DOCSLIB.ORG

Role of CD44 in the Reaction of Vascular Smooth Muscle Cells to Arterial Wall Injury

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Role of CD44 in the Reaction of Vascular Smooth Muscle Cells to Arterial Wall Injury Role of CD44 in the reaction of vascular smooth muscle cells to arterial wall injury. M Jain, … , M E Lee, E Haber J Clin Invest. 1996;97(3):596-603. https://doi.org/10.1172/JCI118455. Research Article CD44, the principal receptor for hyaluronic acid, is a widely distributed cell surface proteoglycan involved in cellular activation, proliferation, and migration. These processes are also central to the vascular smooth muscle cell's response to arterial wall injury. We evaluated the expression of CD44 and its isoform, CD44-V6, on vascular smooth muscle cells in vitro and in vivo and assessed the role of CD44 in DNA synthesis. Cultured vascular smooth muscle cells expressed CD44 and CD44-V6 at levels equal to or higher than those of the beta 1 and beta 2 integrins. In a rat carotid artery balloon injury model, CD44 and CD44-V6 mRNAs were unregulated in vascular smooth muscle cells after injury, and CD44 protein expression was greatest at the luminal edge of the growing neointima. CD44-expressing smooth muscle cells proliferated actively, and hyaluronic acid expression increased after injury in a temporal pattern similar to that of CD44. Through binding to hyaluronic acid, CD44 augmented DNA synthesis in cultured human and rat smooth muscle cells by 48 +/- 7.8 and 100 +/- 12.5%, respectively, an effect inhibited by an anti-CD44 antibody that blocked hyaluronate binding. These observations support a role for CD44 in the reaction of vascular smooth muscle cells to arterial wall injury. Find the latest version: https://jci.me/118455/pdf Role of CD44 in the Reaction of Vascular Smooth Muscle Cells to Arterial Wall Injury Mukesh Jain,§ Qi He,* Wen-Sen Lee,‡ Saori Kashiki,* Lauren C. Foster,* Jer-Chia Tsai,* Mu-En Lee,‡ʈ and Edgar Haber‡ *Cardiovascular Biology Laboratory, Harvard School of Public Health; ‡Department of Medicine, Harvard Medical School; §Cardiovascular Division, Beth Israel Hospital; and ʈCardiovascular Division, Brigham and Women’s Hospital, Boston, Massachusetts 02115 Abstract cur in coronary artery bypass grafts and in the concentric lumi- nal narrowing that follows balloon angioplasty and arterioscle- CD44, the principal receptor for hyaluronic acid, is a widely rosis associated with transplantation (1, 2). In the course of distributed cell surface proteoglycan involved in cellular ac- these processes the smooth muscle cell phenotype changes tivation, proliferation, and migration. These processes are from that of a contractile cell that replicates slowly to that of a also central to the vascular smooth muscle cell’s response to migratory cell that proliferates rapidly and secretes abundant arterial wall injury. We evaluated the expression of CD44 extracellular matrix (3). Soluble growth factors, cytokines, and and its isoform, CD44-v6, on vascular smooth muscle cells vasoactive agents released in a paracrine manner by inflamma- in vitro and in vivo and assessed the role of CD44 in DNA tory cells, or in an autocrine manner by smooth muscle cells synthesis. Cultured vascular smooth muscle cells expressed themselves, are believed to play important roles in initiating CD44 and CD44-v6 at levels equal to or higher than those these phenotypic changes. Adhesion and signaling molecules of the ␤1 and ␤3 integrins. In a rat carotid artery balloon in- found on the cell surface, such as the ␤1 and ␤3 integrins (4, 5) jury model, CD44 and CD44-v6 mRNAs were upregulated and vascular cell adhesion molecule-1 (6), have also been im- in vascular smooth muscle cells after injury, and CD44 pro- plicated in modulating smooth muscle cell function. tein expression was greatest at the luminal edge of the grow- CD44 is a cell surface proteoglycan that has been described ing neointima. CD44-expressing smooth muscle cells