Characterization of a Cell Death Suppressing Effector Broadly Conserved Across the Fungal Kingdom Ehren Lee Whigham Iowa State University

Iowa State University Capstones, Theses and Graduate Theses and Dissertations Dissertations

2013 Characterization of a cell death suppressing effector broadly conserved across the fungal kingdom Ehren Lee Whigham Iowa State University

Follow this and additional works at: https://lib.dr.iastate.edu/etd Part of the Agricultural Science Commons, Agriculture Commons, and the Plant Pathology Commons

Recommended Citation Whigham, Ehren Lee, "Characterization of a cell death suppressing effector broadly conserved across the fungal kingdom" (2013). Graduate Theses and Dissertations. 13431. https://lib.dr.iastate.edu/etd/13431

This Thesis is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State University Digital Repository. It has been accepted for inclusion in Graduate Theses and Dissertations by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected].

Characterization of a cell death suppressing effector broadly conserved across the fungal kingdom

Ehren L. Whigham

A thesis submitted to the graduate faculty

in partial fulfillment of the requirements for the degree of

MASTER OF SCIENCE

Major: Plant Pathology

Program of Study Committee: Roger P. Wise, Major Professor Adam Bogdanove Erik Vollbrecht

Iowa State University Ames, Iowa 2013

TABLE OF CONTENTS

GLOSSARY/ABBREVIATIONS ...... iii

ABSTRACT ...... iv

CHAPTER 1 GENERAL INTRODUCTION ...... 1 Thesis Organization ...... 1 Literature Review ...... 1 References ...... 12

CHAPTER 2 AN EFFECTOR BROADLY CONSERVED ACROSS THE FUNGAL KINGDOM SUPPRESSES CELL DEATH ...... 17 Introduction ...... 17 Results ...... 19 Discussion ...... 35 Materials and Methods ...... 39 Acknowledgements ...... 47 Author Contributions ...... 47 References ...... 47

CHAPTER 3 ITAG BARLEY: A 9-12 CLASSROOM MODULE TO EXPLORE GENE EXPRESSION AND SEGREGATION USING OREGON WOLFE BARLEY ...... 53 Overview of the project ...... 53 The learning module ...... 58 Extensions to the module ...... 66 Appendices ...... 77 Acknowledgements ...... 84

CHAPTER 4 CONCLUSIONS AND FUTURE DIRECTIONS ...... 86 Conclusions ...... 86 Future Directions ...... 87 References ...... 88

APPENDIX SUPPLEMENTAL DATA FOR CHAPTER 2 ...... 90 Supplemental Figure 1 ...... 90 Supplemental Figure 2 ...... 91 Supplemental Table 1 ...... 92 Supplemental Table 2 ...... 96 Supplemental Table 3 ...... 100 Supplemental Table 4 ...... 103

iii

GLOSSARY/ABBREVIATIONS

PAMP Pathogen Associated Molecular Pattern

PTI PAMP-triggered Immunity

Effector Defined in this thesis as pathogen proteins and small molecules that modify host defense

ETI Effector-triggered Immunity

R-gene Resistance gene

Avr-gene Avirulence gene

BEC Blumeria effector candidate

RNAi RNA interference; Eukaryotic viral defense mechanism to digest double stranded RNA

HIGS Host-Induced Gene Silencing; a transient, single-cell RNAi mediated gene silencing system

BSMV-VIGS Barley Stripe Mosaic Virus-Induced Gene Silencing; a transient, systemic RNAi mediated gene silencing system

Type III secretion system Needle-like molecular structure used by some bacteria to deliver proteins into host cells

HR Hypersensitive reaction, defined in this thesis as a rapid cell death response at the infection site

Homolog Genes sharing a similar DNA sequence due to descent from a common ancestor

Ortholog Genes in different species that share a common ancestral DNA sequence as a result of a speciation event; often these genes retain similar functions

Paralog Result of gene duplication in a species enabling evolution of gene variants with new functions

ABSTRACT

The proteins used by pathogens to modify, suppress or evade host defenses (called effectors) are fascinating probes into plant defense pathways and are changing the way scientists think about host/pathogen interactions. Blumeria graminis f. sp. hordei, causal agent of barley powdery mildew disease, is a model system to study the nature of obligate biotrophy.

In addition to the nearly 500 predicted effector candidates unique to the mildews, this pathogen contains at least one that is broadly conserved across the fungal kingdom. Understanding the functions and targets of both the unique and conserved effectors has the potential to reveal new mechanisms of resistance. The development of RNAi-mediated gene silencing assays and the use of bacterial secretion based delivery systems has enabled the functional characterization of effectors in ways that were impossible until now.

Silencing an effector candidate from B. graminis by Barley Stripe Mosaic Virus –Induced

Gene Silencing is shown to significantly reduce accumulation of fungal biomass. When delivered to barley cells via the Xanthomonas bacterial type III secretion system, this effector is able to suppress host cell death. Conservation of this protein in 96 of 240 surveyed fungal genomes is presented. Notably, orthologs of this gene are present in non-pathogens as well as major pathogens of both plants and animals. Site-directed mutagenesis revealed two amino acids that are required for the cell death suppression phenotype. Taken together, this evidence supports reclassification of this gene from candidate effector to bona fide effector.

Biological research and bioinformatic analysis are meaningful only to the extent that scientists can communicate value to stakeholders and the public. Through collaboration with high school science teachers, a curriculum was developed to expose students to plant biology and illustrate that an organism’s DNA (genotype) has a direct influence on its traits (phenotype).

Students plant seeds, extract DNA from leaf tissue, amplify genes through polymerase chain

v reactions, and screen plant phenotypes. They learn to use pipets, how to conduct PCR and gel electrophoresis, and spend time determining relevant traits of their plants. The goal is to equip teachers to train and excite students about the field of plant biology.

CHAPTER 1: GENERAL INTRODUCTION

Thesis Organization The focus of this thesis is the characterization of Blumeria Effector Candidate

(BEC) 1019. A literature review detailing the history of effector biology is presented in the first chapter. Topics include Flor’s study of flax which led to the gene-for-gene hypothesis, the bacterial type III secretion system and its effectors, identification of the first filamentous fungal effectors, sequencing of the Blumeria graminis f. sp. hordei genome, detailed annotation, and the first functional screen of B. graminis effectors.

The second chapter is a manuscript to be submitted to PLOS Pathogens describing functional analysis of BEC1019 through the use of systemic Virus-induced gene silencing (VIGS) and the Xanthomonas type III secretion system for protein delivery into host cells. The third chapter is a curriculum written in collaboration with several Iowa

State University Research Experience for Teachers (ISU-RET) interns that has been published on the American Society of Plant Biologists education website. The final chapter lists general conclusions and future directions for the study of BEC1019.

Literature Review Introduction The increasing global population is forcing the agriculture industry to produce more food, fuel and fiber on less land. Past approaches to addressing this issue include breeding for desired agronomic traits (e.g., drought tolerance, more grain, etc), attempting to reduce spoilage of food through improved storage practices and post harvest chemical treatments, and through breeding crops for resistance to major pathogens to decrease yield loss. Historically, disease resistance has been dependent upon specific plant genes that are effective early in their deployment but are rapidly

overcome by selection and evolution of the pathogen(s) they target. By understanding molecular plant-pathogen interactions, better strategies can be developed with the promise of more durable resistance.

Gene-for-gene hypothesis Prior to the turn of the 19th century, scientists knew that plant cultivars had varying degrees of resistance to different pathogens. It wasn’t until 1905 that the first report of heritable resistance was published; Biffen showed that a single gene in wheat controlled resistance to stripe rust and could be bred according to Mendel’s Laws

(Biffen, 1905). The hope for a simple solution to plant disease was quickly dashed in

1911 after the discovery that different races of the fungus causing anthracnose of common bean, Colletotrichum lindemuthianum, displayed variation in infection severity on different bean cultivars (Phaseolus vulgaris) (Barrus, 1911). In 1922, Stakman and

Levine used differential varieties of wheat to define races of the stem rust fungus,

Puccinia graminis. Differential varieties are lines of wheat that have varying degrees of resistance to different races of Puccinia graminis and races of this pathogen were classified according to their infection phenotypes on these genotypically variable lines

(Stakman and Levine, 1922). As a result, scientists could now explain that resistance or susceptibility of a plant to a pathogen was dependent upon the race(s) present and that resistance breaks down due to selection for races of pathogens capable of infecting the planted variety. In addition, breeders needed to think differently about breeding for resistance because, unlike agronomic traits that depend only on the plant genotype, resistance to biotic disease requires interactions with pathogens that have the ability to adapt.

