Of a Short-Chain Oligonucleotide Without Inert Atmosphere

applied sciences

Article A Simple and Efﬁcient Microﬂuidic System for Reverse Chemical Synthesis (50-30) of a Short-Chain Oligonucleotide Without Inert Atmosphere

Rahul Bhardwaj *, Phan T. Tue, Manish Biyani and Yuzuru Takamura *

Department of Bioscience and Biotechnology, Japan Advanced Institute of Science and Technology (JAIST), 1-1 Asahidai, Nomi city, Ishikawa 923-1211, Japan; [email protected] (P.T.T.), [email protected] (M.B.) * Correspondence: [email protected] (R.B.); [email protected] (Y.T.); Tel.: +81-761-51-1661

Received: 7 February 2019; Accepted: 28 March 2019; Published: 31 March 2019

Abstract: Reverse DNA synthesis (50-30) plays diverse functional roles in cellular biology, biotechnology, and nanotechnology. However, current microfluidic systems for synthesizing single-stranded DNAs at a laboratory scale are limited. In this work, we develop a simple and efficient polydimethylsiloxane- (PDMS-) based microfluidic system for the reverse chemical synthesis of short-chain oligonucleotides (in the 50-30 direction) under ambient conditions. The use of a microfluidics device and anhydrous conditions effectively surpass the problem of moisture sensitivity during oligonucleotide synthesis. With optimized microfluidic synthesis conditions, the system is able to synthesize up to 21 bases-long oligonucleotides in air atmosphere. The as-synthesized oligonucleotides, without further purification, are characterized using matrix-assisted laser desorption ionization–time of flight (MALDI-TOF/TOF) mass spectroscopy (MS) supported by the denatured polyacrylamide gel electrophoresis (PAGE) analysis. This developed system is highly promising for producing the desired sequence at the nanomolar scale on-chip and on-demand in the near future.

Keywords: reverse oligonucleotide synthesis (50-30), PDMS chip; on-chip and on-demand; air atmosphere

1. Introduction The past two decades have witnessed signiﬁcant advancement in research efforts to incorporate synthetic short-chain ssDNAs into a variety of applications and miniaturized devices, such as oligonucleotide-Chip technology [1–5]. In the miniaturization of devices made of nucleic acids, single-stranded DNAs are the preferred choice, which are largely synthesized autonomously or non-autonomously via a staged process that uses conventional phosphoramidite chemistry [6]. The rapid growth in the use of synthetic oligonucleotides made chemical synthesis (30-50 direction) the standard protocol for preparing oligos using a commercial DNA synthesizer. This occurred because of the easy accessibility of the corresponding protected monomeric building blocks [7]. On the other hand, reverse chemical synthesis (50-30 direction) has been limited to nuclease resistance and hairpin loop applications, where the terminal linkage of natural 50-30 antisense oligonucleotides was modiﬁed via the construction of alternating 30-30 or 50-50 internucleotide linkages (terminal capping), and hence has not been matured much yet [8–11]. However, addressed micro-arrays of surface-bound ssDNAs (50-30) with a free 30 terminal group recently found multiple biotechnology applications in genetics, for example, in enzymatic extension via DNA or RNA polymerase at the 30 hydroxyl group, and transcriptomics/genomic analysis of cells using 30-poly T tail-based primers (50-30) containing short-chain oligos as a barcode address-tag (<12 bases) [12,13]. In later applications, researchers have

Appl. Sci. 2019, 9, 1357; doi:10.3390/app9071357 www.mdpi.com/journal/applsci Appl. Sci. 2019, 9, 1357 2 of 13 been preparing random sequences for barcode-tags using mix and pool synthesis, which limits the application. Direct reverse synthesis of a specific sequence as an address-tag is attractive to overcome this limitation. Our work presents an application of reverse synthesis which centers upon on-chip and on-demand synthesis of a barcode as an address-tag which can be used for applications like positional information-based transcriptomics and proteomics analysis of single cells. To develop a system for the reverse synthesis of oligonucleotides, microfluidic devices were the favored choice because of their advantages like precise and reproducibly actuate fluids, low reagent consumption, and plentiful quantity production [14]. Most of the microfluidic systems have been limited to continuous flow reactors fabricated in glass or silicon because a variety of organic reagents are needed for chemical syntheses, which limits the workable complexity and reagent savings [15]. In some cases where solvents are mild, it has been possible to use integrated elastomeric material to perform batch syntheses at the nanogram scale [16,17]. Hua et al. developed a chemically resistant microreactor made of a hybrid silicon–elastomer microfluidic system, but with limited chemical characterizations of the products [18], whereas Quake et al. reported a photocurable perfluoropolyether elastomer for oligonucleotide synthesis (50-30)[19,20]. In addition, Quake et al. succeeded in developing mild reagents, which made DNA synthesis feasible on a polydimethylsiloxane- (PDMS-) based microfluidic device [21]. Despite significant advancements, the necessity of an inert atmosphere, skilled operators, and expensive controller units to perform the synthesis is still a significant challenge. Therefore, the development of an efficient system with a simple design and ample product yield under ambient conditions is necessary; this will not only reduce the cost of the process, but also facilitate on-chip and on-demand processing at a laboratory scale. In this paper, we present a simple and low-cost PDMS microfluidic system that enables the synthesis of reverse oligonucleotides (50-30) under ambient conditions suitable for on-chip and on-demand applications. The single-layered microchannel fabrication makes the microfluidic system simple and easy to use at common laboratory scales. We have also optimized the microfluidic conditions, like flow rates and flow times of the synthesis step, to achieve a high yield of the desired sequence.

