Functional Non-Coding Polymorphism in an EPHA2 Promoter PAX2
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Retrocopy Contributions to the Evolution of the Human Genome Robert Baertsch*1, Mark Diekhans1, W James Kent1, David Haussler1 and Jürgen Brosius2
BMC Genomics BioMed Central Research article Open Access Retrocopy contributions to the evolution of the human genome Robert Baertsch*1, Mark Diekhans1, W James Kent1, David Haussler1 and Jürgen Brosius2 Address: 1Center for Biomolecular Science and Engineering, University of California Santa Cruz, Santa Cruz, California 95064, USA and 2Institute of Experimental Pathology, ZMBE, University of Münster, Von-Esmarch-Str. 56, D-48149, Münster, Germany Email: Robert Baertsch* - [email protected]; Mark Diekhans - [email protected]; W James Kent - [email protected]; David Haussler - [email protected]; Jürgen Brosius - [email protected] * Corresponding author Published: 8 October 2008 Received: 17 March 2008 Accepted: 8 October 2008 BMC Genomics 2008, 9:466 doi:10.1186/1471-2164-9-466 This article is available from: http://www.biomedcentral.com/1471-2164/9/466 © 2008 Baertsch et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Background: Evolution via point mutations is a relatively slow process and is unlikely to completely explain the differences between primates and other mammals. By contrast, 45% of the human genome is composed of retroposed elements, many of which were inserted in the primate lineage. A subset of retroposed mRNAs (retrocopies) shows strong evidence of expression in primates, often yielding functional retrogenes. Results: To identify and analyze the relatively recently evolved retrogenes, we carried out BLASTZ alignments of all human mRNAs against the human genome and scored a set of features indicative of retroposition. -
A Genome-Wide Association Study of Bisphosphonate-Associated
Calcifed Tissue International (2019) 105:51–67 https://doi.org/10.1007/s00223-019-00546-9 ORIGINAL RESEARCH A Genome‑Wide Association Study of Bisphosphonate‑Associated Atypical Femoral Fracture Mohammad Kharazmi1 · Karl Michaëlsson1 · Jörg Schilcher2 · Niclas Eriksson3,4 · Håkan Melhus3 · Mia Wadelius3 · Pär Hallberg3 Received: 8 January 2019 / Accepted: 8 April 2019 / Published online: 20 April 2019 © The Author(s) 2019 Abstract Atypical femoral fracture is a well-documented adverse reaction to bisphosphonates. It is strongly related to duration of bisphosphonate use, and the risk declines rapidly after drug withdrawal. The mechanism behind bisphosphonate-associated atypical femoral fracture is unclear, but a genetic predisposition has been suggested. With the aim to identify common genetic variants that could be used for preemptive genetic testing, we performed a genome-wide association study. Cases were recruited mainly through reports of adverse drug reactions sent to the Swedish Medical Products Agency on a nation- wide basis. We compared atypical femoral fracture cases (n = 51) with population-based controls (n = 4891), and to reduce the possibility of confounding by indication, we also compared with bisphosphonate-treated controls without a current diagnosis of cancer (n = 324). The total number of single-nucleotide polymorphisms after imputation was 7,585,874. A genome-wide signifcance threshold of p < 5 × 10−8 was used to correct for multiple testing. In addition, we performed candidate gene analyses for a panel of 29 genes previously implicated in atypical femoral fractures (signifcance threshold of p < 5.7 × 10−6). Compared with population controls, bisphosphonate-associated atypical femoral fracture was associated with four isolated, uncommon single-nucleotide polymorphisms. -
The Title of the Dissertation
UNIVERSITY OF CALIFORNIA SAN DIEGO Novel network-based integrated analyses of multi-omics data reveal new insights into CD8+ T cell differentiation and mouse embryogenesis A dissertation submitted in partial satisfaction of the requirements for the degree Doctor of Philosophy in Bioinformatics and Systems Biology by Kai Zhang Committee in charge: Professor Wei Wang, Chair Professor Pavel Arkadjevich Pevzner, Co-Chair Professor Vineet Bafna Professor Cornelis Murre Professor Bing Ren 2018 Copyright Kai Zhang, 2018 All rights reserved. The dissertation of Kai Zhang is approved, and it is accept- able in quality and form for publication on microfilm and electronically: Co-Chair Chair University of California San Diego 2018 iii EPIGRAPH The only true wisdom is in knowing you know nothing. —Socrates iv TABLE OF CONTENTS Signature Page ....................................... iii Epigraph ........................................... iv Table of Contents ...................................... v List of Figures ........................................ viii List of Tables ........................................ ix Acknowledgements ..................................... x Vita ............................................. xi Abstract of the Dissertation ................................. xii Chapter 1 General introduction ............................ 1 1.1 The applications of graph theory in bioinformatics ......... 1 1.2 Leveraging graphs to conduct integrated analyses .......... 4 1.3 References .............................. 6 Chapter 2 Systematic -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Downloaded from [266]