H. H. Flor, a USDA plant pathologist in North Dakota, spent his career attempting to identify all the resistance genes in flax and the most pathogenic race of

flax rust (Melampsora lini) an attempt to breed a plant with durable resistance. As a result he showed that avirulence is generally dominant and epistatic to virulence, virulence is monogenic, and factors conferring virulence are not linked (Flor, 1946). In addition, the resistance of established lines could be broken down through mutation, genetic hybridization, or introduction of new pathogen races. One year later he demonstrated that race specific resistance is commonly monogenic and dominant; also, genes conferring resistance are often clustered (Flor, 1947). The primary conclusion of

Flor’s work is known as the Gene-for-Gene hypothesis which states, “For each gene controlling resistance in the host (R-gene), there is one gene controlling virulence in the pathogen (Avr-gene)”(Flor, 1955). Incompatibility occurs when an R-gene is present in the host and a corresponding Avr-gene is present in the pathogen; all other combinations result in compatible interactions.

Hrp genes Due to their haploid genomes, prokaryotes are prime organisms to confirm Flor’s gene-for-gene hypothesis. Hrp genes, an acronym for hypersensitive reaction and pathogenicity (Lindgren et al., 1986), were first identified in 1984 by the Panopoulos lab at University of California-Berkeley. In these experiments, eight Tn5 insertion mutants of Pseudomonas syringae pv. phaseolicola lost both the ability to infect host bean plants and the ability to elicit a hypersensitive reaction (HR) on nonhost plants connecting, for the first time, HR in nonhosts and pathogenicity in hosts. Clustering of these hrp genes was inferred when a single recombinant plasmid carrying

Pseudomonas syringae genomic sequences was able to recover the wild-type phenotype in all but one mutant (Panopoulos and Peet, 1985; Lindgren et al., 1986).

Additionally, in another study, a 31 kb genomic region of Pseudomonas syringae pv. syringae cloned into the nonpathogens Pseudomonas fluorescens and Escherichia coli

resulted in their ability to elicit HR in tobacco, a nonhost (Huang et al., 1988). It is now known that hrp genes are highly conserved across Gram-negative phytopathogenic bacteria (Niepold et al., 1985; Steinberger and Beer, 1988; Bonas et al., 1991). In addition, a connection between plant and animal pathology at the molecular level was revealed by the homology between Hrp proteins and proteins from animal pathogenic bacteria (van Gijsegem et al., 1993). In fact, the broad conservation of some Hrp proteins led to the classification of hrc genes where the c stands for conserved

(Bogdanove et al., 1996).

This connection between plant and animal pathology was solidified when virulence was demonstrated to be dependent upon both secreted proteins active in host cells and a hrp/hrc gene cluster in Yersinia (Rosqvist et al., 1994; Rosqvist et al., 1995),

Pseudomonas syringae (Gopalan et al., 1996; Scofield et al., 1996), and Xanthomonas campestris (Van den Ackerveken et al., 1996). By the end of the 1990’s, evidence was clear that both plant pathogenic and animal pathogenic bacteria employ hrp/hrc genes to facilitate delivery of proteins (Avr gene products/effectors) into the cytoplasm of their hosts. Once there, compatibility is determined by the presence or absence of host protein detectors (R-gene products). The conservation across gram-negative pathogens of secretion machinery involved in virulence resulted in the identification of the bacterial type III secretion system (Salmond and Reeves, 1993). The discovery that a Hrp pilus acts as a molecular needle that enables protein translocation further supported effector delivery via type III secretion (Wei et al., 2000; Jin and He, 2001)

Type III secretion system effectors The role of the type III secretion system in pathogenicity manifests through the delivery of secreted effector proteins to the cytoplasm of host cells. Genomic studies coupled with bioinformatic analyses identified promoter elements and conserved signal

peptide signatures that could be used to identify other proteins likely to be type III secretion system effectors (Collmer et al., 2002; Arnold et al., 2009). As more bacterial genomes became available, the number of predicted effector proteins present in a given strain ranged from a few to more than 100 (Grant et al., 2006). Effectors of the type III secretion system increase pathogen fitness through manipulation of host defense machinery in both PAMP- and effector-triggered immunity pathways (Jones and Dangl,

2006). While these effectors can be grouped according to their function, the specific host protein targets remain elusive (Tampakaki et al., 2010).

One notable example of a type III secretion system effector with a known target is AvrRxo1. Xanthomonas oryzae pv. oryzicola (Xoc) strain BLS256 is the causal agent of rice bacterial leaf streak to which no simply inherited resistance genes are known. In the maize cultivar B73, the Rxo1 protein recognizes AvrRxo1 and triggers HR, while the maize line Mo17 lacks a gene coding for Rxo1 and presents no phenotype when exposed to Xoc. Incredibly, when the maize gene Rxo1 is transferred to rice, the expressed protein is still able to recognize AvrRxo1 and trigger HR providing a powerful tool to control this pathogen (Zhao et al., 2005).

B. graminis AVR a10 and AVR k1

In 2006 the first B. graminis AVR-genes (effectors) were cloned. AVR k1 was mapped to a 5102 base pair region of the B. graminis genome. Within this region, full length open reading frames (ORF) were identified in all avirulent interactions. In all virulent interactions on a barley line containing the Mlk1 resistance gene, frameshift mutations resulted in non-functional proteins or a premature stop codon resulted in a truncated protein. Green fluorescent protein (GFP) is a transformation marker that, when bombarded into leaf tissue, is only visible in living cells capable of expressing the protein. Thus, a GFP index comparing the number of florescent cells in Mlk1 (resistant)

lines to those in mlk1 (susceptible) lines would indicate if cells were dying due to HR induced by the co-bombarded Avrk1 protein. When AVR k1 was biolistically delivered with GFP into Mlk1 containing barley plants, a significant reduction in GFP index dependent on Mlk1 was observed. Expression of this ORF in susceptible plants resulted in significantly more infected cells as compared to a null control. AVRa10 was identified as a paralog of AVRk1 and was cloned and confirmed using the same techniques (Ridout et al., 2006).

Host-Induced Gene Silencing (HIGS) Conventional genetics would recommend the creation of AVR-gene knockout strains of B. graminis which could be used to test the effect of these genes on virulence

(Saitoh et al., 2012). Unfortunately, a robust transformation procedure does not exist for this pathogen (Pliego et al., 2013). Moreover, it is reasonable to believe that knocking out completely a gene that is required for virulence would be lethal to an obligate biotrophic pathogen given that it could no longer infect its host. In light of this, researchers are now taking advantage of RNA interference (RNAi); a phenomenon in eukaryotes that involves recognition of double stranded RNA followed by degradation of homologous transcripts. In 2010, Nowara and colleagues (Nowara et al., 2010) recognized that transgenic plants containing RNAi constructs targeting genes in nematodes (Huang et al., 2006) and insects (Baum et al., 2007) negatively influenced the development of those pathogenic organisms. They reasoned that uptake by B. graminis of RNAi constructs expressed in barley cells was possible (Nowara et al.,

2010).

By independently bombarding barley leaves with RNAi constructs targeting 76 fungal candidate genes, 16 were found to significantly inhibit the ability of conidia to infect and develop haustoria. In addition, RNAi constructs targeting either AVRa10 or

AVRk1 resulted in significantly fewer haustoria in susceptible interactions. This result is not only consistent with uptake of RNAi constructs from barley by B. graminis but also supports the function of these effector genes in the absence of their corresponding R- genes. The AVRa10 result was verified using an AVRa10 wobble construct containing multiple silent point mutations that render it resistant to RNAi silencing. Expression of this AVRa10 wobble gene with the AVRa10 RNAi construct counteracted the RNAi- induced reduction in haustoria formation. These data support the conclusion that RNAi constructs expressed in the host but targeting fungal genes are taken up by the pathogen and result in fungal gene silencing; a tool now called Host-Induced Gene

Silencing (HIGS) (Nowara et al., 2010).