2. Materials and Methods

2.1. Materials The DNA phosphoramidite monomers and controlled pore glass (CPG) (nominal particle size 110 µm, average pore size = 1000 Å) were purchased from Link Technologies Ltd. (Scotland, UK). Superdehydrated acetonitrile (water < 0.001%, 10 ppm) was purchased from Wako Pure Chemical Industries Ltd. (Osaka, Japan). A 25–30% NH4OH aqueous solution was purchased from Fluka Analytical (Munich, Germany). The (1S)-(+)-(10-camphorsulfonyl) oxaziridine (CSO) oxidizer, 5-(ethylthio)-1H-tetrazole (ETT activator, 0.25 mol/L solution in anhydrous acetonitrile), 5-(benzylthio)-1H-tetrazole (BTT activator, 0.3 mol/L solution in anhydrous acetonitrile), and anhydrous acetonitrile (MeCN) were purchased from Glen Research (Sterling, VA, USA). The SYBR gold nucleic acid gel stain was purchased from Invitrogen (Carlsbad, CA, USA). Tris-EDTA buffer (pH = 7.5) was purchased from Integrated DNA Technologies (IDT; Coralville, IA, USA). All the DNA oligonucleotides, except the ones that we synthesized from the microﬂuidic chips, were ordered from IDT and were puriﬁed using high-performance liquid chromatography (HPLC). Other chemicals, including tris (hydroxymethyl) aminomethane (Tris), Tris-borate-EDTA (TBE) buffer 10x, poly (vinylpyrrolidone), and TFA, were purchased from Sigma-Aldrich (Tokyo, Japan).

2.2. Fabrication of the PDMS Microﬂuidic Chip The chip fabrication steps were conducted in a clean room facility at JAIST (see supplementary information, Figure S1) [22]. The PDMS chip with a microchannel was developed from a deﬁned mold structure, made of SU-8 over silicon wafers using photolithography techniques. PTFE tubes Appl. Sci. 2019, 9, 1357 3 of 13

Appl. Sci. 2018, 8, x FOR PEER REVIEW 3 of 13 (ID 1mm, New England Small Tube Co., Litchfield, NH, USA) were inserted into the inlet and outlet holesholes ofof thethe chip,chip, andand sealedsealed thethe gapgap withwith PDMS.PDMS. AnotherAnother endend ofof thethe inletinlet PTFEPTFE tubetube waswas bondedbonded withwith aa needleneedle toto introduceintroduce reagentsreagents fromfrom rubberrubber cappedcapped glass vials (see supplementary information, FigureFigure S2a).S2a). The PDMS chip consisted of a long chamberchamber (W = 2 mm, L = 10 mm, and H = 220 µm),µm), micropillarsmicropillars (W = 120 µm,µm, L = 500 µµm,m, and H = 220 µµm),m), a zigzag channel (W = 400 µµm,m, L = 60 mm, andand HH = 220 µm)µm) near the outlet, and a through-hole (2(2mm) mm) close to inlet (Figure 1 1).). TheseThese micropillarsmicropillars areare designeddesigned (the(the gapgap betweenbetween twotwo pillarspillars waswas setset toto bebe 100 µµm)m) toto traptrap thethe CPGCPG particlesparticles ofof aa 110110 µμm size.size. For CPG loading,loading, 2020 µµlL of of freshly freshly prepared CPGs slurry (60 mg, loading capacitycapacity 25–4025–40 µµmol/g)mol/g) inin 11 mLmL anhydrous anhydrous acetonitrile acetonitrile was was introduced introduced slowly slowly from from the the through-hole through-hole using using a micropipette, a micropipette, and onceand once the micro-chamber the micro-chamber was filled, was filled, CPGs wereCPGs washed were washed with fresh with anhydrous fresh anhydrous acetonitrile. acetonitrile. A column A ofcolumn porous of CPG porous particles CPG wasparticles therefore was packedtherefore inside packed the inside reaction the chamber reaction in chamber a defined in mannera defined of particlesmanner of monolayer particles monolayer (see supplementary (see supplementary information, information, Figure S2b). Figure The PDMS S2b). chipThe PDMS filled with chip CPGsfilled waswith then CPGs placed was atthen a high placed temperature, at a high 120temperature,◦C, overnight 120°C, to ensure overnight that particlesto ensure were that completelyparticles were dry priorcompletely to experiments. dry prior to experiments.

FigureFigure 1.1. (AA)) Illustration Illustration of of experimental setup, (BB)) design design of of microfluidic microﬂuidic chip inin detail,detail, andand (C) photographphotograph ofof thethe microﬂuidicmicrofluidic chip.chip.

2.3.2.3. Operation of the MicrofluidicMicrofluidic ChipChip AA micromicro syringesyringe pumppump ESP-64ESP-64 fromfrom EiCOMEiCOM Corp.Corp. (Kyoto, Japan) in reverse flowflow modemode waswas connectedconnected to thethe outlet,outlet, andand controlledcontrolled thethe flowflow ofof reagentsreagents withinwithin thethe microfluidicmicrofluidic channel.channel. AtAt thethe inlet,inlet, reagentreagent vialsvials werewere exchangedexchanged manuallymanually inin accordanceaccordance withwith thethe synthesissynthesis steps.steps. TheThe flowflow raterate andand flow-timeflow-time of each synthesis step were optimized for the PDMS microfluidicmicrofluidic system according toto thethe desireddesired lengthlength ofof thethe oligonucleotides.oligonucleotides. It was easyeasy toto changechange thesethese variablesvariables preciselyprecisely withwith thethe micromicro syringesyringe pump,pump, priorprior toto thethe nextnext synthesissynthesis step.step. After completing the synthesis, a forward flowflow withwith freshfresh anhydrousanhydrous acetonitrileacetonitrile waswas appliedapplied usingusing aa syringesyringe pump,pump, toto recollectrecollect thethe CPGCPG particlesparticles fromfrom thethe inletinlet inin aa smallsmall EppendorfEppendorf tubetube (200 µµL).L). We diddid notnot noticenotice anyany damagedamage toto thethe channelchannel ofof thethe PDMSPDMS chipchip duedue toto thethe exposureexposure ofof synthesissynthesis reagents,reagents, eveneven afterafter repeatingrepeating multiplemultiple stepssteps ofof thethe oligonucleotideoligonucleotide synthesis. Therefore, the chips were operated on aa multiple-usemultiple-use basis.basis. In the case ofof oligonucleotideoligonucleotide synthesissynthesis inin inertinert atmosphere,atmosphere, thethe GloveGlove boxbox fromfrom MiwaMiwa mfg.mfg. Co.Co. Ltd. (Osaka, Japan) filled with Argon (Ar) atmosphere and O (<1 ppm level) was used. A micro syringe pump, PDMS filled with Argon (Ar) atmosphere and O22 (<1 ppm level) was used. A micro syringe pump, PDMS chip,chip, andand all the synthesis reagents were shifted insideinside the glove box one day before the experiments. experiments.

