast cancer. Our analysis of human breast cancer samples provides strong support for an important role Note for the FOXP3 gene in the development of breast None. cancer (Zuo et al., 2007a; Zuo et al., 2007b). First, FOXP3 is likely the minimal region of deletion in Breakpoints breast cancer. Second, a high proportion of somatic Note None.

Ingenuity Pathway analysis indicated that FoxP3-regulated genes belong to multiple cellular pathways related to the process of cancer development. Most of which are not directly related to FOXP3-mediated repression of ErbB2 (Zuo et al., 2007b). Interestingly, when we used the GeneGo MetaCore knowledgebase to analyze genes that related to ErbB2 signaling pathway, we found that FOXP3 downregulated 10 genes in this pathway. With the notable exception of b-Myb and c-Myb, the down-regulation is not likely related to FoxP3- mediated ErbB2 repression, as they are not known transcriptional targets of ErbB2. Thus, FOXP3 can suppress ErbB2 signaling and tumor growth by mechanisms other than ErbB2 expression. These data provide a plausible explanation for the tumor suppressor activity of FOXP3 in breast cancer cell lines that do not substantially overexpress HER-2. We also demonstrated that downregulation of SKP2 was critical for FOXP3-mediated growth inhibition in breast cancer cells that do not overexpress ERBB2/HER2 (Zuo et al., 2007a). Our data provide genetic, biochemical, and functional evidence that FOXP3 is a novel transcriptional repressor for the oncogenes HER2/ErbB2 and SKP2 (Zuo et al., 2007b; Zuo et al., 2007a). References Godfrey VL, Wilkinson JE, Rinchik EM, Russell LB. Fatal protein, is mutated in X-linked autoimmunity-allergic lymphoreticular disease in the scurfy (sf) mouse requires T disregulation syndrome. J Clin Invest. 2000 Dec;106(12):R75- cells that mature in a sf thymic environment: potential model 81 for thymic education. Proc Natl Acad Sci U S A. 1991 Jul 1;88(13):5528-32 Bennett CL, Christie J, Ramsdell F, Brunkow ME, Ferguson PJ, Whitesell L, Kelly TE, Saulsbury FT, Chance PF, Ochs HD. Chatila TA, Blaeser F, Ho N, Lederman HM, Voulgaropoulos The immune dysregulation, polyendocrinopathy, enteropathy, C, Helms C, Bowcock AM. JM2, encoding a fork head-related X-linked syndrome (IPEX) is caused by mutations of FOXP3. Nat Genet. 2001 Jan;27(1):20-1

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 346 FOXP3 (forkhead box P3) Liu Y, Wang L

Brunkow ME, Jeffery EW, Hjerrild KA, Paeper B, Clark LB, Smith EL, Finney HM, Nesbitt AM, Ramsdell F, Robinson MK. Yasayko SA, Wilkinson JE, Galas D, Ziegler SF, Ramsdell F. Splice variants of human FOXP3 are functional inhibitors of Disruption of a new forkhead/winged-helix protein, scurfin, human CD4+ T-cell activation. Immunology. 2006 results in the fatal lymphoproliferative disorder of the scurfy Oct;119(2):203-11 mouse. Nat Genet. 2001 Jan;27(1):68-73 Wu Y, Borde M, Heissmeyer V, Feuerer M, Lapan AD, Stroud Wildin RS, Ramsdell F, Peake J, Faravelli F, Casanova JL, JC, Bates DL, Guo L, Han A, Ziegler SF, Mathis D, Benoist C, Buist N, Levy-Lahad E, Mazzella M, Goulet O, Perroni L, Chen L, Rao A. FOXP3 controls regulatory T cell function Bricarelli FD, Byrne G, McEuen M, Proll S, Appleby M, through cooperation with NFAT. Cell. 2006 Jul 28;126(2):375- Brunkow ME. X-linked neonatal diabetes mellitus, enteropathy 87 and endocrinopathy syndrome is the human equivalent of mouse scurfy. Nat Genet. 2001 Jan;27(1):18-20 Ziegler SF. FOXP3: of mice and men. Annu Rev Immunol. 2006;24:209-26 Fontenot JD, Gavin MA, Rudensky AY. Foxp3 programs the development and function of CD4+CD25+ regulatory T cells. Zuo T, Liu R, Zhang H, Chang X, Liu Y, Wang L, Zheng P, Liu Nat Immunol. 2003 Apr;4(4):330-6 Y. FOXP3 is a novel transcriptional repressor for the breast cancer oncogene SKP2. J Clin Invest. 2007 Dec;117(12):3765- Hori S, Nomura T, Sakaguchi S. Control of regulatory T cell 73 development by the transcription factor Foxp3. Science. 2003 Feb 14;299(5609):1057-61 Zuo T, Wang L, Morrison C, Chang X, Zhang H, Li W, Liu Y, Wang Y, Liu X, Chan MW, Liu JQ, Love R, Liu CG, Godfrey V, Khattri R, Cox T, Yasayko SA, Ramsdell F. An essential role Shen R, Huang TH, Yang T, Park BK, Wang CY, Zheng P, Liu for Scurfin in CD4+CD25+ T regulatory cells. Nat Immunol. Y. FOXP3 is an X-linked breast cancer suppressor gene and 2003 Apr;4(4):337-42 an important repressor of the HER-2/ErbB2 oncogene. Cell. 2007 Jun 29;129(7):1275-86 Bettelli E, Dastrange M, Oukka M. Foxp3 interacts with nuclear factor of activated T cells and NF-kappa B to repress cytokine Chen GY, Chen C, Wang L, Chang X, Zheng P, Liu Y. Cutting gene expression and effector functions of T helper cells. Proc edge: Broad expression of the FoxP3 locus in epithelial cells: a Natl Acad Sci U S A. 2005 Apr 5;102(14):5138-43 caution against early interpretation of fatal inflammatory diseases following in vivo depletion of FoxP3-expressing cells. Chang X, Gao JX, Jiang Q, Wen J, Seifers N, Su L, Godfrey J Immunol. 2008 Apr 15;180(8):5163-6 VL, Zuo T, Zheng P, Liu Y. The Scurfy mutation of FoxP3 in the thymus stroma leads to defective thymopoiesis. J Exp Med. Tone Y, Furuuchi K, Kojima Y, Tykocinski ML, Greene MI, 2005 Oct 17;202(8):1141-51 Tone M. Smad3 and NFAT cooperate to induce Foxp3 expression through its enhancer. Nat Immunol. 2008 Chae WJ, Henegariu O, Lee SK, Bothwell AL. The mutant Feb;9(2):194-202 leucine-zipper domain impairs both dimerization and suppressive function of Foxp3 in T cells. Proc Natl Acad Sci U This article should be referenced as such: S A. 2006 Jun 20;103(25):9631-6 Liu Y, Wang L. FOXP3 (forkhead box P3). Atlas Genet Lopes JE, Torgerson TR, Schubert LA, Anover SD, Ocheltree Cytogenet Oncol Haematol. 2009; 13(5):343-347. EL, Ochs HD, Ziegler SF. Analysis of FOXP3 reveals multiple domains required for its function as a transcriptional repressor. J Immunol. 2006 Sep 1;177(5):3133-42

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 347 Atlas of Genetics and Cytogenetics

in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS

Gene Section Review

FRAP1 (FK506 binding protein 12-rapamycin associated protein 1) Deborah A Altomare, Joseph R Testa Fox Chase Cancer Center, 333 Cottman Avenue, Philadelphia, PA 19111, USA (DAA, JRT)

Published in Atlas Database: June 2008 Online updated version : http://AtlasGeneticsOncology.org/Genes/FRAP1ID40639ch1p36.html DOI: 10.4267/2042/44468 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2009 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Identity Other names: FLJ44809; FRAP; FRAP2; MTOR; RAFT1; RAPT1; mTOR HGNC (Hugo): MTOR Location: 1p36.22

Note: EXOSC10 is exosome component 10, ANGPTL7 encodes angiopoietin-like 7, UBIAD1 is UbiA prenyltransferase domain containing 1, PTCHD2 is patched domain containing 2, LOC100128221 is similar to hCG2041787, and SRM encodes spermidine synthase.

DNA/RNA Protein Note Description A map of the genomic organization of the human The amino terminus of FRAP (alias, mTOR) consists FRAP1 gene can be found at of several tandem HEAT (Huntingtin, EF2, A subunit http://www.ncbi.nlm.nih.gov/projects/sviewer/?id=NC_ of PP2A, TOR1) repeats) that are implicated in protein- 000001.9v=11081381..11252951. protein interations (Hay and Sonenberg, 2004; Bhaskar Description and Hay, 2007). Each HEAT repeat contains two alpha The FRAP1 gene encompasses approximatively 156 kb helices of approximatively 40 amino acids. and contains 58 exons. The gene resides on the minus The carboxy-terminal half contains two FAT (FRAP, strand. Reported location on human chromosome 1 is ATM, TRAP) domains. between 11,089,179-11,245,151 bases in NCBI36 Upstream of the catalytic domain is the FRB (FKBP12- coordinates and 11,089,180-11,245,176 bases in rapamycin binding) domain. ensemble49 coordinates. The catalytic domain has sequence similarity to the catalytic domain of phosphatidylinositol kinase (PIK), Transcription which is homologous to a family of other protein Transcript length is 8,680 bp. kinases termed PIKK (PIK-related kinase). Pseudogene No human pseudogene known.

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 348 FRAP1 (FK506 binding protein 12-rapamycin associated protein 1) Altomare DA, Testa JR

The amino acid residues corresponding to the FRAP1 (alias mTOR) protein domains are reported in pfam (see below) Pfam: PF00454: Phosphatidylinositol 3- and 4-kinase (2181-2431) Pfam: PF02259: FAT domain (1513-1910) Pfam: PF02260: FATC domain (2517-2549) Pfam: PF08771: FKBP12 Rapamycin Binding domain (2015-2114) mTOR also contains a putative negative regulatory mTOR protein exists in two functionally distinct (NR) domain between the catalytic domain and FATC. complexes named mTOR complex 1 (mTORC1) and The FATC (FRAP, ATM, TRRAP C-terminal) domain complex 2 (mTORC2) (see figure under "Implicated is essential for the kinase activity. The FATC and FAT in"). The regulator of mTORC1 signaling and kinase domains are thought to interact in a way the exposes activity is the ras-like small GTPase Rheb (Ras the catalytic domain. homologue enriched in brain), which binds directly to The protein consists of 2549 amino acids, with a the mTOR catalytic domain and enables mTORC1 to predicted molecular weight of 288,891 Da. attain an active configuration (Avruch et al., 2006). The ternary complex of human FK506-binding protein Insulin/IGF stimulates the accumulation of Rheb-GTP (FKBP12), the inhibitor rapamycin, and the FKBP12- through activated AKT and subsequent inhibition of the rapamycin-binding (FRB) domain of human FRAP has Rheb-GTPase-activating function of the tuberous been crystallized at a resolution of 2.7 angstroms (Choi sclerosis (TSC1/TSC2) heterodimer. Energy depletion et al., 1996), and then refined at 2.2 angstroms (Liang decreases Rheb-GTP through the action of adenosine et al., 1999). monophosphate-activated protein kinase (AMPK) to Phosphorylation sites of FRAP (alias, mTOR) are phosphorylate TSC2 and stimulate its Rheb-GTPase reported in http://www.phosphosite.org . activating function and also HIFalpha-mediated transcriptional responses that act upstream of the TSC1/2 complex. Amino-acid depletion inhibits mTORC1 by acting predominantly downstream of the TSC complex, by interfering with the ability of Rheb to bind to mTOR. As shown below, mTORC1 contains the core Expression components mTOR, Raptor (regulatory associated Expressed is found in numerous tissues, with high protein of mTOR), and mLST8/GbetaL (G protein levels in testis. beta-subunit-like protein). It is the mTORC1 complex that is characteristically sensitive to inhibition by Localisation rapamycin. mTORC1 is a major regulator of ribosomal Localization is predominantly cytoplasmic, but the biogenesis and protein synthesis, largely through the protein is also associated with mitochondrial, phosphorylation/inactivation of the 4E-BPs (4E- endoplasmic reticulum and Golgi membranes (Guertin binding proteins) and the phosphorylation/activation of and Sabatini, 2007). A fraction of protein also may S6K (ribosomal S6 kinase). The binding of S6K1 and shuttle between the nucleus and cytoplasm. 4E-BP1 to raptor requires a TOR signaling (TOS) Function motif, which contains an essential phenylalanine followed by four alternating acidic and small There are more than 2500 articles specifically referring hydrophobic amino acids (Schalm and Blenis, 2002). to FRAP1 or mTOR in PubMed. mTOR is central to Recently, a TOS motif also has been identified in the N several key cellular pathways including insulin terminus of HIF1alpha, which has been shown to signaling, regulation of eIF4e and p70S6 kinase, and interact with Raptor (Land and Tee, 2007). hypoxia induced factor 1alpha (HIF1alpha) stimulation Furthermore, activation of mTOR by Rheb of vascular endothelial growth factor (VEGF). These overexpression enhanced HIF1alpha activity and pathways affect several processes including cell growth VEGF-A secretion under hypoxic conditions, whereas (size), protein translation, ribosome biogenesis, the mTOR inhibitor rapamycin blocked the pathway. regulation of cell cycle progression, response to PRAS40 (proline-rich AKT substrate 40 kDa) is a nutrients and cellular stress, angiogenesis, cell polarity novel mTOR binding partner that mediates AKT and cytoskeletal reorganization. mTOR also has been signals to mTOR independently of TSC1/TSC2 shown to play a role in the regulation of autophagy (Vander Haar et al., 2007). Hence, PRAS40 and Rheb (Pattingre et al., 2008), an adaptive cellular response to are postulated to co-regulate mTORC1 (Guertin and nutrient starvation whereby a cytoplasmic vacuole or Sabatini, 2007). PRAS40 binds mTORC1 via Raptor, autophagosome engulfs cellular macromolecules and and is an mTOR phosphorylation substrate (Thedieck organelles for degradation. et al., 2007). Moreover, PRAS40 binds the mTOR

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 349 FRAP1 (FK506 binding protein 12-rapamycin associated protein 1) Altomare DA, Testa JR

kinase domain and its interaction with mTOR is Disease induced under conditions that inhibit mTOR signaling, Among the dominantly inherited disorders classified as such as nutrient or serum deprivation or mitochondrial phakomatoses are tuberous sclerosis 1 and 2, Peutz- metabolic inhibition (Vander Haar et al., 2007). Jeghers syndrome, Cowden disease, neurofibromatosis PRAS40 contains a variant TOS motif and competes 1 and neurofibromatosis 2, and von-Hippel-Lindau with S6K1 and 4E-BP1 by functioning as a direct disease (Tucker et al., 2000). These disorders are inhibitor of substrate binding (Oshiro et al., 2007, characterized by scattered hamartomatous or Wang et al., 2007). adenomatous "two-hit" lesions that have a low mTORC2 contains mTOR, Rictor (rapamycin- probability of becoming malignant. These particular insensitive companion of mTOR), SIN1 (SAPK disorders are caused by germline mutations of certain interacting protein) and mLST8/GbetaL. Proline rich tumor suppressor genes, i.e., TSC2 / TSC1, LKB1, protein 5-like (PRR5) protein also binds specifically to PTEN, NF1/NF2 and VHL, respectively, encoding mTORC2, via Rictor and/or SIN1 (Thedieck et al., proteins that intersect with the AKT/mTOR signaling 2007). mTORC2 has been shown to regulate cell-cycle- pathway (Altomare and Testa, 2005). dependent polarization of the actin cytoskeleton. Germline mutations of TSC1 and TSC2 each give rise Although not as sensitive to rapamycin as mTOR1, to the hereditary disorder known as tuberous sclerosis mTORC2 may be affected by prolonged rapamycin complex (TSC) (Astrinidis and Henske, 2005; Jozwiak exposure in some cell types (Sarbassov et al., 2006; et al., 2008). Hamartomas arise in the central nervous Zeng et al., 2007). However, the regulation of system, kidney, heart, lung, and skin, with occasional mTORC2 is largely unknown and does not function tumors progressing to malignancy (i.e., renal cell downstream of Rheb (Blaskar and Hay, 2007). carcinoma). In TSC tumor cells, biallelic inactivation Direct genetic evidence for the importance of various of TSC2 or TSC1 results in constitutive mTOR components of the mTORC1 and/or mTORC2 activity, independent of AKT activation status. Aside complexes was provided by targeted disruption studies from TSC, another rare lung disease known as in mice (Guertin et al., 2006). Mice null for mTOR, as pulmonary lymphangioleiomyomatosis (LAM) occurs well as those lacking Raptor die early in embryonic from somatic or genetic mutations of TSC1 or TSC2 development. However, mLST8-null embryos survive that lead to the activation of downstream mTOR until e10.5 and resemble embryos missing Rictor. (Krymskaya, 2008). These findings have provided Collectively, mTORC1 function was found to be rationale for the first rapamycin clinical trial for LAM essential in early development, mLST8 was required (Goncharova and Krymskaya, 2008). only for mTORC2 signaling, and mTORC2 was found The LKB1 tumor suppressor/AMPK pathway is an to be a necessary component of the AKT-FOXO and alternate means of inactivating TSC2 and contributing PKCalphaalpha pathways. to constitutive mTOR activation (Inoki et al., 2005; Homology Kwiatkowski and Manning, 2005). The kinase controlling AMPK (AMP-activated protein kinase) has Mouse (Mus musculus): Frap1, 99 % amino acid been identified as LKB1, which is encoded by the gene smilarity with Human FRAP1. inactivated in Peutz-Jeghers syndrome, a disorder Rat (Rattus norvegicus): Frap1, 99% amino acid characterized by multiple gastrointestinal similarity with Human FRAP1. hamartomatous polyps. There is now experimental Dog (Canis familiaris): FRAP1, 99% amino acid evidence that Peutz-Jeghers polyposis could be similarity with Human FRAP1. suppressed by targeting mTOR (Wei et al., 2008). Worm (Caenorhabditis elegans): B0261.2b, 51% amino Germline PTEN mutations occur in 80% of patients acid similarity with Human FRAP1. with Cowden disease, a heritable multiple hamartoma Fruit fly (Drosophila melanogaster): Tor, 64% amino syndrome with a high risk of breast, thyroid and acid similarity with Human FRAP1. endometrial carcinomas (Gustafson, et al., 2007). Decreased or absent expression of PTEN results in Mutations constitutive activation of the AKT/mTOR pathway. Note Loss-of-function mutations in NF1 contributes to the No mutations are reported to date. neurofibromatosis type I familial cancer syndrome, which is characterized by benign neurofibromas and Implicated in occasional malignant peripheral nerve sheath tumors (MPNSTs), as well as hamartomatous lesions of the Various cancers and hamartoma eye, myeloid malignancies, gliomas, and syndromes pheochromocytomas. The NF1-encoded protein, neurofibromin, functions as a Ras-GAP, and Note deregulation of Ras due to NF1 inactivation is Activation of mTOR signaling is associated with postulated to contribute to tumor development. several hamartoma syndromes, as well as in cancer. Activated Ras signaling to PI3K results in activation of

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 350 FRAP1 (FK506 binding protein 12-rapamycin associated protein 1) Altomare DA, Testa JR

the AKT/mTOR pathway (Johannessen et al., 2005). and a concomitant increase in intracellular AMP. Under The mTOR inhibitor rapamycin has been shown to conditions of energy depletion, TSC2 is phosphorylated suppress the growth of NF1-associated malignancies in and activated by AMPK, thereby inhibiting mTORC1 a genetically modified mouse model (Johannessen et activity. Amino acid starvation also elicits a decrease in al., 2008). Like NF1, NF2 also can regulate mTORC1 activity through Rheb. Abundant evidence AKT/mTOR signaling (Scoles, 2008); the NF2- suggests that a deregulation between signaling encoded protein, merlin, does so by binding to PIKE components in the PI3K-AKT-TSC2-Rheb-mTORC1 (phosphatidylinositol 3-kinase enhancer). pathway is a critical step in tumorigenesis. Tumor Germline inactivation of the von Hippel-Lindau tumor suppressor genes involved in predisposition to suppressor gene (VHL) causes hamartomatous tumors hamartomatous lesions are discussed above in the associated with the von-Hippel-Lindau syndrome. Implicated Diseases section. Moreover, most renal cell carcinomas have biallelic Human malignant tumors alterations in the von VHL gene, resulting in the accumulation of hypoxia-inducible factors 1 and 2 , and Note downstream targets including vascular endothelial Activation of mTOR signaling has been reported in growth factor (VEGF) (Cho et al., 2007). The observed several types of human malignant tumors. clinical efficacy of mTOR inhibitors in patients with Clinical results have been reported for the mTOR renal cell carcinoma may be mediated in part by the inhibitors CCI-799 (Wyeth), RAD001 (Novartis) and dependence of efficient hypoxia-inducible factor AP23573 (Ariad Pharmaceuticals), all rapamycin translation. analogs (Guertin and Sabatini, 2007). Therapeutic response is highly variable, suggesting that biomarkers Hybrid/Mutated gene still are needed for predicting response to rapamycin A schematic model of mTOR signaling depicts various therapy. To date, some of the best clinical response environmental and molecular interactions that influence rates to rapamycin have been observed in patients the pathway. mTOR protein exists in two functionally suffering from Kaposi's sarcoma or mantle-cell distinct complexes named mTORC1 and mTORC2. lymphoma. Patients with renal cell carcinomas Components are described above, under the Protein exhibiting a nonclear cell histology also appear to Function section. The classical phosphorylation benefit from treatment with mTOR inhibitors (Hanna et substrates of mTORC1 are S6 kinases and 4E-BP1, al., 2008). Patients with advanced sarcomas are yet although HIF1alpha and PRAS40 also have been another subset of individuals that have benefited from shown to have TOR signaling motifs. Because mTOR therapeutic mTOR inhibition (Wan and Helman, 2007). is shared by both mTORC1 and mTORC2, there may be equilibrium between the two complexes, as well as Disease competition for mTOR (Bhuskar and Hay, 2007). Collectively, there are a number of mechanisms that Insulin and other growth factors activate mTORC1 via contribute to the deregulation of the AKT/mTOR activation of phosphatidylinositol 3-OH kinase (PI3K) pathway in human malignant tumors (Altomare and and downstream AKT. Constitutive activation of Testa, 2005; Wan and Helman, 2007). Phospho-AKT mTORC1 can occur in the absence of TSC1 or TSC2. immunohistochemical staining is frequently associated Once mTORC1 is activated, it is able to elicit a with phospho-mTOR staining. mTOR has emerged as a negative feedback loop to inhibit AKT activity. In validated therapeutic target in cancer (Abraham and opposition, mTORC2 is an activator of AKT, which Eng, 2008). places this pathway under both positive and negative Specific to mTOR, mTORC2 activity was found to be controls mediated by mTOR. In contrast to growth elevated in glioma cell lines and primary tumors as factor activation of mTORC1, responses to cellular compared with normal brain tissue (Masri et al., 2007). stresses such as energy depletion and amino acid Overexpression of Rictor increased mTORC2 activity, deprivation are mediated by TSC1/2 and/or Rheb (Hay anchorage-independent growth in soft agar, S-phase and Sonenberg, 2004; Guertin and Sabatini, 2007). cell cycle distribution, motility, and integrin AMPK is activated by reduced intracellular ATP levels expression, whereas knockdown of Rictor inhibited these events.

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 351 FRAP1 (FK506 binding protein 12-rapamycin associated protein 1) Altomare DA, Testa JR

Xenograft studies also supported a role for increased Disease mTORC2 activity in tumorigenesis and enhanced Ravikumar et al. (2004) showed that mTOR is tumor growth. PKCalpha activity was shown to be sequestered in polyglutamine aggregates in cell models, dependent of Rictor-expression, consistent with the transgenic mice, and human brains. Sequestration of known regulation of actin organization by mTORC2 mTOR impaired its kinase activity and induced via PKCalpha. Collectively, these data suggest that autophagy, a key mechanism for clearance of mutant mTORC2 is hyperactivated in gliomas and promotes huntingtin fragments to protect against polyglutamine tumor cell proliferation and invasive potential due to toxicity. Rapamycin also attenuated huntingtin increased complex formation in the presence of accumulation and cell death in cell models, and overexpressed Rictor. inhibited autophagy. Furthermore, rapamycin protected Prognosis against neurodegeneration in a fly model, and the Recent data suggest that inhibition of mTOR results in rapamycin analog CCI-779 decreased aggregate clinical benefit in patients with poor prognostic formation in a mouse model of Huntington disease. features, and in preclinical models this therapeutic effect involves downregulation of HIF1alpha (Hanna et References al., 2008). Choi J, Chen J, Schreiber SL, Clardy J. Structure of the FKBP12-rapamycin complex interacting with the binding Huntington disease domain of human FRAP. Science. 1996 Jul 12;273(5272):239- Note 42 mTOR has been implicated in Huntington disease, an inherited neurodegenerative disorder.