prolif- on a variety of cell types. It is highly pleomorphic: 10 exons en- erated actively, and hyaluronic acid expression increased code a CD44 sequence that is expressed generally, but one or after injury in a temporal pattern similar to that of CD44. more of 10 variable exons can be inserted by alternative splic- Through binding to hyaluronic acid, CD44 augmented ing (7, 8). CD44 plays a role in extracellular matrix binding, DNA synthesis in cultured human and rat smooth muscle cell migration, lymphocyte activation, lymphocyte homing, cells by 48Ϯ7.8 and 100Ϯ12.5%, respectively, an effect in- and proliferation of bronchial smooth muscle cells (7–10). An hibited by an anti-CD44 antibody that blocked hyaluronate isoform of CD44 containing the sixth variable exon, CD44-v6, binding. These observations support a role for CD44 in the has been shown to confer metastatic potential to rat carcinoma reaction of vascular smooth muscle cells to arterial wall in- cells (11). jury. (J. Clin. Invest. 1996. 97:596–603.) Key words: pro- We examine in this study the role of CD44 and its isoform, teoglycans • hyaluronic acid • smooth muscle cells • DNA CD44-v6, in the response of vascular smooth muscle cells to synthesis • carotid artery arterial wall injury. We show in vitro that CD44 and CD44-v6 are expressed abundantly on cultured smooth muscle cells. We Introduction show in vivo that CD44 and CD44-v6 mRNA and CD44 pro- tein are expressed minimally on smooth muscle cells in the me- The migration of smooth muscle cells from their normal place dia of normal arteries but are expressed highly on smooth in the tunica media to the intima, their subsequent prolifera- muscle cells in the neointima of injured arteries. We also pro- tion, and the formation of a fibrous plaque are central features vide evidence that the specific binding of hyaluronic acid to of the advanced arteriosclerotic lesion. Smooth muscle cell CD44 on smooth muscle cells produces a significant increase proliferation is also prominent in the occlusive lesions that oc- in DNA synthesis. Methods M. Jain and Q. He contributed equally to this work. Address correspondence to Dr. Edgar Haber, Cardiovascular Bi- Cell culture. Rat aortic smooth muscle cells (RASMCs)1 were har- ology Laboratory, Harvard School of Public Health, 677 Huntington vested from the thoracic aorta of adult male Sprague-Dawley rats Avenue, Boston, MA 02115. Phone: 617-432-1010; FAX: 617-432- (200–250 g) by enzymatic dissociation according to the method of 4098. E-mail: [email protected]. Q. He’s present Gunther et al. (12). The cells were grown in DME (JRH Biosciences, address is Department of Molecular and Cellular Biology, Harvard Lenexa, KS) supplemented with 10% FCS, penicillin (100 U/ml), University, 7 Divinity Avenue, Cambridge, MA 02138. J.-C. Tsai’s streptomycin (100 ␮g/ml), and 25 mM Hepes, pH 7.4, in a humidified present address is Kaohsiung Medical College, 100 Shih-Chuan First incubator (37ЊC, 5% CO2). Human aortic smooth muscle cells Road, Kaohsiung, Taiwan. (HASMCs; Clonetics, San Diego) were grown in M199 medium Received for publication 14 July 1995 and accepted in revised form (GIBCO BRL, Grand Island, NY) containing 20% FCS, penicillin 14 November 1995. J. Clin. Invest. © The American Society for Clinical Investigation, Inc. 1. Abbreviations used in this paper: b-PG, biotinylated proteoglycan; 0021-9738/96/02/0596/08 $2.00 HASMC, human aortic smooth muscle cell; RASMC, rat aortic Volume 97, Number 3, February 1996, 596–603 smooth muscle cell. 596 Jain, He, Lee, Kashiki, Foster, Tsai, Lee, and Haber (100 U/ml), streptomycin (100 ␮g/ml), and 25 mM Hepes (pH 7.4). In situ hybridization. In situ hybridization for CD44 mRNA was Cells from passages 5–7 were used. performed as described (17) with minor modifications. Adult male Amplification of CD44 and CD44-v6 from RASMC. The two Sprague-Dawley rats were perfused with 4% paraformaldehyde at 2, cDNA fragments were amplified from RASMC RNA by reverse 5, and 8 d after