2.4. On-Chip Chemical Syntheses of Reverse Oligonucleotides (5′-3′) Appl. Sci. 2018, 8, x FOR PEER REVIEW 4 of 13 Appl. Sci. 2019, 9, 1357 4 of 13

Solid-phase organic synthesis on a microchip has the advantages of a high reaction efficiency, 2.4.low On-Chipreagent consumption, Chemical Syntheses and high of Reverse product Oligonucleotides purity [14,22]. (5 0Phosphoramidite-30) chemistry was adopted for on-chip reverse chemical synthesis of oligos [23,24]. Traditionally, oligonucleotide elongation is Solid-phase organic synthesis on a microchip has the advantages of a high reaction efficiency, induced by repeating the four steps (deprotection, coupling, capping, oxidation, and four in-between low reagent consumption, and high product purity [14,22]. Phosphoramidite chemistry was adopted washing steps) in a single cycle. A detailed scheme of the solid-phase reverse oligonucleotide for on-chip reverse chemical synthesis of oligos [23,24]. Traditionally, oligonucleotide elongation is synthesis on CPG as a solid support is shown in Figure 2. Before synthesis, glass vials (10 ml) were induced by repeating the four steps (deprotection, coupling, capping, oxidation, and four in-between filled with 2 g, and molecular sieves were dried at 180°C in a vacuum oven overnight to remove the washing steps) in a single cycle. A detailed scheme of the solid-phase reverse oligonucleotide synthesis absorbed moisture and other materials, if any, and were allowed to cool down to room temperature on CPG as a solid support is shown in Figure2. Before synthesis, glass vials (10 mL) were filled with 15 min prior to use. All the used solutions were kept under a molecular sieve (3 Å) for 24 h to make 2 g, and molecular sieves were dried at 180 ◦C in a vacuum oven overnight to remove the absorbed the solution completely moisture-free. Phosphoramidite compounds were dissolved in moisture and other materials, if any, and were allowed to cool down to room temperature 15 min prior superdehydrated MeCN to form 0.1 mol/L solutions, and the CSO was dissolved in anhydrous MeCN to use. All the used solutions were kept under a molecular sieve (3 Å) for 24 h to make the solution (0.1 g/mL) and filtered through a 0.45 µm filter. The porous CPGs were modified with the first completely moisture-free. Phosphoramidite compounds were dissolved in superdehydrated MeCN to nucleoside attached. form 0.1 mol/L solutions, and the CSO was dissolved in anhydrous MeCN (0.1 g/mL) and filtered through a 0.45 µm filter. The porous CPGs were modified with the first nucleoside attached.

Figure 2. Scheme of solid phase reverse synthesis of oligonucleotides on-chip using phosphoramidite chemistry. One cycle of single nucleotide addition is shown using circular arrows. The released Figure 2. Scheme of solid phase reverse synthesis of oligonucleotides on-chip using phosphoramidite dimethoxytrityl (DMT) cation solution from the deprotection step was examined using absorbance for chemistry. One cycle of single nucleotide addition is shown using circular arrows. The released trekking the yield at each step. dimethoxytrityl (DMT) cation solution from the deprotection step was examined using absorbance First,for trekking the CPG the particlesyield at each were step. rinsed with anhydrous acetonitrile at a flow rate of 10 µL min−1 for 5 min to ensure continuous flow of the solvent through the chamber. The flow rate was optimized −1 and maintainedFirst, the CPG at particles 10 µL min were−1 for rinsed all solutions. with anhydrous The first acetonitrile 30-DMTr-protected at a flow rate nucleoside of 10 µL attachedmin for to5 min the CPGto ensure particles continuous was deprotected flow of the by solvent introducing through a mild the chamber. deblocking The reagent flow rate (5% was trifluoroacetic optimized −1 acidand maintained (TFA) in anhydrous at 10 µL min acetonitrile) for all solutions. at a flow The rate first of 103′-DMTr-protectedµL min−1 for 2–4 nucleoside min (the 5%attached TFA into acetonitrilethe CPG particles shows was high deprotected solvent compatibility by introducing with a mild PDMS deblocking compared reagent to conventional (5% trifluoroacetic deblocking acid −1 solvent(TFA) in dichloromethane anhydrous acetonitrile) (DCM), whichat a flow swells rate the of 10 PDMS µL min and destroysfor 2–4 min the (the microstructure 5% TFA in byacetonitrile clogging theshows channel). high Thesolvent spectrophotometric compatibility with assay PDMS of the co resultantmpared solution to conventional (containing deblocking trityl cations) solvent was collecteddichloromethane and measured (DCM), to which monitor swells the efficiency the PDMS of an thed synthesisdestroys step.the microstructure Stepwise coupling by clogging yields were the channel). The spectrophotometric assay of the resultant solution (containing trityl cations)−1 was−1 estimated on the basis of the characteristic trityl absorbance assay in CH2Cl2 (ε = 76000 LM cm ) (seecollected supplementary and measured information, to monitor 9) [the25]. efficiency The residual of the deblocking synthesis reagentstep. Stepwi in these chamber coupling was yields washed were −1 −1 outestimated through on the the outlet basis viaof the a 2–3 characte min superdehydratedristic trityl absorbance acetonitrile assay washing in CH2Cl step2 (ε performed= 76000 LM atcm the same) (see flowsupplementary rate. Since information, the nitrogenous 9) [25]. bases The of residual the growing deblocking DNA reagent chain are in susceptiblethe chamber to was acid-catalyzed washed out depurination,through the outlet the deblocking via a 2–3 min step superdehydrated needs optimization, acetonitrile and an acetonitrilewashing step rinse performed thoroughly at the removes same flow rate. Since the nitrogenous bases of the growing DNA chain are susceptible to acid-catalyzed Appl. Sci. 2019, 9, 1357 5 of 13 the deblocking agent from the support. Also, coupling efficiency and accuracy are increased by this wash, since premature detritylation of the incoming phosphoramidite monomer is prevented. To add the incoming monomer to the freed 30-OH, the next phosphoramidite was first activated with the ETT activator for 30 s and then introduced into the chip from the inlet for 4 min. After the completion of the coupling reaction, the washing step was repeated for 2 min. Even with a high coupling efficiency, a small percentage of the 30-OH group remained unreacted, which in subsequent coupling, led to deletion sequences. These active 30-OH groups were inactivated with capping steps using cap mix A and cap mix B for 1 min, even though, in our study, we did not find any noticeable difference in the yield of the desired sequence with or without the capping step (confirmed with PAGE analysis, results are not shown here). A similar finding has been mentioned in a previous study [19]. Therefore, we eliminated the capping step from our synthesis cycle. The resultant dimer from the first coupling produced an unstable trivalent phosphite triester, which was further oxidized to a stable pentavalent phosphotriester by introducing a 0.1 M CSO reagent into the anhydrous acetonitrile for 2 min. Then, another deprotection procedure was performed to initiate a new cycle. When the desired oligonucleotide elongation was achieved, a final 30-DMTr deprotection step was performed with a 5% TFA solution into the chip, followed by thorough washing with the superdehydrated acetonitrile solvent for 5 min. Detailed microfluidic conditions with optimized parameters for on-chip oligo synthesis are described in Table S1 (see supplementary information, Table S1).