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 352 FRAP1 (FK506 binding protein 12-rapamycin associated protein 1) Altomare DA, Testa JR

Liang J, Choi J, Clardy J. Refined structure of the FKBP12- growth and cell motility via overexpression of rictor. Cancer rapamycin-FRB ternary complex at 2.2 A resolution. Acta Res. 2007 Dec 15;67(24):11712-20 Crystallogr D Biol Crystallogr. 1999 Apr;55(Pt 4):736-44 Oshiro N, Takahashi R, Yoshino K, Tanimura K, Nakashima A, Tucker M, Goldstein A, Dean M, Knudson A. National Cancer Eguchi S, Miyamoto T, Hara K, Takehana K, Avruch J, Institute Workshop Report: the phakomatoses revisited. J Natl Kikkawa U, Yonezawa K. The proline-rich Akt substrate of 40 Cancer Inst. 2000 Apr 5;92(7):530-3 kDa (PRAS40) is a physiological substrate of mammalian target of rapamycin complex 1. J Biol Chem. 2007 Jul Schalm SS, Blenis J. Identification of a conserved motif 13;282(28):20329-39 required for mTOR signaling. Curr Biol. 2002 Apr 16;12(8):632- 9 Thedieck K, Polak P, Kim ML, Molle KD, Cohen A, Jenö P, Arrieumerlou C, Hall MN. PRAS40 and PRR5-like protein are Hay N, Sonenberg N. Upstream and downstream of mTOR. new mTOR interactors that regulate apoptosis. PLoS One. Genes Dev. 2004 Aug 15;18(16):1926-45 2007 Nov 21;2(11):e1217 Ravikumar B, Vacher C, Berger Z, Davies JE, Luo S, Oroz LG, Vander Haar E, Lee SI, Bandhakavi S, Griffin TJ, Kim DH. Scaravilli F, Easton DF, Duden R, O'Kane CJ, Rubinsztein DC. Insulin signalling to mTOR mediated by the Akt/PKB substrate Inhibition of mTOR induces autophagy and reduces toxicity of PRAS40. Nat Cell Biol. 2007 Mar;9(3):316-23 polyglutamine expansions in fly and mouse models of Huntington disease. Nat Genet. 2004 Jun;36(6):585-95 Wan X, Helman LJ. The biology behind mTOR inhibition in sarcoma. Oncologist. 2007 Aug;12(8):1007-18 Altomare DA, Testa JR. Perturbations of the AKT signaling pathway in human cancer. Oncogene. 2005 Nov Wang L, Harris TE, Roth RA, Lawrence JC Jr. PRAS40 14;24(50):7455-64 regulates mTORC1 kinase activity by functioning as a direct inhibitor of substrate binding. J Biol Chem. 2007 Jul Astrinidis A, Henske EP. Tuberous sclerosis complex: linking 6;282(27):20036-44 growth and energy signaling pathways with human disease. Oncogene. 2005 Nov 14;24(50):7475-81 Zeng Z, Sarbassov dos D, Samudio IJ, Yee KW, Munsell MF, Ellen Jackson C, Giles FJ, Sabatini DM, Andreeff M, Inoki K, Corradetti MN, Guan KL. Dysregulation of the TSC- Konopleva M. Rapamycin derivatives reduce mTORC2 mTOR pathway in human disease. Nat Genet. 2005 signaling and inhibit AKT activation in AML. Blood. 2007 Apr Jan;37(1):19-24 15;109(8):3509-12 Johannessen CM, Reczek EE, James MF, Brems H, Legius E, Abraham RT, Eng CH. Mammalian target of rapamycin as a Cichowski K. The NF1 tumor suppressor critically regulates therapeutic target in oncology. Expert Opin Ther Targets. 2008 TSC2 and mTOR. Proc Natl Acad Sci U S A. 2005 Jun Feb;12(2):209-22 14;102(24):8573-8 Goncharova EA, Krymskaya VP. Pulmonary Kwiatkowski DJ, Manning BD. Tuberous sclerosis: a GAP at lymphangioleiomyomatosis (LAM): progress and current the crossroads of multiple signaling pathways. Hum Mol Genet. challenges. J Cell Biochem. 2008 Feb 1;103(2):369-82 2005 Oct 15;14 Spec No. 2:R251-8 Hanna SC, Heathcote SA, Kim WY. mTOR pathway in renal Avruch J, Hara K, Lin Y, Liu M, Long X, Ortiz-Vega S, cell carcinoma. Expert Rev Anticancer Ther. 2008 Yonezawa K. Insulin and amino-acid regulation of mTOR Feb;8(2):283-92 signaling and kinase activity through the Rheb GTPase. Oncogene. 2006 Oct 16;25(48):6361-72 Johannessen CM, Johnson BW, Williams SM, Chan AW, Reczek EE, Lynch RC, Rioth MJ, McClatchey A, Ryeom S, Guertin DA, Stevens DM, Thoreen CC, Burds AA, Kalaany NY, Cichowski K. TORC1 is essential for NF1-associated Moffat J, Brown M, Fitzgerald KJ, Sabatini DM. Ablation in malignancies. Curr Biol. 2008 Jan 8;18(1):56-62 mice of the mTORC components raptor, rictor, or mLST8 reveals that mTORC2 is required for signaling to Akt-FOXO Jozwiak J, Jozwiak S, Wlodarski P. Possible mechanisms of and PKCalpha, but not S6K1. Dev Cell. 2006 Dec;11(6):859-71 disease development in tuberous sclerosis. Lancet Oncol. 2008 Jan;9(1):73-9 Sarbassov DD, Ali SM, Sengupta S, Sheen JH, Hsu PP, Bagley AF, Markhard AL, Sabatini DM. Prolonged rapamycin Krymskaya VP. Smooth muscle-like cells in pulmonary treatment inhibits mTORC2 assembly and Akt/PKB. Mol Cell. lymphangioleiomyomatosis. Proc Am Thorac Soc. 2008 Jan 2006 Apr 21;22(2):159-68 1;5(1):119-26 Bhaskar PT, Hay N. The two TORCs and Akt. Dev Cell. 2007 Pattingre S, Espert L, Biard-Piechaczyk M, Codogno P. Apr;12(4):487-502 Regulation of macroautophagy by mTOR and Beclin 1 complexes. Biochimie. 2008 Feb;90(2):313-23 Cho D, Signoretti S, Regan M, Mier JW, Atkins MB. The role of mammalian target of rapamycin inhibitors in the treatment of Scoles DR. The merlin interacting proteins reveal multiple advanced renal cancer. Clin Cancer Res. 2007 Jan 15;13(2 Pt targets for NF2 therapy. Biochim Biophys Acta. 2008 2):758s-763s Jan;1785(1):32-54 Guertin DA, Sabatini DM. Defining the role of mTOR in cancer. Wei C, Amos CI, Zhang N, Wang X, Rashid A, Walker CL, Cancer Cell. 2007 Jul;12(1):9-22 Behringer RR, Frazier ML. Suppression of Peutz-Jeghers polyposis by targeting mammalian target of rapamycin Gustafson S, Zbuk KM, Scacheri C, Eng C. Cowden signaling. Clin Cancer Res. 2008 Feb 15;14(4):1167-71 syndrome. Semin Oncol. 2007 Oct;34(5):428-34 Land SC, Tee AR. Hypoxia-inducible factor 1alpha is regulated This article should be referenced as such: by the mammalian target of rapamycin (mTOR) via an mTOR Altomare DA, Testa JR. FRAP1 (FK506 binding protein 12- signaling motif. J Biol Chem. 2007 Jul 13;282(28):20534-43 rapamycin associated protein 1). Atlas Genet Cytogenet Oncol Masri J, Bernath A, Martin J, Jo OD, Vartanian R, Funk A, Haematol. 2009; 13(5):348-353. Gera J. mTORC2 activity is elevated in gliomas and promotes

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 353 Atlas of Genetics and Cytogenetics

in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS

Gene Section Mini Review

GPA33 (glycoprotein A33 (transmembrane)) Tania Tabone, Joan K Heath Ludwig Institute for Cancer Research, Melbourne Branch, PO Box 2008, Royal Melbourne Hospital, Parkville, VIC 3050, Australia (TT, JKH)

Published in Atlas Database: June 2008 Online updated version : http://AtlasGeneticsOncology.org/Genes/GPA33ID40735ch1q23.html DOI: 10.4267/2042/44469 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2009 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Identity Other names: A33; MGC129986; MGC129987 HGNC (Hugo): GPA33 Location: 1q24.1

Note: Location of GPA33 on human chromosome 1q24 showing flanking genes to demonstrate synteny to other vertebrates, such as mouse (chromosome 1) and zebrafish (chromosomes 1 and 9). Note that an evolutionary duplication event of the entire zebrafish genome has resulted in the two copies of gpa33 in zebrafish.

DNA/RNA Transcription 2,793 bp mRNA; 960 bp open reading frame (Heath et Description al., 1997). The human GPA33 gene comprises 7 exons (all coding) spanning 37,787 bp of genomic DNA.

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 354 GPA33 (glycoprotein A33 (transmembrane)) Tabone T, Heath JK

Genomic organization of the GPA33 gene. Coding exonic sequences appear in red, non-coding exonic sequences are in blue and intronic sequence are in yellow, with the corresponding exon and intron sizes given below in base pairs (bp). The exon numbers are indicated above each exon. Note the GPA33 gene is in on the reverse strand.

Schematic representation of the GPA33 protein, indicating the position of the Ig-like V-type and Ig-like C2-type domain in the extracellular region and the polycysteine residue ('CCCC' motif).

Protein Function Unknown; the protein structure is consistent with a Description putative role of GPA33 in cell-cell recognition and 319 amino acids; 43 kDa protein. The A33 signaling (Heath et al., 1997). A33 may play a role in glycoprotein is a member of the immunoglobulin relaying information between intestinal epithelial cells superfamily and contains three distinct structural and the gut immune system (Lee et al., 2007). domains: a 213 amino acid extracellular region containing two immunoglobulin-like domains (a C2- Homology type domain and a v-type domain), a 23 amino acid The two Ig-like domains are well conserved between hydrophobic transmembrane domain, and a 62 amino humans, chimpanzee, dog, mouse and rat, whereas acid highly polar intracellular tail containing four chicken and zebrafish retain only the Ig-like V-like consecutive cysteine residues (Heath et al., 1997). Post domain. The overall GPA33 protein similarity between translational modification includes N-glycosylation humans and various species are: chimpanzee (Pan (containing approximately 8 kDa of N-linked troglodytes) 97%, domestic dog (Canis lupus carbohydrate), and S-palmitoylation. The S- familiaris) 75%, mouse (Mus musculus) 66%, rat palmitoylation may be involved in regulating the (Rattus norvegicus) 68%, domestic chicken (Gallus internalization process initiated by binding of the gallus) 44%, and zebrafish (Danio rerio) 35%. monoclonal antibody A33 to the A33 antigen. There is no evidence of O-glycosylation, sialylation or Implicated in glycophosphatidylinositol (Ritter et al., 1997). Colorectal cancer Expression Note GPA33 demonstrates a rare tissue-specific expression Colorectal cancer marker. pattern. GPA33 is a cell surface differentiation antigen Although the biochemical, immunological and that is constitutively expressed on the basolateral molecular biology of the A33 antigen has been surfaces of normal human and mouse colon and small extensively characterized, the function of the molecule bowel epithelium. GPA33 is homogeneously expressed remains unknown. The antigen has several identified in over 95% of both human primary and metastatic properties that contribute to a potential therapeutic colon cancers, and in 55% of gastric carcinomas, target for colon cancer. The A33 antigen is expressed although absent in normal stomach epithelium (Welt et homogenously and at high levels in colorectal al., 1990). carcinomas, there are a high number of A33 binding Localisation sites per cell and it is not shed or secreted into the Membrane; single-pass type 1 membrane protein. blood stream (Welt et al., 1990). In addition, upon mAB binding to the A33 antigen, the antibody-antigen

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 355 GPA33 (glycoprotein A33 (transmembrane)) Tabone T, Heath JK

complex is internalized and sequestered in vesicles Daghighian F, Barendswaard E, Welt S, Humm J, Scott A, (Daghighian et al., 1996). Willingham MC, McGuffie E, Old LJ, Larson SM. Enhancement of radiation dose to the nucleus by vesicular internalization of Selective immunological targeting of tumors with iodine-125-labeled A33 monoclonal antibody. J Nucl Med. monoclonal antibodies (mAb) is an important 1996 Jun;37(6):1052-7 therapeutic approach in cancer therapy. Clinical Heath JK, White SJ, Johnstone CN, Catimel B, Simpson RJ, imaging and biopsy-based biodistribution studies using Moritz RL, Tu GF, Ji H, Whitehead RH, Groenen LC, Scott AM, radiolabeled murine mAb A33 demonstrated specific Ritter G, Cohen L, Welt S, Old LJ, Nice EC, Burgess AW. The targeting to antigen-positive tumor tissues in 95% of human A33 antigen is a transmembrane glycoprotein and a novel member of the immunoglobulin superfamily. Proc Natl colorectal patients with tumor retention for up to six Acad Sci U S A. 1997 Jan 21;94(2):469-74 weeks (Welt et al., 1990; Welt et al., 1994). The only normal tissue reported to accumulate the radioisotope Ritter G, Cohen LS, Nice EC, Catimel B, Burgess AW, Moritz RL, Ji H, Heath JK, White SJ, Welt S, Old LJ, Simpson RJ. was the bowel, with clearance from the normal Characterization of posttranslational modifications of human gastrointestinal tract within one week. Phase I and II A33 antigen, a novel palmitoylated surface glycoprotein of therapy trials using 125 I- and 131 I-labeled murine A33 human gastrointestinal epithelium. Biochem Biophys Res mAb were shown to have antitumor effects without Commun. 1997 Jul 30;236(3):682-6 bowel toxicity, however human anti-mouse antibody Chong G, Lee FT, Hopkins W, Tebbutt N, Cebon JS, Mountain development in all patients prevented repeated dosing AJ, Chappell B, Papenfuss A, Schleyer P, U P, Murphy R, and led to the development of humanized mAb A33 Wirth V, Smyth FE, Potasz N, Poon A, Davis ID, Saunder T, O'keefe GJ, Burgess AW, Hoffman EW, Old LJ, Scott AM. (huA33). Phase I clinical trials using multiple dose Phase I trial of 131I-huA33 in patients with advanced colorectal 125 131 schedules of I- and I-labled huA33 mAb in carcinoma. Clin Cancer Res. 2005 Jul 1;11(13):4818-26 patients with colorectal carcinoma have been conducted Scott AM, Lee FT, Jones R, Hopkins W, MacGregor D, Cebon and have shown safety and possible efficacy, with JS, Hannah A, Chong G, U P, Papenfuss A, Rigopoulos A, future trials proposed (Chong et al., 2005; Scott et al., Sturrock S, Murphy R, Wirth V, Murone C, Smyth FE, Knight S, 2005). Welt S, Ritter G, Richards E, Nice EC, Burgess AW, Old LJ. A phase I trial of humanized monoclonal antibody A33 in patients with colorectal carcinoma: biodistribution, pharmacokinetics, References and quantitative tumor uptake. Clin Cancer Res. 2005 Jul 1;11(13):4810-7 Welt S, Divgi CR, Real FX, Yeh SD, Garin-Chesa P, Finstad CL, Sakamoto J, Cohen A, Sigurdson ER, Kemeny N. Lee JW, Epardaud M, Sun J, Becker JE, Cheng AC, Yonekura Quantitative analysis of antibody localization in human AR, Heath JK, Turley SJ. Peripheral antigen display by lymph metastatic colon cancer: a phase I study of monoclonal node stroma promotes T cell tolerance to intestinal self. Nat antibody A33. J Clin Oncol. 1990 Nov;8(11):1894-906 Immunol. 2007 Feb;8(2):181-90

Welt S, Divgi CR, Kemeny N, Finn RD, Scott AM, Graham M, This article should be referenced as such: Germain JS, Richards EC, Larson SM, Oettgen HF. Phase I/II study of iodine 131-labeled monoclonal antibody A33 in Tabone T, Heath JK. GPA33 (glycoprotein A33 patients with advanced colon cancer. J Clin Oncol. 1994 (transmembrane)). Atlas Genet Cytogenet Oncol Haematol. Aug;12(8):1561-71 2009; 13(5):354-356.

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 356 Atlas of Genetics and Cytogenetics

in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS

Gene Section Mini Review

KLK5 (Kallikrein-related peptidase 5) George M Yousef, Eleftherios P Diamandis Department of Laboratory Medicine,St Michael's Hospital,30 Bond Street, Toronto, ON, M5B 1W8, Canada, (GMY), Department of Pathology and Laboratory Medicine, Mount Sinai Hospital, 6th Floor, Room 6-201, Box 32, 60 Murray Street, Toronto, Ontario, Canada, M5T 3L9 (EPD)

Published in Atlas Database: June 2008 Online updated version : http://AtlasGeneticsOncology.org/Genes/KLK5ID41085ch19q13.html DOI: 10.4267/2042/44470 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2009 Atlas of Genetics and Cytogenetics in Oncology and Haematology

triad of serine proteases is conserved. KLK5 is Identity synthesized as a full-length protein intracellularly. In Other names: EC 3.4.21; HSCTE; KLK-L2; KLKL2; the secretary pathway, the signal peptide is cleaved and SCTE the zymogen is released outside the cells. Upon HGNC (Hugo): KLK5 activation, the propeptide is removed to generate the mature active protein. In serum and ascites fluid, in Location: 19q13.41 addition to the free (approximately 40 kDa) form, Local order: Telomere to centromere. KLK5 forms complexes with alpha(1)-antitrypsin and alpha(2)-macroglobulin. DNA/RNA Expression Description At the mRNA level, KLK5 is expressed in a variety of The KLK5 gene is approximately 9.5 kb in length, tissues, mainly the testis, brain, breast, thyroid and consisting of 6 exons (5 of them are coding exons) and salivary glands. The KLK5 protein is expressed at 5 introns. higher levels in the skin, salivary gland, testis and female genital organs. KLK5 has also been identified in Transcription many biological fluids, including vaginal secretions, Five alternatively spliced variants have been identified breast milk and seminal plasma. Many fetal tissues, for the KLK5 gene. These variants differ in the number including bone, skin, thymus and kidney also express and length of the 5' untranslated exons and/or the last KLK5. two coding exons. Tissue-specific expression of these Localisation variants is regulated by multiple promoters located in the first exon of each isoform. KLK5 splice variants KLK5 is a secreted protein. were found to be differentially expressed, at the mRNA Function level, in ovarian, breast and prostate cancers. KLK5 is a secreted serine protease. The physiological Pseudogene functions of KLK5 are not fully understood. The KLK5 None identified. protein was originally identified from a keratinocyte library and was purified from the stratum corneum of Protein the human skin. It was found to have a trypsin-like enzymatic activity with strong preference for Arg over Description Lys in the P1 position. Evidence exists that it plays a Full-length KLK5 is formed of 293 amino acids. It is role in skin desquamation. KLK5 can also digest composed of a signal peptide (29 amino acids), extracellular matrix components, collagens type I, II, followed by an activation peptide (37 amino acids) and III, IV, fibronectin, and laminin, and can potentially the mature chain (227 amino acids), with 4 potential N- release angiostatin from plasminogen, and "cystatin- linked glycosylation sites. The position of the catalytic like domain 3" from low molecular weight kininogen, and fibrinopeptide B and peptide beta15-42 from the B

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 357 KLK5 (Kallikrein-related peptidase 5) Yousef GM, Diamandis EP

beta chain of fibrinogen. The KLK5 protein has been overexpressed in node-positive patients with ER- shown to activate another kallikrein, KLK7, and was negative tumors. It is independently associated with found to be under steroid hormonal regulation in cancer decreased DFS and OS, and it is an independent cell lines. It has been recently shown that KLK5 is indicator of shorter DFS and OS in node-positive differentially expressed in a number of malignancies, patients. including ovarian, breast and prostate cancers, but the Cytogenetics mechanisms of its involvement in cancer have yet to be No cytogenetic abnormalities are identified so far. determined. Hybrid/Mutated gene Homology None identified. The human KLK5 protein sequence shares 40-70% Prostate cancer homology with other members of the human tissue kallikreins, and 70% identity with that of the mouse Disease orthologue. KLK5 mRNA is downregulated in cancer vs normal prostatic tissues. Mutations Prognosis KLK5 mRNA is a favorable prognostic maker, with Note higher levels associated with low grade tumors and low No germinal or somatic mutations are identified to be Gleason score. associated with cancer so far. Cytogenetics Implicated in No cytogenetic abnormalities are identified so far. Hybrid/Mutated gene Ovarian cancer None identified. Disease Testicular cancer Higher KLK5 concentrations were found in the serum of 69% of patients with ovarian cancer. The KLK5 Disease protein was found to be elevated in 55% of ovarian KLK5 mRNA is downregulated in cancer vs normal cancer tissues compared to normal. Also, KLK5 testicular tissues. mRNA is significantly elevated in ovarian cancer, Prognosis especially serous type. Ovarian cancer ascites contains KLK5 mRNA is a marker of favorable prognosis, higher levels, as compared to benign effusions and overexpressed in smaller, early stage non-seminomas. ascites from other cancer types. Two KLK5 splice Cytogenetics variants are upregulated in ovarian cancer tissues No cytogenetic abnormalities are identified so far. compared to normal. Hybrid/Mutated gene Prognosis None identified. The KLK5 mRNA and protein are markers of unfavorable prognosis in ovarian cancer, being Non-small cell lung carcinoma overexpressed in late stage and higher grade tumors, Disease and associated with shorter DFS and OS. In addition, Serum KLK5 levels are lower in lung cancer compared the KLK5 protein was shown to be an independent to normal and can be used as part of a multiparametric indicator of poor prognosis in patients with high-grade panel for diagnosis. tumors and optimal debulking success. Prognosis Cytogenetics None identified. No cytogenetic abnormalities are identified so far. Cytogenetics Hybrid/Mutated gene No cytogenetic abnormalities are identified so far. None identified. Hybrid/Mutated gene Breast cancer None identified. Disease Urinary bladder carcinoma Higher concentrations of KLK5 were found in the Disease serum of 49% of patients with breast cancer. KLK5 splice variant 2 is downregulated in breast cancer None identified. compared to normal. Prognosis Prognosis Increased expression of KLK5 was frequently observed The KLK5 mRNA transcript was found to be an in invasive tumors (pT2-pT4) compared with superficial tumors (pTa, pT1). indicator of unfavorable prognosis, being

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 358 KLK5 (Kallikrein-related peptidase 5) Yousef GM, Diamandis EP

Cytogenetics Yousef GM, Polymeris ME, Yacoub GM, Scorilas A, Soosaipillai A, Popalis C, Fracchioli S, Katsaros D, Diamandis Copy number gain was observed in transitional cell EP. Parallel overexpression of seven kallikrein genes in carcinoma. ovarian cancer. Cancer Res. 2003 May 1;63(9):2223-7 Hybrid/Mutated gene Kurlender L, Yousef GM, Memari N, Robb JD, Michael IP, None identified. Borgoño C, Katsaros D, Stephan C, Jung K, Diamandis EP. Differential expression of a human kallikrein 5 (KLK5) splice variant in ovarian and prostate cancer. Tumour Biol. 2004 May- Breakpoints Jun;25(3):149-56 Note Yousef GM, White NM, Kurlender L, Michael I, Memari N, None identified. Robb JD, Katsaros D, Stephan C, Jung K, Diamandis EP. The kallikrein gene 5 splice variant 2 is a new biomarker for breast References and ovarian cancer. Tumour Biol. 2004 Sep-Dec;25(5-6):221-7 Yousef GM, Yacoub GM, Polymeris ME, Popalis C, Kim H, Scorilas A, Katsaros D, Yousef GM, Massobrio M, Soosaipillai A, Diamandis EP. Kallikrein gene downregulation Fracchioli S, Piccinno R, Gordini G, Diamandis EP. Human in breast cancer. Br J Cancer. 2004 Jan 12;90(1):167-72 kallikrein gene 5 (KLK5) expression is an indicator of poor prognosis in ovarian cancer. Br J Cancer. 2001 Mar Michael IP, Sotiropoulou G, Pampalakis G, Magklara A, Ghosh 2;84(5):643-50 M, Wasney G, Diamandis EP. Biochemical and enzymatic characterization of human kallikrein 5 (hK5), a novel serine Yousef GM, Obiezu CV, Jung K, Stephan C, Scorilas A, protease potentially involved in cancer progression. J Biol Diamandis EP. Differential expression of Kallikrein gene 5 in Chem. 2005 Apr 15;280(15):14628-35 cancerous and normal testicular tissues. Urology. 2002 Oct;60(4):714-8 Planque C, de Monte M, Guyetant S, Rollin J, Desmazes C, Panel V, Lemarié E, Courty Y. KLK5 and KLK7, two members Yousef GM, Scorilas A, Chang A, Rendl L, Diamandis M, Jung of the human tissue kallikrein family, are differentially K, Diamandis EP. Down-regulation of the human kallikrein expressed in lung cancer. Biochem Biophys Res Commun. gene 5 (KLK5) in prostate cancer tissues. Prostate. 2002 May 2005 Apr 22;329(4):1260-6 1;51(2):126-32 Prezas P, Arlt MJ, Viktorov P, Soosaipillai A, Holzscheiter L, Yousef GM, Scorilas A, Kyriakopoulou LG, Rendl L, Diamandis Schmitt M, Talieri M, Diamandis EP, Krüger A, Magdolen V. M, Ponzone R, Biglia N, Giai M, Roagna R, Sismondi P, Overexpression of the human tissue kallikrein genes KLK4, 5, Diamandis EP. Human kallikrein gene 5 (KLK5) expression by 6, and 7 increases the malignant phenotype of ovarian cancer quantitative PCR: an independent indicator of poor prognosis cells. Biol Chem. 2006 Jun;387(6):807-11 in breast cancer. Clin Chem. 2002 Aug;48(8):1241-50 Shaw JL, Diamandis EP. Distribution of 15 human kallikreins in Dong Y, Kaushal A, Brattsand M, Nicklin J, Clements JA. tissues and biological fluids. Clin Chem. 2007 Aug;53(8):1423- Differential splicing of KLK5 and KLK7 in epithelial ovarian 32 cancer produces novel variants with potential as cancer biomarkers. Clin Cancer Res. 2003 May;9(5):1710-20 Shinoda Y, Kozaki K, Imoto I, Obara W, Tsuda H, Mizutani Y, Shuin T, Fujioka T, Miki T, Inazawa J. Association of KLK5 Yousef GM, Kapadia C, Polymeris ME, Borgono C, Hutchinson overexpression with invasiveness of urinary bladder carcinoma S, Wasney GA, Soosaipillai A, Diamandis EP. The human cells. Cancer Sci. 2007 Jul;98(7):1078-86 kallikrein protein 5 (hK5) is enzymatically active, glycosylated and forms complexes with two protease inhibitors in ovarian Planque C, Li L, Zheng Y, Soosaipillai A, Reckamp K, Chia D, cancer fluids. Biochim Biophys Acta. 2003 Jul 28;1628(2):88- Diamandis EP, Goodglick L. A multiparametric serum kallikrein 96 panel for diagnosis of non-small cell lung carcinoma. Clin Cancer Res. 2008 Mar 1;14(5):1355-62 Yousef GM, Polymeris ME, Grass L, Soosaipillai A, Chan PC, Scorilas A, Borgoño C, Harbeck N, Schmalfeldt B, Dorn J, This article should be referenced as such: Schmitt M, Diamandis EP. Human kallikrein 5: a potential novel serum biomarker for breast and ovarian cancer. Cancer Res. Yousef GM, Diamandis EP. KLK5 (Kallikrein-related peptidase 2003 Jul 15;63(14):3958-65 5). Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5):357- 359.