balloon injury. Carotid arteries were removed, post- transcriptase PCR as described (13). Primers were designed accord- fixed with 4% paraformaldehyde, soaked in 30% sucrose until the tis- ing to the published rat CD44 sequence (11). Forward (5Ј AGC- sue had sunk, embedded in optimum cutting temperature compound, CAGTGACAGGTTCCATT 3Ј) and reverse (5Ј TGTTGTGTCTT- and stored in isopentane at Ϫ80ЊC until they were cut at a thickness TTCAAGTTA 3Ј) primers were used to amplify a 1,228-bp fragment of 5 ␮m. CD44 mRNA was detected by hybridization with a for CD44, and forward (5Ј GGCGGATCCTAAATAGCCAACG [35S]UTP-labeled antisense cRNA probe synthesized with T7 RNA 3Ј) and reverse (5Ј GGCGGATCCTTCTGTCACATGGGAG 3Ј) polymerase from XbaI-linearized rat CD44 in Bluescript II SKϮ. For primers were used to amplify a 104-bp fragment representing the v6 control experiments, a [35S]UTP-labeled sense cRNA probe was syn- exon (CD44-v6). The PCR fragments were then subcloned and thesized with T3 RNA polymerase from HindIII-linearized rat CD44 ف their sequences were confirmed by the dideoxy chain termination in Bluescript II SKϮ. RNA probes were degraded to a length of method (13). 500 nucleotides by partial hydrolysis for 5 min at 60ЊC in 80 mM RNA extraction and RNA blot analysis. Tissue from adult male NaHCO3 and 120 mM Na2CO3. After the hybridization procedure Sprague-Dawley rats that had been subjected to balloon injury of the the tissue sections were washed under moderately stringent condi- carotid artery (by the Zivic Miller Company, Zelienople, PA) was tions as described (17). The dried tissue sections were then dipped studied at various points after injury. Rats were anesthetized with into Kodak NTB2 emulsion (Eastman Kodak, Rochester, NY) and chloral hydrate, and the injured carotid arteries were isolated. Total exposed for 2–4 d at 4ЊC. Counterstaining was performed with hema- RNA from carotid arteries was extracted by the RNA-Zol method toxylin-eosin. (Cinna/Biotecx Laboratories International, Houston, TX). Total Immunocytochemistry. Adult male Sprague-Dawley rats were RNA from RASMCs and HASMCs was obtained by guanidinium killed 4, 7, 9, and 16 d after balloon injury.
Load more

Recommended publications
  • Quantitation of the Number of Molecules of Glycophorins C and D on Normal Red Blood Cells Using Radioiodinatedfab Fragments of Monoclonal Antibodies
    Quantitation of the Number of Molecules of Glycophorins C and D on Normal Red Blood Cells Using RadioiodinatedFab Fragments of Monoclonal Antibodies By Jon Smythe, Brigitte Gardner, andDavid J. Anstee Two rat monoclonal antibodies (BRAC 1 and BRAC 1 1 ) cytes. Fabfragments of BRAC 1 1 and ERIC 10 gave values have been produced. BRAC 1 recognizes an epitope com- of 143,000 molecules GPC per red blood cell (RBC). Fab mon to the human erythrocyte membrane glycoproteins fragments of BRAC1 gave 225,000 molecules of GPC and glycophorin C (GPC) and glycophorin D (GPD). BRAC 11 GPD per RBC. These results indicate that GPC and GPD is specific for GPC. Fabfragments of these antibodies and together are sufficiently abundantto provide membrane at- BRlC 10, a murine monoclonal anti-GPC,were radioiodin- tachment sites for all ofthe protein 4.1 in normal RBCs. ated and used in quantitative binding assays to measure 0 1994 by The American Societyof Hematology. the number of GPC and GPD molecules on normal erythro- HE SHAPE AND deformability of the mature human (200,000)" and those reported for GPC (50,000).7 This nu- Downloaded from http://ashpublications.org/blood/article-pdf/83/6/1668/612763/1668.pdf by guest on 24 September 2021 T erythrocyte is controlled by a flexible two-dimensional merical differencehas led to the suggestion that a significant lattice of proteins, which together comprise the membrane proportion of protein 4.1 in normal erythrocyte membranes skeleton.' The major components of the skeleton are spec- must be bound to sites other than GPC and GPD.3 The trin, actin, ankyrin, and protein 4.1.