Patterns of DNA methylation on the human X chromosome and use in analyzing X-chromosome inactivation by Allison Marie Cotton B.Sc., The University of Guelph, 2005 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in The Faculty of Graduate Studies (Medical Genetics) THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) January 2012 © Allison Marie Cotton, 2012 Abstract The process of X-chromosome inactivation achieves dosage compensation between mammalian males and females. In females one X chromosome is transcriptionally silenced through a variety of epigenetic modifications including DNA methylation. Most X-linked genes are subject to X-chromosome inactivation and only expressed from the active X chromosome. On the inactive X chromosome, the CpG island promoters of genes subject to X-chromosome inactivation are methylated in their promoter regions, while genes which escape from X- chromosome inactivation have unmethylated CpG island promoters on both the active and inactive X chromosomes. The first objective of this thesis was to determine if the DNA methylation of CpG island promoters could be used to accurately predict X chromosome inactivation status. The second objective was to use DNA methylation to predict X-chromosome inactivation status in a variety of tissues. A comparison of blood, muscle, kidney and neural tissues revealed tissue-specific X-chromosome inactivation, in which 12% of genes escaped from X-chromosome inactivation in some, but not all, tissues. X-linked DNA methylation analysis of placental tissues predicted four times higher escape from X-chromosome inactivation than in any other tissue. Despite the hypomethylation of repetitive elements on both the X chromosome and the autosomes, no changes were detected in the frequency or intensity of placental Cot-1 holes. -
Insulin/Glucose-Responsive Cells Derived from Induced Pluripotent Stem Cells: Disease Modeling and Treatment of Diabetes
Insulin/Glucose-Responsive Cells Derived from Induced Pluripotent Stem Cells: Disease Modeling and Treatment of Diabetes Sevda Gheibi *, Tania Singh, Joao Paulo M.C.M. da Cunha, Malin Fex and Hindrik Mulder * Unit of Molecular Metabolism, Lund University Diabetes Centre, Jan Waldenströms gata 35; Box 50332, SE-202 13 Malmö, Sweden; [email protected] (T.S.); [email protected] (J.P.M.C.M.d.C.); [email protected] (M.F.) * Correspondence: [email protected] (S.G.); [email protected] (H.M.) Supplementary Table 1. Transcription factors associated with development of the pancreas. Developmental Gene Aliases Function Ref. Stage SRY-Box Transcription Factor Directs the primitive endoderm SOX17 DE, PFE, PSE [1] 17 specification. Establishes lineage-specific transcriptional programs which leads DE, PFE, PSE, Forkhead Box A2; Hepatocyte to proper differentiation of stem cells FOXA2 PMPs, EPs, [2] Nuclear Factor 3-β into pancreatic progenitors. Regulates Mature β-cells expression of PDX1 gene and aids in maturation of β-cells A pleiotropic developmental gene which regulates growth, and Sonic Hedgehog Signaling differentiation of several organs. SHH DE [3] Molecule Repression of SHH expression is vital for pancreas differentiation and development Promotes cell differentiation, proliferation, and survival. Controls C-X-C Motif Chemokine the spatiotemporal migration of the Receptor 4; Stromal Cell- CXCR4 DE angioblasts towards pre-pancreatic [4] Derived Factor 1 Receptor; endodermal region which aids the Neuropeptide Y3 Receptor induction of PDX1 expression giving rise to common pancreatic progenitors Crucial for generation of pancreatic HNF1 Homeobox B HNF1B PFE, PSE, PMPs multipotent progenitor cells and [5] Hepatocyte Nuclear Factor 1-β NGN3+ endocrine progenitors Master regulator of pancreatic organogenesis. -
CD29 Identifies IFN-Γ–Producing Human CD8+ T Cells With