Virus-Induced Gene Silencing (VIGS) Virus-Induced Gene Silencing (VIGS) was first successfully used in monocots by targeting the gene encoding phytoene desaturase (PDS) in barley using Barley stripe mosaic virus (BSMV) (Holzberg et al., 2002; Lacomme et al., 2003). Knockdown of

PDS transcripts results in photobleaching of leaf tissue due to photolysis of chlorophyll; this phenotype works well as a reporter for effective RNAi-mediated degradation of target-gene transcripts. In 2005, Scofield and colleagues optimized the BSMV-VIGS system in wheat using PDS and then applied the concept to the Lr21 R-gene signaling pathway (Scofield et al., 2005).

Taking advantage of the few genes in wheat with functional analysis to support activity in NB-LRR R-pathways, three genes, RAR1, SGT1 and cytosolic HSP90, were chosen for silencing in addition to Lr21. Seven days after germination, WGRC7, a wheat line containing the R-gene corresponding to Lr21, was infected with BSMV:00,

BSMV:PDS4, BSMV:Lr21, BSMV:RAR1, BSMV:SGT1, or BSMV:HSP90. These plants were then inoculated with Puccinia triticina isolate PRTUS6 (incompatible on WGRC7)

8 days after infection with BSMV. While BSMV:00 and BSMV:PDS4 showed no altered infection phenotype, all four constructs containing genes involved in Lr21 resistance showed regions of compatibility on the distal end of the third leaves. This result is consistent with the products of Lr21, RAR1, SGT1 and cytosolic HSP90 all being required for resistance to Puccinia triticina isolate PRTUS6. qRT-PCR was used to confirm knockdown of the target gene transcripts (Scofield et al., 2005).

Blumeria Effector Candidates (BECs) and Candidate Secreted Effector Proteins (CSEPs) With tools now available for the functional analysis of fungal genes; specifically

HIGS, a single-cell transient RNAi technique, VIGS, a systemic transient RNAi technique, and the bacterial type III secretion system for individual delivery, the challenge was to identify genes in B. graminis that may be acting as effectors. One of the first approaches involved a proteogenomic analysis of three stages of pathogen development including conidia, sporulating hyphae, and barley epidermis + Blumeria haustoria (EH) (Bindschedler et al., 2009). In sum, 827 proteins were identified from these three tissues; 47 were identified from EH samples and of those nine were unique to haustoria. Interestingly, these nine proteins were all predicted to have a signal peptide for secretion and were on average approximately one third the length of the other 36 haustorial proteins. Seven of them showed no homology to known proteins.

Worth noting is the overrepresentation in EH samples of proteins involved in carbohydrate metabolism. This might be expected given that the haustoria are responsible for uptake of nutrients from host cells.

A draft of the B. graminis genome was available, and used extensively, during the initial proteogenomic analysis. However, publication of a high-quality genome was instrumental in identification and annotation of new candidate effectors. In December

2010 an assembly of the Blumeria graminis f. sp hordei genome with 140-fold coverage was published. At the same time, draft genomes with approximately 8-fold coverage of

Erysiphe pisi and Golovinomyces orontii, powdery mildew pathogens of pea (Pisum sativum) and Arabidopsis thaliana respectively, were also published (Spanu et al.,

2010). At ~120 Mb, ~151 MB and ~160 Mb respectively, the powdery mildew genomes dwarf other ascomycetes which average less than one quarter their size. Alongside publication of the genome, the authors predicted 248 Candidate Secreted Effector

Proteins (CSEPs). Most contained a signal peptide, lacked a transmembrane domain, and lacked homology to proteins outside the mildews (as determined by BLAST searches). Also present in many CSEPs is a YxC motif near the N-terminal and most are expressed primarily in haustoria. In addition, less than 10 are found outside

Blumeria suggesting a possible link to host specificity.

With an assembly covering >99% of the Blumeria genome, and a new list of 248 predicted CSEPs, Bindschedler and colleagues returned to the proteogenomic analysis of proteins found only in haustoria (Bindschedler et al., 2011). 1401 of the 5854 predicted proteins were independently confirmed in their study. For 71, expression was found to be unique to haustoria; 43 had been predicted as CSEPs. Here again, most

(95%) of these proteins had signal peptides and their average length (235 amino acids) was less than half of the global average (511 amino acids). Also, only 12 had homology to known proteins. Significant to this project, one (bgh_03531) showed similarity to

AspF2, a predicted metalloprotease and major allergen from Aspergillus fumigatus.

Shortly after the proteogenomic analysis, a more intensive analysis of the

Blumeria genome was performed with the intent of identifying the complete arsenal of

CSEPs. In this study, CSEPs were identified through the use of iterative BLAST

searches of the genome using as queries the 248 previously identified CSEPs. ORF and signal peptide prediction was then done on RNA sequencing data. The result was

491 CSEPs including the original 248 predicted alongside publication of the Blumeria genome (Pedersen et al., 2012). Other criteria for inclusion as a CSEP include no transmembrane domain and no homology to proteins outside the three sequenced mildews.

Functional analysis of Blumeria effector candidates using HIGS With more than 500 candidate effectors (491 CSEPs, 28 BECs), functional analysis was needed to determine bona fide B. graminis effectors. Pliego and colleagues selected 50 BECs uniquely found in haustoria (Bindschedler et al., 2009;

Bindschedler et al., 2011) or highly upregulated in haustoria (Spanu et al., 2010) to be screened using HIGS (Pliego et al., 2013). The predicted mature coding sequence of each BEC was cloned into a vector that promotes expression of a hairpin construct.

This vector was co-bombarded, along with a visible marker construct, pUbiGUS, into barley leaves. The pUbiGUS plasmid served as a marker as histochemical staining would reveal activity of β-glucuronidase (GUS) in transfected cells. Following inoculation with B. graminis, leaves were stained and scored for variation in haustorial development as compared to an empty vector control (Pliego et al., 2013). AVRk1 was used as a positive control because it had previously been shown to reduce formation of haustoria (Nowara et al., 2010). All 50 BECs and AVRk1 were silenced in three independent replications. The infection phenotype was quantified as a haustorial index

(HI) where the ratio of GUS stained cells with haustoria was divided by the total number of GUS stained cells. While some BECs increased HI as much as 140%; the 18 that reduced HI the most were subjected to up to four more replications (Pliego et al., 2013).

Eight of these BECs and AVRk1 were shown to have statistically significant reductions in

HI when silenced. Consistent with effector function, time course expression analysis revealed that all eight BECs are highly expressed in early infection (16hpi) and development of haustoria (24hpi) (Pliego et al., 2013).

Because they yielded the largest reduction in HI, BEC1011 and BEC1054 were chosen for further analysis. These two genes share 75% identity at the nucleotide level and are considered paralogs. To determine if cross silencing of these genes was occurring, “wobble” expression constructs were designed with point mutations to both optimize expression in barley and minimize homology to the RNAi construct. The resulting constructs had sequences with 61% and 67% identity to BEC1011 and

BEC1054 respectively (Pliego et al., 2013). Five replications of a complementation analysis were performed for each BEC in which the “wobble” expression construct was co-bombarded with the RNAi construct. For both BECs the RNAi construct alone again significantly reduced HI. The wobble construct alone had no effect on HI. Significantly, the wobble construct was able to complement the RNAi construct resulting in no effect on HI when the two were co-bombarded. This evidence demonstrates that each RNAi construct is specific to its intended target and, because the wobble construct is likely expressed in the barley cell, is consistent with function of these effectors in the host cell

(Pliego et al., 2013). One further experiment used anthocyanin accumulation to show that of the eight BECs that significantly reduced HI when silenced, only BEC1011 was able to interfere with cell death. Taken together, this study demonstrates the effectiveness of HIGS in identifying bona fide effectors and confirms the methodology used to predict effector candidates in B. graminis (Pliego et al., 2013).

Conclusion The focus of this thesis is a Blumeria candidate effector first identified through a proteogenomic screen as bgh_03531 (Bindschedler et al., 2011) and is presented in

Chapter 2. Because it has homology to a few known proteins outside of the mildews

(Aspergillus fumigatus AspF2 and Candida albicans Pra1) it was not included in the group of 492 Candidate Secreted Effector Proteins identified in 2012 (Pedersen et al.,

2012). In that paper the authors point out that the possibility exists, “that some proteins with (an) N-terminal secretion signal and identifiable sequence similarity to polypeptides in other species (e.g. secreted proteases) exert an effector function during B. graminis pathogenesis.” This group would include bgh_03531. Additionally, this effector was designated BEC1019 when included as part of a Host-Induced gene silencing screen where it was shown to significantly reduce (adjusted p-value = 0.0184) haustorial development when silenced (Pliego et al., 2013).