2.5. Characterization Using Mass Spectroscopy (MS) After synthesis, the CPG particles were collected from the inlet by reversing the flow with fresh anhydrous acetonitrile in an Eppendorf tube. The solvent was evaporated using CentriVap. Then, the oligonucleotides were cleaved from the solid support (CPG particles) and deprotected. This is a two-step process that starts with cleavage and deprotection. However, it is not uncommon to perform it in one step. We added 200 µL of 25–30% ammonium hydroxide into an Eppendorf tube containing CPGs and then incubated the tube at 55 ◦C for 4 h to remove the base-protection groups from the oligonucleotides. Finally, the tube was lyophilized to yield solid-form oligonucleotides (with salts). In some cases, long incubation (>6 h) led to an insoluble white powder, which resulted from the CPG particles being dissolved with concentrated ammonium hydroxide. The synthesized oligonucleotides, without any further HPLC purification or desalting, were characterized using matrix-assisted laser desorption ionization–time of flight (MALDI-TOF/TOF) spectroscopy. 3-Hydroxypicolinic acid (3-HPA) was found to be the most suitable matrix for the soft ionization of the as-synthesized oligonucleotides. 10 µl of sample: matrix (1:1) solution was dropped over the MALDI substrate and dried in air atmosphere at room temperature before the characterization.

2.6. Electrophoresis The synthesized oligonucleotides were resuspended in Milli-Q water and normalized to a stock concentration of 100 pmol/µL using a NanoDrop 1000 spectrophotometer (Thermo Fisher Scientiﬁc, Japan). All gels were cast prior to the experiments in 5x concentrations of TBE buffer by precisely diluting the stock buffer in 56x TBE (450 mM Tris base, 450 mM boric acid, and 10 mM EDTA, pH = 8.9) with the required quantity of deionized water. All electrophoreses were carried out with a 16% w/v polyacrylamide gel composed of Acrylamide/Bis 19:1 in the TBE buffer (pH = 8.3) at 25 ◦C and 25 V/cm. Before gel loading, the oligonucleotides were mixed with the TBE-urea sample loading buffer (Invitrogen) and heated to 90 ◦C for 2 min. Samples of 2 µL were loaded. Samples with different lengths were run at room temperature at 175 V for different time intervals. The gels were stained with SYBR gold dye (1x) and visualized using a Fluoroimager, Quantity One (Bio-Rad, Hercules, CA, USA), with 550 nm for the excitation and 570 nm for the emission. Appl. Sci. 2019, 9, 1357 6 of 13

3. Results and Discussions

On-Chip Reverse Synthesis of Oligonucleotides Due to the fact that the coupling reaction is highly moisture-sensitive, the reverse oligonucleotide synthesis is challenging under ambient conditions [26]. To overcome the problem associated with the moisture sensitivity, we are taking advantage of a closed microfluidic system by minimizing the exposure to the atmosphere to some extent. In standard phosphoramidite chemistry, the primary 50-OH group of the phosphoramidite monomer is significantly more reactive than the secondary 30-OH group (or 20-OH group). Contrary to standard synthesis (30-50 direction), in (50-30) reverse synthesis, the 30-OH group of the phosphoramidite monomer (dCBz, Figure2) is protected with DMT, which makes the 5 0-OH group of the monomer (dCBz, Figure2) available to form a dimer with the less reactive secondary 3 0-OH group of dGiBu-CPG in order to grow the sequence in the 30-50 direction. Due to this chemistry, the coupling in reverse synthesis takes place at a slower rate than standard chemistry [8]. Therefore, to achieve a higher coupling efficiency for the reverse synthesis, optimization of the coupling and deprotection step is required in the first part. To optimize the conditions for a high coupling efficiency, oligonucleotides were synthesized by varying the synthesis conditions, such as the coupling time, deprotection time, and washing time (especially washing after the deprotection step as coupling efficiency and accuracy are increased by this wash, since premature detritylation of the incoming phosphoramidite monomer is prevented) (see Supplementary Information Figure S3). Figure S3d shows that the single intense peak at 2986.89 (m/z) corresponds to the 10-mer oligonucleotide, which was obtained as a major product with negligible small peaks of n-mer oligonucleotides (n < 10, truncated products), when the synthesis was performed with 4 min of coupling and 3 min washing. While the oligo synthesis was performed at a lower coupling time (see Supplementary Information, Figure S3a–c), 10-mer oligonucleotides were obtained as minor or negligible products, whereas truncated products were obtained as major products. The MS spectra obtained from the above optimization with coupling and washing time variation between 2 min and 4 min, depict that reaction propagation takes place in a stepwise manner. The longer coupling time enhances the chances of efficient coupling of the active site of the oligonucleotide chain with the incoming phosphoramidite more effectively, and therefore results in a high yield of the desired sequence (oligos yield calculation was made by trityl cation monitoring during the synthesis) with a single intense peak. The improved coupling efficiency and yield are attributed to the optimized flow conditions of the enhanced coupling and thorough washing. During the synthesis of short chain oligos, the capping step was omitted from the synthesis scheme; therefore, the effect of the capping step was also confirmed by performing synthesis of the oligonucleotide with and without the capping step (see supplementary information, Figure S4). It is clear from the results that the capping step is not as significant in the case of short chain oligos synthesis. In the next step, a comparative study of the oligonucleotide synthesis with and without inert atmosphere was performed. Figure3 shows the MALDI-TOF/TOF MS spectra (Bruker Daltonics UltrafleXtreme, Bremen, Germany) of 10-mer oligonucleotides (TTCGAGACTG, m/z = 3041) in an inert (N2) atmosphere, and (TATGTACGAC, m/z = 3026) in an air atmosphere. Specific synthesis conditions are mentioned in the graph. The MS data of oligonucleotides synthesized in the inert atmosphere [Figure3a] and in the air atmosphere [Figure3b] show the single intense peak of the desired product at m/z = 3043.8 and m/z = 3026.2, respectively, corresponding to 10-mer oligonucleotides. Some other peaks are also observed in Figure3a,b with extremely low intensities and can be assigned to truncated products (products with one or more missing nucleotides from the desired sequence) with a negligibly low amount compare to the target sequence. Appl. Sci. 2019, 9, 1357 7 of 13 Appl. Sci. 2018, 8, x FOR PEER REVIEW 7 of 13