    [Show full text]
  • Syndecan-1 Depletion Has a Differential Impact on Hyaluronic Acid Metabolism and Tumor Cell Behavior in Luminal and Triple-Negative Breast Cancer Cells
    International Journal of Molecular Sciences Article Syndecan-1 Depletion Has a Differential Impact on Hyaluronic Acid Metabolism and Tumor Cell Behavior in Luminal and Triple-Negative Breast Cancer Cells Sofía Valla 1,2 , Nourhan Hassan 3 , Daiana Luján Vitale 2,4 , Daniela Madanes 5, Fiorella Mercedes Spinelli 2,4, Felipe C. O. B. Teixeira 3, Burkhard Greve 6 , Nancy Adriana Espinoza-Sánchez 3,6 , Carolina Cristina 1,2, Laura Alaniz 2,4,* and Martin Götte 3,* 1 Laboratorio de Fisiopatología de la Hipófisis, Centro de Investigaciones Básicas y Aplicadas (CIBA), Universidad Nacional del Noroeste de la Provincia de Buenos Aires (UNNOBA), Libertad 555, Junín (B6000), Buenos Aires 2700, Argentina; sofi[email protected] (S.V.); [email protected] (C.C.) 2 Centro de Investigaciones y Transferencia del Noroeste de la Provincia de Buenos Aires (CITNOBA, UNNOBA-UNSAdA-CONICET), Buenos Aires 2700, Argentina; [email protected] (D.L.V.); fi[email protected] (F.M.S.) 3 Department of Gynecology and Obstetrics, Münster University Hospital, Domagkstrasse 11, 48149 Münster, Germany; [email protected] (N.H.); [email protected] (F.C.O.B.T.); [email protected] (N.A.E.-S.) 4 Laboratorio de Microambiente Tumoral, Centro de Investigaciones Básicas y Aplicadas (CIBA), Universidad Nacional del Noroeste de la Provincia de Buenos Aires (UNNOBA), Libertad 555, Junín (B6000), Citation: Valla, S.; Hassan, N.; Vitale, Buenos Aires 2700, Argentina 5 Laboratorio de Inmunología de la Reproducción, Instituto de Biología y Medicina Experimental—Consejo D.L.; Madanes, D.; Spinelli, F.M.; Nacional de Investigaciones Científicas y Técnicas (IBYME-CONICET), Vuelta de Obligado 2490, Ciudad Teixeira, F.C.O.B.; Greve, B.; Autónoma de Buenos Aires (C1428ADN), Buenos Aires 2700, Argentina; [email protected] Espinoza-Sánchez, N.A.; Cristina, C.; 6 Department of Radiotherapy—Radiooncology, Münster University Hospital, Robert-Koch-Str.
    [Show full text]
  • The CD44-Initiated Pathway of T-Cell Extravasation Uses VLA-4 but Not LFA-1 for Firm Adhesion
    The CD44-initiated pathway of T-cell extravasation uses VLA-4 but not LFA-1 for firm adhesion Mark H. Siegelman, … , Diana Stanescu, Pila Estess J Clin Invest. 2000;105(5):683-691. https://doi.org/10.1172/JCI8692. Article Leukocytes extravasate from the blood in response to physiologic or pathologic demands by means of complementary ligand interactions between leukocytes and endothelial cells. The multistep model of leukocyte extravasation involves an initial transient interaction (“rolling” adhesion), followed by secondary (firm) adhesion. We recently showed that binding of CD44 on activated T lymphocytes to endothelial hyaluronan (HA) mediates a primary adhesive interaction under shear stress, permitting extravasation at sites of inflammation. The mechanism for subsequent firm adhesion has not been elucidated. Here we demonstrate that the integrin VLA-4 is used in secondary adhesion after CD44-mediated primary adhesion of human and mouse T cells in vitro, and by mouse T cells in an in vivo model. We show that clonal cell lines and polyclonally activated normal T cells roll under physiologic shear forces on hyaluronate and require VCAM-1, but not ICAM-1, as ligand for subsequent firm adhesion. This firm adhesion is also VLA-4 dependent, as shown by antibody inhibition. Moreover, in vivo short-term homing experiments in a model dependent on CD44 and HA demonstrate that superantigen-activated T cells require VLA-4, but not LFA-1, for entry into an inflamed peritoneal site. Thus, extravasation of activated T cells initiated by CD44 binding to HA depends upon VLA-4–mediated firm adhesion, which may explain the frequent association of these adhesion receptors with diverse chronic inflammatory processes.