Isaac Newton, in a letter to Robert Hooke, said, “If I have seen further it is by standing on the shoulders of giants.” A goal of the agricultural industry from its beginning was to reduce yield loss due to pathogens. From Flor’s study of flax and flax rust in the 1940s through the identification of bacterial secretion systems that deliver effectors into host cells to the sequencing of fungal genomes that enable prediction of effectors, plant pathology is offering more insight than ever into host-pathogen interactions. Combined with RNAi-mediated gene silencing assays such as HIGS/VIGS and the exploitation of the type III secretion system to deliver eukaryotic effectors to plant cells, high-throughput functional characterization is increasingly possible. The next challenge is to use these tools to identify effectors that can be used to engineer broad and durable resistance to the crops we use for food, fuel and fiber.

References Arnold, R., Brandmaier, S., Kleine, F., Tischler, P., Heinz, E., Behrens, S., Niinikoski, A., Mewes, H.-W., Horn, M., and Rattei, T. (2009). Sequence- Based Prediction of Type III Secreted Proteins. PLoS Pathog 5, e1000376.

Barrus, M.F. (1911). Variations of varieties of beans in their susceptibility to anthracnose. Phytopathology, 190-195

Baum, J.A., Bogaert, T., Clinton, W., Heck, G.R., Feldmann, P., Ilagan, O., Johnson, S., Plaetinck, G., Munyikwa, T., Pleau, M., Vaughn, T., and Roberts, J. (2007). Control of coleopteran insect pests through RNA interference. Nature Biotechnology 25, 1322-1326.

Biffen, R.H. (1905). Mendel's Laws of Inheritance and Wheat Breeding. The Journal of Agricultural Science 1, 4-48.

Bindschedler, L.V., McGuffin, L.J., Burgis, T.A., Spanu, P.D., and Cramer, R. (2011). Proteogenomics and in silico structural and functional annotation of the barley powdery mildew Blumeria graminis f. sp hordei. Methods 54.

Bindschedler, L.V., Burgis, T.A., Mills, D.J.S., Ho, J.T.C., Cramer, R., and Spanu, P.D. (2009). In planta proteomics and proteogenomics of the biotrophic barley fungal pathogen Blumeria graminis f. sp. hordei. Molecular & Cellular Proteomics 8, 2368-2381.

Bogdanove, A.J., Beer, S.V., Bonas, U., Boucher, C.A., Collmer, A., Coplin, D.L., Cornelis, G.R., Huang, H.-C., Hutcheson, S.W., Panopoulos, N.J., and Van Gijsegem, F. (1996). Unified nomenclature for broadly conserved hrp genes of phytopathogenic bacteria. Molecular Microbiology 20, 681-683.

Bonas, U., Schulte, R., Fenselau, S., Minsavage, G.V., Staskawicz, B.J., and Stall, R.E. (1991). Isolation of a gene cluster from Xanthomonas campestris pv. vesicatoria that determines pathogenicity and the hypersensitive response on pepper and tomato. Molecular Plant-Microbe Interactions 4, 81-88.

Collmer, A., Lindeberg, M., Petnicki-Ocwieja, T., Schneider, D.J., and Alfano, J.R. (2002). Genomic mining type III secretion system effectors in Pseudomonas syringae yields new picks for all TTSS prospectors. Trends in Microbiology 10, 462-469.

Flor, H.H. (1946). Genetics of pathogenicity in Melampsora lini. Journal of Agricultural Research 73, 335-357 pp.

Flor, H.H. (1947). Inheritance of reaction to rust in Flax. Journal of Agricultural Research 74, 241-262 pp.

Flor, H.H. (1955). Host-parasite interaction in flax rust -its genetics and other implications. Phytopathology 45, 680-685.

Gopalan, S., Bauer, D.W., Alfano, J.R., Loniello, A.O., He, S., and Collmer, A. (1996). Expression of the Pseudomonas syringae avirulence protein AvrB in plant cells alleviates its dependence on the hypersensitive response and

pathogenicity (Hrp) secretion system in eliciting genotype-specific hypersensitive cell death. Plant Cell 8, 1095-1105.

Grant, S.R., Fisher, E.J., Chang, J.H., Mole, B.M., and Dangl, J.L. (2006). Subterfuge and manipulation: type III effector proteins of phytopathogenic bacteria. Annual Review of Microbiology 60, 425-449.

Holzberg, S., Brosio, P., Gross, C., and Pogue, G.P. (2002). Barley stripe mosaic virus-induced gene silencing in a monocot plant. Plant Journal 30, 315-327.

Huang, G.Z., Allen, R., Davis, E.L., Baum, T.J., and Hussey, R.S. (2006). Engineering broad root-knot resistance in transgenic plants by RNAi silencing of a conserved and essential root-knot nematode parasitism gene. Proc Natl Acad Sci USA 103, 14302-14306.

Huang, H.C., Schuurink, R., Denny, T.P., Atkinson, M.M., Baker, C.J., Yucel, I., Hutcheson, S.W., and Collmer, A. (1988). Molecular cloning of a Pseudomonas syringae pv. syringae gene cluster that enables Pseudomonas fluorescens to elicit the hypersensitive response in tobacco plants. Journal of Bacteriology 170, 4748-4756.

Jin, Q., and He, S.Y. (2001). Role of the Hrp pilus in type III protein secretion in Pseudomonas syringae. Science (Washington) 294, 2556-2558.

Jones, J.D.G., and Dangl, J.L. (2006). The plant immune system. Nature (London) 444, 323-329.

Lacomme, C., Hrubikova, K., and Hein, I. (2003). Enhancement of virus-induced gene silencing through viral-based production of inverted-repeats. Plant Journal 34, 543-553.

Lindgren, P.B., Peet, R.C., and Panopoulos, N.J. (1986). Gene cluster of Pseudomonas syringae pv. " phaseolicola" controls pathogenicity of bean plants and hypersensitivity on nonhost plants. Journal of Bacteriology 168, 512-522.

Niepold, F., Anderson, D., and Mills, D. (1985). Cloning determinants of pathogenesis from Pseudomonas syringae pathovar syringae. Proc Natl Acad Sci USA 82, 406-410.

Nowara, D., Gay, A., Lacomme, C., Shaw, J., Ridout, C., Douchkov, D., Hensel, G., Kumlehn, J., and Schweizer, P. (2010). HIGS: host-induced gene silencing in the obligate biotrophic fungal pathogen Blumeria graminis. Plant Cell 22, 3130- 3141.

Panopoulos, N.J., and Peet, R.C. (1985). The molecular genetics of plant pathogenic bacteria and their plasmids. Annual Review of Phytopathology 23, 381-419.

Pedersen, C., Themaat, E.V.v., McGuffin, L.J., Abbott, J.C., Burgis, T.A., Barton, G., Bindschedler, L.V., Lu, X., Maekawa, T., Wessling, R., Cramer, R., Thordal-Christensen, H., Panstruga, R., and Spanu, P.D. (2012). Structure and evolution of barley powdery mildew effector candidates. BMC Genomics 13, (11 December 2012).

Pliego, C., Nowara, D., Bonciani, G., Gheorghe, D.M., Xu, R., Surana, P., Whigham, E., Nettleton, D., Bogdanove, A.J., Wise, R.P., Schweizer, P., Bindschedler, L.V., and Spanu, P. (2013). Host-Induced Gene Silencing in barley powdery mildew reveals a class of ribonuclease-like effectors. Molecular Plant-Microbe Interactions.

Ridout, C.J., Skamnioti, P., Porritt, O., Sacristan, S., Jones, J.D.G., and Brown, J.K.M. (2006). Multiple avirulence paralogues in cereal powdery mildew fungi may contribute to parasite fitness and defeat of plant resistance. Plant Cell 18.

Rosqvist, R., Magnusson, K.E., and Wolf-Watz, H. (1994). Target cell contact triggers expression and polarized transfer of Yersinia YopE cytotoxin into mammalian cells. EMBO Journal 13, 964-972.