Figure 3. MALDI-TOF/TOF MS spectra of on-chip synthesized reverse oligonucleotides of 10-mer Figure 3. MALDI-TOF/TOF MS spectra of on-chip synthesized reverse oligonucleotides of 10-mer length (a) in inert atmosphere and (b) in air-atmosphere (without inert atmosphere) with optimized length (a) in inert atmosphere and (b) in air-atmosphere (without inert atmosphere) with optimized conditions. Specific synthesis conditions are described for each synthesis. Data shown are baseline conditions. Specific synthesis conditions are described for each synthesis. Data shown are baseline corrected using flex analysis software. corrected using flex analysis software. The MS results (Figure3) confirm the successful synthesis of 10-mer oligonucleotides as major The MS results (Figure 3) confirm the successful synthesis of 10-mer oligonucleotides as major products in both cases. The overall yield of the 10-mer oligonucleotides was calculated to be 95% in the products in both cases. The overall yield of the 10-mer oligonucleotides was calculated to be 95% in N2 atmosphere and >91% in the air atmosphere from the stepwise yield using trityl cation absorbance. the N2 atmosphere and >91% in the air atmosphere from the stepwise yield using trityl cation From the MS spectra and calculated yield, it is explicit that reverse syntheses of oligonucleotides in absorbance. From the MS spectra and calculated yield, it is explicit that reverse syntheses of inert atmosphere and in air atmosphere obtained comparable results. This achievement was made oligonucleotides in inert atmosphere and in air atmosphere obtained comparable results. This possible by applying anhydrous conditions to all the freshly prepared solutions using molecular achievement was made possible by applying anhydrous conditions to all the freshly prepared sieves, and optimized synthesis conditions. Figure S5 (see supplementary information) confirms this solutions using molecular sieves, and optimized synthesis conditions. Figure S5 (see Supplementary explanation as we synthesized the same length of oligonucleotides with anhydrous reagents without Information) confirms this explanation as we synthesized the same length of oligonucleotides with molecular sieve treatment. Before the experiment, reagents were kept in closed vials for at least 24 h, anhydrous reagents without molecular sieve treatment. Before the experiment, reagents were kept in and identical synthesis conditions were applied. The result clearly shows that the major products closed vials for at least 24 h, and identical synthesis conditions were applied. The result clearly shows obtained from this synthesis were truncated products with an unacceptable low amount of the desired that the major products obtained from this synthesis were truncated products with an unacceptable low amount of the desired sequence. The above experimental results clearly show that this Appl. Sci. 2019, 9, 1357 8 of 13 sequence. The above experimental results clearly show that this microfluidic system and anhydrous conditions allow the reverse synthesis of oligonucleotides without inert atmosphere by providing sufficient protection from atmospheric moisture. The on-chip reverse synthesis conditions for oligonucleotides (>10 bases) were optimized further with an increased flow time of the deprotection step. Figure4 shows the MALDI-TOF/TOF MS spectra of the 12-mer oligonucleotides synthesized in an air atmosphere before and after changing the flow time of the deprotection step. Detailed microfluidic syntheses conditions are summarized in Table S1, unless otherwise specified (see Supplementary Information Table S1). Figure4a shows the MS spectra of the 12-mer oligonucleotide (CTGGCTTTAGTA, m/z = 3649) with a deprotection time of 2 min, and the peak of the desired sequence corresponds to 3651.62 (m/z), which was obtained with a <70% yield (calculated). It also shows the peaks of truncated sequences (n-1 mer, n = 12) with a peak intensity comparable to the demanded sequence. It is clear from the MS spectra that optimized conditions are not acceptable for synthesizing 12-mer oligos with a high quality. To improve the quality of oligo sequences (>10-mer), the time of the deprotection step was varied from 2 min to 2.5 min, and 3 min, which resulted in an improved quality, as shown in Figure4b (data with deprotection time of 2.5 min not shown here). Figure4b shows that the MS-spectra of the synthesized 12-mer oligonucleotide (CCAGTCGACCGA, m/z = 3613) with a deprotection time of 3 min corresponds to the intense peak at 3615.13 (m/z). With increased deprotection time, we become successful at achieving an improved quality of 12-mer oligonucleotides with a 85% yield (synthesized in an air atmosphere). The MS spectra (Figure4b) also demonstrate peaks at 2972.96 and 1752.64 (m/z), which correspond to (n-2) and (n-6) truncated products, respectively, but these sub-sequences with a minor amount can be ignored compared to the amount of desired sequence. From the MS spectra (Figure4), it is clear that oligo synthesis (<10 bases) with 2 min is insufficient, which leads to incomplete deprotection. It interferes in the next synthesis cycle, which results in the production of truncated sequences with remaining protected sites from the previous cycle. The improved result of the 12-mer oligonucleotides using PDMS chips in an air atmosphere confirms that the extended exposure of the deprotection reagents along with optimized coupling and washing times leads to a pure product with a high yield. Appl. Sci. 2019, 9, 1357 9 of 13 Appl. Sci. 2018, 8, x FOR PEER REVIEW 9 of 13

FigureFigure 4. MALDI-TOF/TOF 4. MALDI-TOF/TOF MS MS spectra spectra comparison comparison of 12- of 12-mermer oligonucleotide oligonucleotide synthesis synthesis without without inert inert atmosphereatmosphere (a) ( abefore) before and and (b ()b after) after modified modified synthesis synthesis conditions. conditions. MS MS data data clearly clearly shows shows the the effect effect of of deprotectiondeprotection step step on on longer longer synthe synthesis.sis. Specific Specific synthesis synthesis conditions conditions are are described described for for each each synthesis. synthesis. DataData shown shown are are baseline baseline corrected corrected using using flex flex analysis analysis software. software.