    [Show full text]
  • Regulation of Cellular Adhesion Molecule Expression in Murine Oocytes, Peri-Implantation and Post-Implantation Embryos
    Cell Research (2002); 12(5-6):373-383 http://www.cell-research.com Regulation of cellular adhesion molecule expression in murine oocytes, peri-implantation and post-implantation embryos 1,2 1,2 2 1, DAVID P LU , LINA TIAN , CHRIS O NEILL , NICHOLAS JC KING * 1Department of Pathology, University of Sydney, NSW 2006 Australia 2Human Reproduction Unit, Department of Physiology, University of Sydney, Royal North Shore Hospital, NSW 2065, Australia ABSTRACT Expression of the adhesion molecules, ICAM-1, VCAM-1, NCAM, CD44, CD49d (VLA-4, α chain), and CD11a (LFA-1, α chain) on mouse oocytes, and pre- and peri-implantation stage embryos was examined by quantitative indirect immunofluorescence microscopy. ICAM-1 was most strongly expressed at the oocyte stage, gradually declining almost to undetectable levels by the expanded blastocyst stage. NCAM, also ex- pressed maximally on the oocyte, declined to undetectable levels beyond the morula stage. On the other hand, CD44 declined from highest expression at the oocyte stage to show a second maximum at the com- pacted 8-cell/morula. This molecule exhibited high expression around contact areas between trophectoderm and zona pellucida during blastocyst hatching. CD49d was highly expressed in the oocyte, remained signifi- cantly expressed throughout and after blastocyst hatching was expressed on the polar trophectoderm. Like CD44, CD49d declined to undetectable levels at the blastocyst outgrowth stage. Expression of both VCAM- 1 and CD11a was undetectable throughout. The diametrical temporal expression pattern of ICAM-1 and NCAM compared to CD44 and CD49d suggest that dynamic changes in expression of adhesion molecules may be important for interaction of the embryo with the maternal cellular environment as well as for continuing development and survival of the early embryo.
    [Show full text]
  • CD44 and Integrin Matrix Receptors Participate in Cartilage Homeostasis
    CMLS, Cell. Mol. Life Sci. 59 (2002) 36–44 1420-682X/02/010036-09 $ 1.50 + 0.20/0 © Birkhäuser Verlag, Basel, 2002 CMLS Cellular and Molecular Life Sciences CD44 and integrin matrix receptors participate in cartilage homeostasis W. Knudson a, * and R. F. Loeser a, b a Department of Biochemistry, Rush Medical College, Rush-Presbyterian-St. Luke’s Medical Center, Chicago, Illinois 60612 (USA), Fax +1 312 942 3053, e-mail: [email protected] b Section of Rheumatology, Rush Medical College, Rush-Presbyterian-St. Luke’s Medical Center, Chicago, Illinois 60612 (USA) Abstract. Articular chondrocytes express the matrix re- to detect changes in matrix composition or to function as ceptors CD44 and integrins. Both of these receptors ex- mechanotransducers. Disruption of CD44 or integrin- hibit interactions with adjacent extracellular matrix mediated cell-matrix interactions, either experimentally macromolecules. In addition, both integrins and CD44 induced or when present in osteoarthritis, have profound have the capacity for signal transduction as well as mod- effects on cartilage metabolism. Thus, CD44 and integrin ulated interactions with the actin cytoskeleton. As such, receptors play a critical role in maintaining cartilage both receptor families provide the chondrocytes a means homeostasis. Key words. CD44; hyaluronan; proteoglycan; integrin; collagen; fibronectin; chondrocyte. In many tissues, carefully regulated cell-matrix interac- drocytes, CD44 represents the primary receptor responsi- tions are responsible for maintaining tissue homeostasis ble for hyaluronan (HA) binding [4, 9]. However, in carti- [1–4]. Most cell-matrix interactions are mediated via lage, HA is seldom present as a pure molecule. Often more transmembrane receptors. Articular chondrocytes have than 50 aggrecan proteoglycan (PG) monomers together been shown to express both integrin [5–7]) as well as with an associated link protein become bound to a single nonintegrin (e.g., annexin V and CD44) extracellular ma- filament of HA [13].