Rosqvist, R., Håkansson, S., Forsberg, Å., and Wolf-Watz, H. (1995). Functional conservation of the secretion and translocation machinery for virulence proteins of Yersiniae, Salmonellae and Shigellae. EMBO Journal 14, 4187-4195.

Saitoh, H., Fujisawa, S., Mitsuoka, C., Ito, A., Hirabuchi, A., Ikeda, K., Irieda, H., Yoshino, K., Yoshida, K., Matsumura, H., Tosa, Y., Win, J., Kamoun, S., Takano, Y., and Terauchi, R. (2012). Large-scale gene disruption in Magnaporthe oryzae identifies MC69, a secreted protein required for infection by monocot and dicot fungal pathogens. PLoS Pathog 8, e1002711.

Salmond, G.P.C., and Reeves, P.J. (1993). Membrance traffic wardens and protein secretion in gram-negative bacteria. Trends in Biochemical Sciences 18, 7-12.

Scofield, S.R., Huang, L., Brandt, A.S., and Gill, B.S. (2005). Development of a virus- induced gene-silencing system for hexaploid wheat and its use in functional analysis of the Lr21-mediated leaf rust resistance pathway. Plant Physiology 138, 2165-2173.

Scofield, S.R., Tobias, C.M., Rathjen, J.P., Chang, J.H., Lavelle, D.T., Michelmore, R.W., and Staskawicz, B.J. (1996). Molecular basis of gene-for-gene specificity in bacterial speck disease of tomato. Science (Washington) 274, 2063-2065.

Klages, S., Kleemann, J., Knoll, D., Koti, P.S., Kreplak, J., López-Ruiz, F.J., Lu, X., Maekawa, T., Mahanil, S., Micali, C., Milgroom, M.G., Montana, G., Noir, S., O'Connell, R.J., Oberhaensli, S., Parlange, F., Pedersen, C., Quesneville, H., Reinhardt, R., Rott, M., Sacristán, S., Schmidt, S.M., Schön, M., Skamnioti, P., Sommer, H., Stephens, A., Takahara, H., Thordal- Christensen, H., Vigouroux, M., Weßling, R., Wicker, T., and Panstruga, R. (2010). Genome expansion and gene loss in powdery mildew fungi reveal tradeoffs in extreme parasitism. Science 330.

Stakman, E.C., and Levine, M.N. (1922). The determination of biologic forms of Puccinia graminis on Triticum spp. Univ. Minnesota Agric. Exper. Stat. Tech. Bull. 8, 8 pp.

Steinberger, E.M., and Beer, S.V. (1988). Creation and complementation of pathogenicity mutants of Erwinia amylovora. Molecular Plant-Microbe Interactions 1, 135-144.

Tampakaki, A.P., Skandalis, N., Gazi, A.D., Bastaki, M.N., Sarris, P.F., Charova, S.N., Kokkinidis, M., and Panopoulos, N.J. (2010). Playing the "harp": evolution of our understanding of hrp/hrc genes. Annual Review of Phytopathology 48, 347-370.

Van den Ackerveken, G., Marois, E., and Bonas, U. (1996). Recognition of the bacterial avirulence protein AvrBs3 occurs inside the host plant cell. Cell (Cambridge) 87, 1307-1316. van Gijsegem, F., Genin, S., and Boucher, C. (1993). Conservation of secretion pathways for pathogenicity determinants of plant and animal bacteria. Trends in Microbiology 1, 175-180.

Wei, W., Plovanich-Jones, A., Deng, W., Jin, Q., Collmer, A., Huang, H., and He, S. (2000). The gene coding for the Hrp pilus structural protein is required for type III secretion of Hrp and Avr proteins in Pseudomonas syringae pv. tomato. Proc Natl Acad Sci USA 97, 2247-2252.

Zhao, B.Y., Lin, X.H., Poland, J., Trick, H., Leach, J., and Hulbert, S. (2005). A maize resistance gene functions against bacterial streak disease in rice. Proc Natl Acad Sci USA 102, 15383-15388.

CHAPTER 2: AN EFFECTOR BROADLY CONSERVED ACROSS

THE FUNGAL KINGDOM SUPPRESSES PLANT CELL DEATH

Ehren Whigham1, Shan Qi2, Divya Mistry3, Ruo Xu4, Clara Pliego5, Laurence

Bindschedler6, Pietro Spanu5, Dan Nettleton4, Roger Innes8, Adam J. Bogdanove2 and

Roger Wise1,9

1 Department of Plant Pathology and Microbiology, Iowa State University, Ames, Iowa 50011–1020 2Department of Plant Pathology and Plant-Microbe Biology, Cornell University, Ithaca, NY, 14853 3Department of Bioinformatics and Computational Biology, Iowa State University, Ames, Iowa 50011 4Department of Statistics, Iowa State University, Ames, IA, 50011-1210 5Department of Life Sciences, Imperial College London, South Kensington Campus, London SW7 2AZ, United Kingdom 6School of Biological Sciences, Royal Holloway University of London (RHUL), Egham, Surrey, TW20 0EX, United Kingdom 7Leibniz-Institute of Plant Genetics and Crop Plant Research, 06466-Gatersleben, Germany 8Department of Biology, Indiana University, Bloomington, Indiana 47405 9Corn Insects and Crop Genetics Research Unit, U.S. Department of Agriculture- Agricultural Research Service, Iowa State University, Ames, Iowa 50011–1020

A manuscript to be submitted to PLOS Pathogens

Ehren Whigham designed BEC1019 RNAi constructs and conducted VIGS experiments to demonstrate BEC1019 function. He identified orthologous sequences in other fungi, created site-directed mutants of BEC1019 for use in the Xanthomonas type III secretion system assay, obtained Candida albicans Pra1 and subcloned it into pCR8 for further experiments. He also collaborated on development of LeafQuant software, as well as random forest analysis. He prepared all tables and figures and wrote the manuscript.

Introduction The obligate biotrophic fungus Blumeria graminis f. sp. hordei is the causal agent of barley (Hordeum vulgare) powdery mildew disease. After a conidiospore lands on the leaf surface, an appresorium is formed that penetrates the cuticle and plant cell

wall. Here the pathogen forms its feeding structure, a haustorium, by invaginating the cell membrane of the epidermal cell layer. Using nutrients obtained from the host, secondary hyphae are formed that are capable of infecting additional cells. Some hyphae will form the aerial conidiophores that give “powdery mildew” it’s name.

Pathogen infection of plants is partly established by delivering a set of secreted proteins called effectors into host cells to suppress defense. The plant defense response includes two major pathways, pathogen-associated molecular pattern

(PAMP)-triggered immunity (PTI); and effector-triggered immunity (ETI) (Bent and

Mackey, 2007). PAMPs are recognized by host transmembrane recognition receptors and then signal through the downstream mitogen-activated protein kinase (MAPK) cascade (Boller and Felix, 2009; Boller and He, 2009). Some PAMPs can trigger hypersensitive reaction (HR), defined in this study as a rapid cell death response at the infection site. Cytoplasmic NB-LRR proteins recognize effectors secreted by plant pathogens and often initiate an HR. The direct or indirect interaction between an effector and an R-protein results in resistance, usually associated with HR. In order to survive, pathogens have evolved or acquired effectors that suppress defense response

(Kjemtrup et al., 2000). Effectors of obligate biotrophic pathogens are particularly interesting due to their requirement of living host tissue for survival.

Based on studies of the B. graminis proteogenome (Bindschedler et al., 2009;

Bindschedler et al., 2011) and the genome (Spanu et al., 2010; Pedersen et al., 2012), fifty Blumeria effector candidates (BECs) were selected for functional analysis. Results of host-induced gene silencing (HIGS) identified eight BECs as reducing haustorial development (Pliego et al., 2013). Some of these candidates are unique to powdery mildews while others show varying degrees of conservation across fungal taxa.

Characterization of BECs exclusive to the mildews has the potential to shed light on the nature of obligate biotrophy. Alternatively, characterization of BECs that are broadly conserved may reveal plant defense gene targets that could be exploited to engineer resistance to a spectrum of fungal pathogens.