InIn this this work, work, we we extended extended the the oligonucleotide oligonucleotide chain chain up up to to18 18 mer mer and and 21 21 mer mer using using optimized optimized conditionsconditions for for the the on-chip on-chip reverse reverse synthesis. synthesis. Figu Figureres 5a,b5a,b show show the the MALDI-TOF/TOF MALDI-TOF/TOF MS MS spectra spectra of of thethe 18-mer18-mer (CAGTCTGAGTCAGCTGAT, (CAGTCTGAGTCAGCTGAT,m/z = 5511) andm/z 21-mer = (GCGGCTGAAGACGGCCTATGT,5511) and 21-mer (GCGGCTGAAGACGGCCTATGT,m/z = 6480) oligo sequences, respectively. m/z = 6480) Both oligo spectra sequences, show the respectively. intense peak Both of spectra the corresponding show the intensesequences peak withof the a corresponding maximum yield sequences of 75% inwith each a maximum case (average yield yield of 75% of >98%). in each Thecase MS(average spectra yield(Figure of >98%).5) also The demonstrate MS spectra multiple (Figure peaks 5) also of sequencesdemonstrate other multiple than the peaks target of sequence. sequences Some other of than these thecorrespond target sequence. to the truncated Some of products these correspond of the respective to the target truncated sequence, products but there of the are respective still plenty target number sequence,of peaks but which there correspond are still plenty to unknown number sequences. of peaks which We are correspond not able to to analyze unknown these sequences. peaks through We arem/z not withable respectto analyze to the these synthesized peaks through sequence. m/z Thewith exact respect reasons to the for synthesized these peaks sequence. are not clear The yet,exact but reasonsit is expected for these that peaks the peaks are not are clear obtained yet, frombut it the is expected sequences that with the the peaks deletion are ofobtained nucleotides from during the sequencesthe synthesis. with the The deletion most probable of nucleotides reason during for those the unexpectedsynthesis. The peaks most could probable be because reason offor omitting those unexpected peaks could be because of omitting the capping steps from the synthesis cycle. Although we proved in Figure S5 (see supplementary information) that the capping step is not significant, long- Appl. Sci. 2019, 9, 1357 10 of 13

the capping steps from the synthesis cycle. Although we proved in Figure S5 (see supplementary Appl. Sci. 2018, 8, x FOR PEER REVIEW 10 of 13 information) that the capping step is not signiﬁcant, long-chain oligo synthesis (>12 bases) is expected chainto have oligo a largesynthesis impact (>12 from bases) the omittingis expected of theto have capping a large step impact as capping from blocks the omitting the remaining of the capping active site stepfrom as capping the previous blocks cycle. the Anotherremaining reason active could site fr beom the the effect previous of long cycle. exposure Another of the reason deprotection could be reagent the effecton theof long growing exposure oligo chain,of the whichdeprotection results inreagent the depurination on the growing of bases oligo and chain, thus which creates results another in site the for depurinationa side reaction. of bases Therefore, and thus a study creates on the another depurination site for of abases side withreaction. an optimized Therefore, deprotection a study on time the is depurinationrequired in theof bases future with to understand an optimized the origindeprotection of these time peaks. is Finally,required the in random the future fragmentation to understand of the theoligo origin sequence of these during peaks. ionization,Finally, the most random probably fragmentation related to of the the high oligo laser sequence intensity, during could ionization, also notbe mostneglected, probably which related led to multiplethe high peakslaser intensity, at random couldm/z alsothat arenot difﬁcultbe neglected, to analyze which (see led supplementary to multiple peaksinformation at random also, m/ Figurez that are S6). difficult to analyze (see supplementary information also, Figure S6).

Figure 5. MALDI-TOF/TOF MS spectra of (a) 18-mer and (b) 21-mer oligonucleotide with optimized Figureconditions. 5. MALDI-TOF/TOF Figure5b inset MS shows spectra the PAGEof (a) 18-mer image of and differently (b) 21-mer synthesized oligonucleotide 21-mer with oligonucleotides optimized conditions.with running Figure conditions 5b inset shows at the the bottom. PAGE Theimage optimized of differently synthesis synthesized conditions 21-mer are oligonucleotides described for both withsyntheses. running Theconditions data shown at the are bottom. baseline The corrected optimized using synthesis ﬂex analysis conditions software are described (Version 2.4,for Brukerboth syntheses.Daltonics, The Bremen, data shown Germany). are baseline corrected using flex analysis software (Version 2.4, Bruker Daltonics, Bremen, Germany).