    [Show full text]
  • Proteome of Stored RBC Membrane and Vesicles from Heterozygous Beta Thalassemia Donors
    International Journal of Molecular Sciences Article Proteome of Stored RBC Membrane and Vesicles from Heterozygous Beta Thalassemia Donors Vassilis L. Tzounakas 1,†, Alkmini T. Anastasiadi 1,†, Monika Dzieciatkowska 2, Dimitrios G. Karadimas 1, Konstantinos Stamoulis 3, Issidora S. Papassideri 1, Kirk C. Hansen 2, Angelo D’Alessandro 2 , Anastasios G. Kriebardis 4,* and Marianna H. Antonelou 1,* 1 Department of Biology, School of Science, National and Kapodistrian University of Athens (NKUA), 15784 Athens, Greece; [email protected] (V.L.T.); [email protected] (A.T.A.); [email protected] (D.G.K.); [email protected] (I.S.P.) 2 Department of Biochemistry and Molecular Genetics, School of Medicine–Anschutz Medical Campus, University of Colorado, Aurora, CO 80045, USA; [email protected] (M.D.); [email protected] (K.C.H.); [email protected] (A.D.) 3 Hellenic National Blood Transfusion Centre, Acharnes, 13677 Athens, Greece; [email protected] 4 Laboratory of Reliability and Quality Control in Laboratory Hematology (HemQcR), Department of Biomedical Sciences, School of Health & Welfare Sciences, University of West Attica (UniWA), 12243 Egaleo, Greece * Correspondence: [email protected] (A.G.K.); [email protected] (M.H.A.) † These authors contributed equally to this work. Abstract: Genetic characteristics of blood donors may impact the storability of blood products. Despite higher basal stress, red blood cells (RBCs) from eligible donors that are heterozygous for Citation: Tzounakas, V.L.; beta-thalassemia traits (βThal+) possess a differential nitrogen-related metabolism, and cope better Anastasiadi, A.T.; Dzieciatkowska, with storage stress compared to the control.
    [Show full text]
  • A Comprehensive Review of Our Current Understanding of Red Blood Cell (RBC) Glycoproteins
    membranes Review A Comprehensive Review of Our Current Understanding of Red Blood Cell (RBC) Glycoproteins Takahiko Aoki Laboratory of Quality in Marine Products, Graduate School of Bioresources, Mie University, 1577 Kurima Machiya-cho, Mie, Tsu 514-8507, Japan; [email protected]; Tel.: +81-59-231-9569; Fax: +81-59-231-9557 Received: 18 August 2017; Accepted: 24 September 2017; Published: 29 September 2017 Abstract: Human red blood cells (RBC), which are the cells most commonly used in the study of biological membranes, have some glycoproteins in their cell membrane. These membrane proteins are band 3 and glycophorins A–D, and some substoichiometric glycoproteins (e.g., CD44, CD47, Lu, Kell, Duffy). The oligosaccharide that band 3 contains has one N-linked oligosaccharide, and glycophorins possess mostly O-linked oligosaccharides. The end of the O-linked oligosaccharide is linked to sialic acid. In humans, this sialic acid is N-acetylneuraminic acid (NeuAc). Another sialic acid, N-glycolylneuraminic acid (NeuGc) is present in red blood cells of non-human origin. While the biological function of band 3 is well known as an anion exchanger, it has been suggested that the oligosaccharide of band 3 does not affect the anion transport function. Although band 3 has been studied in detail, the physiological functions of glycophorins remain unclear. This review mainly describes the sialo-oligosaccharide structures of band 3 and glycophorins, followed by a discussion of the physiological functions that have been reported in the literature to date. Moreover, other glycoproteins in red blood cell membranes of non-human origin are described, and the physiological function of glycophorin in carp red blood cell membranes is discussed with respect to its bacteriostatic activity.