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 359 Atlas of Genetics and Cytogenetics

in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS

Gene Section Mini Review

MIR10B (microRNA 10b) Begum Akman, Ayse Elif Erson Department of Biology, Office 141, Laboratory, B-56, Middle East Technical University, Ankara 06531, Turkey (BA, AEE)

Published in Atlas Database: June 2008 Online updated version : http://AtlasGeneticsOncology.org/Genes/MIRN10BID44292ch2q31.html DOI: 10.4267/2042/44471 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2009 Atlas of Genetics and Cytogenetics in Oncology and Haematology

to the HOXD cluster on 2q31.1. HOX genes are a Identity family of transcription factor genes that play crucial Other names: MIRN10B (microRNA 10b): MIR10B; roles during normal development and in oncogenesis. hsa-mir-10b; mir-10b HOXD4 expression is deregulated in a variety of solid HGNC (Hugo): MIR10B and hematopoietic cancers. Location: 2q31.1 Transcription Local order: Based on Mapviewer Genes on miRNAs are generally transcribed by RNA polymerase Sequence, genes flanking MIRN10B oriented from II. centromere to telomere on 2q31.1 are: There is limited information on how miRNA gene expression is regulated due to lack of basic information HOXD11; Homeobox 11, 2q31.1 of their gene structures. Screening of miRNA putative HOXD 10; Homeobox 10, 2q31.1 promoter regions (miPPRs) revealed miPPR-10b for HOXD 9; Homeobox 9, 2q31.1 MIRN10B. TWIST1, a metastasis-promoting HOXD 8; Homeobox 8, 2q31.1 transcription factor, has been shown to induce miR-10b via binding to the most proximal E-box upstream of the MIRN10B; microRNA 10b, 2q31.1 miR-10b hairpin region. This E-box was in the miPPR- HOXD 4; Homeobox 4, 2q31.1 10b. HOXD 3; Homeobox3, 2q31.1 Pri-miRNA (primary) mir-10b: The primary miRNA MTX2; Metaxin 2, 2q31.1. transcripts are called pri-miRNAs. They contain cap structures and poly(A) tails. If transcribed by RNA DNA/RNA polymerase II, primary transcript of mir-10b is not known yet. Pre-miRNA (precursor) mir-10b: pri-miRNA transcripts are processed by microprocessor complex consisting nuclear RNase enzyme Drosha and the double-stranded RNA binding protein Pasha to generate pre-miRNAs. The precursor mir-10b is 110 Stem-loop structure of mir-10b. nucleotides long. Pre-miR-10b is transferred from Description nucleus to cytoplasm. Sequence: In human, microRNA-10 gene has been duplicated. It is 5'-CCAGAGGUUGUAACGUUGUCUAUAUA now present in the form of two variants as miR-10a and UACCCUGUAGAACCGAAUUUGUGUGGUAUCC miR-10b located on different chromosomes. miR-10a is GUAUAGUCACAGAUUCGAUUCUAGGGGAAUA located between HOX4B and HOX5B on 17q21, while UAUGGUCGAUGCAAAAACUUCA-3' miR-10b is located between HOXD4 and HOXD8 on Mature miR-10b: In the cytoplasm, pre-miRNA 2q31.1. It is believed that, there is a strong correlation molecules are processed into mature miRNA by RNA- between the specific miRs and HOX genes. MIRN10B maps

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 360 MIR10B (microRNA 10b) Akman B, Erson AE

induced silencing complex (RISC). Mature miR-10b is were highly vascularized. miR-10b promoted 23 nucleotides long. metastasis in non-metastatic breast cancer cells. Lung Sequence: micro-metastasis was detected in miR-10b over- 5'-UACCCUGUAGAACCGAAUUUGUG-3' expressing cells while there were no intravasating cells Pseudogene or lung metastases in control tumors. It was shown that miR-10b expression was induced by No reported pseudogenes. transcription factor TWIST allowing miR-10b to inhibit translation of the mRNA encoding homeobox D10 Protein (Figure 2). This resulted in increased expression of a Note well-characterized prometastatic gene, RHOC (ras homolog gene family member C), thus leading to MicroRNAs are not translated into amino acids. migration, tumor invasion, and metastasis. Mutations Glioblastoma Note Disease Gene mutations have not been described. miR-10b was one of the over-expressed miRNAs in glioblastomas compared to peripheral tissues. Implicated in According to the microarray studies on glioblastomas, an excess of 1.97- to 13.6-fold increase was observed Colorectal neoplasia in 5 in out of 9 samples. This data was further confirmed by Northern blotting. miR-10b was stated to Disease be a candidate oncogene microRNA as it was Possible changes in microRNA levels; including miR- significantly upregulated in glioblastomas. 10b, was investigated during colorectal tumorigenesis. There was not a significant down-regulation of Acute Myeloid Leukemia (AML) microRNA 10b in colon tumors to suggest a potential Disease role in colorectal tumorigenesis. Role of microRNAs in the biology of NPMc+ Breast Cancer (nucleophosmin) AML was investigated in 85 adult de novo AML patients. Microarray studies characterized Disease these patients for subcellular localization/mutation 76 breast cancers and 10 normal breast samples were status of NPM1 and FLT3 mutations. A strong analyzed by microRNA microarray and Northern microRNA expression pattern was identified which Blotting to identify miRNAs whose expression is differentiated NPMc+ mutated from the cytoplasmic- deregulated notably in cancer versus normal breast negative (NPM1 unmutated) cases. According to this tissues. According to these results; miR-10b was one of pattern, miRNA-10b together with miRNA-10a, let-7 the microRNAs which were down-regulated. and miR-29 family members were up-regulated. These Oncogenesis data was further confirmed by qRT-PCR in 44 AML Tumor invasion and Metastasis: Although miR-10b patients (randomly chosen from the initial cohort). was downregulated in nonmetastatic breast cancers in According to the overall results, it was remarkable that comparison with normal breast tissue, this miRNA was miRNA-10b and miRNA-10a expression levels clearly over-expressed in about 50% of metastatic breast differentiated NPMc+ vs. NPMc- cases. cancers. Ectopic expression of miR-10b had no effect Central Nervous System (CNS) tumors on proliferation, but an increase in transwell migration and Matrigel invasion was observed. In vivo ectopic Disease expression of miR-10b conferred invasive properties on Although, miRNA-10b was not specifically expressed otherwise non-invasive breast cancer cells. Although in brain tissue, it was one of the 5 microRNAs which control tumors could not invade surrounding tissues were highly expressed in CNS tumor-derived cell lines and exhibited poor vascularization, miR-10b over- compared to normal brain tissue. expressing tumors exhibited an invasive behavior and

Regulation and function of miR-10b in breast cancer metastasis.

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 361 MIR10B (microRNA 10b) Akman B, Erson AE

Hepatocellular adenomas (HCAs) and Bernstein E, Caudy AA, Hammond SM, Hannon GJ. Role for a bidentate ribonuclease in the initiation step of RNA Hepatocellular Carcinomas (HCCs) interference. Nature. 2001 Jan 18;409(6818):363-6 Disease Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T. Expression of miRNAs was analyzed in a series of 46 New microRNAs from mouse and human. RNA. 2003 malignant and benign hepatocellular tumors compared Feb;9(2):175-9 to 4 normal liver tissues. The most significant Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young deregulated miRNAs were further analyzed in a second GP, James RJ. Reduced accumulation of specific microRNAs in colorectal neoplasia. Mol Cancer Res. 2003 Oct;1(12):882- series of 43 tumors and 16 non-tumor liver tissues 91 including cirrhosis and chronic hepatitis of various etiologies. miRNA-10b was found to be overexpressed Calin GA, Sevignani C, Dumitru CD, Hyslop T, Noch E, Yendamuri S, Shimizu M, Rattan S, Bullrich F, Negrini M, in HCC when compared to benign tumors and non- Croce CM. Human microRNA genes are frequently located at tumor liver tissues. fragile sites and genomic regions involved in cancers. Proc Protein synthesis inhibition Natl Acad Sci U S A. 2004 Mar 2;101(9):2999-3004 Denli AM, Tops BB, Plasterk RH, Ketting RF, Hannon GJ. Disease Processing of primary microRNAs by the Microprocessor The apolipoprotein B mRNA-editing enzyme catalytic complex. Nature. 2004 Nov 11;432(7014):231-5 polypeptide-like 3G (APOBEC3G or A3G) and other Lee Y, Kim M, Han J, Yeom KH, Lee S, Baek SH, Kim VN. APOBEC family members were shown to induce MicroRNA genes are transcribed by RNA polymerase II. protein synthesis by miRNAs such as miR-10b in 293T EMBO J. 2004 Oct 13;23(20):4051-60 and HeLa cells. miRNA microarray results suggested Ciafrè SA, Galardi S, Mangiola A, Ferracin M, Liu CG, overexpression of miR-10b in 293T cells. Luciferase Sabatino G, Negrini M, Maira G, Croce CM, Farace MG. assay showed A3G effects on miRNA mediated Extensive modulation of a set of microRNAs in primary translational repression. A3G facilitates recruitment of glioblastoma. Biochem Biophys Res Commun. 2005 Sep 9;334(4):1351-8 miRNA-targeted mRNA to polysomes to synthesize more proteins and drives dissociation of miRNA- Iorio MV, Ferracin M, Liu CG, Veronese A, Spizzo R, Sabbioni S, Magri E, Pedriali M, Fabbri M, Campiglio M, Ménard S, targeted mRNA from P-bodies. Palazzo JP, Rosenberg A, Musiani P, Volinia S, Nenci I, Calin Megakaryocytopoiesis GA, Querzoli P, Negrini M, Croce CM. MicroRNA gene expression deregulation in human breast cancer. Cancer Res. Disease 2005 Aug 15;65(16):7065-70 In order to discover regulatory pathways during Zeng Y, Yi R, Cullen BR. Recognition and cleavage of primary megakaryocytic differentiation, microRNA expression microRNA precursors by the nuclear processing enzyme profiling was performed for in vitro differentiated Drosha. EMBO J. 2005 Jan 12;24(1):138-48 megakaryocytes derived from CD34+ hematopoietic Garzon R, Pichiorri F, Palumbo T, Iuliano R, Cimmino A, progenitors. According to the PAM (predictive analysis Aqeilan R, Volinia S, Bhatt D, Alder H, Marcucci G, Calin GA, of microarray), miR-10b was one of the microRNAs Liu CG, Bloomfield CD, Andreeff M, Croce CM. MicroRNA fingerprints during human megakaryocytopoiesis. Proc Natl which were identified to be involved in megakaryocytic Acad Sci U S A. 2006 Mar 28;103(13):5078-83 differentiation. Downregulation of miR-10b was shown by microarrays. But Northern blot analysis and q-RT- Kajimoto K, Naraba H, Iwai N. MicroRNA and 3T3-L1 pre- adipocyte differentiation. RNA. 2006 Sep;12(9):1626-32 PCR results showed that miR-10a and miR-130a were the most significantly down-regulated among the Debernardi S, Skoulakis S, Molloy G, Chaplin T, Dixon-McIver examined miRNAs. A, Young BD. MicroRNA miR-181a correlates with morphological sub-class of acute myeloid leukaemia and the Adipogenesis expression of its target genes in global genome-wide analysis. Leukemia. 2007 May;21(5):912-6 Disease Gaur A, Jewell DA, Liang Y, Ridzon D, Moore JH, Chen C, miR-10b was shown to be up-regulated during 3T3-L1 Ambros VR, Israel MA. Characterization of microRNA pre-adipocyte differentiation. It was stated that this up- expression levels and their biological correlates in human regulation may not be related to an actual cancer cell lines. Cancer Res. 2007 Mar 15;67(6):2456-68 differentiation process and may be induced by growth Huang J, Liang Z, Yang B, Tian H, Ma J, Zhang H. arrest and/or hormonal stimulation. Derepression of microRNA-mediated protein translation inhibition by apolipoprotein B mRNA-editing enzyme catalytic polypeptide-like 3G (APOBEC3G) and its family members. J References Biol Chem. 2007 Nov 16;282(46):33632-40 Meazza R, Faiella A, Corsetti MT, Airoldi I, Ferrini S, Boncinelli Lui WO, Pourmand N, Patterson BK, Fire A. Patterns of known E, Corte G. Expression of HOXC4 homeoprotein in the nucleus and novel small RNAs in human cervical cancer. Cancer Res. of activated human lymphocytes. Blood. 1995 Apr 2007 Jul 1;67(13):6031-43 15;85(8):2084-90 Ma L, Teruya-Feldstein J, Weinberg RA. Tumour invasion and Manohar CF, Salwen HR, Furtado MR, Cohn SL. Up-regulation metastasis initiated by microRNA-10b in breast cancer. Nature. of HOXC6, HOXD1, and HOXD8 homeobox gene expression 2007 Oct 11;449(7163):682-8 in human neuroblastoma cells following chemical induction of differentiation. Tumour Biol. 1996;17(1):34-47

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 362 MIR10B (microRNA 10b) Akman B, Erson AE

Fujita S, Iba H. Putative promoter regions of miRNA genes hepatocellular tumors is associated with clinical features and involved in evolutionarily conserved regulatory systems among oncogene/tumor suppressor gene mutations. Hepatology. 2008 vertebrates. Bioinformatics. 2008 Feb 1;24(3):303-8 Jun;47(6):1955-63 Garzon R, Garofalo M, Martelli MP, Briesewitz R, Wang L, Ma L, Weinberg RA. MicroRNAs in malignant progression. Cell Fernandez-Cymering C, Volinia S, Liu CG, Schnittger S, Cycle. 2008 Mar 1;7(5):570-2 Haferlach T, Liso A, Diverio D, Mancini M, Meloni G, Foa R, Martelli MF, Mecucci C, Croce CM, Falini B. Distinctive Negrini M, Calin GA. Breast cancer metastasis: a microRNA microRNA signature of acute myeloid leukemia bearing story. Breast Cancer Res. 2008;10(2):203 cytoplasmic mutated nucleophosmin. Proc Natl Acad Sci U S A. 2008 Mar 11;105(10):3945-50 This article should be referenced as such: Ladeiro Y, Couchy G, Balabaud C, Bioulac-Sage P, Pelletier L, Akman B, Erson AE. MIR10B (microRNA 10b). Atlas Genet Rebouissou S, Zucman-Rossi J. MicroRNA profiling in Cytogenet Oncol Haematol. 2009; 13(5):360-363.

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 363 Atlas of Genetics and Cytogenetics

in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS

Gene Section Mini Review

RSPO1 (R-spondin homolog (Xenopus laevis)) Diana Blaydon Centre for Cutaneous Research, Institute of Cell and Molecular Sciences, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, 4 Newark Street, Whitechapel, London E1 2AT, United Kingdom (DB)

Published in Atlas Database: June 2008 Online updated version : http://AtlasGeneticsOncology.org/Genes/RSPO1ID44137ch1p34.html DOI: 10.4267/2042/44472 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2009 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Identity Expression R-spondin1 expression is seen in a number of organs Other names: FLJ40906; R-spondin1; RP11-566C13; and appears to coincide with expression of genes that RSPONDIN; hRspo1 form part of the Wnt signaling pathway. HGNC (Hugo): RSPO1 In the developing mouse Rspo1 transcripts are Location: 1p34.3 undetectable at E7, dramatically increased by E11 and significantly reduced again by E17. Rspo1 expression DNA/RNA is predominantly found in mesenchymal cells in a number of developing organs, including the forebrain, Description dorsal neural tube (roof plate), whisker follicles, 8 exons, 5 coding exons, 24 kb of genomic DNA. kidney, mammary gland, small intestine, the long bones and vertebrae (Nam et al., 2007). Transcription Rspo1 expression is also detected in the mesenchyme mRNA about 2.5 kb, 263 residues in full-length underlying the developing dermis, while in adult skin, translated protein, which contains an N-terminal signal expression is restricted to the dermal papilla of the hair peptide, followed by two cysteine-rich furin-like (Parma et al., 2006). domains, one thrombospondin type 1 domain (TSP1 Similarly, in humans, RSPO1 expression is detected in domain) and a putative C-terminal nuclear localization the small intestine, kidney, prostate, adrenal gland and signal domain. pancreas (Kim et al., 2005). Three alternatively spliced isoforms have been Expression of RSPO1 is detected in cultured primary identified: one lacking the signal peptide encoded by human fibroblasts but not in cultured keratinocytes, exon 4, one lacking the thrombospondin domain indicating that R-spondin1 may be acting as a paracrine encoded exon 7 and the third has an alternative 5' UTR. signaling molecule. Pseudogene Localisation None known. Secreted. Protein Function R-spondin1 is implicated in the Wnt signaling pathway Description where it seems to act as an enhancer of Wnt signaling. Secreted ligand with an N-terminal signal peptide, two R-spondin1 appears to antagonize Dickkopf1 action, an cysteine-rich furin-like domains, one thrombospondin inhibitor of the Wnt signaling pathway, by binding to type 1 domain (TSP1) and a putative C-terminal the receptor Kremen1 and inhibiting the internalization nuclear localization signal domain. of LRP6, a Wnt signaling co-receptor (Binnerts et al., 2007).

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 364 RSPO1 (R-spondin homolog (Xenopus laevis)) Blaydon D

Homology the five sisters, or their offspring, were affected. The squamous cell carcinoma lesions found in these There are 3 paralogs of human RSPO1: RSPO2, patients first developed in the hyperkeratotic skin of the RSPO3 and RSPO4. Orthologs have been identified in: hands and feet (PPK) and then metastasized to other mouse, chicken, dog, cow and chimpanzee. parts of the body, indicating that a single gene is responsible for both the PPK and predisposition to SCC Mutations (Radi et al., 2005). However, the sex reversal can be Germinal considered to be non-penetrant in affected XY individuals. In this extended Italian family there are To date, three homozygous RSPO1 mutations have eleven 46,XX individuals in two sibships, all of the been identified: a single base pair insertion, 896insG, a affected individuals have a male phenotype (two 46,XY 2752 bp deletion that includes exon 4 (the first coding and four 46,XX), while none of the seven genetic exon) and 286+1G>A, a splice site mutation. females with a female phenotype show any sign of the 896insG and the 2752 bp deletion were identified in PPK/SCC phenotype or sexual ambiguity. This two families exhibiting palmoplantar hyperkeratosis indicates that a single gene defect underlies both the with a predisposition to squamous cell carcinoma of the PPK/SCC and sex reversal, rather than two independent skin and XX sex reversal. 896insG leads to a frameshift mutations. The family is informative for linkage and stop codon after 10 amino acids resulting in the analysis for the PPK trait and allows linkage exclusion abolition of all normal isoforms of RSPO1. While the for the sex reversal trait. 2752 bp deletion allows production of a shorter form of Linkage analysis performed on this family detected RSPO1 mRNA, that may translate to a shorter protein positive LOD scores for two markers at 1p34-p35. lacking the signal peptide and first furin-like domain Furthermore, an additional affected individual, also (Parma et al., 2006). from Southern Italy, who presented with XX sex The splice site mutation 286+1G>A was identified in a reversal, PPK and SCC, also showed linkage to 1p34, 46,XX female with true hermaphroditism, palmoplantar but with a different haplotype (Parma et al., 2006). keratoderma, congenital bilateral corneal opacities, Sequencing identified two homozygous RSPO1 onychodystrophy and hearing impairment. 286+1G>A mutations in the two families. A single nucleotide leads to aberrant splicing of the mRNA and skipping of insertion in codon 36 results in a frame-shift and stop the second coding exon in all RSPO1 isoforms and a codon after ten amino acid residues, predicted to lead to predicted shortened R-spondin1 protein that lacks the abolition of all RSPO1 isoforms. However, the second entire first furin-like domain and the first two residues mutation, a 2752 bp deletion including exon 4, leads to of the second furin-like repeat (Tomaselli et al., 2007). a shorter mRNA that may translate to a putative, shorter protein lacking the signal peptide and first furin Implicated in domain. Palmoplantar hyperkeratosis with a In situ hybridization analysis has identified expression of mRspo1 in the urogenital ridge at E10.5, with sex- predisposition to squamous cell specific differences appearing at E12.5 inline with an carcinoma of the skin and XX sex increase in the somatic cells of the XX gonad. reversal Furthermore, qPCR detected no differences in mRspo1 Note levels between XX and XY gonads at E10.5 and E11.5, Two families. by E12.5, however, there is a clear increase of expression in XX gonads which is five-fold higher than Disease XY gonads by E14.5. Therefore, there is a sex-specific Mutations in the RSPO1 gene have been implicated in regulation of R spondin1 at a crucial time in sex an autosomal recessive syndrome identified in an determination (Parma et al., 2006). What is more, in the Italian family spanning three generations (Micali et al., XX sex reversal patients, functional testes are present, 2005). The syndrome is characterized by: but the individuals are sterile, indicating that R- sclerodactyly, non-epidermolytic palmar plantar spondin1 is not required for testis differentiation and keratoderma (PPK) associated with multiple cutaneous function (Parma et al., 2006). squamous cell carcinomas, dental anomlies and early RT-PCR has shown that RSPO1 is not expressed in tooth loss due to chronic periodontal disease (in three cultured keratinocytes, but it is expressed in fibroblasts. out of five brothers), hypogenitalism with hypospadias, Furthermore, plantar keratinocytes from an affected gynecomastia (in one brother), altered plasma sex individual did not differentiate in organotypic culture. hormone levels in the two brothers with abnormal Together, this data suggests that R-spondin1 might act genitalia and hypertriglyceridemia. Four out of the five as a paracrine signal from fibroblasts to keratinocytes, affected brothers had an abnormal XX karyotype that regulating keratinocyte proliferation and differentiation was associated with the genital abnormalities. None of (Parma et al., 2006).

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 365 RSPO1 (R-spondin homolog (Xenopus laevis)) Blaydon D

Syndromic true hermaphroditism with essential in sex determination, skin differentiation and malignancy. Nat Genet. 2006 Nov;38(11):1304-9 palmoplantar keratoderma, congenital Binnerts ME, Kim KA, Bright JM, Patel SM, Tran K, Zhou M, bilateral corneal opacities, Leung JM, Liu Y, Lomas WE 3rd, Dixon M, Hazell SA, Wagle onychodystrophy and hearing M, Nie WS, Tomasevic N, Williams J, Zhan X, Levy MD, Funk WD, Abo A. R-Spondin1 regulates Wnt signaling by inhibiting impairment internalization of LRP6. Proc Natl Acad Sci U S A. 2007 Sep Note 11;104(37):14700-5 One patient. Nam JS, Turcotte TJ, Yoon JK. Dynamic expression of R- spondin family genes in mouse development. Gene Expr References Patterns. 2007 Jan;7(3):306-12 Wei Q, Yokota C, Semenov MV, Doble B, Woodgett J, He X. Kim KA, Kakitani M, Zhao J, Oshima T, Tang T, Binnerts M, R-spondin1 is a high affinity ligand for LRP6 and induces LRP6 Liu Y, Boyle B, Park E, Emtage P, Funk WD, Tomizuka K. phosphorylation and beta-catenin signaling. J Biol Chem. 2007 Mitogenic influence of human R-spondin1 on the intestinal May 25;282(21):15903-11 epithelium. Science. 2005 Aug 19;309(5738):1256-9 Zhao J, de Vera J, Narushima S, Beck EX, Palencia S, Micali G, Nasca MR, Innocenzi D, Frasin LA, Radi O, Parma P, Shinkawa P, Kim KA, Liu Y, Levy MD, Berg DJ, Abo A, Funk Camerino G, Schwartz RA. Association of palmoplantar WD. R-spondin1, a novel intestinotrophic mitogen, ameliorates keratoderma, cutaneous squamous cell carcinoma, dental experimental colitis in mice. Gastroenterology. 2007 anomalies, and hypogenitalism in four siblings with 46,XX Apr;132(4):1331-43 karyotype: a new syndrome. J Am Acad Dermatol. 2005 Nov;53(5 Suppl 1):S234-9 Tomaselli S, Megiorni F, De Bernardo C, Felici A, Marrocco G, Maggiulli G, Grammatico B, Remotti D, Saccucci P, Valentini Radi O, Parma P, Imbeaud S, Nasca MR, Uccellatore F, F, Mazzilli MC, Majore S, Grammatico P. Syndromic true Maraschio P, Tiepolo L, Micali G, Camerino G. XX sex hermaphroditism due to an R-spondin1 (RSPO1) homozygous reversal, palmoplantar keratoderma, and predisposition to mutation. Hum Mutat. 2008 Feb;29(2):220-6 squamous cell carcinoma: genetic analysis in one family. Am J Med Genet A. 2005 Oct 15;138A(3):241-6 This article should be referenced as such: Parma P, Radi O, Vidal V, Chaboissier MC, Dellambra E, Blaydon D. RSPO1 (R-spondin homolog (Xenopus laevis)). Valentini S, Guerra L, Schedl A, Camerino G. R-spondin1 is Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5):364-366.