The focus of this study is BEC1019 (bgh03531_mRNA) (Bindschedler et al.,

2011) a candidate effector that is conserved in more than 90 fungal taxa. Host-induced gene silencing of BEC1019 significantly limits the development of haustoria in a compatible interaction, indicating that BEC1019 is important for infection (Pliego et al.,

2013). BSMV-VIGS of BEC1019 revealed significant inhibition of pathogen growth.

Xanthomonas type III based delivery of BEC1019 suppresses both the cultivar non- specific HR induced by Xanthomonas. oryzae pv. oryzicola (Xoc) and the cultivar specific HR induced by AvrPphB. Moreover, orthologs of BEC1019 are conserved in more than 90 fungal taxa and one is shown to functionally mimic BEC1019. We conclude that B. graminis BEC1019 plays a key role in suppression of host defense and enables the survival of this obligate biotrophic pathogen.

Results Virus induced gene silencing of BEC1019 reduces fungal growth in a compatible interaction Silencing of an effector should alter the ability of B. graminis to infect and grow on barley. Host-Induced Gene Silencing (HIGS) is a transient, single-cell assay that can be quantified and analyzed statistically to determine significance (Nowara et al.,

2010). When BEC1019 is silenced by HIGS, B. graminis develops significantly fewer haustoria as compared to a control interaction (Pliego et al., 2013). To extend the single cell results to whole leaves, we used Barley Stripe Mosaic Virus –Induced Gene

Silencing (BSMV-VIGS) a systemic assay that enables quantification of fungal biomass accumulation. qRT-PCR is used for verification that target gene expression is reduced.

BSMV-mediated silencing of three WRKY transcription factors in barley compromises

Mla R-gene mediated defense against powdery mildew (Meng and Wise, 2012). This technique was also used to functionally characterize genes from Puccinia graminis in the wheat/wheat stripe rust interaction (Yin et al., 2011).

Two independent regions of BEC1019, designated BSMV:10195’ and

BSMV:1019mid, were inserted into the BSMV:γ genome (Meng et al., 2009). The wild- type BSMV:γ (empty vector) was used as a negative control and is designated

BSMV:00. Three replications of each BEC1019 silencing construct resulted in significantly less fungal growth, quantified as the amount of white hyphae on the surface of the leaves, compared to BSMV:00 and mock treatments (Figure 1A & 1B).

Fungal biomass accumulation depends upon successful infection of the host and can be considered a measure of virulence. To quantify fungal biomass accumulation, we developed a novel image processing software called LeafQuant using

Matlab. Starting with high-resolution RGB images of non-overlapping leaves on a relatively uniform, dark background, LeafQuant first defines the edges of each leaf.

Next, it detects the background and makes it a uniformly true black color, and then converts the high-resolution color RGB image to an 8bit gray-scale image with 256 shades of gray. Every pixel of each leaf is then placed into one of the 256 bins. After defining the exposure value (Methods), the program outputs leaf area in pixels, percent infection [(# of discolored pixels in leaf) / (# of total pixels in leaf)], and several quantiles representing degree of leaf discoloration. Optionally, histograms of leaf discoloration are also produced. Because powdery mildew biomass is white and the barley leaf it is

A 33/33 33/33 14/32*** C 5’ ATG 52 47 TAG 3’ 697 244 160 445 236

BSMV:10195’ BSMV:1019mid qRT-PCR

14 cm D

RE < 1 RE > 1

Mock BSMV:00 BSMV:1019mid B 3

2 Relative Expression 14 cm

0 0 20 40 60 80 100 % Infection Mock BSMV:00 BSMV:1019mid

Figure 1. BSMV-VIGS of BEC1019 results in decreased fungal growth. (A) HOR 11358 (Mla9) barley leaves infected with two independent BEC1019 constructs, BSMV:10195’ and BSMV:1019mid, exhibited significantly less fungal growth compared to BSMV:00 (empty vector). The number above each group shows the number of leaves with that phenotype for the sum of 4 biological replicates. *** Indicates p-value of 0.0003. (B) LeafQuant was used to generate this gray scale image for quantification of the intensity of discoloration for each pixel. Because powdery mildew is white, the intensity of discoloration can be used as a measure of fungal biomass on the surface of a green leaf. (C) Exon/intron structure of B. graminis BEC1019 gene (top) and cDNA (middle) positions of VIGS constructs (bottom). (D) Knockdown of BEC1019 transcript accumulation significantly reduces percent infection of HOR 11358 (Mla9) barley leaves by B. graminis isolate 5874 (avra9). Leaves with a BEC1019:β-tubulin relative expression <1 have a significantly lower percent infection (open circles, p-value 0.0003) when compared to BSMV:00 empty vector control than leaves with a relative expression >1 (dark circles, p-value 0.3750).

infecting is green, the degree of discoloration can be used as a measure of fungal biomass. The ability to assay fungal biomass is a major advantage of the transient, systemic silencing of genes using the BSMV-VIGS system as compared to transient single cell assays. Silencing of BEC1019 was verified by transcript quantification in

VIGS-treated leaves. BEC1019 transcript in the either BSMV:10195’ or BSMV:1019mid treated plants was significantly reduced as compared to BSMV:00 treated plants. There was no significant difference in transcript accumulation between the BSMV:00 treated and mock treated plants.

qRT-PCR data was overlayed onto the LeafQuant output percent infection to determine if the observed differences in fungal virulence, quantified as accumulated fungal biomass as described above, correlated significantly to BEC1019 silencing.

Leaves with BEC1019 relative expression less than one were considered “knocked down” while leaves with a relative expression greater than one were considered “not knocked down.” In BSMV:1019mid knocked down leaves, percent infection clusters between 20 and 50% (Figure 1D). When compared to BSMV:00, the p-value for this treatment is 0.0003. No clustering is observed for leaves without transcript knockdown and comparison of these leaves to BSMV:00 yields a p-value of 0.375. BSMV:10195’ also significantly reduced fungal biomass accumulation (p-value = 0.01). Thus, two independent RNAi constructs (Figure 1C) targeting BEC1019 both result in statistically significant reduction in fungal biomass accumulation, supporting an effector function of this secreted B. graminis protein.

BEC1019 can suppress HR-like symptoms caused by X. oryzae pv. oryzicola strain BLS256 We expect that some bona fide effectors should be able to induce or suppress

HR in barley. Previously, assaying individual B. graminis effectors has been difficult

due to the obligate biotrophic nature of this pathogen and the lack of a robust transformation protocol (Pliego et al., 2013). To overcome these obstacles, we adapted the bacterial type III secretion system to deliver individual effector candidates.

Pseudomonas syringae has been used as a delivery vehicle in Arabidopsis thaliana to characterize oomycete effector proteins by fusion to the type III signals of avirulence proteins AvrRPS4 and AvrRpm1 (Sohn et al., 2007; Rentel et al., 2008). For barley, we chose to use Xanthomonas campestris pv. raphani strain 756C (Xcr) (Kamoun et al.,

1992), which causes bacterial spot of brassicas and Xanthomonas oryzae pv. oryzicola strain BLS256 (Xoc), which causes bacterial leaf streak of rice. In barley, these strains elicit no response, or an HR, respectively. Therefore, they offer the opportunity to search for HR eliciting effectors by delivering them via Xcr or for HR suppressive effectors by delivering through Xcr co-inoculated with Xoc or another elicitor.

BEC1019 was fused to the 3’ end of the sequence encoding the avrBs2 signal peptide in expression vector pYM5 (Methods). When expressed in Xcr (Xcr-1019) and inoculated into barley no visible plant response was observed, identical to untransformed Xcr (Xcr-Empty) or Xcr expressing just the N terminus of AvrBs2 (Xcr-

AvrBs2’) (not shown). It also failed to alter the HR elicited by Xoc when expressed from that strain. To account for the possibility that any suppressor function of BEC1019 is quantitative, we co-inoculated Xoc with Xcr-1019, at several different relative titers. At a ratio of 16 Xcr cells to 1 Xoc cell, the AvrBs2:BEC1019 fusion protein, and not the

AvrBs2 N terminus alone, suppressed the HR elicited by Xoc (Figure 2). This suppressive effect depended on an intact type III secretion system as confirmed by loss of HR suppression when BEC1019 was expressed in the Xcr:HW9 type III secretion system mutant strain (Xcr:HW9-1019).