    [Show full text]
  • Resolving the Distinct Stages in Erythroid Differentiation Based on Dynamic Changes in Membrane Protein Expression During Erythropoiesis
    Resolving the distinct stages in erythroid differentiation based on dynamic changes in membrane protein expression during erythropoiesis Ke Chena,1, Jing Liua,1, Susanne Heckb, Joel A. Chasisc, Xiuli Ana,d,2, and Narla Mohandasa aRed Cell Physiology Laboratory, bFlow Cytometry Core, New York Blood Center, New York, NY 10065; cLife Sciences Division, Lawrence Berkeley National Laboratory, Berkeley, CA 94720; and dDepartment of Biophysics, Peking University Health Science Center, Beijing 100191, China Communicated by Joseph F. Hoffman, Yale University School of Medicine, New Haven, CT, August 18, 2009 (received for review June 25, 2009) Erythropoiesis is the process by which nucleated erythroid progeni- results in loss of cohesion between the bilayer and the skeletal tors proliferate and differentiate to generate, every second, millions network, leading to membrane loss by vesiculation. This diminution of nonnucleated red cells with their unique discoid shape and mem- in surface area reduces red cell life span with consequent anemia. brane material properties. Here we examined the time course of A number of additional transmembrane proteins, including CD44 appearance of individual membrane protein components during and Lu, have been characterized, although their structural organi- murine erythropoiesis to throw new light on our understanding of zation in the membrane has not been fully defined. the evolution of the unique features of the red cell membrane. We Some transmembrane proteins exhibit multiple functions. Band found that the accumulation of all of the major transmembrane and 3 serves as an anion exchanger, while Rh/RhAG are probably gas all skeletal proteins of the mature red blood cell, except actin, accrued transporters (8, 9), and Duffy functions as a chemokine receptor progressively during terminal erythroid differentiation.
    [Show full text]
  • Heterogeneity for Stem Cell–Related Markers According to Tumor Subtype and Histologic Stage in Breast Cancer
    Published OnlineFirst January 26, 2010; DOI: 10.1158/1078-0432.CCR-09-1532 Published Online First on January 26, 2010 as 10.1158/1078-0432.CCR-09-1532 Clinical Human Cancer Biology Cancer Research Heterogeneity for Stem Cell–Related Markers According to Tumor Subtype and Histologic Stage in Breast Cancer So Yeon Park1,2,3, Hee Eun Lee2, Hailun Li4,5,6, Michail Shipitsin3,5, Rebecca Gelman4,5,6, and Kornelia Polyak3,5 Abstract Purpose: To evaluate the expression of stem cell–related markers at the cellular level in human breast tumors of different subtypes and histologic stage. Experimental Design: We performed immunohistochemical analyses of 12 proteins [CD44, CD24, ALDH1, vimentin, osteonectin, EPCR, caveolin 1, connexin 43, cytokeratin 18 (CK18), MUC1, claudin 7, and GATA3] selected based on their differential expression in breast cancer cells with more differenti- ated and stem cell–like characteristics in 47 cases of invasive ductal carcinoma (IDC) only, 135 cases of IDC with ductal carcinoma in situ (DCIS), 35 cases of DCIS with microinvasion, and 58 cases of pure DCIS. We also analyzed 73 IDCs with adjacent DCIS to determine the differences in the expression of markers by histology within individual tumors. CD44+/CD24− and CD24−/CD24+ cells were detected using double immunohistochemistry. Results: CD44 and EPCR expression was different among the four histologic groups and was lower in invasive compared with in situ tumors, especially in luminal A subtype. The expression of vimentin, osteo- nectin, connexin 43, ALDH1, CK18, GATA3, and MUC1 differed by tumor subtype in some histologic groups. ALDH1-positive cells were more frequent in basal-like and HER2+ than in luminal tumors.
    [Show full text]
  • Human B-Cell and Progenitor Stages As
    Human B-Cell and Progenitor Stages as Determined by Probability State Modeling of Multidimensional Cytometry Data Bagwell, CB1, Hill, BL1, Wood BL2, Wallace, PK3, Kelliher, AS4, Preffer, FI4 1 Verity Software House, 2 University of Washington, 3Roswell Park Cancer Institute, 4 Massachusetts General Hospital Introduction B-Cell Staging Results Progenitor Staging Results The development of B lymphocytes in the bone marrow is well-studied due to the importance of understanding the dysregulation that occurs in leukemias and other diseases of the hematopoetic system. This development occurs in a well-ordered progression that can be defined by the sequential up-regulation and down-regulation of markers which can be subdivided into distinct stages 1-3. These stages remain fairly consistent throughout a normal lifetime, but vary with the percentage of cells in a particular stage due to age, exposure to antigens and individual genetics4. Historically in the scientific literature there have been discrepancies and inconsistencies in the timing of the up-regulation or down-regulation of some markers in relationship to other markers 5-8. Since it is important to have a clear picture of these relationships in normal bone marrow in order to diagnose and treat disrupted marrows, we undertook a statistical study of normal B-Cell progression using Probability State Modeling and data files from sixteen normal samples. Probability State Modeling, or PSM, employs algorithms that allow one to model any number of flow cytometry data files and calculate the average expression of markers as well as the correlations between samples and directionality of the markers 9. In addition, with PSM we can perform an unattended analysis of each data file, thus reducing the subjectivity that arises during traditional gating analysis.