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 366 Atlas of Genetics and Cytogenetics

in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS

Gene Section Review

UBE2C (ubiquitin-conjugating enzyme E2C) Pierlorenzo Pallante, Maria Teresa Berlingieri, Alfredo Fusco Istituto di Endocrinologia ed Oncologia Sperimentale del CNR c/o Dipartimento di Biologia e Patologia Cellulare e Molecolare, Facolta di Medicina e Chirurgia, Universita degli Studi di Napoli "Federico II", via Pansini 5, 80131 Napoli, Italy (PP, MTB, AF)

Published in Atlas Database: June 2008 Online updated version : http://AtlasGeneticsOncology.org/Genes/UBE2CID44079ch20q13.html DOI: 10.4267/2042/44473 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2009 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Identity Protein Other names: UBCH10; UBE2C-PEN; UbcH10; Description dJ447F3.2; LOC11065 The UbcH10 gene encodes a member of the E2 HGNC (Hugo): UBE2C ubiquitin-conjugating enzyme family that is involved in Location: 20q13.12 the ubiquitin dependent proteolysis. In this pathway, Local order: CENTROMERE---WFDC3-DNTTIP1- ubiquitin-activating enzyme (E1), ubiquitin- UBE2C-TNNC2-SNX21-ACOT8---TELOMERE. conjugating enzyme (E2), together with ubiquitin ligase (E3), catalyze the covalent attachment of ubiquitin to Note: UbcH10 catalyzes the covalent attachment of target proteins, targeting them for degradation mediated ubiquitin to target proteins. It is required for the by the 26S proteasome. destruction of mitotic cyclins. The full-length UbcH10 contains 179 residues for a 19.6 kDa weight. It belongs to the class III Ubc DNA/RNA proteins that are characterized by an NH2-terminal Description extension followed by the "core" Ubc fold. Like all E2 enzymes, UbcH10 contains an active site UBE2C is located on chromosome 20, at 20q13.12 cysteine residue (position 114) that is crucial for the according to Entrez Gene. In AceView, it covers 4.40 formation of the ubiquitin-thiolester. Alteration of this kb, from 43874623 to 43879017 on the direct strand. residue C(114)S strongly inhibits ubiquitination of Transcription cyclin A and Cyclin B confering a dominant-negative There are 6 representative transcripts annotated in phenotype. RefSeq database, but, according to AceView, Homo Levels of UbcH10 are modulated by sapiens cDNA sequences in GenBank support at least autoubiquitination. This process is dependent on a 13 spliced variants. Isoform 1, the longest isoform, is motif, the "destruction box" [Arg-X-X-Leu-X-X- composed of 6 coding exons of varying lengths, (Leu/Ile)-X-Asp] recognized by the mitotic-specific separated by introns: NM_007019.2 (mRNA-ubiquitin- ubiquitination machinery. conjugating enzyme E2C): mRNA product length: 823. A study suggests that a destruction box is present in the UbcH10 sequence and includes residues 129-132 (Arg- Thr-Ile-Leu). Interestingly an SNP is reported for the residue 129 (refSNP ID: rs7352110, alleles A/G, Arg>Gly).

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 367 UBE2C (ubiquitin-conjugating enzyme E2C) Pallate P, et al.

This would be important since any change in the Disease putative destruction box could stabilize UbcH10 UbcH10 overexpression was reported in a number of against destruction. human cancer cell lines and primary tumors and Expression expression data strongly support an association UbcH10 mRNA and protein are expressed at low levels between high UbcH10 expression and a poor tumor in most adult normal tissues. In contrast, UbcH10 differentiation. Expression studies have also shown a mRNA and protein are highly expressed in tumor correlation between UbcH10 overexpression and the tissues. Moreover, UbcH10 protein levels fluctuate proliferation status since there is a good association during the cell cycle being abundant during M and with the proliferation marker Ki-67/MIB1. It was found early G1 phases, but decreasing in late G1, S and G2 overexpressed in lung carcinoma ( squamous and phases. adenocarcinoma, poorly versus well differentiated), bladder carcinoma (grade 3 versus grade 2), prostate Localisation carcinoma (metastatic versus primary), gastric Nucleoplasm. Cytosol. adenocarcinoma cervical, esophageal adenocarcinoma (adenocarcinoma versus Barrett's metaplasia), breast Function cancer (grade 3 versus grade 1, malignant versus UbcH10 is crucial for cell cycle progression during the benign neoplastic lesions), brain (astrocytomas versus G2/M phase, since its function is required for the low-grade tumors or normal controls), destruction of mitotic cyclins and other mitosis-related medulloblastoma, ovarian carcinoma (grade 3 versus substrates. UbcH10 interacts with the multiprotein grade 1 and 2), thyroid carcinoma (poorly versus well complex APC (anaphase-promoting complex), which differentiated), adrenocortical gland, Wilms tumor has E3 ubiquitin ligase activity, and targets for (relapsed versus relapse-free) hepatocellular carcinoma destruction substrates from the preceding mitosis (correlation with higher frequencies of invasion to (cyclin A, cyclin B, securin, geminin). Once these capsular formation, invasion to portal vein and tumor target proteins have been degraded, UbcH10 adds de-differentiation). Several expression analysis and ubiquitins to itself, triggering its own destruction. As a functional studies have also shown that UbcH10 result, the absence of UbcH10 allows the accumulation resulted up-regulated in experimental model of of cyclin A, which in turn contributes to the APC carcinogenesis, that its overexpression leads to the inactivation, providing a molecular switch that allows acquisition of a malignant phenotype and that its cells to proceed from cell division to a new round of knockdown successfully resulted in growth arrest. DNA duplication. Hence, the function of UbcH10 is Prognosis strictly linked to the progression of cell cycle through It was seen that UbcH10 overexpression is a negative the M phase and the coupling of mitosis to S-phase predictor of clinical outcome in patients affected by entry via autonomous regulation of the anaphase- ovarian and hepatocellular carcinoma. Therefore, promoting complex. UbcH10 has been suggested as a helpful prognostic indicator for ovarian and hepatocellular carcinoma Implicated in patients. Human cancers Oncogenesis Note 20q13.1 chromosomal region is frequently associated Several studies suggest a possible use of UbcH10 with genomic amplification in different malignant investigation (together with other molecular markers) neoplasias and amplification of UbcH10 locus has been in early detection of cancer. Other studies suggest that reported in the case of gastroesophageal carcinomas, inhibition of UbcH10 could have a therapeutic potential colorectal carcinomas with liver metastases, cervical in cancer treatment. cancers, ovarian carcinomas, gliomas and culture cell lines obtained from anaplastic thyroid carcinomas.

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 368 UBE2C (ubiquitin-conjugating enzyme E2C) Pallate P, et al.

Lin J, Raoof DA, Wang Z, Lin MY, Thomas DG, Greenson JK, References Giordano TJ, Orringer MB, Chang AC, Beer DG, Lin L. Expression and effect of inhibition of the ubiquitin-conjugating Yu H, King RW, Peters JM, Kirschner MW. Identification of a enzyme E2C on esophageal adenocarcinoma. Neoplasia. novel ubiquitin-conjugating enzyme involved in mitotic cyclin 2006 Dec;8(12):1062-71 degradation. Curr Biol. 1996 Apr 1;6(4):455-66 Peters JM. The anaphase promoting complex/cyclosome: a Townsley FM, Aristarkhov A, Beck S, Hershko A, Ruderman machine designed to destroy. Nat Rev Mol Cell Biol. 2006 JV. Dominant-negative cyclin-selective ubiquitin carrier protein Sep;7(9):644-56 E2-C/UbcH10 blocks cells in metaphase. Proc Natl Acad Sci U S A. 1997 Mar 18;94(6):2362-7 Rape M, Reddy SK, Kirschner MW. The processivity of multiubiquitination by the APC determines the order of Tang Z, Li B, Bharadwaj R, Zhu H, Ozkan E, Hakala K, substrate degradation. Cell. 2006 Jan 13;124(1):89-103 Deisenhofer J, Yu H. APC2 Cullin protein and APC11 RING protein comprise the minimal ubiquitin ligase module of the Takahashi Y, Ishii Y, Nishida Y, Ikarashi M, Nagata T, anaphase-promoting complex. Mol Biol Cell. 2001 Nakamura T, Yamamori S, Asai S. Detection of aberrations of Dec;12(12):3839-51 ubiquitin-conjugating enzyme E2C gene (UBE2C) in advanced colon cancer with liver metastases by DNA microarray and Criqui MC, de Almeida Engler J, Camasses A, Capron A, two-color FISH. Cancer Genet Cytogenet. 2006 Jul Parmentier Y, Inzé D, Genschik P. Molecular characterization 1;168(1):30-5 of plant ubiquitin-conjugating enzymes belonging to the UbcP4/E2-C/UBCx/UbcH10 gene family. Plant Physiol. 2002 Zirn B, Hartmann O, Samans B, Krause M, Wittmann S, Nov;130(3):1230-40 Mertens F, Graf N, Eilers M, Gessler M. Expression profiling of Wilms tumors reveals new candidate genes for different clinical Lin Y, Hwang WC, Basavappa R. Structural and functional parameters. Int J Cancer. 2006 Apr 15;118(8):1954-62 analysis of the human mitotic-specific ubiquitin-conjugating enzyme, UbcH10. J Biol Chem. 2002 Jun 14;277(24):21913-21 Berlingieri MT, Pallante P, Guida M, Nappi C, Masciullo V, Scambia G, Ferraro A, Leone V, Sboner A, Barbareschi M, Okamoto Y, Ozaki T, Miyazaki K, Aoyama M, Miyazaki M, Ferro A, Troncone G, Fusco A. UbcH10 expression may be a Nakagawara A. UbcH10 is the cancer-related E2 ubiquitin- useful tool in the prognosis of ovarian carcinomas. Oncogene. conjugating enzyme. Cancer Res. 2003 Jul 15;63(14):4167-73 2007 Mar 29;26(14):2136-40 Dairkee SH, Ji Y, Ben Y, Moore DH, Meng Z, Jeffrey SS. A Berlingieri MT, Pallante P, Sboner A, Barbareschi M, Bianco molecular 'signature' of primary breast cancer cultures; M, Ferraro A, Mansueto G, Borbone E, Guerriero E, Troncone patterns resembling tumor tissue. BMC Genomics. 2004 Jul G, Fusco A. UbcH10 is overexpressed in malignant breast 19;5(1):47 carcinomas. Eur J Cancer. 2007 Dec;43(18):2729-35 Rape M, Kirschner MW. Autonomous regulation of the Ieta K, Ojima E, Tanaka F, Nakamura Y, Haraguchi N, Mimori anaphase-promoting complex couples mitosis to S-phase K, Inoue H, Kuwano H, Mori M. Identification of overexpressed entry. Nature. 2004 Dec 2;432(7017):588-95 genes in hepatocellular carcinoma, with special reference to Wagner KW, Sapinoso LM, El-Rifai W, Frierson HF, Butz N, ubiquitin-conjugating enzyme E2C gene expression. Int J Mestan J, Hofmann F, Deveraux QL, Hampton GM. Cancer. 2007 Jul 1;121(1):33-8 Overexpression, genomic amplification and therapeutic Lee JJ, Foukakis T, Hashemi J, Grimelius L, Heldin NE, Wallin potential of inhibiting the UbcH10 ubiquitin conjugase in human G, Rudduck C, Lui WO, Höög A, Larsson C. Molecular carcinomas of diverse anatomic origin. Oncogene. 2004 Aug cytogenetic profiles of novel and established human anaplastic 26;23(39):6621-9 thyroid carcinoma models. Thyroid. 2007 Apr;17(4):289-301 Bredel M, Bredel C, Juric D, Harsh GR, Vogel H, Recht LD, Narayan G, Bourdon V, Chaganti S, Arias-Pulido H, Nandula Sikic BI. Functional network analysis reveals extended SV, Rao PH, Gissmann L, Dürst M, Schneider A, Pothuri B, gliomagenesis pathway maps and three novel MYC-interacting Mansukhani M, Basso K, Chaganti RS, Murty VV. Gene genes in human gliomas. Cancer Res. 2005 Oct dosage alterations revealed by cDNA microarray analysis in 1;65(19):8679-89 cervical cancer: identification of candidate amplified and Israeli O, Goldring-Aviram A, Rienstein S, Ben-Baruch G, overexpressed genes. Genes Chromosomes Cancer. 2007 Korach J, Goldman B, Friedman E. In silico chromosomal Apr;46(4):373-84 clustering of genes displaying altered expression patterns in Reddy SK, Rape M, Margansky WA, Kirschner MW. ovarian cancer. Cancer Genet Cytogenet. 2005 Jul Ubiquitination by the anaphase-promoting complex drives 1;160(1):35-42 spindle checkpoint inactivation. Nature. 2007 Apr Kobirumaki F, Miyauchi Y, Fukami K, Tanaka H. A novel 19;446(7138):921-5 UbcH10-binding protein facilitates the ubiquitinylation of cyclin Stegmeier F, Rape M, Draviam VM, Nalepa G, Sowa ME, Ang B in vitro. J Biochem. 2005 Feb;137(2):133-9 XL, McDonald ER 3rd, Li MZ, Hannon GJ, Sorger PK, Pallante P, Berlingieri MT, Troncone G, Kruhoffer M, Orntoft Kirschner MW, Harper JW, Elledge SJ. Anaphase initiation TF, Viglietto G, Caleo A, Migliaccio I, Decaussin-Petrucci M, is regulated by antagonistic ubiquitination and deubiquitination Santoro M, Palombini L, Fusco A. UbcH10 overexpression activities. Nature. 2007 Apr 19;446(7138):876-81 may represent a marker of anaplastic thyroid carcinomas. Br J Cancer. 2005 Aug 22;93(4):464-71 Walker G, MacLeod K, Williams AR, Cameron DA, Smyth JF, Langdon SP. Estrogen-regulated gene expression predicts Chen CC, Chang TW, Chen FM, Hou MF, Hung SY, Chong response to endocrine therapy in patients with ovarian cancer. IW, Lee SC, Zhou TH, Lin SR. Combination of multiple mRNA Gynecol Oncol. 2007 Sep;106(3):461-8 markers (PTTG1, Survivin, UbcH10 and TK1) in the diagnosis of Taiwanese patients with breast cancer by membrane array. Campone M, Campion L, Roché H, Gouraud W, Charbonnel C, Oncology. 2006;70(6):438-46 Magrangeas F, Minvielle S, Genève J, Martin AL, Bataille R, Jézéquel P. Prediction of metastatic relapse in node-positive de Gramont A, Ganier O, Cohen-Fix O. Before and after the breast cancer: establishment of a clinicogenomic model after spindle assembly checkpoint--an APC/C point of view. Cell Cycle. 2006 Sep;5(18):2168-71

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 369 UBE2C (ubiquitin-conjugating enzyme E2C) Pallate P, et al.

FEC100 adjuvant regimen. Breast Cancer Res Treat. 2008 This article should be referenced as such: Jun;109(3):491-501 Pallate P, Berlingieri MT, Fusco A. UBE2C (ubiquitin- Jiang L, Huang CG, Lu YC, Luo C, Hu GH, Liu HM, Chen JX, conjugating enzyme E2C). Atlas Genet Cytogenet Oncol Han HX. Expression of ubiquitin-conjugating enzyme Haematol. 2009; 13(5):367-370. E2C/UbcH10 in astrocytic tumors. Brain Res. 2008 Mar 27;1201:161-6

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 370 Atlas of Genetics and Cytogenetics

in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS

Gene Section Mini Review

WNT5A (wingless-type MMTV integration site family, member 5A) Masaru Katoh Genetics and Cell Biology Section, National Cancer Center Research Institute, 5-1-1 Tsukiji, Chuo-ku, Tokyo 104-0045, Japan (MK)

Published in Atlas Database: June 2008 Online updated version : http://AtlasGeneticsOncology.org/Genes/WNT5AID42825ch3p14.html DOI: 10.4267/2042/44474 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2009 Atlas of Genetics and Cytogenetics in Oncology and Haematology

colorectal cancer, and acute lymphocytic leukemia. Identity Wnt5a is upregulated by IL6 family cytokines through Other names: WNT-5A gp130 in cultured cardiomyocytes, by TGFbeta in HGNC (Hugo): WNT5A mammary epithelial cells, and by TNFalpha in gastric cancer cells. WNT5A upregulation in primary tumor is Location: 3p14.3 in part due to stromal expression based on tumor- Local order: CACNA2D3 - WNT5A - ERC2. stromal interaction, while WNT5A downregulation in Note: WNT family ligand. WNT family members with primary tumor is in part due to epigenetic silencing conserved 22 or 24 Cys residues are secreted-type induced by promoter CpG hypermethylation. glycoproteins, which are implicated in embryogenesis and carcinogenesis. Nineteen WNT family genes exist Protein within the human genome. Description DNA/RNA Mature WNT5A protein with conserved Cys residues is a secreted-type glycoprotein. Note WNT5A gene at chromosome 3p14.3 and WNT5B Expression gene at chromosome 12p13.33 are paralogs within the WNT5A mRNA is relatively abundantly expressed in human genome. salivary gland, bladder, uterus, placenta, and fetal Description kidney. WNT5A gene consists of 5 exons. First methionine is Localisation located in exon 1, while stop codon in exon 5. dbSNP Naive WNT5A protein is synthesized in the rs655731, located within exon 5 of the human WNT5A endoplasmic reticulum. Mature WNT5A protein with gene, is a synonymous SNP corresponding to codon lipid modifications and glycosylations enters the trans- 263. Golgi network for secretion from the cell surface. Transcription

WNT5A is preferentially upregulated in gastric cancer, and melanoma, but downregulated in breast cancer,

Schematic representation of WNT5A gene.

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 371 WNT5A (wingless-type MMTV integration site family, member 5A) Katoh M

Function Poor prognosis WNT5A signals are transduced to the canonical and Breast cancer non-canonical WNT signaling cascades. WNT5A Prognosis signaling through Frizzled-4 (FZD4) or FZD5 receptor Better prognosis. and LRP5 or LRP6 co-receptor leads to the stabilization and nuclear accumulation of beta-catenin Colorectal cancer for the transcriptional activation of target genes, such Prognosis as MYC, CCND1, and FGF20. On the other hand, Better prognosis. WNT5A signaling through Frizzled family receptor or ROR1 or ROR2 co-receptor leads to the activation of Acute lymphocytic leukemia the non-canonical WNT signaling cascades, such as Prognosis DAG - PKC, IP3 - NFAT, or IP3 - NLK signaling Better prognosis. cascades. WNT5A-PKC signaling promotes invasion and metastasis of tumors through SNAI1 (Snail)- References mediated epithelial-to-mesenchymal transition (EMT), Clark CC, Cohen I, Eichstetter I, Cannizzaro LA, McPherson while WNT5A-NLK signaling suppresses JD, Wasmuth JJ, Iozzo RV. Molecular cloning of the human carcinogenesis through inhibition of the canonical proto-oncogene Wnt-5A and mapping of the gene (WNT5A) to WNT signaling cascade. Expression of WNT5A is chromosome 3p14-p21. Genomics. 1993 Nov;18(2):249-60 associated with metastatic or aggressive phenotype in Dealy CN, Roth A, Ferrari D, Brown AM, Kosher RA. Wnt-5a gastric cancer, melanoma, and osteosarcoma, but is and Wnt-7a are expressed in the developing chick limb bud in associated with non-aggressive or better prognostic a manner suggesting roles in pattern formation along the proximodistal and dorsoventral axes. Mech Dev. 1993 phenotype in breast cancer, colorectal cancer, and acute Oct;43(2-3):175-86 lymphocytic leukemia. Together these facts indicate that WNT5A induces oncogenic as well as tumor Moon RT, Campbell RM, Christian JL, McGrew LL, Shih J, Fraser S. Xwnt-5A: a maternal Wnt that affects morphogenetic suppressive functions in a context-dependent manner. movements after overexpression in embryos of Xenopus Homology laevis. Development. 1993 Sep;119(1):97-111 Human WNT5A shows 98.7% total amino-acid identity Wong GT, Gavin BJ, McMahon AP. Differential transformation of mammary epithelial cells by Wnt genes. Mol Cell Biol. 1994 with rodent Wnt5a, indicating that mammalian Sep;14(9):6278-86 WNT5A orthologs are highly conserved. Among 19 WNT family members, WNT5A is most homologous to Iozzo RV, Eichstetter I, Danielson KG. Aberrant expression of the growth factor Wnt-5A in human malignancy. Cancer Res. WNT5B. 1995 Aug 15;55(16):3495-9 Lejeune S, Huguet EL, Hamby A, Poulsom R, Harris AL. Mutations Wnt5a cloning, expression, and up-regulation in human primary breast cancers. Clin Cancer Res. 1995 Feb;1(2):215- Note 22 WNT5A gene is located at human chromosome 3p14.3 Austin TW, Solar GP, Ziegler FC, Liem L, Matthews W. A role around the susceptible locus of Zimmermann-Laband for the Wnt gene family in hematopoiesis: expansion of Syndrome; however, mutation of WNT5A gene has not multilineage progenitor cells. Blood. 1997 May 15;89(10):3624- been detected. 35 Germinal Bui TD, Zhang L, Rees MC, Bicknell R, Harris AL. Expression and hormone regulation of Wnt2, 3, 4, 5a, 7a, 7b and 10b in Wnt5a knockout mice show smaller somites and normal human endometrium and endometrial carcinoma. Br J shortened presomitic mesoderm, abnormalities in the Cancer. 1997;75(8):1131-6 lungs with the foreshortened trachea, dysplasia of He X, Saint-Jeannet JP, Wang Y, Nathans J, Dawid I, Varmus genitals, and ventricular septal defects. H. A member of the Frizzled protein family mediating axis induction by Wnt-5A. Science. 1997 Mar 14;275(5306):1652-4 Implicated in Slusarski DC, Yang-Snyder J, Busa WB, Moon RT. Modulation of embryonic intracellular Ca2+ signaling by Wnt-5A. Dev Biol. Melanoma 1997 Feb 1;182(1):114-20 Prognosis He TC, Sparks AB, Rago C, Hermeking H, Zawel L, da Costa Poor prognosis. LT, Morin PJ, Vogelstein B, Kinzler KW. Identification of c-MYC as a target of the APC pathway. Science. 1998 Sep Gastric cancer 4;281(5382):1509-12 Prognosis Tetsu O, McCormick F. Beta-catenin regulates expression of Poor prognosis. cyclin D1 in colon carcinoma cells. Nature. 1999 Apr 1;398(6726):422-6 Osteosarcoma Yamaguchi TP, Bradley A, McMahon AP, Jones S. A Wnt5a Prognosis pathway underlies outgrowth of multiple structures in the vertebrate embryo. Development. 1999 Mar;126(6):1211-23

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 372 WNT5A (wingless-type MMTV integration site family, member 5A) Katoh M

Jönsson M, Dejmek J, Bendahl PO, Andersson T. Loss of Wnt- Dissanayake SK, Wade M, Johnson CE, O'Connell MP, 5a protein is associated with early relapse in invasive ductal Leotlela PD, French AD, Shah KV, Hewitt KJ, Rosenthal DT, breast carcinomas. Cancer Res. 2002 Jan 15;62(2):409-16 Indig FE, Jiang Y, Nickoloff BJ, Taub DD, Trent JM, Moon RT, Bittner M, Weeraratna AT. The Wnt5A/protein kinase C Saitoh T, Katoh M. Expression and regulation of WNT5A and pathway mediates motility in melanoma cells via the inhibition WNT5B in human cancer: up-regulation of WNT5A by of metastasis suppressors and initiation of an epithelial to TNFalpha in MKN45 cells and up-regulation of WNT5B by mesenchymal transition. J Biol Chem. 2007 Jun beta-estradiol in MCF-7 cells. Int J Mol Med. 2002 8;282(23):17259-71 Sep;10(3):345-9 Katoh M, Katoh M. STAT3-induced WNT5A signaling loop in Saitoh T, Mine T, Katoh M. Frequent up-regulation of WNT5A embryonic stem cells, adult normal tissues, chronic persistent mRNA in primary gastric cancer. Int J Mol Med. 2002 inflammation, rheumatoid arthritis and cancer (Review). Int J May;9(5):515-9 Mol Med. 2007 Feb;19(2):273-8 Weeraratna AT, Jiang Y, Hostetter G, Rosenblatt K, Duray P, Roarty K, Serra R. Wnt5a is required for proper mammary Bittner M, Trent JM. Wnt5a signaling directly affects cell gland development and TGF-beta-mediated inhibition of ductal motility and invasion of metastatic melanoma. Cancer Cell. growth. Development. 2007 Nov;134(21):3929-39 2002 Apr;1(3):279-88 Zuidervaart W, Pavey S, van Nieuwpoort FA, Packer L, Out C, Carr KM, Bittner M, Trent JM. Gene-expression profiling in Maat W, Jager MJ, Gruis NA, Hayward NK. Expression of human cutaneous melanoma. Oncogene. 2003 May Wnt5a and its downstream effector beta-catenin in uveal 19;22(20):3076-80 melanoma. Melanoma Res. 2007 Dec;17(6):380-6 Oishi I, Suzuki H, Onishi N, Takada R, Kani S, Ohkawara B, Cheng CW, Yeh JC, Fan TP, Smith SK, Charnock-Jones DS. Koshida I, Suzuki K, Yamada G, Schwabe GC, Mundlos S, Wnt5a-mediated non-canonical Wnt signalling regulates Shibuya H, Takada S, Minami Y. The receptor tyrosine kinase human endothelial cell proliferation and migration. Biochem Ror2 is involved in non-canonical Wnt5a/JNK signalling Biophys Res Commun. 2008 Jan 11;365(2):285-90 pathway. Genes Cells. 2003 Jul;8(7):645-54 Fukuda T, Chen L, Endo T, Tang L, Lu D, Castro JE, Widhopf Fujio Y, Matsuda T, Oshima Y, Maeda M, Mohri T, Ito T, GF 2nd, Rassenti LZ, Cantwell MJ, Prussak CE, Carson DA, Takatani T, Hirata M, Nakaoka Y, Kimura R, Kishimoto T, Kipps TJ. Antisera induced by infusions of autologous Ad- Azuma J. Signals through gp130 upregulate Wnt5a and CD154-leukemia B cells identify ROR1 as an oncofetal antigen contribute to cell adhesion in cardiac myocytes. FEBS Lett. and receptor for Wnt5a. Proc Natl Acad Sci U S A. 2008 Feb 2004 Aug 27;573(1-3):202-6 26;105(8):3047-52 Chamorro MN, Schwartz DR, Vonica A, Brivanlou AH, Cho KR, Pilarsky C, Ammerpohl O, Sipos B, Dahl E, Hartmann A, Varmus HE. FGF-20 and DKK1 are transcriptional targets of Wellmann A, Braunschweig T, Löhr M, Jesnowski R, Friess H, beta-catenin and FGF-20 is implicated in cancer and Wente MN, Kristiansen G, Jahnke B, Denz A, Rückert F, development. EMBO J. 2005 Jan 12;24(1):73-84 Schackert HK, Klöppel G, Kalthoff H, Saeger HD, Grützmann Gregorieff A, Pinto D, Begthel H, Destrée O, Kielman M, R. Activation of Wnt signalling in stroma from pancreatic Clevers H. Expression pattern of Wnt signaling components in cancer identified by gene expression profiling. J Cell Mol Med. the adult intestine. Gastroenterology. 2005 Aug;129(2):626-38 2008 Dec;12(6B):2823-35 Katoh M. WNT/PCP signaling pathway and human cancer Witze ES, Litman ES, Argast GM, Moon RT, Ahn NG. Wnt5a (review). Oncol Rep. 2005 Dec;14(6):1583-8 control of cell polarity and directional movement by polarized redistribution of adhesion receptors. Science. 2008 Apr Katoh M, Katoh M. Comparative genomics on Wnt5a and 18;320(5874):365-9 Wnt5b genes. Int J Mol Med. 2005 Apr;15(4):749-53 Ying J, Li H, Yu J, Ng KM, Poon FF, Wong SC, Chan AT, Sung Dejmek J, Säfholm A, Kamp Nielsen C, Andersson T, JJ, Tao Q. WNT5A exhibits tumor-suppressive activity through Leandersson K. Wnt-5a/Ca2+-induced NFAT activity is antagonizing the Wnt/beta-catenin signaling, and is frequently counteracted by Wnt-5a/Yes-Cdc42-casein kinase 1alpha methylated in colorectal cancer. Clin Cancer Res. 2008 Jan signaling in human mammary epithelial cells. Mol Cell Biol. 1;14(1):55-61 2006 Aug;26(16):6024-36 This article should be referenced as such: Mikels AJ, Nusse R. Purified Wnt5a protein activates or inhibits beta-catenin-TCF signaling depending on receptor context. Katoh M. WNT5A (wingless-type MMTV integration site family, PLoS Biol. 2006 Apr;4(4):e115 member 5A). Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5):371-373. Pukrop T, Klemm F, Hagemann T, Gradl D, Schulz M, Siemes S, Trümper L, Binder C. Wnt 5a signaling is critical for macrophage-induced invasion of breast cancer cell lines. Proc Natl Acad Sci U S A. 2006 Apr 4;103(14):5454-9