Xoc & Xcr-Empty

Xoc & Xcr-AvrBs2’

Xoc & Xcr-1019

Xoc & Xcr:HW9-1019

16 cm

Figure 2. The Xanthomonas type III secretion system assay reveals BEC1019 suppresses cultivar non-specific HR. Xanthomonas campestris pv. raphani (Xcr) does not elicit HR in barley line CI 16151 (Mla6) and is used to deliver BEC1019. Xanthomonas oryzae pv. oryzicola (Xoc) elicits HR in all barley lines tested. These two strains are mixed to a final OD620=0.8 for Xcr and OD620=0.05 for Xoc,and coinfiltrated into barley. Xcr-Empty is an empty vector strain. Xcr- AvrBs2’ is an additional negative control that expresses just the AvrBs2 type III secretion signal. Xcr-1019 has been transformed with pYM5 containing BEC1019. Xcr:HW9-1019 is a type III secretion system deficient mutant strain expressing BEC1019.

Bacterial counts were used to determine how long the bacteria were able to survive inside barley leaves, and thus deliver the effector. The population of Xcr-1019 was steady over time up to 6 days after infiltration, similar to Xcr-Empty. This indicates

BEC1019 does not facilitate bacterial growth in this non-host interaction. Bacterial populations within the Xcr-1019 and Xoc co-inoculated leaves, however, also remained steady, in contrast to Xoc alone or Xoc co-inoculated with Xcr-Empty, which declined 10 fold (Table 1). Thus, BEC1019 enables bacterial survival in an otherwise HR-eliciting, non-host interaction. Ostensibly, BC1019 does this by preventing the HR.

BEC1019 can suppress the HR elicited by AvrPphB, a cysteine protease effector from Pseudomonas syringae We have shown that BEC1019 can suppress cultivar non-specific HR induced by Xoc In barley. To further probe the necrosis suppressing activity of BEC1019, we

Table 1. Time course analysis of bacterial survival in Xanthomonas infected leaf spots Bacterial counts indicate that growth of Xcr remains unchanged in the presence of Xoc when BEC1019 is present. When the C134S mutation is introduced, significantly fewer bacteria are present (as determined by ANOVA) at six days after infiltration.

daia 0 dai 3 dai 6 rep 1 rep 2 rep 1 rep 2 rep 1 rep 2 Xcr 4b 3 3 4 4 4 4 4 3 3 4 4 5 5 4 4 3 4

Xcr 5 4 6 3 0.4 0.5 & Xoc 7 4 7 3 0.4 0.4 6 3 6 2 0.5 0.5

Xcr-1019 4 4 4 4 3 5 4 4 4 4 5 5 5 3 3 4 3 2

Xcr-1019 5 5 6 6 5 5 & Xoc 7 4 5 7 6 6 6 6 5 5 6 5

Xcr-1019:C134S 3 3 4 3 3 4 5 5 4 4 3 3 5 4 5 4 4 4

Xcr -1019:C134S 6 6 5 5 0.3 0.2 & Xoc 5 5 5 5 0.3 0.3 6 5 4 4 0.4 0.4 aDays after infiltration bNumbers are reported as N*107 next wanted to determine if BEC1019 could suppress HR induced by a known effector.

AvrPphB is a cysteine protease effector that elicits HR in the interaction between

Arabidopsis thaliana and Pseudomonas syringae pv. phaseolicola. AvrPphB targets protein kinases involved in basal immunity (Shao et al., 2003; Zhang et al., 2010).

Cleavage of the PBS1 kinase by AvrPphB activates the R-protein RPS5, which elicits an HR in response to P. syringae strains expressing the effector (Simonich and Innes,

1995; Shao et al., 2003; Ade et al., 2007; Qi et al., 2012). We first searched the barley genome (Mayer et al., 2012) for homologs of PBS1 via BLAST (Altschul et al., 1990), and a single copy was found on chromosome 1H. Next, we screened 73 diverse barley lines for HR elicitation using Xcr to deliver AvrPphB via pYM5 (Xcr-AvrPphB). As illustrated in Figure 3, four of the 73 lines exhibited an HR in the presence of AvrPphB, but not in the empty vector control. Given the conservation of PBS1 and its AvrPphB cleavage site in barley, these results are consistent with the presence of an RPS5 ortholog or other NB-LRR protein that recognizes cleavage of the barley PBS1 by

AvrPphB. More importantly for this study, these lines enabled us to assay the ability of

BEC1019 to suppress the HR elicited by AvrPphB. We tested suppression by co- inoculating Xcr-1019 with Xcr-AvrPphB, at a ratio of 8:1. In each of the four lines that showed HR in response to AvrPphB, Xcr-1019 suppressed that response (Figure 3).

HIGS of BEC1019 resulted in a significantly lower haustorial index than the empty vector control (Pliego et al., 2013); likewise, BSMV-VIGS of BEC1019 resulted in a significant reduction of fungal biomass accumulation as measured by LeafQuant

(Figure 1). Moreover, delivery of BEC1019 via the Xanthomonas type III secretion system was able to suppress both the cultivar non-specific HR induced by Xoc (Figure

2) and the cultivar specific HR induced by AvrPphB (Figure 3). Taken together, these data support BEC1019 as a defense suppressing effector from B. graminis.

BEC1019 is broadly conserved The functional assays presented above indicate that B. graminis uses BEC1019 to suppress cell death and that percent infection, as determined by LeafQuant, is reduced when this effector is silenced. A BLASTp search of the BEC1019 amino acid sequence against 240 fungal genome sequences available from the NCBI

Xcr: Xcr: Xcr: Xcr: AvrPphB & Xcr: Xcr: AvrPphB & Empty Vector AvrPphB BEC1019 Empty Vector AvrPphB BEC1019 10.8cm Diamond WBDC209 10.8cm Hv531 PI452421 10.8cm Morex

Figure 3. The Pseudomonas syringae effector AvrPphB was delivered via Xanthomonas campestris pv. raphani (Xcr-AvrPphB) into 73 diverse barley lines to screen for elicitation of a hypersensitive reaction (HR). Empty vector Xcr does not elicit a visible defense response in any of the lines tested as seen in the left image of each panel. Four lines (Diamond, Hv531, WBDC209 and PI452421) showed sensitivity to AvrPphB as seen in the center image of each panel. When co-infiltrated with Xcr-BEC1019, the cell death response was suppressed in all four lines as seen in the right image of each panel.

nonredundant database (Johnson et al., 2008), the Fungal Genome Initiative (Broad

Institute of Harvard and MIT, http://www.broadinstitute.org/), and the Department of

Energy Joint Genome Institute (Grigoriev et al., 2012) returned sequences from 96 species with an E-value less than 1E-15 (Supplemental Table 2). Individuals are represented from every major fungal taxon in which at least five genomes have been sequenced (Supplemental Figure 1). Lifestyles of the fungi include plant pathogens, animal pathogens, non-pathogens and one symbiont (a lichen). The default settings of

MegAlign were used to generate a similarity tree of all 96 orthologous sequences

(Figure 4). Several major plant pathogens are found on the tree, including rice blast

(Magnaporthe oryzae), tan spot of wheat (Pyrenophora tritici-repentis), northern and southern corn leaf blight (Setosphaeria turcica and Cochliobolus heterostrophus respectively) and several Fusarium species. Among animal pathogens, the BEC1019 amino acid sequence shows similarity to the characterized genes Pra1 from Candida albicans, Major Allergen Asp F2 from Aspergillus fumigatus and Zps1 from

Saccharomyces cerevisiae.

A multiple sequence alignment (MSA), generated with MegAlign, was used to create a Weblogo (Schneider and Stephens, 1990; Crooks et al., 2004) that revealed many highly conserved residues spanning ~220 amino acids (Figure 5). Six conserved cysteines are predicted by DISULFIND (Ceroni et al., 2006) to form three disulfide bonds (Figure 5). Two more cysteines are found at the C-terminus of the B. graminis sequence and are predicted to form a fourth disulfide bond. HRxxH is the only recognized motif in the amino acid sequence. Notably, other proteins with this motif are fungal allergens (Punta et al., 2012) including Asp F2 and Pra1.