For analyzing the quality of synthesized oligos (21-mer), we also performed a denatured polyacrylamide gel electrophoresis (PAGE) analysis with a known marker to confirm the length of the synthesized product. Three different oligonucleotide sequences with the same length of 21 bases Appl. Sci. 2019, 9, 1357 11 of 13

For analyzing the quality of synthesized oligos (21-mer), we also performed a denatured polyacrylamide gel electrophoresis (PAGE) analysis with a known marker to confirm the length of the synthesized product. Three different oligonucleotide sequences with the same length of 21 bases were synthesized separately using the same conditions and checked using gel electrophoresis. The oligonucleotides were dissolved in Milli-Q water, and sample solutions of 10 pmol/µL were prepared using the NanoDrop system for the PAGE analysis. Figure5b (inset) shows a denatured gel image with all four samples of 21 mer (lanes 2–5) and a 5 bp ladder (lane 1) for a standard marker. The gel image shows that the dominant sharp bands in sample lanes 2–5 have a slightly lower mobility than the band of 20 mer from the ladder, which confirms the presence of synthesized 21-mer oligonucleotides. The band intensities of the 21-mer product in all the lanes are higher, which is directly related to the amount of 21-mer sequence in the synthesized product, including the truncated products. The PAGE image also reveals multiple bands of lower intensities compared to the target band, which directly correspond to the truncated products from the same synthesis with a negligible amount. However, the sum of these negligible amounts of truncated sequences is highly comparable to the amount of target sequence. The gel electrophoresis results of 21-mer oligos support the MALDI-TOF/TOF MS analysis and it is clear from both analyses that 21-mer oligos were synthesized with a large number of truncated products. It is also clear that the it is difficult to provide an accurate yield and quality of the synthesized target sequence, even though it was calculated from the trityl cation absorbance during each cycle. Without capping step inclusion, it will not be wise to predict the yield accurately only on the basis of trityl cation absorbance. Therefore, it is highly recommended that the synthesis conditions are optimized further for synthesizing the long chain oligos (>15 bases) with high purity. From the oligo synthesis (<15 bases) results, it is explicit that such negligibly low amounts of truncated products are expected to not interfere with the application of the synthesized oligos. We found that, at this length, the resulting oligonucleotides were of a sufficiently high quality, but we still required further analysis and optimization in the case of long chain oligo synthesis on-chip. Fortunately, however, many biochemical applications do not have stringent purity requirements, and if the coupling efficiency is high enough, a mixture of produced products can often be used with either minimal (desalting) or no purification [27].

4. Conclusions A simple PDMS microfluidic device is demonstrated for on-chip reverse chemical syntheses of oligonucleotides (50-30) without inert atmosphere. In this work, we have synthesized oligonucleotides up to 21 bases with optimized microfluidic synthesis conditions. The results confirm that the developed system, to some extent, is suitable for overcoming the limitation of inert atmosphere for short-chain oligo synthesis. The sealed microchamber and anhydrous conditions were most significant to achieve the adequate protection from atmospheric moisture. The design of the microchamber provides a systematic orientation to the CPG particles, which results in synthesizing oligos with more than a 75% yield by uniform interaction with synthesis reagents. The MS results also demonstrate that reverse synthesis with the developed microfluidic system provides a sufficient purity of short-chain oligonucleotides (<15-mer) with an acceptably low amount of truncated sequences. The reproducibility of synthesis by the developed system opens ups the possibility of designing an automated programmable microfluidic system with multichannel synthesis in the future. However, the optimization of synthesis conditions is still required for long-chain oligos. In future work, we will also investigate methods for the analysis of synthesized oligos for precise quality and accurate yield determination with the introduction of a capping step in the synthesis cycle. We are also developing a computer controlled programmable system for on-demand syntheses of oligonucleotides and oligopeptides, which can further be used for various biosensing, biotechnology, and molecular biology applications.

Supplementary Materials: The following are available online at http://www.mdpi.com/2076-3417/9/7/1357/s1. Figure S1: Illustration of PDMS microchip fabrication steps. Figure S2: (a) Photograph of the experimental setup Appl. Sci. 2019, 9, 1357 12 of 13

(Inset shows an end of inlet PTFE tube attached with needle). (b) Photograph of the PDMS chamber filled with CPGs, and it clearly depict a monolayer of glass particles. Figure S3: MS spectra of different oligonucleotides of 10 bases of length. Figure show the optimization of coupling time and 2nd washing step for high coupling efficiency. (a)–(d) graph shows the effect of increasing coupling time on product yield as desired sequence produce sharp and high intensity peak as major product of the synthesis. Synthesis conditions are described in the MS spectra for each synthesis. Blue color indicates the changed parameter and green color indicate the parameters which remained same. Figure S4: MALDI-MS of 10-mer oligos with and without. Capping steps. Detailed synthesis conditions and 10-mer oligos information are mentioned in the above graph. Figure S5: MALDI-TOF/TOF MS spectra of 10 mer oligonucleotide (CCAGTCAGTC, m/z = 2987) with optimized conditions. Synthesis was performed with anhydrous reagents without molecular sieve exposure. Data shows multiple truncated products as major product while desired sequence is produced as minor product. Figure S6: Shows MALDI-TOF/TOF MS of 5-mer oligo at different laser intensities. Figure S7: Image of the glass vial for the collection of DMT cation fragment during deblocking step and washing step. Table S1: Synthesis and Flow Conditions for On-chip Synthesis of Reverse Oligonucleotide. Table S2: Shows the absorbance values obtained after trityl absorbance from 7-mer oligonucleotide synthesis. Author Contributions: R.B., and Y.T. designed the research and provided funding and intellectual support. R.B. performed the experiments and wrote the original draft of the manuscript. M.B., P.T.T., and Y.T. reviewed and edited the manuscript. All the authors analyzed the data and discussed the results. Funding: This work was supported by CREST program funded by the Japan Science and Technology Agency (JST). Acknowledgments: Akio Miyazato (JAIST) is gratefully acknowledged for their helpful comments on analysis using conventional mass spectrometry. Conflicts of Interest: The authors declare that they have no competing interests.