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 373 Atlas of Genetics and Cytogenetics

in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS

Leukaemia Section Mini Review

Nasal T cell lymphoma Antonio Cuneo, Francesco Cavazzini, Gian Matteo Rigolin Hematology Section, Dept. Of Biomedical Sciences, University of Ferrara, Ferrara Italy (AC, FC, GMR)

Published in Atlas Database: May 2008 Online updated version : http://AtlasGeneticsOncology.org/Anomalies/NasalTCellLymphomID2100.html DOI: 10.4267/2042/44475 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2009 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Epstein-Barr virus infection in this lymphoma was well Identity documented by molecular methods (Chiang et al., Alias: Angiocentric T-cell lymphoma; Polymorphic 1997). reticulosis; Lethal midline granuloma Treatment Clinics and pathology Combination regimens such as CHOP or other aggressive schedules followed by local radiotherapy are Disease the mainstay of treatment. Autologous bone marrow transplantation has been used. Extranodal NH/T-cell lymphoma, nasal type. Phenotype/cell stem origin Prognosis Prognosis is severe, with less than 50% of the patients This lymphoma derives form the transformation of NK achieving durable complete response after intensive lymphocytes and, less frequently, T-lymphocytes. chemotherapy and local radiotherapy. The disseminated Epidemiology forms of the disease are almost uniformly fatal. It is seen most frequently in China, Japan, Korea and other Asian countries and in Central America. Cytogenetics Clinics Cytogenetics morphological Middle aged adults are most frequently affected, with Three out of seven cases studied by Wong et al (1997), slight male predominance. The disease involves the including one nasal, one extranasal and one leukaemic nasal cavity and may spread to the pharynx, palate and form, showed a common region of deletion at 6q21- larinx. Less frequently, orbital and cranial nerve q25, suggesting that this may be a nonrandom involvement was described. Spreading to the skin, soft chromosomal aberration. tissue and gastrointestinal tract may occur. Bone Other non-random abnormalities include +X, i(1q), marrow involvement is unusual at presentation. i(7q), +8, del(13q), del(17p), i(17q), and 11q23 Hemophagocytic syndrome was described in some rearrangement (Wong et al., 1999). cases. The tumor is locally invasive and destructive (Liang et al., 2006). Cytogenetics molecular P73 gene methylation was described in 94% of the Pathology cases; other methylated genes included hMLH1 (63%), The cellular infiltrate is polymorphic, typically p16 (63%), p15 (48%), and RAR beta (47%) (Siu et al., associated with an angioinvase growth pattern, with 2002). P53 gene overexpression was documented consequent angiodestruction, ischemia and tissue (Quintanilla-Martinez et al., 1999). necrosis. Neoplastic cells are CD56 positive, with Comparative genomic hybridization studies identified negativity for surface CD3. The TCR gene is usually del(6q), del(13q),del (17p), del (1p), del(12q), and germline, even though some cases with a clonally partial gain of Xp, 2p, 10q as recurrent abnormalities rearranged TCR were reported (Yoon et al., 1999). (Siu et al., 1999; Ko et al., 2001). Some of these

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 374 Nasal T cell lymphoma Cuneo A, et al.

abnormalities (i.e. 17p deletion and 1p deletion) may be Wong KF, Zhang YM, Chan JK. Cytogenetic abnormalities in associated the aggressive leukemic variant of the natural killer cell lymphoma/leukaemia--is there a consistent pattern? Leuk Lymphoma. 1999 Jul;34(3-4):241-50 disease (Nakashima et al., 2005). Genome-wide array-based comparative genomic Yoon TY, Lee HT, Chang SH. Nasal-type T/natural killer cell angiocentric lymphoma, Epstein-Barr virus-associated, and hybridization identified recurrent regions of showing clonal T-cell receptor gamma gene rearrangement. Br imbalances: gain of 2q and loss of 6q16-27,11q22-23, J Dermatol. 1999 Mar;140(3):505-8 5p14, 5q34, 1p36, 2p16, 4q12, 4q31 (Nakashima et al., Ko YH, Choi KE, Han JH, Kim JM, Ree HJ. Comparative 2005). genomic hybridization study of nasal-type NK/T-cell lymphoma. Cytometry. 2001 Apr 15;46(2):85-91 References Siu LL, Chan JK, Wong KF, Kwong YL. Specific patterns of Chiang AK, Chan AC, Srivastava G, Ho FC. Nasal T/natural gene methylation in natural killer cell lymphomas : p73 is killer (NK)-cell lymphomas are derived from Epstein-Barr virus- consistently involved. Am J Pathol. 2002 Jan;160(1):59-66 infected cytotoxic lymphocytes of both NK- and T-cell lineage. Nakashima Y, Tagawa H, Suzuki R, Karnan S, Karube K, Int J Cancer. 1997 Nov 4;73(3):332-8 Ohshima K, Muta K, Nawata H, Morishima Y, Nakamura S, Wong KF, Chan JK, Kwong YL. Identification of del(6)(q21q25) Seto M. Genome-wide array-based comparative genomic as a recurring chromosomal abnormality in putative NK cell hybridization of natural killer cell lymphoma/leukemia: different lymphoma/leukaemia. Br J Haematol. 1997 Sep;98(4):922-6 genomic alteration patterns of aggressive NK-cell leukemia and extranodal Nk/T-cell lymphoma, nasal type. Genes Quintanilla-Martinez L, Franklin JL, Guerrero I, Krenacs L, Chromosomes Cancer. 2005 Nov;44(3):247-55 Naresh KN, Rama-Rao C, Bhatia K, Raffeld M, Magrath IT. Histological and immunophenotypic profile of nasal NK/T cell Liang RL.. Nasal T7NK-cell lymphoma. In: Canellos GP, Lister lymphomas from Peru: high prevalence of p53 overexpression. TA, Young BD: The Lymphomas 2nd edition. Sanuders Hum Pathol. 1999 Jul;30(7):849-55 Elsevier, Philadelphia, 2006, pp 451-455 Siu LL, Wong KF, Chan JK, Kwong YL. Comparative genomic This article should be referenced as such: hybridization analysis of natural killer cell lymphoma/leukemia. Recognition of consistent patterns of genetic alterations. Am J Cuneo A, Cavazzini F, Rigolin GM. Nasal T cell lymphoma. Pathol. 1999 Nov;155(5):1419-25 Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5):374-375.

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 375 Atlas of Genetics and Cytogenetics

in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS

Leukaemia Section Short Communication t(14;14)(q11;q32) CEBPE/IGH, inv(14)(q11q32) CEBPE/IGH Jean-Loup Huret Genetics, Dept Medical Information, University of Poitiers, CHU Poitiers Hospital, F-86021 Poitiers, France (JLH)

Published in Atlas Database: May 2008 Online updated version : http://AtlasGeneticsOncology.org/Anomalies/t1414q11q32CEBPEIGHID1438.html DOI: 10.4267/2042/44476 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2009 Atlas of Genetics and Cytogenetics in Oncology and Haematology

patients with a t(8;14)(q11;q32) CEBPD/IGH Identity translocation. Note One case was a Down syndrome patient; this may not This chromosome anomaly should not be confused be anecdotical, since more than 1/4 of t(8;14)(q11;q32) with the t(14;14)(q11;q32)/inv(14)(q11q32) found in T- case are also Down syndrome patients. cell diseases, which implicates TCR alpha or TCR delta (14q11) and TCL1A (14q32). Genes involved and proteins Clinics and pathology CEBPE Location Disease 14q11 CD10+ acute lymphoblastic leukaemia (B-ALL). Protein Epidemiology DNA-binding protein. CCAAT enhancer-binding protein (CEBP) transcription factors are a family of 6 Only 4 cases to date of multifunctional basic leucine zipper (bZIP) t(14;14)(q11;q32)/inv(14)(q11q32) with CEBPE and transcription factors. The 5 other CEBPs are: CEBPA IGH involvements (Akasaka et al., 2007). Five other (19q13), CEBPB (20q13), CEBPD (8q11), CEBPG cases of t(14;14)(q11;q32)/inv(14)(q11q32) in B-cell (19q13), all four equally implicated in leukemias, and leukemias are known (Denny et al., 1986; Speleman et DDIT3/CHOP/CEBP zeta (12q13), so far known to be al., 1991; Chervinsky et al., 1995; Wong et al., 1995; involved in solid tumours (liposarcoma). These Thomas et al., 2001), but without proof that CEBPE transcription factors play a key role in cellular was involved. As a matter of fact, a t(4;11)(q21;q23) differentiation, in particular in the control of myeloid was found in 2 of these cases, and a t(8;14)(q24;q32) in differentiation. CEBPE is composed of an N-term another case; this latter group is certainly transactivation domain, a negative regulatory domain, a heterogeneous. DNA-binding basic motif, and a leucine-zipper domain Clinics in C-term (Ramji et al., 2002; Nerlov et al., 2007). The four patients were male patients, aged 15, 25, 45, IgH and 45 years, with a WBC under 50 x 10 9/l. Survival is Location available only for two cases: 19 mths+ and 48 months+, resembling the relatively fair survival of 14q32

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 376 t(14;14)(q11;q32) CEBPE/IGH, inv(14)(q11q32) CEBPE/IGH Huret JL

Thomas X, Olteanu N, Charrin C, Lhéritier V, Magaud JP, Result of the chromosomal Fiere D. Acute lymphoblastic leukemia in the elderly: The Edouard Herriot Hospital experience. Am J Hematol. 2001 anomaly Jun;67(2):73-83 Fusion protein Ramji DP, Foka P. CCAAT/enhancer-binding proteins: structure, function and regulation. Biochem J. 2002 Aug Oncogenesis 1;365(Pt 3):561-75 Overexpression of the CEBP gene. Akasaka T, Balasas T, Russell LJ, Sugimoto KJ, Majid A, Walewska R, Karran EL, Brown DG, Cain K, Harder L, Gesk S, References Martin-Subero JI, Atherton MG, Brüggemann M, Calasanz MJ, Davies T, Haas OA, Hagemeijer A, Kempski H, Lessard M, Denny CT, Hollis GF, Hecht F, Morgan R, Link MP, Smith SD, Lillington DM, Moore S, Nguyen-Khac F, Radford-Weiss I, Kirsch IR. Common mechanism of chromosome inversion in B- Schoch C, Struski S, Talley P, Welham MJ, Worley H, Strefford and T-cell tumors: relevance to lymphoid development. JC, Harrison CJ, Siebert R, Dyer MJ. Five members of the Science. 1986 Oct 10;234(4773):197-200 CEBP transcription factor family are targeted by recurrent IGH translocations in B-cell precursor acute lymphoblastic leukemia Speleman F, Mangelschots K, Vercruyssen M, Dal Cin P, (BCP-ALL). Blood. 2007 Apr 15;109(8):3451-61 Aventin A, Offner F, Laureys G, Van den Berghe H, Leroy J. Analysis of whole-arm translocations in malignant blood cells Nerlov C. The C/EBP family of transcription factors: a by nonisotopic in situ hybridization. Cytogenet Cell Genet. paradigm for interaction between gene expression and 1991;56(1):14-7 proliferation control. Trends Cell Biol. 2007 Jul;17(7):318-24

Chervinsky DS, Grossi M, Kakati S, Block AW, Aplan PD. This article should be referenced as such: Concurrent presence of inv(14)(q11q32) and t(4;11)(q21;q23) in pre-B acute lymphoblastic leukemia. Genes Chromosomes Huret JL. t(14;14)(q11;q32) CEBPE/IGH, inv(14)(q11q32) Cancer. 1995 Mar;12(3):229-36 CEBPE/IGH. Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5):376-377. Wong KF, Kwong YL, Wong TK. Inversion 14q in acute lymphoblastic leukemia of B-lineage. Cancer Genet Cytogenet. 1995 Mar;80(1):72-4

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 377 Atlas of Genetics and Cytogenetics

in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS

Leukaemia Section Mini Review t(14;19)(q32;q13) IGH/CEBPA Jean-Loup Huret Genetics, Dept Medical Information, University of Poitiers, CHU Poitiers Hospital, F-86021 Poitiers, France (JLH)

Published in Atlas Database: May 2008 Online updated version : http://AtlasGeneticsOncology.org/Anomalies/t1419q32q13ALLID1335.html DOI: 10.4267/2042/44477 This article is an update of : Moorman AV, Robinson HM. t(14;19)(q32;q13) in acute lymphoblastic leukaemia. Atlas Genet Cytogenet Oncol Haematol 2004;8(4):326- 327.

Identity Clinics and pathology Note Disease This abnormality is cytogenetically identical but Acute lymphoblastic leukaemia (ALL). molecularly distinct from the t(14;19)(q32;q13) seen in chronic lymphoid leukaemia (CLL) and other chronic Phenotype/cell stem origin B-cell lymphoproliferative disorders, which results in B-lineage immunophenotype and FAB L1, mostly the juxtaposition of BCL3 with IGH on the der(14) and CD10+: B-cell precursor acute lymphoblastic leukemia subsequent over expression of the BCL3 protein. (BCP-ALL). Epidemiology Rare, with only 28 cases reported to date (Heerema et al., 1985; Prigogina et al., 1988; Pui et al., 1993; Andreasson et al., 2000; Robinson et al., 2004; Chapiro et al., 2006; Akasaka et al., 2007). The estimated incidence in childhood and adult ALL is <1%. Among the reported cases there appears to be a female predominance (9M/19F) which is unusual for ALL. The age range of patients is 5 to 76 years with a median of 19 years. This abnormality is most often found in adolescents and young adults. Clinics Typically, patients with this abnormality have low white cell count of 9/L, but 10% of patients present with a WBC above 50 x 10 9/L. Prognosis It is difficult to assess the true prognosis of patients with this abnormality given its rarity, however initial data suggest that the prognosis is better than expected G-banded metaphase showing the t(14;19)(q32;q13). The for patients of a similar age (see Figure 2). derivative chromosomes 14 and 19 are arrowed (bottom) G- banded karyogram showing the t(14;19)(q32;q13) and a add(15q) (top).

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 378 t(14;19)(q32;q13) IGH/CEBPA Huret JL

CEBPA Location 19q13 Note Alternatively, CEBPG can be involved instead of CEBPA (one case so far described). It is unknown if they bear the same prognosis, as they differ in their N- term. DNA/RNA CEBPA is a single-exon gene, CEBPG also. Protein DNA-binding protein. CCAAT enhancer-binding protein (CEBP) transcription factors are a family of 6 multifunctional basic leucine zipper (bZIP) transcription factors. The 4 other CEBPs are: CEBPB

(20q13), CEBPD (8q11), CEBPE (8q11), all three Cytogenetics equally implicated in leukemias, and DDIT3/CHOP/CEBP zeta (12q13), so far known to be Note involved in solid tumours (liposarcoma). These This balanced translocation can usually be identified by transcription factors play a key role in cellular G-banding alone. The breakpoint on chromosome 14 is differentiation, in particular in the control of myeloid consistently given as 14q32; however the breakpoint on differentiation. CEBPA is composed of an N-term chromosome 19 has, in the past, been more variably transactivation domain, a negative regulatory domain, a attributed, from q11 to q13. It is to be noted, however, DNA-binding basic motif, and a leucine-zipper domain that the gene involved on chromosome 19, CEBPA, lies in C-term. CEBPA mRNA is translated into two major at 38,482,776 bp from pter, very close to the q12 band proteins, p42CEBPA and p30CEBPA. The 30 kDa limit. protein lacks the transactivating domain, and inhibits Cytogenetics morphological DNA binding and transactivation by p42CEBPA. CEBPA is essential for the lineage specific The t(14;19) has been described as the sole abnormality differentiation of myelocytic haematopoietic precursors in 12 out of 28 cases, and is more frequently into mature neutrophils. CEBPG only contains a DNA- accompanied by additional structural and/or numerical binding basic motif, and a leucine-zipper domain abnormalities; +21 (acquired) was found in three cases, (Ramji et al., 2002; Nerlov et al., 2007). +6 in two cases. A t(9;22)(q34;q11) was found in one Germinal mutations case, a trisomy 8 in one case. CEBPA has been found mutated in a familial acute This abnormality has been reported in a single case myeloid leukemia (Smith et al., 2004). with Down syndrome. In a closely related translocation, the t(8;14)(q11;q32) with CEBPD/IGH Somatic mutations involvement, more than 1/4 of cases were Down 10% of acute myeloid leukemia (AML) and syndrome patients. myelodysplastic syndromes (MDS) cases exhibit a mutation in CEBPA, It seems to bear a good prognosis Genes involved and proteins Result of the chromosomal Note The involvement of the IGH gene located at 14q32 has anomaly been demonstrated via FISH using the LSI IGH Dual Colour Break Apart Rearrangement Probe in all cases Fusion protein tested. Metaphase and interphase FISH using probes Oncogenesis flanking the BCL3 gene have ruled out the involved of Overexpression of the CEBP gene. this gene; thus distinguishing it from the cytogenetically identical translocation References t(14;19)(q32;q13) seen in CLL and other chronic B-cell Heerema NA, Palmer CG, Baehner RL. Karyotypic and clinical lymphoproliferative disorders. findings in a consecutive series of children with acute lymphocytic leukemia. Cancer Genet Cytogenet. 1985 IgH Jun;17(2):165-79 Location Prigogina EL, Puchkova GP, Mayakova SA. Nonrandom 14q32 chromosomal abnormalities in acute lymphoblastic leukemia of childhood. Cancer Genet Cytogenet. 1988 Jun;32(2):183-203

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 379 t(14;19)(q32;q13) IGH/CEBPA Huret JL

Pui CH, Raimondi SC, Borowitz MJ, Land VJ, Behm FG, Valle V, Strefford JC, Berger R, Harrison CJ, Bernard OA, Pullen DJ, Hancock ML, Shuster JJ, Steuber CP, Crist WM. Nguyen-Khac F. Overexpression of CEBPA resulting from the Immunophenotypes and karyotypes of leukemic cells in translocation t(14;19)(q32;q13) of human precursor B acute children with Down syndrome and acute lymphoblastic lymphoblastic leukemia. Blood. 2006 Nov 15;108(10):3560-3 leukemia. J Clin Oncol. 1993 Jul;11(7):1361-7 Akasaka T, Balasas T, Russell LJ, Sugimoto KJ, Majid A, Andreasson P, Höglund M, Békássy AN, Garwicz S, Heldrup J, Walewska R, Karran EL, Brown DG, Cain K, Harder L, Gesk S, Mitelman F, Johansson B. Cytogenetic and FISH studies of a Martin-Subero JI, Atherton MG, Brüggemann M, Calasanz MJ, single center consecutive series of 152 childhood acute Davies T, Haas OA, Hagemeijer A, Kempski H, Lessard M, lymphoblastic leukemias. Eur J Haematol. 2000 Jul;65(1):40- Lillington DM, Moore S, Nguyen-Khac F, Radford-Weiss I, 51 Schoch C, Struski S, Talley P, Welham MJ, Worley H, Strefford JC, Harrison CJ, Siebert R, Dyer MJ. Five members of the Ramji DP, Foka P. CCAAT/enhancer-binding proteins: CEBP transcription factor family are targeted by recurrent IGH structure, function and regulation. Biochem J. 2002 Aug translocations in B-cell precursor acute lymphoblastic leukemia 1;365(Pt 3):561-75 (BCP-ALL). Blood. 2007 Apr 15;109(8):3451-61 Robinson HM, Taylor KE, Jalali GR, Cheung KL, Harrison CJ, Nerlov C. The C/EBP family of transcription factors: a Moorman AV. t(14;19)(q32;q13): a recurrent translocation in B- paradigm for interaction between gene expression and cell precursor acute lymphoblastic leukemia. Genes proliferation control. Trends Cell Biol. 2007 Jul;17(7):318-24 Chromosomes Cancer. 2004 Jan;39(1):88-92 Smith ML, Cavenagh JD, Lister TA, Fitzgibbon J. Mutation of This article should be referenced as such: CEBPA in familial acute myeloid leukemia. N Engl J Med. 2004 Huret JL. t(14;19)(q32;q13) IGH/CEBPA. Atlas Genet Dec 2;351(23):2403-7 Cytogenet Oncol Haematol. 2009; 13(5):378-380. Chapiro E, Russell L, Radford-Weiss I, Bastard C, Lessard M, Struski S, Cave H, Fert-Ferrer S, Barin C, Maarek O, Della-

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 380 Atlas of Genetics and Cytogenetics

in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS

Leukaemia Section Mini Review t(2;4)(p22;q12) Jean-Loup Huret Genetics, Dept Medical Information, University of Poitiers, CHU Poitiers Hospital, F-86021 Poitiers, France (JLH)

Published in Atlas Database: May 2008 Online updated version : http://AtlasGeneticsOncology.org/Anomalies/t0204p22q12ID2136.html DOI: 10.4267/2042/44478 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2009 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Clinics and pathology Protein Composed of an extracellular domain (the Disease immunoglobulin-like motifs), a transmembrane domain, with an inhibitory juxtamembrane WW-like Myeloproliferative disease with eosinophilia domain (Irusta et al., 2002), and an intracellular domain Epidemiology (kinase domain); receptor tyrosine kinase; forms Only one case to date, a 64 year old male patient. homodimer, and heterodimer with PDGFRB; dimerization induces kinase domain activation, leading Prognosis to the activation of intracellular signalling pathways The patient remained in complete remission for 24 (Kawagishi et al., 1995). months of treatment with imatinib, but refused any Somatic mutations more treatment, althoughthere was no side effect. Hybrid genes between various partners and PDFRGA Elevated eosinophil counts were again detected 14 occur in chronic myeloid leukaemia-like diseases with months after end of treatment. eosinophilia, mostly chronic eosinophilic leukemia (CEL), a clonal hypereosinophilic syndrome. PDGFRA Genes involved and proteins partners known so far are: STRN (2p24), herein STRN described (Curtis et al., 2007), FIP1L1 (4q12) (Cools et al., 2003; Pardanani et al., 2004), CDK5RAP2 (9q33) Location (Walz et al., 2006), KIF5B (10p11) (Score et al., 2006), 2p22.2 ETV6 (12p13) (Curtis et al., 2007), and BCR (22q11) Protein (Baxter et al., 2002). Composed of a caveolin-binding domain, a coiled-coil Mutations of platelet-derived growth factor receptor- domain, a calmodulin-binding domain, and at least 6 alpha (PDGFRA) are observed in a subset of WD-repeats. Striatin (STRN) binds many proteins, and gastrointestinal stromal tumors (GISTs) (Heinrich et forms multi-protein complexes. It is a scaffolding al., 2003). protein; striatin contains a caveolin-binding consensus Tumours with PDGFRA involvement are responsive to motif, and binds caveolin-1, the major protein involved imatinib therapy (Cools et al., 2003; Debiec-Rychter et in caveolae and lipid rafts. Striatin is also involved in al., 2004). signaling and trafficking in a Ca 2+ dependant manner, exhibiting a dual role in endocytic process and Result of the chromosomal signaling. anomaly PDGFRA Location Hybrid gene 4q12 Transcript 5' STRN-3' PDGFRA; Fusion between STRN intron 6