    [Show full text]
  • The Use of a Novel MUC1 Antibody to Identify Cancer Stem Cells and Circulating MUC1 in Mice and Patients with Pancreatic Cancer
    Journal of Surgical Oncology The Use of a Novel MUC1 Antibody to Identify Cancer Stem Cells and Circulating MUC1 in Mice and Patients With Pancreatic Cancer 1 2 1 1 JENNIFER M. CURRY, PhD, KYLE J. THOMPSON, PhD, SHANTI G. RAO, DAHLIA M. BESMER, 1 1 2 ANDREA M. MURPHY, PhD, VALERY Z. GRDZELISHVILI, PhD, WILLIAM A. AHRENS, MD, 2 2 2 2 IAIN H. MCKILLOP, PhD, DAVID SINDRAM, MD, PhD, DAVID A. IANNITTI, MD, JOHN B. MARTINIE, MD, 1 AND PINKU MUKHERJEE, PhD * 1Department of Biology, University of North Carolina at Charlotte, Charlotte, North Carolina 2Section of Hepatobiliary and Pancreas Surgery, Department of Surgery, Carolinas Medical Center, Charlotte, North Carolina Background and Objectives: MUC1 is over-expressed and aberrantly glycosylated in >60% of human pancreatic cancer (PC). Development of novel approaches for detection and/or targeting of MUC1 are critically needed and should be able to detect MUC1 on PC cells (including cancer stem cells) and in serum. Methods: The sensitivity and specificity of the anti-MUC1 antibody, TAB 004, was determined. CSCs were assessed for MUC1 expression using TAB 004-FITC on in vitro PC cell lines, and on lineageÀ cells from in vivo tumors and human samples. Serum was assessed for shed MUC1 via the TAB 004 EIA. Results: In vitro and in vivo, TAB 004 detected MUC1 on >95% of CSCs. Approximately, 80% of CSCs in patients displayed MUC1 expression as detected by TAB 004. Shed MUC1 was detected serum in mice with HPAF-II (MUC1high) but not BxPC3 tumors (MUC1low). The TAB 004 EIA was able to accurately detect stage progression in PC patients.
    [Show full text]
  • Putative Markers for Thedetection of Breast Carcinoma Cells in Blood
    British Joumal of Cancer (1998) 77(8), 1203-1207 a 1998 Cancer Research Campaign Putative markers for the detection of breast carcinoma cells in blood EM Eltahir', DS Mallinson2, GD Birnie2, C Hagan1, WD George1 and AD Purushotham1 'University Department of Surgery, Westem Infirmary, Glasgow Gll 6NT; 2Beatson Institute for Cancer Research, Garscube Estate, Bearsden, Glasgow G61 1 BD, UK Summary The aim of this study was to investigate certain genes for their suitability as molecular markers for detection of breast carcinoma cells using the reverse transcriptase-polymerase chain reaction (RT-PCR). RNA was prepared from MCF-7 breast carcinoma cells and peripheral blood leucocytes of healthy female volunteers. This RNA was screened for mRNA of MUC1, cytokeratin 19 (CK19) and CD44 (exons 8-11) by RT-PCR and the results validated by Southern blots. Variable degrees of expression of MUC1 and CD44 (exons 5-11) were detected in normal peripheral blood, rendering these genes non-specific for epithelial cells and therefore unsuitable for use as markers to detect breast carcinoma cells. Although CK1 9 mRNA was apparently specific, it was deemed unsuitable for use as a marker of breast cancer cells in light of its limited sensitivity. Furthermore, an attempt at using nested primers to increase sensitivity resulted in CK19 mRNA being detected after two amplification rounds in blood from healthy volunteers. Keywords: breast carcinoma cells; reverse transcriptase-polymerase chain reaction; specificity of markers Breast cancer is a significant world-wide public health problem. are uncommon and, consequently, putative tissue-specific mRNAs The lifetime risk of a woman developing breast cancer is 1 in 8 and have been used as molecular markers to detect circulating tumour the risk of dying from disseminated disease is 1 in 30 (Feuer et al, cells by RT-PCR (Smith et al, 1991; Burchill et al, 1994; Brown 1993).
    [Show full text]