References

1. Church, G.M.; Gao, Y.; Kosuri, S. Next-generation digital information storage in DNA. Science 2012, 337, 1628. [CrossRef][PubMed] 2. Douglas, S.M.; Dietz, H.; Liedl, T.; Högberg, B.; Graf, F.; Shih, W.M. Self-assembly of DNA into nanoscale three-dimensional shapes. Nature 2009, 459, 414–418. [CrossRef][PubMed] 3. Linko, V.; Ora, A.; Kostiainen, M.A. DNA nanostructures as smart drug-delivery vehicles and molecular devices. Trends Biotechnol. 2015, 33, 586–594. [CrossRef] 4. Pinheiro, A.V.; Han, D.; Shih, W.M.; Yan, H. Challenges and opportunities for structural DNA nanotechnology. Nat. Nanotechnol. 2011, 6, 763–772. [CrossRef][PubMed] 5. Yan, H. DNA-templated self-assembly of protein arrays and highly conductive nanowires. Science 2003, 301, 1882–1884. [CrossRef][PubMed] 6. Matteucci, M.D.; Caruthers, M.H. Synthesis of deoxyoligonucleotides on a polymer support. J. Am. Chem. Soc. 1981, 103, 3185–3191. [CrossRef] 7. Caruthers, M.H. The chemical synthesis of DNA/rna: Our gift to science. J. Biol. Chem. 2013, 288, 1420–1427. [CrossRef][PubMed] 8. Claeboe, C.D.; Gao, R.; Hecht, S.M. 30-modified oligonucleotides by reverse DNA synthesis. Nucleic Acids Res. 2003, 31, 5685–5691. [CrossRef] 9. Koga, M.; Moore, M.F.; Beaucage, S.L. Alternating.Alpha.,.Beta.-oligothymidylates with alternating (30.Fwdarw.30)- and (50.Fwdarw.50)-internucleotidic phosphodiester linkages as models for antisense oligodeoxyribonucleotides. J. Org. Chem. 1991, 56, 3757–3759. [CrossRef] 10. Koga, M.; Wilk, A.; Moore, M.F.; Scremin, C.L.; Zhou, L.; Beaucage, S.L. Synthesis and physicochemical properties of alternating. α,β-oligodeoxyribonucleotides with alternating (30.Fwdarw.30)- and (50.Fwdarw.50)-internucleotidic phosphodiester linkages. J. Org. Chem. 1995, 60, 1520–1530. [CrossRef] 11. Wagner, T.; Pfleiderer, W. Nucleotides, part lxv, synthesis of 20-deoxyribonucleoside 50-phosphoramidites: New building blocks for the inverse (50-30)-oligonucleotide approach. Helv. Chim. Acta 2000, 83, 2023–2035. [CrossRef] 12. Gierahn, T.M.; Wadsworth, M.H.; Hughes, T.K.; Bryson, B.D.; Butler, A.; Satija, R.; Fortune, S.; Love, J.C.; Shalek, A.K. Seq-well: Portable, low-cost rna sequencing of single cells at high throughput. Nat. Methods 2017, 14, 395–398. [CrossRef][PubMed] 13. Zilionis, R.; Nainys, J.; Veres, A.; Savova, V.; Zemmour, D.; Klein, A.M.; Mazutis, L. Single-cell barcoding and sequencing using droplet microfluidics. Nat. Protoc. 2016, 12, 44–73. [CrossRef][PubMed] 14. Whitesides, G.M. The origins and the future of microfluidics. Nature 2006, 442, 368–373. [CrossRef] Appl. Sci. 2019, 9, 1357 13 of 13

15. Elvira, K.S.; i Solvas, X.C.; Wootton, R.C.R.; deMello, A.J. The past, present and potential for microfluidic reactor technology in chemical synthesis. Nat. Chem. 2013, 5, 905–915. [CrossRef][PubMed] 16. Lee, C.C. Multistep synthesis of a radiolabeled imaging probe using integrated microfluidics. Science 2005, 310, 1793–1796. [CrossRef][PubMed] 17. Wang, J.; Sui, G.; Mocharla, V.P.; Lin, R.J.; Phelps, M.E.; Kolb, H.C.; Tseng, H.-R. Integrated microfluidics for parallel screening of an in situ click chemistry library. Angew. Chem. Int. Ed. 2006, 45, 5276–5281. [CrossRef] [PubMed] 18. Hua, Z.; Xia, Y.; Srivannavit, O.; Rouillard, J.-M.; Zhou, X.; Gao, X.; Gulari, E. A versatile microreactor platform featuring a chemical-resistant microvalve array for addressable multiplex syntheses and assays. J. Micromech. Microeng. 2006, 16, 1433–1443. [CrossRef] 19. Huang, Y.; Castrataro, P.; Lee, C.-C.; Quake, S.R. Solvent resistant microfluidic DNA synthesizer. Lab Chip 2007, 7, 24–26. [CrossRef] 20. Rolland, J.P.; Van Dam, R.M.; Schorzman, D.A.; Quake, S.R.; DeSimone, J.M. Solvent-resistant photocurable “liquid teflon” for microfluidic device fabrication. J. Am. Chem. Soc. 2004, 126, 2322–2323. [CrossRef] [PubMed] 21. Lee, C.-C.; Snyder, T.M.; Quake, S.R. A microfluidic oligonucleotide synthesizer. Nucleic Acids Res. 2010, 38, 2514–2521. [CrossRef] 22. Bhardwaj, R.; Lightson, N.; Ukita, Y.; Takamura, Y. Development of oligopeptide-based novel biosensor by solid-phase peptide synthesis on microchip. Sensors Actuators B Chem. 2014, 192, 818–825. [CrossRef] 23. Beaucage, S.L.; Caruthers, M.H. Deoxynucleoside phosphoramidites—A new class of key intermediates for deoxypolynucleotide synthesis. Tetrahedron Lett. 1981, 22, 1859–1862. [CrossRef] 24. Matteucci, M.D.; Caruthers, M.H. The synthesis of oligodeoxyprimidines on a polymer support. Tetrahedron Lett. 1980, 21, 719–722. [CrossRef] 25. Guzaev, A.P.; Pon, R.T. Attachment of nucleosides and other linkers to solid-phase supports for oligonucleotide synthesis. Curr. Protoc. Nucleic Acid Chem. 2013, 52, 3.2.1–3.2.23. 26. LeProust, E.M.; Peck, B.J.; Spirin, K.; McCuen, H.B.; Moore, B.; Namsaraev, E.; Caruthers, M.H. Synthesis of high-quality libraries of long (150mer) oligonucleotides by a novel depurination controlled process. Nucleic Acids Res. 2010, 38, 2522–2540. [CrossRef][PubMed] 27. Pon, R.T.; Buck, G.A.; Hager, K.M.; Naeve, C.W.; Niece, R.L.; Robertson, M.; Smith, A.J. Multi-facility survey of oligonucleotide synthesis and an examination of the performance of unpurified primers in automated DNA sequencing. Biotechniques 1996, 21, 680–685.

© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).