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 381 t(2;4)(p22;q12) Huret JL

and a truncated PDGFRA exon 12; reciprocal product hypereosinophilic syndrome. N Engl J Med. 2003 Mar not found -> in frame fusion between STRN exon 6 and 27;348(13):1201-14 PDGFRA exon 12. Heinrich MC, Corless CL, Duensing A, McGreevey L, Chen CJ, Joseph N, Singer S, Griffith DJ, Haley A, Town A, Demetri GD, Fusion protein Fletcher CD, Fletcher JA. PDGFRA activating mutations in Description gastrointestinal stromal tumors. Science. 2003 Jan 31;299(5607):708-10 The N-term STRN - C-term PDGFRA fusion protein retains the caveolin-binding domain, the coiled-coil Debiec-Rychter M, Dumez H, Judson I, Wasag B, Verweij J, Brown M, Dimitrijevic S, Sciot R, Stul M, Vranck H, Scurr M, domain, and the calmodulin-binding domain, but not Hagemeijer A, van Glabbeke M, van Oosterom AT. Use of c- the WD-repeats of STRN, fused to a truncated WW- KIT/PDGFRA mutational analysis to predict the clinical like domain and the kinase domain of PDGFRA; the response to imatinib in patients with advanced gastrointestinal coiled-coil domain from STRN may act as a stromal tumours entered on phase I and II studies of the EORTC Soft Tissue and Bone Sarcoma Group. Eur J Cancer. dimerization motif that could constitutively activate 2004 Mar;40(5):689-95 PDGFRA tyrosine kinase. Pardanani A, Brockman SR, Paternoster SF, Flynn HC, Ketterling RP, Lasho TL, Ho CL, Li CY, Dewald GW, Tefferi A. References FIP1L1-PDGFRA fusion: prevalence and clinicopathologic correlates in 89 consecutive patients with moderate to severe Kawagishi J, Kumabe T, Yoshimoto T, Yamamoto T. Structure, eosinophilia. Blood. 2004 Nov 15;104(10):3038-45 organization, and transcription units of the human alpha- platelet-derived growth factor receptor gene, PDGFRA. Benoist M, Gaillard S, Castets F. The striatin family: a new Genomics. 1995 Nov 20;30(2):224-32 signaling platform in dendritic spines. J Physiol Paris. 2006 Mar-May;99(2-3):146-53 Couet J, Li S, Okamoto T, Ikezu T, Lisanti MP. Identification of peptide and protein ligands for the caveolin-scaffolding Score J, Curtis C, Waghorn K, Stalder M, Jotterand M, Grand domain. Implications for the interaction of caveolin with FH, Cross NC. Identification of a novel imatinib responsive caveolae-associated proteins. J Biol Chem. 1997 Mar KIF5B-PDGFRA fusion gene following screening for PDGFRA 7;272(10):6525-33 overexpression in patients with hypereosinophilia. Leukemia. 2006 May;20(5):827-32 Gaillard S, Bartoli M, Castets F, Monneron A. Striatin, a calmodulin-dependent scaffolding protein, directly binds Walz C, Curtis C, Schnittger S, Schultheis B, Metzgeroth G, caveolin-1. FEBS Lett. 2001 Nov 9;508(1):49-52 Schoch C, Lengfelder E, Erben P, Müller MC, Haferlach T, Hochhaus A, Hehlmann R, Cross NC, Reiter A. Transient Baxter EJ, Hochhaus A, Bolufer P, Reiter A, Fernandez JM, response to imatinib in a chronic eosinophilic leukemia Senent L, Cervera J, Moscardo F, Sanz MA, Cross NC. The associated with ins(9;4)(q33;q12q25) and a CDK5RAP2- t(4;22)(q12;q11) in atypical chronic myeloid leukaemia fuses PDGFRA fusion gene. Genes Chromosomes Cancer. 2006 BCR to PDGFRA. Hum Mol Genet. 2002 Jun 1;11(12):1391-7 Oct;45(10):950-6 Irusta PM, Luo Y, Bakht O, Lai CC, Smith SO, DiMaio D. Curtis CE, Grand FH, Musto P, Clark A, Murphy J, Perla G, Definition of an inhibitory juxtamembrane WW-like domain in Minervini MM, Stewart J, Reiter A, Cross NC. Two novel the platelet-derived growth factor beta receptor. J Biol Chem. imatinib-responsive PDGFRA fusion genes in chronic 2002 Oct 11;277(41):38627-34 eosinophilic leukaemia. Br J Haematol. 2007 Jul;138(1):77-81 Cools J, DeAngelo DJ, Gotlib J, Stover EH, Legare RD, Cortes J, Kutok J, Clark J, Galinsky I, Griffin JD, Cross NC, Tefferi A, This article should be referenced as such: Malone J, Alam R, Schrier SL, Schmid J, Rose M, Huret JL. t(2;4)(p22;q12). Atlas Genet Cytogenet Oncol Vandenberghe P, Verhoef G, Boogaerts M, Wlodarska I, Haematol. 2009; 13(5):381-382. Kantarjian H, Marynen P, Coutre SE, Stone R, Gilliland DG. A tyrosine kinase created by fusion of the PDGFRA and FIP1L1 genes as a therapeutic target of imatinib in idiopathic

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 382 Atlas of Genetics and Cytogenetics

in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS

Leukaemia Section Mini Review t(5;14)(q35;q32.2) Stefan Nagel, Roderick AF MacLeod DSMZ - German Collection of Microorganisms and Cell Cultures, Dept of Human & (SN), Animal Cell Cultures, Inhoffenstr. 7b, 38124, Braunschweig, Germany (RAFM)

Published in Atlas Database: May 2008 Online updated version : http://AtlasGeneticsOncology.org/Anomalies/t0514q35q32ID1386.html DOI: 10.4267/2042/44479 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2009 Atlas of Genetics and Cytogenetics in Oncology and Haematology

ALL (approximatively 20%); less Clinics and pathology frequent in adult T-ALL. Disease Cytology T cell acute lymphoblastic leukemia (T-ALL) FAB nomenclature: L1 or L2 ALL. Phenotype/cell stem origin Prognosis Cortical T cell leukemia (CD1a+, CD10+). TLX3 expression - presumably due to Epidemiology t(5;14)(q35.1;q32) or its congeners - has been reported to confer poor prognosis. Restricted to T-ALL. Relatively frequent in pediatric T-

Cytogenetics

G-banding of t(5;14)(q35;q32.2) in a pediatric T-ALL leukemia cell line (CCRF-CEM) illustrating the cryptic nature of this rearrangement. Hence normal and rearranged homologs are indistinguishable by G-banding, as are standard and rare variant t(5;14) subtypes. In chromosome painting images only a minority of cells in even superior preparations show the t(5;14).

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 383 t(5;14)(q35;q32.2) Nagel S, MacLeod RAF

Cytogenetics morphological downstream region of BCL11B and are widely t(5;14), like other cryptic chromosomal aberrations, distributed along an almost unprecedentedly long was discovered relatively recently and most subsequent stretch of about 1 Mbp in extent. So far there is no hint studies have focused on molecular and clinical aspects of deregulation of BCL11B by t(5;14)(q35;32). The of this entity to the exclusion of cytogenetics. This gap t(5;14) aberration results in the juxtaposition of either is aggravated by the uniquely large breakpoint cluster TLX3 or NKX2-5 homeobox genes with enhancer region (bcr) of the 14q32 partner gene, BCL11B (alias elements located downstream of BCL11B inside a CTIP2, RIT1). Hence, detailed documentation of this "genomic desert" region. TLX3 and NKX2-5 are interesting rearrangement is largely based on data located at 5q35.1 and 5q35.2, respectively, about 2 obtained using t(5;14) T-ALL cell lines which hitherto Mbp apart. all carry submicroscopic insertions, both ins(5;14) and The centromeric neighbour of TLX3, RANBP17, may ins(14;5), instead of conventional reciprocal undergo truncation by the translocation, although this translocations. If verified in patient material, detailed may not be significant as RANBP17 is not expressed in analysis of such configurations may reveal neighboring T-cells. While both, TLX3 and NKX2-5 have been genes or regulators inimical to the oncogenic activity of described to be activated by translocations involving t(5;14), and therefore excluded by the more selective the T-cell receptor genes, aberrations targeting NKX2- insertional rearrangements. 5 seem to be very rare in T-ALL. Together with TLX1/HOX11 both homeobox genes, TLX3 and Cytogenetics molecular NKX2-5, are members of the NK-like family of The proximities of the 14q32.2, and of both standard homeobox genes, implicating similar activities in T-cell and variant 5q35 breakpoints to their respective leukemogenesis. However, differences in the telomeres, impairs FISH detection using chromosome prognostic outcome may indicate functional differences painting probes except in optimal preparations. The between TLX1 and TLX3. A couple of dysregulated tendency of t(5;14) to involve microinsertions (in both targets of these NK-like homeobox genes have been directions), together with the sheer magnitude of the described, including PP2A for TLX1 and MEF2C for BCL11B bcr, impedes detection by specific BAC/PAC NKX2-5. Physiologically, TLX3 and NKX2-5 are combinations. involved in organogenesis of the spleen. Additionally, Probes TLX3 is expressed in neuronal cells of the periphery The widespread involvement of cryptic rearrangements, and NKX2-5 in the heart. Therefore, their expression in notably microinsertions, plus the sheer length of the T-cells is ectopic and serves as a solid diagnostic 14q32.2 breakpoint cluster complicates diagnostic marker detectable by (quantitiative) RT-PCR. probe design. Sensitive molecular cytogenetic However, no standard assay for TLX3, as described for diagnosis requires a BAC contig-battery covering bcr at other mutated genes in leukemia/lymphoma by both 5q35 and 14q32. Given the ectopic - all or none - BIOMED, has been published so far. nature of TLX3 expression in affected cells, screening TLX3 t(5;14) is probably better performed by RT-PCR. Location Variants 5q35.1 A microscopically synonymous variant, Note t(5;14)(q35.2;q32.2), whereby the closely related and Alias: HOX11L2. neighboring NKX2-5 is juxtaposed to BCL11B, has proved frustratingly difficult to identify clinically Protein despite occurring in two widely used T-ALL cell lines, Homeodomain; member of the NK-like family of CCRF-CEM and PEER. NKX2-5 is ectopically homeobox genes. activated in t(5;14)(q35.2;q11.2) where it is juxtaposed NKX2-5 with TRAD. The diagnostic caveats for the standard Location translocation also apply: detection of variant t(5;14) by 5q35.2 RT-PCR is likely to pose fewer technical difficulties than cytogenetic detection by FISH. Note Alias: CSX. Genes involved and proteins Protein Note Homeodomain; member of the NK-like family of The breakpoints at 14q32.2 are located in the homeobox genes.

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 384 t(5;14)(q35;q32.2) Nagel S, MacLeod RAF

Upper image depicts results of chromosome painting in an above average T-ALL cell (CCRF-CEM) with t(5;14) and concurrent ins(14;5). Note absence of visible signs betraying reciprocal exchange. Chromosome painting was performed using Cambio probes (Cambridge, UK) for chromosomes 5 (TexasRed), and 14 (Cy3). Middle image depicts standard t(5;14)(q35.1;q32.2) as represented by ins(5;14)(q35.1;q32.2q32.2) in cell line DND-41 which activates TLX3 transcription by juxtaposition with part of the noncoding region of BCL11B (clones shown below). Insert shows fiber-FISH confirming the regions juxtaposed. Lower image summarizes breakpoint data for t(5;14)(q35;q32) in T-ALL at three loci: TLX3 (standard translocation), NKX2-5 (variant translocation), and BCL11B (both translocations). Patient and cell line breakpoints are shown red and blue, respectively, together with insertion data from cell line DND-41. The NKX2-5 patient breakpoint included for comparison is from a t(5;14)(q35.2;q11.2) patient where TRAD is the activating partner. Coordinates are given in Mbp. Note the circa 1 Mbp 14q32.2 bcr which effectively covers the 3'-BCL11B regulatory region, while TLX3 breakpoints cover a "modest" 90 Kbp. NKX2-5 cases are too rare to allow bcr delineation.

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 385 t(5;14)(q35;q32.2) Nagel S, MacLeod RAF

partipicipant translocations. The precise physiological Result of the chromosomal mechanism(s) underlying the normal activity of anomaly presumptive BCL11B enhancers awaits clarification: although these enhancers may be involved in the Hybrid gene developmental control of BCL11B activity - a gene demanding exquisite regulation in T-cells - little supporting data are as yet available. References Bernard OA, Busson-LeConiat M, Ballerini P, Mauchauffé M, Della Valle V, Monni R, Nguyen Khac F, Mercher T, Penard- Lacronique V, Pasturaud P, Gressin L, Heilig R, Daniel MT, Lessard M, Berger R. A new recurrent and specific cryptic translocation, t(5;14)(q35;q32), is associated with expression of the Hox11L2 gene in T acute lymphoblastic leukemia. Leukemia. 2001 Oct;15(10):1495-504 Satterwhite E, Sonoki T, Willis TG, Harder L, Nowak R, Arriola EL, Liu H, Price HP, Gesk S, Steinemann D, Schlegelberger B, Oscier DG, Siebert R, Tucker PW, Dyer MJ. The BCL11 gene family: involvement of BCL11A in lymphoid malignancies. Blood. 2001 Dec 1;98(12):3413-20 MacLeod RA, Nagel S, Kaufmann M, Janssen JW, Drexler HG. Activation of HOX11L2 by juxtaposition with 3'-BCL11B in an acute lymphoblastic leukemia cell line (HPB-ALL) with t(5;14)(q35;q32.2). Genes Chromosomes Cancer. 2003 May;37(1):84-91 Nagel S, Kaufmann M, Drexler HG, MacLeod RA. The cardiac homeobox gene NKX2-5 is deregulated by juxtaposition with BCL11B in pediatric T-ALL cell lines via a novel t(5;14)(q35.1;q32.2). Cancer Res. 2003 Sep 1;63(17):5329-34 Cavé H, Suciu S, Preudhomme C, Poppe B, Robert A, Figure 1 shows RT-PCR analysis of genes involved in Uyttebroeck A, Malet M, Boutard P, Benoit Y, Mauvieux L, Lutz t(5;14)(q35;q32) in T-ALL cell lines PEER and CCRF-CEM, P, Méchinaud F, Grardel N, Mazingue F, Dupont M, both expressing NKX2-5 instead of TLX3. Margueritte G, Pages MP, Bertrand Y, Plouvier E, Brunie G, Figure 2 shows expression array data converted into a heat- Bastard C, Plantaz D, Vande Velde I, Hagemeijer A, Speleman map and demonstrate gene activities in five T-ALL cell lines: F, Lessard M, Otten J, Vilmer E, Dastugue N. Clinical ALL-SIL (TRAD/TLX1), CCRF-CEM (NKX2-5/BCL11B), HPB- significance of HOX11L2 expression linked to t(5;14)(q35;q32), ALL (TLX3/BCL11B), PEER (NKX2-5/BCL11B), JURKAT of HOX11 expression, and of SIL-TAL fusion in childhood T- (negative control). Red indicates high, green low, and black cell malignancies: results of EORTC studies 58881 and 58951. medium expression level. Note expression of homeobox genes Blood. 2004 Jan 15;103(2):442-50 is restricted to presence of corresponding translocation. MacLeod RA, Nagel S, Drexler HG. BCL11B rearrangements Fusion protein probably target T-cell neoplasia rather than acute myelocytic leukemia. Cancer Genet Cytogenet. 2004 Aug;153(1):88-9 Description Su XY, Busson M, Della Valle V, Ballerini P, Dastugue N, No fusion protein, but ectopic expression of either Talmant P, Ferrando AA, Baudry-Bluteau D, Romana S, TLX3 or NKX2-5. Berger R, Bernard OA. Various types of rearrangements target Oncogenesis TLX3 locus in T-cell acute lymphoblastic leukemia. Genes Chromosomes Cancer. 2004 Nov;41(3):243-9 Due to the chromosomal translocation, transcription factor binding sites for PU.1 and HMGA1, located near Gottardo NG, Jacoby PA, Sather HN, Reaman GH, Baker DL, Kees UR. Significance of HOX11L2/TLX3 expression in 5'-TLX3/NKX2-5 (5q35) and 3'-BCL11B (14q32.2), children with T-cell acute lymphoblastic leukemia treated on respectively, are juxtaposed. PU.1 and HMGA1 Children's Cancer Group protocols. Leukemia. 2005 proteins are thus able to interact across the boundaries Sep;19(9):1705-8 of the juxtaposed regions and form enhanceosomal Nagel S, Scherr M, Kel A, Hornischer K, Crawford GE, complexes mediating transcriptional activity. Kaufmann M, Meyer C, Drexler HG, MacLeod RAF.. Inhibition Furthermore, BCL11B enhancer regions at 14q32 of TLX3 and NKX2-5 in t(5;14)(q35;q32) T-ALL after Blocking aggregate with acetylated histones recruited to open Remote 3'-BCL11B Enhancer Sequences with Matching DNA Oligos Reveals Coregulation by PU.1 and HMGA1. Blood , chromatin at DNaseI hypersensitive sites and contact 2006; 108: 2212. the nuclear matrix - a region favorable to transcription. Altogether, these data indicate the existence of potent Su X, Drabkin H, Clappier E, Morgado E, Busson M, Romana S, Soulier J, Berger R, Bernard OA, Lavau C. Transforming enhancer regions at 14q32 downstream of BCL11B potential of the T-cell acute lymphoblastic leukemia-associated responsible for homeobox gene activation in homeobox genes HOXA13, TLX1, and TLX3. Genes Chromosomes Cancer. 2006 Sep;45(9):846-55

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 386 t(5;14)(q35;q32.2) Nagel S, MacLeod RAF

Su XY, Della-Valle V, Andre-Schmutz I, Lemercier C, Radford- Nagel S, Meyer C, Quentmeier H, Kaufmann M, Drexler HG, Weiss I, Ballerini P, Lessard M, Lafage-Pochitaloff M, MacLeod RA. MEF2C is activated by multiple mechanisms in a Mugneret F, Berger R, Romana SP, Bernard OA, Penard- subset of T-acute lymphoblastic leukemia cell lines. Leukemia. Lacronique V. HOX11L2/TLX3 is transcriptionally activated 2008 Mar;22(3):600-7 through T-cell regulatory elements downstream of BCL11B as a result of the t(5;14)(q35;q32). Blood. 2006 Dec van Grotel M, Meijerink JP, van Wering ER, Langerak AW, 15;108(13):4198-201 Beverloo HB, Buijs-Gladdines JG, Burger NB, Passier M, van Lieshout EM, Kamps WA, Veerman AJ, van Noesel MM, van Grotel M, Meijerink JP, Beverloo HB, Langerak AW, Buys- Pieters R. Prognostic significance of molecular-cytogenetic Gladdines JG, Schneider P, Poulsen TS, den Boer ML, abnormalities in pediatric T-ALL is not explained by Horstmann M, Kamps WA, Veerman AJ, van Wering ER, van immunophenotypic differences. Leukemia. 2008 Noesel MM, Pieters R. The outcome of molecular-cytogenetic Jan;22(1):124-31 subgroups in pediatric T-cell acute lymphoblastic leukemia: a retrospective study of patients treated according to DCOG or Van Vlierberghe P, Homminga I, Zuurbier L, Gladdines-Buijs J, COALL protocols. Haematologica. 2006 Sep;91(9):1212-21 van Wering ER, Horstmann M, Beverloo HB, Pieters R, Meijerink JP. Cooperative genetic defects in TLX3 rearranged Nagel S, Scherr M, Kel A, Hornischer K, Crawford GE, pediatric T-ALL. Leukemia. 2008 Apr;22(4):762-70 Kaufmann M, Meyer C, Drexler HG, MacLeod RA. Activation of TLX3 and NKX2-5 in t(5;14)(q35;q32) T-cell acute This article should be referenced as such: lymphoblastic leukemia by remote 3'-BCL11B enhancers and coregulation by PU.1 and HMGA1. Cancer Res. 2007 Feb Nagel S, MacLeod RAF. t(5;14)(q35;q32.2). Atlas Genet 15;67(4):1461-71 Cytogenet Oncol Haematol. 2009; 13(5):383-387.

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 387 Atlas of Genetics and Cytogenetics

in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS

Leukaemia Section Mini Review t(8;14)(q11;q32) Jean-Loup Huret Genetics, Dept Medical Information, University of Poitiers, CHU Poitiers Hospital, F-86021 Poitiers, France (JLH)

Published in Atlas Database: May 2008 Online updated version : http://AtlasGeneticsOncology.org/Anomalies/t0814ID1112.html DOI: 10.4267/2042/44480 This article is an update of : Huret JL. t(8;14)(q11;q32). Atlas Genet Cytogenet Oncol Haematol 2005;9(3):256-258. Huret JL. t(8;14)(q11;q32). Atlas Genet Cytogenet Oncol Haematol 1999;3(4):196-197.

Identity

- 8, + der(14) t(8;14)(q11;q32) G banding (left) - Courtesy Gitte Birk Kerndrup and Steen Rosthoj; der(14) t(8;14)(q11;q32) R-banding - Courtesy Pascale Cornillet-Lefebvre and Stephanie Struski (top), and with a constitutional trisomy 21 (bottom) - Courtesy Petr Balicek, Jana Rabasova, and Jiri Hak. More iconography can be found in the Case Report section (see below). Clinics and pathology Epidemiology At least 52 cases to date (see Ref. below); the Disease t(8;14)(q11;q32) represents about 1/1 000 cases of CD10+ acute lymphoblastic leukemia (ALL) in most childhood leukemias; median age is 11 years (range 3- cases; chronic myelogenous leukemia (CML) very 49), with 10% above 20 years; unbalanced sex ratio rarely; one case of histiocyte-rich B-cell lymphoma. (29M/18F). Etiology Clinics Strikingly, more than 1/4 of cases are Down syndrome Organomegaly is not frequent, central nervous system patients. (CNS) involvement was not noted; WBC was < 50 X 10 9/l in most cases.

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 388 t(8;14)(q11;q32) Huret JL

IgH Location 14q32 Result of the chromosomal anomaly Fusion protein Oncogenesis Overexpression of the CEBP gene. To be noted Case Report A case of pre-B ALL with t(8;14)(q11;q32). A case of Down syndrome with acute lymphoblastic Prognosis leukemia and t(8;14)(q11;q32). A new case of t(8;14)(q11;q32) in an acute Prognosis is likely to be not bad, although a long lymphoblastic leukemia. follow up is missing in about half of the cases (see Figure 2). References Cytogenetics Hayata I, Sakurai M, Kakati S, Sandberg AA. Chromosomes and causation of human cancer and leukemia. XVI. Banding Cytogenetics morphological studies of chronic myelocytic leukemia, including five unusual Ph11 translocations. Cancer. 1975 Oct;36(4):1177-91 Sole (acquired) anomaly in 1/3 of cases; accompany a t(9;22)(q34;q11) in 20% of cases; unbalanced form Kardon NB, Slepowitz G, Kochen JA. Childhood acute lymphoblastic leukemia associated with an unusual 8;14 with a der(14) t(8;14) in 15% of cases, indicating that translocation. Cancer Genet Cytogenet. 1982 Aug;6(4):339-43 the crucial event is likely to lie on der(14). One case Carroll AJ, Castleberry RP, Crist WM. Lack of association was a three way translocation t(2;14;8). between abnormalities of the chromosome 9 short arm and Additional anomalies either "lymphomatous" features or T cell phenotype in childhood acute lymphocytic leukemia. Blood. 1987 t(8;14) may be found with t(9;22) (see above); t(8;14) Mar;69(3):735-8 is accompanied by an acquired (not constitutional) +21 Crist W, Carroll A, Shuster J, Jackson J, Head D, Borowitz M, in 10% of cases; +X, +8, and del(13q) are also Behm F, Link M, Steuber P, Ragab A. Philadelphia recurrently found with t(8;14). chromosome positive childhood acute lymphoblastic leukemia: clinical and cytogenetic characteristics and treatment outcome. A Pediatric Oncology Group study. Blood. 1990 Aug Genes involved and proteins 1;76(3):489-94 CEBPD Hayashi Y, Pui CH, Behm FG, Fuchs AH, Raimondi SC, Kitchingman GR, Mirro J Jr, Williams DL. 14q32 translocations Location are associated with mixed-lineage expression in childhood 8q11 acute leukemia. Blood. 1990 Jul 1;76(1):150-6 Protein Hu N, Bian ML, Le Beau MM, Rowley JD. Cytogenetic analysis DNA-binding protein. CCAAT enhancer-binding of 51 patients with chronic myeloid leukemia. Chin Med J (Engl). 1990 Oct;103(10):831-9 protein (CEBP) transcription factors are a family of 6 multifunctional basic leucine zipper (bZIP) Wodzinski MA, Watmore AE, Lilleyman JS, Potter AM. Chromosomes in childhood acute lymphoblastic leukaemia: transcription factors. The 5 other CEBPs are: CEBPA karyotypic patterns in disease subtypes. J Clin Pathol. 1991 (19q13), CEBPB (20q13), CEBPE (14q11), CEBPG Jan;44(1):48-51 (19q13), all four equally implicated in leukemias, and Pui CH, Carroll AJ, Raimondi SC, Schell MJ, Head DR, DDIT3/CHOP/CEBP zeta (12q13), so far known to be Shuster JJ, Crist WM, Borowitz MJ, Link MP, Behm FG. involved in solid tumours (liposarcoma). These Isochromosomes in childhood acute lymphoblastic leukemia: a transcription factors play a key role in cellular collaborative study of 83 cases. Blood. 1992 May differentiation, in particular in the control of myeloid 1;79(9):2384-91 differentiation. CEBPD is composed of a N-term Pui CH, Raimondi SC, Borowitz MJ, Land VJ, Behm FG, transactivation domain, a DNA-binding basic motif, Pullen DJ, Hancock ML, Shuster JJ, Steuber CP, Crist WM. and a leucine-zipper domain in C-term (Ramji et al., Immunophenotypes and karyotypes of leukemic cells in children with Down syndrome and acute lymphoblastic 2002; Nerlov et al., 2007). leukemia. J Clin Oncol. 1993 Jul;11(7):1361-7

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 389 t(8;14)(q11;q32) Huret JL