+ CD29 identifies IFN-γ–producing human CD8 T cells with an increased cytotoxic potential Benoît P. Nicoleta,b, Aurélie Guislaina,b, Floris P. J. van Alphenc, Raquel Gomez-Eerlandd, Ton N. M. Schumacherd, Maartje van den Biggelaarc,e, and Monika C. Wolkersa,b,1 aDepartment of Hematopoiesis, Sanquin Research, 1066 CX Amsterdam, The Netherlands; bLandsteiner Laboratory, Oncode Institute, Amsterdam University Medical Center, University of Amsterdam, 1105 AZ Amsterdam, The Netherlands; cDepartment of Research Facilities, Sanquin Research, 1066 CX Amsterdam, The Netherlands; dDivision of Molecular Oncology and Immunology, Oncode Institute, The Netherlands Cancer Institute, 1066 CX Amsterdam, The Netherlands; and eDepartment of Molecular and Cellular Haemostasis, Sanquin Research, 1066 CX Amsterdam, The Netherlands Edited by Anjana Rao, La Jolla Institute for Allergy and Immunology, La Jolla, CA, and approved February 12, 2020 (received for review August 12, 2019) Cytotoxic CD8+ T cells can effectively kill target cells by producing therefore developed a protocol that allowed for efficient iso- cytokines, chemokines, and granzymes. Expression of these effector lation of RNA and protein from fluorescence-activated cell molecules is however highly divergent, and tools that identify and sorting (FACS)-sorted fixed T cells after intracellular cytokine + preselect CD8 T cells with a cytotoxic expression profile are lacking. staining. With this top-down approach, we performed an un- + Human CD8 T cells can be divided into IFN-γ– and IL-2–producing biased RNA-sequencing (RNA-seq) and mass spectrometry cells. Unbiased transcriptomics and proteomics analysis on cytokine- γ– – + + (MS) analyses on IFN- and IL-2 producing primary human producing fixed CD8 T cells revealed that IL-2 cells produce helper + + + CD8 Tcells. -
Functional Characterization of Rfx6 and Sel1l in Pancreatic Development
FUNCTIONAL CHARACTERIZATION OF RFX6 AND SEL1L IN PANCREATIC DEVELOPMENT by Shuai Li This thesis/dissertation document has been electronically approved by the following individuals: Long,Qiaoming (Chairperson) Schimenti,John C. (Minor Member) Boisclair,Yves R (Minor Member) FUNCTIONAL CHARACTERIZATION OF RFX6 AND SEL1L IN PANCREATIC DEVELOPMENT A Thesis Presented to the Faculty of the Graduate School of Cornell University In Partial Fulfillment of the Requirements for the Degree of Master of Science by Shuai Li August 2010 © 2010 Shuai Li ABSTRACT During vertebrate embryonic development, a common pool of progenitor cells gives rise to all three lineages of the pancreas, including endocrine, exocrine and duct cells. The molecular mechanisms regulating pancreatic differentiation are incompletely understood. We investigated the function of two genes in the control of pancreatic differentiation. In chapter two, we show that Sel1L (Sel-1 suppressor of lin- 12-like) is a potential Notch regulator during pancreas development. SEL1L is initially expressed throughout the pancreatic epithelia and later restricted in differentiated cells. Mice lacking SEL1L show severe defects in the differentiation of both endocrine and exocrine pancreas. These differentiation defects can be rescued by the Notch signaling inhibitor, DAPT. In chapter three, we show that RFX6 (Regulatory factor X 6) functions as a transcription factor in the developing pancreas. Knockdown of RFX6 in zebrafish causes disorganized pancreatic morphology and attenuated insulin expression. Expression of Nkx6.1 is down regulated in pancreatic cell line transfected with Rfx6 SiRNA. Luciferase reporter studies reveal that RFX6 activates the proximal promoter of Nkx6.1. In summary, our studies have provided new insight in the spatial and temporal regulation underlying pancreas development. -
SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line -
(P -Value<0.05, Fold Change≥1.4), 4 Vs. 0 Gy Irradiation
Table S1: Significant differentially expressed genes (P -Value<0.05, Fold Change≥1.4), 4 vs. 0 Gy irradiation Genbank Fold Change P -Value Gene Symbol Description Accession Q9F8M7_CARHY (Q9F8M7) DTDP-glucose 4,6-dehydratase (Fragment), partial (9%) 6.70 0.017399678 THC2699065 [THC2719287] 5.53 0.003379195 BC013657 BC013657 Homo sapiens cDNA clone IMAGE:4152983, partial cds. [BC013657] 5.10 0.024641735 THC2750781 Ciliary dynein heavy chain 5 (Axonemal beta dynein heavy chain 5) (HL1). 