Secker-Walker LM, Hawkins JM, Prentice HG, Mackie PH, bands 13q12 to 13q14 in childhood acute lymphoblastic Heerema NA, Provisor AJ. Two Down syndrome patients with leukemia. J Clin Oncol. 2000 Nov 15;18(22):3837-44 an acquired translocation, t(8;14)(q11;q32), in early B-lineage acute lymphoblastic leukemia. Cancer Genet Cytogenet. 1993 Kaleem Z, Shuster JJ, Carroll AJ, Borowitz MJ, Pullen DJ, Oct 15;70(2):148-50 Camitta BM, Zutter MM, Watson MS. Acute lymphoblastic leukemia with an unusual t(8;14)(q11.2;q32): a Pediatric Testoni N, Zaccaria A, Martinelli G, Pelliconi S, Buzzi M, Oncology Group Study. Leukemia. 2000 Feb;14(2):238-40 Farabegoli P, Panzica G, Tura S. t(8;14)(q11;q32) in acute lymphoid leukemia: description of two cases. Cancer Genet Balicek P, Rabasova J, Hak J.. A case of Down syndrome with Cytogenet. 1993 May;67(1):55-8 acute lymphoblastic leukemia and t(8;14)(q11;q32). Atlas Genet Cytogenet Oncol Haematol. June 2001. Shearer P, Parham D, Kovnar E, Kun L, Rao B, Lobe T, Pratt C. Neurofibromatosis type I and malignancy: review of 32 Byatt SA, Cheung KL, Lillington DM, Mazzullo H, Martineau M, pediatric cases treated at a single institution. Med Pediatr Bennett C, Roberts K, Harewood L, Sumption N, Humphreys Oncol. 1994;22(2):78-83 M, Burrett J, Harrison CJ. Three further cases of t(8;14)(q11.2;q32) in acute lymphoblastic leukemia. Leukemia. Litz CE, Davies S, Brunning RD, Kueck B, Parkin JL, Gajl 2001 Aug;15(8):1304-5 Peczalska K, Arthur DC. Acute leukemia and the transient myeloproliferative disorder associated with Down syndrome: Kerndrup GB, Rosthoj S. A case of pre-B ALL with morphologic, immunophenotypic and cytogenetic t(8;14)(q11;q32). Atlas Genet Cytogenet Oncol Haematol. June manifestations. Leukemia. 1995 Sep;9(9):1432-9 2001. Schoch C, Rieder H, Stollmann-Gibbels B, Freund M, Tischler Mathew S, Rao PH, Dalton J, Downing JR, Raimondi SC. HJ, Silling-Engelhardt G, Fonatsch C. 17p anomalies in Multicolor spectral karyotyping identifies novel translocations in lymphoid malignancies: diagnostic and prognostic implications. childhood acute lymphoblastic leukemia. Leukemia. 2001 Leuk Lymphoma. 1995 Apr;17(3-4):271-9 Mar;15(3):468-72 Lee AC, Chan LC, Kwong KW. Down syndrome, acute Ramji DP, Foka P. CCAAT/enhancer-binding proteins: lymphoblastic leukemia, and t(8;14)(q11;q32) Cancer Genet structure, function and regulation. Biochem J. 2002 Aug Cytogenet. 1996 May;88(1):92 1;365(Pt 3):561-75 Sun T, Susin M, Tomao FA, Brody J, Koduru P, Hajdu SI. Moore S, Suttle J, Bain S, Story C, Rice M. Acute Histiocyte-rich B-cell lymphoma. Hum Pathol. 1997 lymphoblastic leukemia characterized by t(8;14)(q11.2;q32). Nov;28(11):1321-4 Cancer Genet Cytogenet. 2003 Feb;141(1):1-4 Forrest DL, Nevill TJ, Horsman DE, Brockington DA, Fung HC, Quilichini B, Zattara H, Casalonga F, BastideAlliez LA, Curtillet Toze CL, Conneally EA, Hogge DE, Sutherland HJ, Nantel SH, C, Fossat C, Michel G.. A new case of t(8;14)(q11;q32) in an Shepherd JD, Barnett MJ. Bone marrow transplantation for acute lymphoblastic leukemia. Atlas Genet Cytogenet Oncol adults with acute leukaemia and 11q23 chromosomal Haematol. May 2003 . abnormalities. Br J Haematol. 1998 Dec;103(3):630-8 Akasaka T, Balasas T, Russell LJ, Sugimoto KJ, Majid A, Whitehead VM, Vuchich MJ, Cooley LD, Lauer SJ, Mahoney Walewska R, Karran EL, Brown DG, Cain K, Harder L, Gesk S, DH, Shuster JJ, Payment C, Koch PA, Akabutu JJ, Bowen T, Martin-Subero JI, Atherton MG, Brüggemann M, Calasanz MJ, Kamen BA, Ravindranath Y, Emami A, Look AT, Beardsley Davies T, Haas OA, Hagemeijer A, Kempski H, Lessard M, GP, Pullen DJ, Camitta B. Accumulation of methotrexate Lillington DM, Moore S, Nguyen-Khac F, Radford-Weiss I, polyglutamates, ploidy and trisomies of both chromosomes 4 Schoch C, Struski S, Talley P, Welham MJ, Worley H, Strefford and 10 in lymphoblasts from children with B-progenitor cell JC, Harrison CJ, Siebert R, Dyer MJ. Five members of the acute lymphoblastic leukemia: a Pediatric Oncology Group CEBP transcription factor family are targeted by recurrent IGH Study. Leuk Lymphoma. 1998 Nov;31(5-6):507-19 translocations in B-cell precursor acute lymphoblastic leukemia (BCP-ALL). Blood. 2007 Apr 15;109(8):3451-61 Andreasson P, Höglund M, Békássy AN, Garwicz S, Heldrup J, Mitelman F, Johansson B. Cytogenetic and FISH studies of a Nerlov C. The C/EBP family of transcription factors: a single center consecutive series of 152 childhood acute paradigm for interaction between gene expression and lymphoblastic leukemias. Eur J Haematol. 2000 Jul;65(1):40- proliferation control. Trends Cell Biol. 2007 Jul;17(7):318-24 51 This article should be referenced as such: Heerema NA, Sather HN, Sensel MG, Lee MK, Hutchinson RJ, Nachman JB, Reaman GH, Lange BJ, Steinherz PG, Bostrom Huret JL. t(8;14)(q11;q32). Atlas Genet Cytogenet Oncol BC, Gaynon PS, Uckun FM. Abnormalities of chromosome Haematol. 2009; 13(5):388-390.

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 390 Atlas of Genetics and Cytogenetics

in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS

Solid Tumour Section Mini Review

Liver tumors: an overview Munechika Enjoji Department of Clinical Pharmacology, Faculty of Pharmaceutical Sciences, Fukuoka University, 8-19-1 Nanakuma, Johnan-ku, Fukuoka 814-0180, Japan (ME)

Published in Atlas Database: May 2008 Online updated version : http://AtlasGeneticsOncology.org/Tumors/LiverOverviewID5273.html DOI: 10.4267/2042/44481 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2009 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Classification Others Hematopoietic and lymphoid tumors WHO histological classification of the liver and Secondary tumors intrahepatic bile ducts. Epithelial abnormalities Epithelial tumors Liver cell dysplasia Benign: Dysplastic nodules Hepatocellular adenoma Bile duct abnormalities Focal nodular hyperplasia Intrahepatic bile duct adenoma Miscellaneous lesions Intrahepatic bile duct cystadenoma Mesenchymal hamartoma Biliary papillomatosis Nodular transformation Malignant: Inflammatory pseudotumor Hepatocellular carcinoma Intrahepatic cholangiocarcinoma Clinics and pathology Bile duct cystadenocarcinoma Combined hepatocellular and Disease cholangiocarcinoma Benign tumors Hepatoblastoma Hepatic hemangioma: Hemangioma is the most Undifferentiated carcinoma common benign tumor of the liver and is more frequent Non-epithelial tumors in women. Many cases are discovered incidentally and Benign: the reported incidence is 2-20%. Tumor size may be Angiomyolipoma associated with pregnancy and estrogen levels. Hepatic Lymphangioma and lymphangiomatosis hemangioma is usually asymptomatic, and rarely grows Hemangioma or bleeds. Surgical excision is required in some Infantile hemangioendothelioma symptomatic cases. No genetic alterations heave been Malignant: reported. Epithelioid hemangioendothelioma Focal nodular hyperplasia (FNH): FNH is the second Angiosarcoma most frequent benign tumor of the liver and occurs Embryonal sarcoma mainly in women (80-90%). In a hyperplastic lesion, all Rhabdomyosarcoma of the normal liver constituents are present but in an Others abnormally organized pattern. Underlying congenital arteriovenous malformation, oral contraceptives, and Miscellaneous tumors some medicines such as azathioprine are considered to Solitary fibrous tumor be pathogenic factors. FNH has no malignant potential Teratoma but a combination of various imaging techniques may York sac tumor be needed for correct diagnosis. FNHs exhibit few Carcinosarcoma chromosomal abnormalities. Strong immunostaining of Rhabdoid tumor

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 391 Liver tumors: an overview Enjoji M

ras oncogene p21 has been reported and epithelial cells altered expression of bcl-2 and human Mut S of the ductular proliferation were bcl-2-positive. homologue-2 (hMSH2) proteins was observed during Hepatocellular adenoma: Adenomas occur almost hepatocarcinogenesis. c-erbB-2 oncopeptide was exclusively in younger women. Evidence is immunohistochemically detected in HCCs although the accumulating that the intake of oral contraceptives is percentage of samples positive for c-erbB-2 was low. associated with the occurrence of hepatocellular Intrahepatic cholangiocarcinoma: Intrahepatic adenoma. Most are asymptomatic and found by chance cholangiocarcinoma (CC), the second most prevalent at the time of a scan. Prognosis is relatively good. intrahepatic primary cancer, arises from the Occasionally, hepatocellular adenomas can be intrahepatic bile duct epithelium. It occurs primarily in complicated by bleeding either spontaneously or the middle-aged and elderly patients with no obvious following trauma. The risk of evolution to sex differences. Its incidence varies widely between hepatocellular carcinoma is small. Hepatic adenomas geographic regions: the highest incidence is reported in exhibit few chromosomal abnormalities. In one study, Southeast Asia. Opisthorchis viverrini-induced CCs are nuclear accumulation of β-catenin was reported in 46% common in Thailand. Liver fluke infection, of hepatic adenomas, which indicates activation of the carcinogenic nitroso-compounds, hepatolithiasis, and Wnt signaling pathway. In another report, truncated primary sclerosing cholangitis are high-risk factors for forms of β-catenin were detected. Uneven and intrahepatic CC. CA19-9, CEA, and CA125 are well relatively weak p21 reactions were noted in hepatic studied as tumor-associated markers. In intrahepatic adenomas. CCs, loss of heterozygosity (LOH) at chromosomal loci Angiomyolipoma: Angiomyolipoma is a relatively rare 3p13-p21, 5q35-qter, 8p22, 17p13, and 18q has been tumor and is composed of fatty cells, blood vessels, and reported. The reported mutation rates of K-ras, which is smooth muscle cells in varying proportions. Thick- converted to an active oncogene by point mutations, in walled blood vessels are usually arranged in an island- intrahepatic CCs vary widely; for example, a mutation like formation. Malignant degeneration has not been rate of 50-56% has been reported in Japanese patients reported. In one report, of 15 hepatic angiomyolipoma versus 0-8% in Thai patients. Inactivation of p53 by samples tested, all were KIT (CD117), transmembrane mis-sense or non-sense mutations and by loss of growth factor receptor, positive. chromosome 17p induces disruption of critical growth- Bile duct cystadenoma: Hepatic cystadenoma is a rare regulating mechanisms and may have a crucial role in multilocular cystic tumor probably occurs as a result of carcinogenesis. It has been reported that the p53 congenital bile duct malformations. It is seen more mutation and loss of chromosome 17p was present in frequently in women and usually arises from ducts near 11-37% and 38% of intrahepatic CCs, respectively. the hilum of the liver. Owing to its trend towards Alterations of the tumor suppressor gene, p16INK4A, malignant degeneration, surgical resection may be were found to be frequent in a study of intrahepatic recommended. No cytogenetic alterations have been CCs. Therefore, the p16 gene may be crucial for reported. intrahepatic biliary carcinogenesis and progression. Malignant tumors Amplification and overexpression of proto-oncogene c- Hepatocellular carcinoma (HCC): HCC is the most erbB-2 are frequently seen in cancers of the biliary frequently observed and clinically important primary tract. hepatic neoplasm. It occurs more commonly in men Combined hepatocellular and cholangiocarcinoma: than women and its geographical distribution varies Combined hepatocellular and cholangiocarcinoma considerably. In areas with high incidence, chronic (combined tumors) is a more aggressive malignancy infection with HBV or HCV is a well-known with a poorer prognosis than ordinary HCC. Its underlying cause. A frequent association with chronic reported frequency varies widely; but a rate of 1.0- liver disease/cirrhosis has also been reported. a- 6.5% has been observed among patients with primary fetoprotein and PIVKA-II are the most commonly used liver cancer. Statistically, combined tumors occur tumor-associated markers. It has been reported that predominantly in men, with a mean age of onset in the chromosomal aberrations on 1p, 6q, 8p/q, and 13p sixth decade. In Asian cases, a high incidence of HBV occur almost exclusively in HCCs. Overexpression of or HCV infection and frequent association of cirrhosis c-myc oncogene and a-prothymosin was also reported. have been reported. LOH at 4q, 8p, 13q, 16q, and 17p An uneven and comparatively weak ras p21 is frequently seen in combined tumors similar to that in immunohistochemical reaction was noted in HCC. The HCC. LOH at 3p and 14q are reported to be specific in frequency of p53 mutations varies among different CCs and combined tumors in contrast to HCCs. geographic areas. In recent reports, expression of Mutations of the K-ras gene have been reported to be nuclear Jun activation binding protein 1 (Jab1) was common in CC but rarely in HCC. The reported observed in 57% of HCCs, and MDM mutations and incidence of p53 mutation is 10-29% in combined GAGE-1, GAGE-2 expression were also commonly tumors. observed in HCC specimens. In an Hepatoblastoma: Hepatoblastoma, the most common immunohistochemical evaluation of HCC specimens, hepatic tumor in children, is arises in the endodermal

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 392 Liver tumors: an overview Enjoji M

liver epithelium and displays various histological Schlott T, Ahrens K, Ruschenburg I, Reimer S, Hartmann H, patterns. The incidence is twice as high in boys than Droese M. Different gene expression of MDM2, GAGE-1, -2 and FHIT in hepatocellular carcinoma and focal nodular girls. Key markers include elevation or non-decreasing hyperplasia. Br J Cancer. 1999 Apr;80(1-2):73-8 expression of a-fetoprotein, hepatomegaly, and weight Fujii H, Zhu XG, Matsumoto T, Inagaki M, Tokusashi Y, loss. It is strongly associated with familial adenomatous Miyokawa N, Fukusato T, Uekusa T, Takagaki T, Kadowaki N, polyposis probably owing to altered expression of the Shirai T. Genetic classification of combined hepatocellular- adenomatous polyposis coli (APC) gene. The most cholangiocarcinoma. Hum Pathol. 2000 Sep;31(9):1011-7 common genetic aberrations are extra copies of Hirohashi S, et al.. Tumors of the liver and intrahepatic bile chromosomes 1q, 2q, 4q, 7q, 8, 17q, and 20, and LOH ducts. in "WHO classification tumors of the digestive system" for 11p. It has been reported that p53 mutations Hamilton SR and Aaltonen LA (2000) Eds. The IARC Press. contribute to hepatoblastoma. REVIEW Bile duct cystadenocarcinoma: Hepatic Tannapfel A, Benicke M, Katalinic A, Uhlmann D, Köckerling F, cystadenocarcinoma is a rare multilocular tumor Hauss J, Wittekind C. Frequency of p16(INK4A) alterations containing mucinous fluid. However, it is uncertain and K-ras mutations in intrahepatic cholangiocarcinoma of the liver. Gut. 2000 Nov;47(5):721-7 whether the incidence differs between sexes. After curative resection, the prognosis is good. In an Cong WM, Bakker A, Swalsky PA, Raja S, Woods J, Thomas S, Demetris AJ, Finkelstein SD. Multiple genetic alterations immunohistochemical study of hepatic involved in the tumorigenesis of human cholangiocarcinoma: a cystadenocarcinomas, p53, c-erbB-2, and bcl-2 were molecular genetic and clinicopathological study. J Cancer Res focally expressed in the tumor epithelium. Clin Oncol. 2001;127(3):187-92 Chen YW, Jeng YM, Yeh SH, Chen PJ. P53 gene and Wnt References signaling in benign neoplasms: beta-catenin mutations in hepatic adenoma but not in focal nodular hyperplasia. Radosevich JA, Gould KA, Koukoulis GK, Haines GK, Rosen Hepatology. 2002 Oct;36(4 Pt 1):927-35 ST, Lee I, Gould VE. Immunolocalization of ras oncogene p21 in human liver diseases. Ultrastruct Pathol. 1993 Jan- Makhlouf HR, Remotti HE, Ishak KG. Expression of KIT Feb;17(1):1-8 (CD117) in angiomyolipoma. Am J Surg Pathol. 2002 Apr;26(4):493-7 Charlotte F, L'Herminé A, Martin N, Geleyn Y, Nollet M, Gaulard P, Zafrani ES. Immunohistochemical detection of bcl-2 Torbenson M, Lee JH, Choti M, Gage W, Abraham SC, protein in normal and pathological human liver. Am J Pathol. Montgomery E, Boitnott J, Wu TT. Hepatic adenomas: analysis 1994 Mar;144(3):460-5 of sex steroid receptor status and the Wnt signaling pathway. Mod Pathol. 2002 Mar;15(3):189-96 Watanabe M, Asaka M, Tanaka J, Kurosawa M, Kasai M, Miyazaki T. Point mutation of K-ras gene codon 12 in biliary Altimari A, Fiorentino M, Gabusi E, Gruppioni E, Corti B, tract tumors. Gastroenterology. 1994 Oct;107(4):1147-53 D'Errico A, Grigioni WF. Investigation of ErbB1 and ErbB2 expression for therapeutic targeting in primary liver tumours. Yoshida S, Todoroki T, Ichikawa Y, Hanai S, Suzuki H, Hori M, Dig Liver Dis. 2003 May;35(5):332-8 Fukao K, Miwa M, Uchida K. Mutations of p16Ink4/CDKN2 and p15Ink4B/MTS2 genes in biliary tract cancers. Cancer Res. Schnater JM, Köhler SE, Lamers WH, von Schweinitz D, 1995 Jul 1;55(13):2756-60 Aronson DC. Where do we stand with hepatoblastoma? A review. Cancer. 2003 Aug 15;98(4):668-78 Imai Y, Oda H, Arai M, Shimizu S, Nakatsuru Y, Inoue T, Ishikawa T. Mutational analysis of the p53 and K-ras genes Terracciano L, Tornillo L. Cytogenetic alterations in liver cell and allelotype study of the Rb-1 gene for investigating the tumors as detected by comparative genomic hybridization. pathogenesis of combined hapatocellular-cholangiocellular Pathologica. 2003 Apr;95(2):71-82 carcinomas. Jpn J Cancer Res. 1996 Oct;87(10):1056-62 Cazals-Hatem D, Rebouissou S, Bioulac-Sage P, Bluteau O, Weihing RR, Shintaku IP, Geller SA, Petrovic LM. Blanché H, Franco D, Monges G, Belghiti J, Sa Cunha A, Hepatobiliary and pancreatic mucinous cystadenocarcinomas Laurent-Puig P, Degott C, Zucman-Rossi J. Clinical and with mesenchymal stroma: analysis of estrogen molecular analysis of combined hepatocellular- receptors/progesterone receptors and expression of tumor- cholangiocarcinomas. J Hepatol. 2004 Aug;41(2):292-8 associated antigens. Mod Pathol. 1997 Apr;10(4):372-9 Hussein MR. Alterations of p53, Bcl-2, and hMSH2 protein Wu CG, Habib NA, Mitry RR, Reitsma PH, van Deventer SJ, expression in the cirrhotic, macroregenerative, dysplastic Chamuleau RA. Overexpression of hepatic prothymosin alpha, nodules and hepatocellular carcinomas in Upper Egypt. Liver a novel marker for human hepatocellular carcinoma. Br J Int. 2004 Dec;24(6):552-60 Cancer. 1997;76(9):1199-204 Raidl M, Pirker C, Schulte-Hermann R, Aubele M, Kandioler- Shrestha ML, Miyake H, Kikutsuji T, Tashiro S. Prognostic Eckersberger D, Wrba F, Micksche M, Berger W, Grasl-Kraupp significance of Ki-67 and p53 antigen expression in carcinomas B. Multiple chromosomal abnormalities in human liver of bile duct and gallbladder. J Med Invest. 1998 Aug;45(1- (pre)neoplasia. J Hepatol. 2004 Apr;40(4):660-8 4):95-102 Nagata T, Nakamura M, Shichino H, Chin M, Sugito K, Ikeda Terada T, Ashida K, Endo K, Horie S, Maeta H, Matsunaga Y, T, Koshinaga T, Fukuzawa M, Inoue M, Mugishima H. Takashima K, Ohta T, Kitamura Y. c-erbB-2 protein is Cytogenetic abnormalities in hepatoblastoma: report of two expressed in hepatolithiasis and cholangiocarcinoma. new cases and review of the literature suggesting imbalance of Histopathology. 1998 Oct;33(4):325-31 chromosomal regions on chromosomes 1, 4, and 12. Cancer Genet Cytogenet. 2005 Jan 1;156(1):8-13 Kang YK, Kim WH, Lee HW, Lee HK, Kim YI. Mutation of p53 and K-ras, and loss of heterozygosity of APC in intrahepatic Aishima S, Kuroda Y, Asayama Y, Taguchi K, Nishihara Y, cholangiocarcinoma. Lab Invest. 1999 Apr;79(4):477-83 Taketomi A, Tsuneyoshi M. Prognostic impact of

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 393 Liver tumors: an overview Enjoji M

cholangiocellular and sarcomatous components in combined hepatocellular carcinoma. Hum Pathol. 2007 Nov;38(11):1621- hepatocellular and cholangiocarcinoma. Hum Pathol. 2006 7 Mar;37(3):283-91 Curia MC, Zuckermann M, De Lellis L, Catalano T, Lattanzio Patel T. Cholangiocarcinoma. Nat Clin Pract Gastroenterol R, Aceto G, Veschi S, Cama A, Otte JB, Piantelli M, Mariani- Hepatol. 2006 Jan;3(1):33-42 Costantini R, Cetta F, Battista P. Sporadic childhood hepatoblastomas show activation of beta-catenin, mismatch Tischoff I, Wittekind C, Tannapfel A. Role of epigenetic repair defects and p53 mutations. Mod Pathol. 2008 alterations in cholangiocarcinoma. J Hepatobiliary Pancreat Jan;21(1):7-14 Surg. 2006;13(4):274-9 Berg JP, Zhou Q, Breuhahn K, Schirmacher P, Patil MA, Chen This article should be referenced as such: X, Schäfer N, Höller TT, Fischer HP, Büttner R, Gütgemann I. Enjoji M. Liver tumors: an overview. Atlas Genet Cytogenet Inverse expression of Jun activation domain binding protein 1 Oncol Haematol. 2009; 13(5):391-394. and cell cycle inhibitor p27Kip1: influence on proliferation in

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 394 Atlas of Genetics and Cytogenetics

in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS

Cancer Prone Disease Section Review

McCune Albright syndrome Margaret Zacharin The Royal Children's Hospital, Parkville, Victoria 3052, Australia (MZ)

Published in Atlas Database: May 2008 Online updated version : http://AtlasGeneticsOncology.org/Kprones/McCuneAlbrightID10093.html DOI: 10.4267/2042/44482 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2009 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Fibrous dysplasia is the characteristic lesion seen in Identity MAS, the bone lesion being of marrow stromal cells of Note osteogenic lineage, with increasing cyclic AMP up McCune Albright syndrome is characterized by the regulating osteogenic cells to osteoblasts within the triad of polyostotic fibrous dysplasia, pigmentary skin fibrous dysplastic cells, compared to normal woven lesions and endocrinopathy. bone. Cartilaginous islands with woven bone and immature mesenchymal cells are found in the lesions, Inheritance with resultant increased bone fragility in affected areas. MAS is not inherited. It is a sporadic genetic disorder, Lesions may be polyostotic, panostotic or monostotic, caused by a mutation in the GNAS gene encoding the with increased risk for long bone fractures, shepherd's alpha subunit of the stimulatory G protein (GSalpha), crook deformity of proximal long bones and spinal cyclic AMP protein kinase dependent cellular signaling compression fractures. Osteomalacia complicates 50% pathway involving G protein coupled receptors. An of fibrous dysplasia bone lesions, due to increased arginine or occasionally serine, leucine or glycine to FGF23 activity resulting in phosphaturia. histidine transposition at residue 201 attenuates GTpase Café au lait marks with a coast of Maine appearance activity. This results in constitutive activation of follow a dermatomal distribution along the lines of adenylyl cyclase. Blaschko. The activating GSalpha mutation in skin The somatic mutation occurs in early embryogenesis, involves tyrosinase gene activation in affected resulting in widespread tissue distribution of melanocytes. Similar pigmentation is seen in oral abnormalities. The post zygotic mutation is responsible mucosa. for the mosaic pattern of tissue distribution and the Endocrinopathies extreme variability of clinical changes, varying from The endocrine events most commonly seen are multi system disease to almost unrecognized disorders gonadotrophin independent precocious puberty, with single organ involvement. thyrotoxicosis and Cushing syndrome. Increased adenylate cyclase activity in bone from Gonadotrophin independent precocious puberty in clinical fibrous dysplastic lesions is caused by girls is seen in at least 30%, presenting with premature expression of Cfos proto-oncogene in bone. Recent thelarche. Progress is often intermittent and identification of increased fibroblast growth factor characterized by suppressed gonadotrophins and (FGF23) activity in fibrous dysplastic lesions has elevated oestrogen levels, confirming the ovarian linked the bony abnormalities to a recognized marker source of the disorder. Ovarian cysts are commonly of bone metabolism. seen. Continuous oestrogen production may result in long term continuing menstrual abnormalities and Clinics infertility. Phenotype and clinics Male precocious puberty is less common, seen in 15%. Macro-orchidism without precocity is more The phenotype of MAS is extremely varied, ranging common and may be unilateral or bilateral, often with from multisystem disease, to minimal single organs excess Sertoli cell hyperactivity. Testicular being affected. microlithiasis is present in 62% compared with a normal population microlithiasis rate of 5%.

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 395 McCune Albright syndrome Zacharin M

Thyroid disease has been described in association with reduce bone pain and bone turnover. Overall impact on nodular and diffuse goitres, single toxic adenoma and the course of the disease is unclear, with minimal hyperthyroidism with T3 toxicosis, with an overall reduction in long term fracture risk and variable reports prevalence of 30%. Thyroid cancer has only rarely of possible reduction in lesional size in adults. been described. Clinical difficulty in detection of Bisphosphonate use in children has not been shown to hyperthyroidism in the presence of a hyperdynamic arrest uncontrolled expansion of dysplastic lesions in circulation due to polyostotic fibrous dysplasia is long bones or to change histomorphology in treated significant, with biochemical evaluation prior to children or adolescents. Dental extractions and surgery suggested to reduce the risk of thyroid storm. restorations do not exacerbate FD lesions. Surgical Acromegaly is reported in up to 21% of affected interventions using a combined approach, involving patients, the pattern of disease varying from the medullary rodding and bisphosphonate have been common isolated form and often being co-secretory shown to improve surgical outcomes.Optic canal without adenoma formation. GS alpha mutations in decompression in fibrous dysplasia of the sphenoid these lesions have been demonstrated on the maternal should be confined to surgical intervention for allele. uncontrolled compression of visual or other nerve Cushing syndrome Macro nodular adrenocortical pathways. hyperplasia is the typical feature, with various Precocious puberty in girls . Treatment is complex outcomes reported, from spontaneous resolution to a with escape from effect of aromatase inhibitors. severe neonatal presentation. Selective oestrogen receptor modulators have been Upper gastrointestinal polyps are now identified in reported to be effective but with similar escape association with MAS, with the typical hamartomatous phenomena. Secondary activation of the hypothalamic appearance similar to Peutz Jegher syndrome polyps. pituitary ovarian axis in response to persistent These may be in association with oral melanotic oestrogen exposure may require addition of GRNH pigmentation or independent of pigmentary changes. analogue. Surgery for removal of a cystic ovary or Overlap in clinical features between disorders laparoscopic cystectomy has been occasionally associated with multiple endocrine disease such as effective. Oophorectomy is not recommended as Carney complex and Peutz Jegher syndrome is evident. fertility is potentially normal. Phosphaturia with associated hypophosphataemia may Precocious puberty in boys . Aromatase inhibitors or require oral phosphate and calcitriol. No outcome data androgen blockade have been utilized with variable has been reported. Surgical removal of FD lesions has outcome. GNRH analogues may be required for been observed to decrease phosphate wasting. secondary activation of the hypothalamic pituitary axis. Neoplastic risk Acromegaly . Management is difficult due to lack of a discrete lesion, limited access due to sphenoid wing Café au lait skin lesions are benign fibrous dysplasia and radiation risk to dysplastic areas. Fibrous dysplastic lesions can undergo malignant Somatostatin and dopamine agonists have been used sarcomatous transformation, most commonly in cranio- with variable outcomes. facial bones. Other rare sarcomas include angiosarcoma, liposclerosing myxoma and Prognosis chondrosarcoma. Of those patients who have developed Morbidity is most commonly related to complications sarcoma within FD lesions, 46% had received prior of polyostotic fibrous dysplasia and the need for radiation treatment in the affected field (for orthopaedic intervention. acromegaly).NB Increased sensitivity of FD lesions to Multiple lower limb fractures and bilateral hip metaplasia after radiation has cause for concern for shepherd's crook deformity frequently result in limited treatment planning strategies locomotion in adulthood, for severely affected Thyroid cancer has only rarely been reported. individuals. Endocrinopathies are amenable to Testicular Sertoli and Leydig cell tumours have both intervention, but management strategies are limited by been described, but are rare. effectiveness of medical interventions and radiation Ovarian hyperfunction is associated with ovarian related risk. Excess mortality risk is related to cysts but are benign. Long term excess oestrogen malignancy risk and occasionally to high output cardiac secretion might increase the risk for breast cancer, failure or cardiomyopathy. particularly in the presence of growth hormone excess. Growth hormone excess with acromegaly is benign Genes involved and proteins but care is required with treatment planning strategies in view of excess radiation risk in an area affected with GNAS fibrous dysplasia. Alias Treatment gsp oncogene Fibrous dysplasia can be treated with Location bisphosphonates. These drugs are well tolerated and 20q13

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 396 McCune Albright syndrome Zacharin M

Note gonadotropins. A unique mechanism of sexual development. N Mutations of gsp are readily identified in lesional tissue Engl J Med. 1985 Jan 10;312(2):65-72 from affected individuals with enhanced detection by Laue L, Kenigsberg D, Pescovitz OH, Hench KD, Barnes KM, multiple rounds of nested PCR and by including a Loriaux DL, Cutler GB Jr. Treatment of familial male precocious puberty with spironolactone and testolactone. N peptide nucleic acid (PNA) in the PCR to block Engl J Med. 1989 Feb 23;320(8):496-502 amplification of wild type GNAS targets. Peripheral Blood gsp detection is similarly enhanced, Weinstein LS, Shenker A, Gejman PV, Merino MJ, Friedman E, Spiegel AM. Activating mutations of the stimulatory G using PNA clamping. protein in the McCune-Albright syndrome. N Engl J Med. 1991 Protein expression: The GNAS locus is under complex Dec 12;325(24):1688-95 imprinting control. GNAS encodes GS alpha expressed Yoshimoto M, Nakayama M, Baba T, Uehara Y, Niikawa N, Ito from maternal and paternal alleles in most tissues, with M, Tsuji Y. A case of neonatal McCune-Albright syndrome with preferential expression of the maternal allele in kidney, Cushing syndrome and hyperthyroidism. Acta Paediatr Scand. thyroid and pituitary somatotrophs. Transcripts 1991 Oct;80(10):984-7 upstream from Exon 1 are expressed only from the Lawless ST, Reeves G, Bowen JR. The development of thyroid paternal allele. storm in a child with McCune-Albright syndrome after Other transcripts 38 kb upstream from exon 1 encode 2 orthopedic surgery. Am J Dis Child. 1992 Sep;146(9):1099-102 proteins, XLalphas and ALEX and a transcript 52 kb Schwindinger WF, Francomano CA, Levine MA. Identification upstream of exon 1, encode distinct proteins that may of a mutation in the gene encoding the alpha subunit of the stimulatory G protein of adenylyl cyclase in McCune-Albright affect signal transduction. The latter is expressed syndrome. Proc Natl Acad Sci U S A. 1992 Jun 1;89(11):5152- exclusively from the maternal allele, encoding a 6 neurosecretory protein, NESP55. Case records of the Massachusetts General Hospital. Weekly Gsalpha expression from the maternal allele will result clinicopathological exercises. Case 7-1993. A six-year-old boy in pathophysiological abnormality in tissues where that with multiple bone lesions, repeated fractures, and sexual allele is expressed, but paternally expressed GNAS precocity. N Engl J Med. 1993 Feb 18;328(7):496-502 alleles may also result in endocrine dysfunction. Feuillan PP, Jones J, Cutler GB Jr. Long-term testolactone Imprinting suppressing expression of paternal GNAS therapy for precocious puberty in girls with the McCune- allele in some patients may result in a more severe Albright syndrome. J Clin Endocrinol Metab. 1993 phenotype. Sep;77(3):647-51 Mutations occurring later in embryogenesis are likely Boston BA, Mandel S, LaFranchi S, Bliziotes M. Activating to give rise to fewer mutant cells and a milder mutation in the stimulatory guanine nucleotide-binding protein in an infant with Cushing's syndrome and nodular adrenal phenotype. hyperplasia. J Clin Endocrinol Metab. 1994 Sep;79(3):890-3 Michiels FM, Caillou B, Talbot M, Dessarps-Freichey F, References Maunoury MT, Schlumberger M, Mercken L, et al. Oncogenic Bajpai A, Zacharin M. Gastrointestinal polyps in McCune potential of guanine nucleotide stimulatory factor alpha subunit Albright syndrome: Expanding the spectrum of a well known in thyroid glands of transgenic mice. Proc Natl Acad Sci U S A. disorder Submitted for publication 1994 Oct 25;91(22):10488-92 PRAY LG. Sexual precocity in females; report of two cases, Shenker A, Weinstein LS, Sweet DE, Spiegel AM. An with arrest of precocity in the McCune-Albright syndrome after activating Gs alpha mutation is present in fibrous dysplasia of removal of a cystic ovary. Pediatrics. 1951 Nov;8(5):684-92 bone in the McCune-Albright syndrome. J Clin Endocrinol Metab. 1994 Sep;79(3):750-5 GORLIN RJ, CHAUDHRY AP. Oral melanotic pigmentation in polyostotic fibrous dysplasia, Albright's syndrome. Oral Surg Candeliere GA, Glorieux FH, Prud'homme J, St-Arnaud R. Oral Med Oral Pathol. 1957 Aug;10(8):857-62 Increased expression of the c-fos proto-oncogene in bone from patients with fibrous dysplasia. N Engl J Med. 1995 Jun Bowerman JE. Polyostotic fibrous dysplasia with oral melanotic 8;332(23):1546-51 pigmentation. Br J Oral Surg. 1969 Mar;6(3):188-91 Ringel MD, Schwindinger WF, Levine MA. Clinical implications Danon M, Robboy SJ, Kim S, Scully R, Crawford JD. Cushing of genetic defects in G proteins. The molecular basis of syndrome, sexual precocity, and polyostotic fibrous dysplasia McCune-Albright syndrome and Albright hereditary (Albright syndrome) in infancy. J Pediatr. 1975 Dec;87(6 Pt osteodystrophy. Medicine (Baltimore). 1996 Jul;75(4):171-84 1):917-21 Yamamoto T, Ozono K, Kasayama S, Yoh K, Hiroshima K, Dent CE, Gertner JM. Hypophosphataemic osteomalacia in Takagi M, Matsumoto S, Michigami T, Yamaoka K, Kishimoto fibrous dysplasia. Q J Med. 1976 Jul;45(179):411-20 T, Okada S. Increased IL-6-production by cells isolated from the fibrous bone dysplasia tissues in patients with McCune- Joishy SK, Morrow LB. McCune-Albright syndrome associated Albright syndrome. J Clin Invest. 1996 Jul 1;98(1):30-5 with a functioning pituitary chromophobe adenoma. J Pediatr. 1976 Jul;89(1):73-5 Riminucci M, Fisher LW, Shenker A, Spiegel AM, Bianco P, Gehron Robey P. Fibrous dysplasia of bone in the McCune- Foster CM, Ross JL, Shawker T, Pescovitz OH, Loriaux DL, Albright syndrome: abnormalities in bone formation. Am J Cutler GB Jr, Comite F. Absence of pubertal gonadotropin Pathol. 1997 Dec;151(6):1587-600 secretion in girls with McCune-Albright syndrome. J Clin Endocrinol Metab. 1984 Jun;58(6):1161-5 Hayward BE, Kamiya M, Strain L, Moran V, Campbell R, Hayashizaki Y, Bonthron DT. The human GNAS1 gene is Wierman ME, Beardsworth DE, Mansfield MJ, Badger TM, imprinted and encodes distinct paternally and biallelically Crawford JD, Crigler JF Jr, Bode HH, et al. Puberty without

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 397 McCune Albright syndrome Zacharin M

expressed G proteins. Proc Natl Acad Sci U S A. 1998 Aug Collins MT, Sarlis NJ, Merino MJ, Monroe J, Crawford SE, 18;95(17):10038-43 Krakoff JA, Guthrie LC, Bonat S, Robey PG, Shenker A. Thyroid carcinoma in the McCune-Albright syndrome: Kim IS, Kim ER, Nam HJ, Chin MO, Moon YH, Oh MR, Yeo contributory role of activating Gs alpha mutations. J Clin UC, Song SM, Kim JS, Uhm MR, Beck NS, Jin DK. Activating Endocrinol Metab. 2003 Sep;88(9):4413-7 mutation of GS alpha in McCune-Albright syndrome causes skin pigmentation by tyrosinase gene activation on affected Fragoso MC, Domenice S, Latronico AC, Martin RM, Pereira melanocytes. Horm Res. 1999;52(5):235-40 MA, Zerbini MC, Lucon AM, Mendonca BB. Cushing's syndrome secondary to adrenocorticotropin-independent Kirk JM, Brain CE, Carson DJ, Hyde JC, Grant DB. Cushing's macronodular adrenocortical hyperplasia due to activating syndrome caused by nodular adrenal hyperplasia in children mutations of GNAS1 gene. J Clin Endocrinol Metab. 2003 with McCune-Albright syndrome. J Pediatr. 1999 May;88(5):2147-51 Jun;134(6):789-92 Matsuba A, Ogose A, Tokunaga K, Kawashima H, Hotta T, Bianco P, Riminucci M, Majolagbe A, Kuznetsov SA, Collins Urakawa S, Umezu H, Higuchi T, Endo N. Activating Gs alpha MT, Mankani MH, Corsi A, Bone HG, et al. Mutations of the mutation at the Arg201 codon in liposclerosing myxofibrous GNAS1 gene, stromal cell dysfunction, and osteomalacic tumor. Hum Pathol. 2003 Nov;34(11):1204-9 changes in non-McCune-Albright fibrous dysplasia of bone. J Bone Miner Res. 2000 Jan;15(1):120-8 Plotkin H, Rauch F, Zeitlin L, Munns C, Travers R, Glorieux FH. Effect of pamidronate treatment in children with polyostotic Cast JE, Nelson WM, Early AS, Biyani S, Cooksey G, Warnock fibrous dysplasia of bone. J Clin Endocrinol Metab. 2003 NG, Breen DJ. Testicular microlithiasis: prevalence and tumor Oct;88(10):4569-75 risk in a population referred for scrotal sonography. AJR Am J Roentgenol. 2000 Dec;175(6):1703-6 Huston TL, Simmons RM. Ductal carcinoma in situ in a 27- year-old woman with McCune-Albright syndrome. Breast J. Chapurlat RD, Meunier PJ. Fibrous dysplasia of bone. 2004 Sep-Oct;10(5):440-2 Baillieres Best Pract Res Clin Rheumatol. 2000 Jun;14(2):385- 98 Leet AI, Chebli C, Kushner H, Chen CC, Kelly MH, Brillante BA, Robey PG, Bianco P, Wientroub S, Collins MT. Fracture Collins MT, Shenker A. MCune Albright syndrome: new incidence in polyostotic fibrous dysplasia and the McCune- insights. Curr Opin Endocrinol Diabetes 2000; 6: 119-125. Albright syndrome. J Bone Miner Res. 2004 Apr;19(4):571-7 Coutant R, Lumbroso S, Rey R, Lahlou N, Venara M, Rouleau Matarazzo P, Lala R, Andreo M, Einaudi S, Altare F, Viora E, S, Sultan C, Limal JM. Macroorchidism due to autonomous Buzi F, De Luca F, De Sanctis V, Rigon F, Wasniewska M, de hyperfunction of Sertoli cells and G(s)alpha gene mutation: an Sanctis L, de Sanctis C. McCune-Albright syndrome: unusual expression of McCune-Albright syndrome in a persistence of autonomous ovarian hyperfunction during prepubertal boy. J Clin Endocrinol Metab. 2001 adolescence and early adult age. J Pediatr Endocrinol Metab. Apr;86(4):1778-81 2006 May;19 Suppl 2:607-17 Laven JS, Lumbroso S, Sultan C, Fauser BC. Dynamics of Metzler M, Luedecke DK, Saeger W, Grueters A, Haberl H, ovarian function in an adult woman with McCune--Albright Kiess W, Repp R, Rascher W, Doetsch J. Low prevalence of syndrome. J Clin Endocrinol Metab. 2001 Jun;86(6):2625-30 Gs alpha mutations in śomatotroph adenomas of children and Peterson AC, Bauman JM, Light DE, McMann LP, Costabile adolescents. Cancer Genet Cytogenet. 2006 Apr RA. The prevalence of testicular microlithiasis in an 15;166(2):146-51 asymptomatic population of men 18 to 35 years old. J Urol. Wasniewska M, Matarazzo P, Weber G, Russo G, Zampolli M, 2001 Dec;166(6):2061-4 Salzano G, Zirilli G, Bertelloni S. Clinical presentation of Lee JS, FitzGibbon E, Butman JA, Dufresne CR, Kushner H, McCune-Albright syndrome in males. J Pediatr Endocrinol Wientroub S, Robey PG, Collins MT. Normal vision despite Metab. 2006 May;19 Suppl 2:619-22 narrowing of the optic canal in fibrous dysplasia. N Engl J Med. Mieszczak J, Lowe ES, Plourde P, Eugster EA. The aromatase 2002 Nov 21;347(21):1670-6 inhibitor anastrozole is ineffective in the treatment of Riminucci M, Collins MT, Lala R, Corsi A, Matarazzo P, precocious puberty in girls with McCune-Albright syndrome. J Gehron Robey P, Bianco P. An R201H activating mutation of Clin Endocrinol Metab. 2008 Jul;93(7):2751-4 the GNAS1 (Gsalpha) gene in a corticotroph pituitary adenoma. Mol Pathol. 2002 Feb;55(1):58-60 This article should be referenced as such: Akintoye SO, Lee JS, Feimster T, Booher S, Brahim J, Zacharin M. McCune Albright syndrome. Atlas Genet Kingman A, Riminucci M, Robey PG, Collins MT. Dental Cytogenet Oncol Haematol. 2009; 13(5):395-398. characteristics of fibrous dysplasia and McCune-Albright syndrome. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 2003 Sep;96(3):275-82

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 398 Atlas of Genetics and Cytogenetics

in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS

Case Report Section Paper co-edited with the European LeukemiaNet

Dic(1;15)(p11;p11) as a non-random abnormality in essential thrombocytemia Olivier Theisen, Steven Richebourg, Jean-Luc Lai, Catherine Roche-Lestienne Laboratoire de Genetique Medicale, Hopital Jeanne de Flandre, CHRU de Lille, France (OT), Institut de Recherche sur le Cancer, Centre JP Aubert, Unite Inserm 837, Lille, France (SR), Institut de Recherche sur le Cancer, Centre JP Aubert, Unite Inserm 837, Lille, France (JLL, CRL)

Published in Atlas Database: May 2008 Online updated version : http://AtlasGeneticsOncology.org/Reports/dic115inETRocheID100036.html DOI: 10.4267/2042/44483 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2009 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Complete remission: no Clinics Treatment related death: no Age and sex Relapse: no 74 years old female patient. Status: Death. Last follow up: 02-2008 Previous history Survival: 131 months No preleukemia; No previous malignancy; No inborn condition of note. Karyotype Organomegaly Sample: Bone marrow No hepatomegaly, no splenomegaly, no enlarged lymph Culture time: 48h nodes, no central nervous system involvement. Banding: GTG Blood Results 46,XX,[3]/46,XX,-15,+dic(1;15)(p11;p11)[10] WBC: 16.4X 10 9/l Karyotype at Relapse: NA HB: 16.3g/dl Platelets: 872X 10 9/l Other molecular cytogenetics technics: NA Blasts: 0% Other Molecular Studies Cyto-Pathology Technics: NA Classification Other Findings Cytology: - Note: NA Immunophenotype: - Rearranged Ig Tcr: - Pathology: MPD Electron microscopy: - Diagnosis: Essential Thrombocytemia Survival

Date of diagnosis: 03-1997 Karyotype at diagnosis presenting the dic(1;15)(p11;p11) as Treatment: Hydroxyurea sole abnormality.

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 399 Dic(1;15)(p11;p11) as a non-random abnormality in essential thrombocytemia Theisen O, et al.

Comments This article should be referenced as such: Theisen O, Richebourg S, Lai JL, Roche-Lestienne C. This is an additional MPD case presenting this Dic(1;15)(p11;p11) as a non-random abnormality in essential recurrent abnormality, with 11 years survival. However thrombocytemia. Atlas Genet Cytogenet Oncol Haematol. the death is not related to the disease (cardiac failure) in 2009; 13(5):399-400. this case.

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 400 Atlas of Genetics and Cytogenetics

in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS

Case Report Section Paper co-edited with the European LeukemiaNet

Dic(1;15)(p11;p11) as a non-random abnormality in Myelodysplasic syndrome Olivier Theisen, Steven Richebourg, Jean-Luc Lai, Catherine Roche-Lestienne Laboratoire de Genetique Medicale, Hopital Jeanne de Flandre, CHRU de Lille, France (OT), Institut de Recherche sur le Cancer, Centre JP Aubert, Unite Inserm 837, Lille, France (SR), Institut de Recherche sur le Cancer, Centre JP Aubert, Unite Inserm 837, Lille, France (JLL, CRL)

Published in Atlas Database: May 2008 Online updated version : http://AtlasGeneticsOncology.org/Reports/dic115inMyelodRocheID100037.html DOI: 10.4267/2042/44484 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2009 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Clinics Treatment: Norethandrolone Complete remission was obtained. Age and sex Treatment related death: no 76 female patient. Relapse: no Previous history Status: Death. Last follow up: 04-1997 No preleukemia; No previous malignancy; No inborn Survival: 37 months condition of note. Organomegaly Karyotype No hepatomegaly, no splenomegaly, no enlarged lymph Sample: Bone marrow nodes, no central nervous system involvement. Culture time: 48h Blood Banding: RHG Results WBC: 6.7X 10 9/l 46,XX,[3]/47,XX,+8[3]/47,XX,+8,- HB: 7.5g/dl 15,+dic(1;15)(p11;p11)[8] Platelets: 450X 10 9/l Blasts: 0% Other molecular cytogenetics technics: NA Bone marrow: 52 ringed sideroblast (Perls staining). Other Molecular Studies Cyto-Pathology Technics: NA Classification Other Findings Cytology: - Note: NA Immunophenotype: - Rearranged Ig Tcr: - Comments Electron microscopy: - This is an MDS case presenting this recurrent Diagnosis: Myelodysplastic syndrome (MDS): abnormality, with a 3 years survival. In this case the refractory anemia with ringed sideroblast (RARS). death is not related to disease (non-small cell lung carcinoma). Survival Date of diagnosis: 05-1994

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 401 Dic(1;15)(p11;p11) as a non-random abnormality in Myelodysplasic syndrome Theisen O, et al.

This article should be referenced as such: Theisen O, Richebourg S, Lai JL, Roche-Lestienne C. Dic(1;15)(p11;p11) as a non-random abnormality in Myelodysplasic syndrome. Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5):401-402.

Partial karyotype at diagnosis presenting the dic(1;15)(p11;p11) associated with trisomy 8.

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 402 Atlas of Genetics and Cytogenetics

in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS

Instructions to Authors Manuscripts submitted to the Atlas must be submitted solely to the Atlas. Iconography is most welcome: there is no space restriction. The Atlas publishes "cards", "deep insights", "case reports", and "educational items". Cards are structured review articles. Detailed instructions for these structured reviews can be found at: http://AtlasGeneticsOncology.org/Forms/Gene_Form.html for reviews on genes, http://AtlasGeneticsOncology.org/Forms/Leukaemia_Form.html for reviews on leukaemias, http://AtlasGeneticsOncology.org/Forms/SolidTumour_Form.html for reviews on solid tumours, http://AtlasGeneticsOncology.org/Forms/CancerProne_Form.html for reviews on cancer-prone diseases. According to the length of the paper, cards are divided, into "reviews" (texts exceeding 2000 words), "mini reviews" (between), and "short communications" (texts below 400 words). The latter category m ay not be accepted for indexing by bibliographic databases. Deep Insights are written as traditional papers, made of paragraphs with headings, at the author's convenience. No length restriction. Case Reports in haematological malignancies are dedicated to recurrent -but rare- chromosomes abnormalities in leukaemias/lymphomas. Cases of interest shall be: 1- recurrent (i.e. the chromosome anomaly has already been described in at least 1 case), 2- rare (previously described in less than 20 cases), 3- with well documented clinics and laboratory findings, and 4- with iconography of chromosomes. It is mandatory to use the specific "Submission form for Case reports": see http://AtlasGeneticsOncology.org/Reports/Case_Report_Submission.html. Educational Items must be didactic, give full information and be accompanied with iconography. Translations into French, German, Italian, and Spanish are welcome.

Subscription : The Atlas is FREE !

Corporate patronage, sponsorship and advertising Enquiries should be addressed to [email protected].

Rules, Copyright Notice and Disclaimer Conflicts of Interest: Authors must state explicitly whether potential conflicts do or do not exist. Reviewers must disclose to editors any conflicts of interest that could bias their opinions of the manuscript. The editor and the editorial board members must disclose any potential conflict. Privacy and Confidentiality – Iconography: Patients have a right to privacy. Identifying details should be omitted. If complete anonymity is difficult to achieve, informed consent should be obtained. Property: As "cards" are to evolve with further improvements and updates from various contributors, the property of the cards belongs to the editor, and modifications will be made without authorization from the previous contributor (who may, nonetheless, be asked for refereeing); contributors are listed in an edit history manner. Authors keep the rights to use further the content of their papers published in the Atlas, provided that the source is cited. Copyright: The information in the Atlas of Genetics and Cytogenetics in Oncology and Haematology is issued for general distribution. All rights are reserved. The information presented is protected under international conventions and under national laws on copyright and neighbouring rights. Commercial use is totally forbidden. Information extracted from the Atlas may be reviewed, reproduced or translated for research or private study but not for sale or for use in conjunction with commercial purposes. Any use of information from the Atlas should be accompanied by an acknowledgment of the Atlas as the source, citing the uniform resource locator (URL) of the article and/or the article reference, according to the Vancouver convention. Reference to any specific commercial products, process, or service by trade name, trademark, manufacturer, or otherwise, does not necessarily constitute or imply its endorsement, recommendation, or favouring. The views and opinions of contributors and authors expressed herein do not necessarily state or reflect those of the Atlas editorial staff or of the web site holder, and shall not be used for advertising or product endorsement purposes. The Atlas does not make any warranty, express or implied, including the warranties of merchantability and fitness for a particular purpose, or assumes any legal liability or responsibility for the accuracy, completeness, or usefulness of any information, and shall not be liable whatsoever for any damages incurred as a result of its use. In particular, information presented in the Atlas is only for research purpose, and shall not be used for diagnosis or treatment purposes. No responsibility is assumed for any injury and/or damage to persons or property for any use or operation of any methods products, instructions or ideas contained in the material herein. See also: "Uniform Requirements for Manuscripts Submitted to Biomedical Journals: Writing and Editing for Biomedical Publication - Updated October 2004": http://www.icmje.org.

http://AtlasGeneticsOncology.org

Dic(1;15)(p11;p11) as a non-random abnormality in Myelodysplasic syndrome Theisen O, et al.

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(5) 404