4.07 0.04353262 DNAH5 [Source:Uniprot/SWISSPROT;Acc:Q8TE73] [ENST00000382416] 3.81 0.002855909 NM_145263 SPATA18 Homo sapiens spermatogenesis associated 18 homolog (rat) (SPATA18), mRNA [NM_145263] AA418814 zw01a02.s1 Soares_NhHMPu_S1 Homo sapiens cDNA clone IMAGE:767978 3', 3.69 0.03203913 AA418814 AA418814 mRNA sequence [AA418814] AL356953 leucine-rich repeat-containing G protein-coupled receptor 6 {Homo sapiens} (exp=0; 3.63 0.0277936 THC2705989 wgp=1; cg=0), partial (4%) [THC2752981] AA484677 ne64a07.s1 NCI_CGAP_Alv1 Homo sapiens cDNA clone IMAGE:909012, mRNA 3.63 0.027098073 AA484677 AA484677 sequence [AA484677] oe06h09.s1 NCI_CGAP_Ov2 Homo sapiens cDNA clone IMAGE:1385153, mRNA sequence 3.48 0.04468495 AA837799 AA837799 [AA837799] Homo sapiens hypothetical protein LOC340109, mRNA (cDNA clone IMAGE:5578073), partial 3.27 0.031178378 BC039509 LOC643401 cds. [BC039509] Homo sapiens Fas (TNF receptor superfamily, member 6) (FAS), transcript variant 1, mRNA 3.24 0.022156298 NM_000043 FAS [NM_000043] 3.20 0.021043295 A_32_P125056 BF803942 CM2-CI0135-021100-477-g08 CI0135 Homo sapiens cDNA, mRNA sequence 3.04 0.043389246 BF803942 BF803942 [BF803942] 3.03 0.002430239 NM_015920 RPS27L Homo sapiens ribosomal protein S27-like (RPS27L), mRNA [NM_015920] Homo sapiens tumor necrosis factor receptor superfamily, member 10c, decoy without an 2.98 0.021202829 NM_003841 TNFRSF10C intracellular domain (TNFRSF10C), mRNA [NM_003841] 2.97 0.03243901 AB002384 C6orf32 Homo sapiens mRNA for KIAA0386 gene, partial cds. -
Functional Analysis of Structural Variation in the 2D and 3D Human Genome
FUNCTIONAL ANALYSIS OF STRUCTURAL VARIATION IN THE 2D AND 3D HUMAN GENOME by Conor Mitchell Liam Nodzak A dissertation submitted to the faculty of The University of North Carolina at Charlotte in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Bioinformatics and Computational Biology Charlotte 2019 Approved by: Dr. Xinghua Mindy Shi Dr. Rebekah Rogers Dr. Jun-tao Guo Dr. Adam Reitzel ii c 2019 Conor Mitchell Liam Nodzak ALL RIGHTS RESERVED iii ABSTRACT CONOR MITCHELL LIAM NODZAK. Functional analysis of structural variation in the 2D and 3D human genome. (Under the direction of DR. XINGHUA MINDY SHI) The human genome consists of over 3 billion nucleotides that have an average distance of 3.4 Angstroms between each base, which equates to over two meters of DNA contained within the 125 µm3 volume diploid cell nuclei. The dense compaction of chromatin by the supercoiling of DNA forms distinct architectural modules called topologically associated domains (TADs), which keep protein-coding genes, noncoding RNAs and epigenetic regulatory elements in close nuclear space. It has recently been shown that these conserved chromatin structures may contribute to tissue-specific gene expression through the encapsulation of genes and cis-regulatory elements, and mutations that affect TADs can lead to developmental disorders and some forms of cancer. At the population-level, genomic structural variation contributes more to cumulative genetic difference than any other class of mutation, yet much remains to be studied as to how structural variation affects TADs. Here, we study the func- tional effects of structural variants (SVs) through the analysis of chromatin topology and gene activity for three trio families sampled from genetically diverse popula- tions from the Human Genome Structural Variation Consortium. -
Transcriptomic Analysis of Ribosome-Bound Mrna in Cortical Neurites in Vivo
This Accepted Manuscript has not been copyedited and formatted. The final version may differ from this version. A link to any extended data will be provided when the final version is posted online. Research Articles: Cellular/Molecular Transcriptomic Analysis of Ribosome-Bound mRNA in Cortical Neurites In Vivo Rebecca Ouwenga1,2,3, Allison M. Lake2,3, David O'Brien2,3, Amit Mogha4, Adish Dani5,6 and Joseph D. Dougherty2,3,6 1Division of Biology and Biomedical Sciences, Washington University School of Medicine, St. Louis, MO, USA 2Department of Genetics, Washington University School of Medicine, St. Louis, MO, USA 3Department of Psychiatry, Washington University School of Medicine, St. Louis, MO, USA 4Department of Developmental Biology, Washington University School of Medicine, St. Louis, MO, USA 5Department of Pathology and Immunology, Washington University School of Medicine, St. Louis, MO, USA 6Hope Center for Neurological Disorders, Washington University School of Medicine, St. Louis, MO, USA DOI: 10.1523/JNEUROSCI.3044-16.2017 Received: 29 September 2016 Revised: 29 June 2017 Accepted: 21 July 2017 Published: 8 August 2017 Author Contributions: RO: Developed and conducted SynapTRAP, data analysis, validation studies, and writing of manuscript; AL: Contributed to data analysis and writing of manuscript; AM: Conducted EM imaging.; DO: Contributed to data analysis; AD: Conducted STORM imaging; JD: Conceived of study, contributed to data analysis, and writing of manuscript. Conflict of Interest: JDD has received royalties related to TRAP in the past. No other authors declare a conflict of interest. We would like to thank M. Wong for Thy-1 mice, K. Monk, C. Weichselbaum and members of the Dougherty lab for helpful comments, N.