Pra1 mimics BEC1019 in type III secretion system BEC1019 exhibits homology to proteins in species distributed across the fungal kingdom. Pra1 is an ortholog from Candida albicans, an opportunistic fungal pathogen

Figure 4. The default settings of MegAlign were used to generate a multiple sequence alignment and phylogenetic tree using 96 amino acid sequences of BEC1019 orthologs from Blastp queries of the NCBI non-redundant database, Department of Energy Joint Genome Institute and the Broad Institute Fungal Genome Initiative. With a few exceptions, this tree aligns with the taxonomic classifications of the included species. that lives commensally as part of the human skin microbiota (Brunke and Hube, 2013).

Both organisms belong to the phylum Ascomycota but B. graminis is classified in subphylum Pezizomycotina while Candida albicans is classified in subphylum

Saccharomycotina. Pra1 binds at least seven plasma proteins and at least one cell surface receptor in humans (Zipfel et al., 2011), none of which have any significant homology to proteins in barley. In addition, Pra1 has activities at the fungal cell surface

(Luo et al., 2009), in the culture medium, and on the host cell surface (Soloviev et al.,

2007).

In the Xanthomonas type III secretion system cell death suppression assay,

Pra1 suppressed Xoc elicited cell death to an intermediate extent relative to BEC1019 and the negative control (Figure 6). This result demonstrates that Pra1, an ortholog of

BEC1019, is active in plants despite none of the known interactors existing in barley and despite coming from a divergent fungal relative that infects animals.

Site-directed mutagenesis of individual amino acids eliminates function of BEC1019 Based on sequence conservation (Figure 5), site-directed mutagenesis of specific residues was performed using Agilent’s Quikchange Lightning Site-Directed

Mutagenesis kit. Six cysteine residues were predicted to form three disulfide bonds; each was mutated to a serine residue. Serine has the same structure as cysteine but lacks the sulfur required to form a disulfide bond. The three conserved residues in the

HRxxH domain were independently and collectively mutated to alanine residues

(1019:ARxxH, 1019:HAxxH, 1019:HRxxA, 1019:AAxxA). The resulting constructs

Bgh V132A, C134S loss of function

* * *

Figure 5. The MegAlign multiple sequence alignment was used as input to generate a WebLogo that illustrates conservation of amino acids at each position. While several residues appear highly conserved, HRxxH is the only recognized motif. Additionally, Valine 132 and Cysteine 134 in the ETVIC motif are required for the HR suppression phenotype observed in the type III secretion system assay. Dotted lines indicate predicted disulfide bonds. Asterisks indicate positions with high VI values in plant pathogenic fungi (green), animal pathogenic fungi (pink), and non-pathogenic fungi (black) as determined by random forest analysis.

Tip Middle Base

Xcr-AvrBs2’

Xcr-BEC1019

Xcr-PRA1

Figure 6. When delivered via Xanthomonas campestris pv. raphani, Candida albicans effector Pra1 is able to suppress the HR elicited by Xanthomonas oryzae pv. oryzicola (compare bottom row to top row). The Pra1 cell death suppression phenotype is intermediate to the BEC1019 phenotype and the empty vector control.

(Supplemental Table 3) were screened for loss of activity in the type III secretion system delivery assay. One construct, 1019:C134S, showed a decreased ability to suppress HR-like symptoms. Bacterial counts of leaves infiltrated with Xoc and Xcr-

1019:C134S display the same ten-fold drop in bacterial growth as seen in leaves infected with Xoc and Xcr-empty vector (Table 1). This result indicates that cysteine

134 is critical in BEC1019 function.

Cysteine 134 is part of a larger highly conserved ETVIC motif. To determine if cell death suppression is dependent upon the entire motif or a subset of residues, each was mutated to alanine and the resulting constructs were screened in the type III

secretion system assay. In addition to the 1019:C134S mutant, the 1019:V132A mutant abolished the cell death suppression phenotype (Figure 7). That either of two point mutations in this five amino acid stretch abolish the cell death suppression phenotype indicates the ETVIC motif is important to the function of this effector.

Xoc & Xoc & Xoc & Xoc & Xoc & Xoc & Xcr-BEC1019 Xcr-1019:E130A Xcr-1019:T131A Xcr-1019:V132A Xcr-1019:I133A Xcr-1019:C134S 11.3 cm

Figure 7. Site-directed mutagenesis of select highly conserved residues in BEC1019 abolishes the cell death suppression phenotype. Five cysteine residues were mutated to serine residues and screened for loss of function in the Xanthomonas type III secretion system cell death suppression assay. One mutant C134S lost function. Cys134 is part of a larger ETVIC motif (Figure 5). Type III secretion of alanine substitutions of these residues shows that both the V132A and C134S mutations abolish the wild type BEC1019 cell death suppression phenotype.

Random Forest Analysis identifies lifestyle associated positions Random forests are very good at prediction problems and have been successfully used in fields ranging from economics to oncology (Pal, 2005; Shi et al.,

2005). This analysis is based on the idea of another machine learning technique called

CART (classification and regression tree) (Breiman, 2001). Random forests have been shown in many studies to handle very well problems with many covariates “p”, but not many observations “n” (p can be larger than n). In this case, each residue in the multiple sequence alignment is considered a covariate while each species’ sequence is

considered an observation. Other strengths of this approach include less modeling assumption and no model/variable selection as in traditional methods. Variable importance (VI) values indicate the relative importance of each covariate.

Given that orthologs of BEC1019 are present in fungal pathogens of plants and animals in addition to nonpathogenic fungi, we hypothesized that sequence characteristics specific to each lifestyle might exist. Highly conserved residues are likely to be important to the structure or conserved functions of the protein, as is the case with V132 and C134 in cell death suppression. Less conserved residues might provide clues to lifestyle-specific functions. For example, at position 212 the arginine

(R) residue is highly conserved regardless of lifestyle. In contrast, at position 211 hydrophobic residues (I and L) are overrepresented in plant pathogenic fungi while polar residues (T and S) are overrepresented in animal pathogenic fungi and nonpathogenic fungi (Figure 8).

Using random forest analysis, three positions in the multiple sequence alignment

(198, 211 and 267) were found to be predictive of at least two lifestyles. Two (198 and

211) flank either side of the ETVIC motif found to be required for the Xanthomonas type

III secretion system cell death suppression phenotype. Position 198 has a VI value of

0.04 for plant pathogens and 0.03 for non-pathogens. Position 211 has VI values of

0.034 for plant pathogens, 0.027 for animal pathogens, and 0.023 for non-pathogens.

Position 267 has VI values of 0.035 for plant pathogens and 0.025 for animal pathogens

(Supplemental Table 4 and Supplemental Figure 2).

198 211 267 B 1.0 1.0 1.0 D N I P D 0.5 D G 0.5 S 0.5 SQ Q L G A A E probability probability A probability S T I E G EA E D S K G A TA H E K H K S D T K L A G Q N P L G L H S LT Q T V S R L T 0.0 0.0 K 0.0 S Pl An Non T Pl An Non Pl An Non MSA Position 198 MSA Position 211 MSA Position 267

Figure 8. Random forest analysis of the BEC1019 multiple sequence alignment identified three positions highly correlated with at least two of three fungal lifestyles (human pathogen, plant pathogen, or non-pathogen). (A) Indicates the location of the three positions in the multiple sequence alignment while (B) shows the sequence logo for each lifestyle at the indicated position (Plant Pathogen, P; Human pathogen, H; non-pathogen, N).

Discussion Here we present evidence of a fungal effector family present in 96 out of 240 sequenced fungi (Figure 4). With the exception of Polyporales, a classification under

Basidiomycota, orthologs of BEC1019 are present in at least one species from every major fungal taxon where a minimum of five genomes has been sequenced

(Supplemental Figure 1). Fungi containing BEC1019 orthologs have diverse lifestyles, including obligate plant pathogens, necrotrophic animal pathogens, and free-living nonpathogenic fungi, suggesting that BEC1019 is not only an effector involved in pathogenesis, but may also play an important role in broader fungal ecology.

Bacteria and oomycetes contain examples of effector proteins with highly conserved motifs. In contrast, effectors identified in many fungi share almost no homology to each other or to any known proteins (Stergiopoulos and Wit, 2009).

Similarly, very few BECs have homology to known proteins; in fact, one of the criteria used to identify candidate effectors when annotating the B. graminis genome was a lack of homology to any protein outside of the powdery mildews (Spanu et al., 2010). To our knowledge, only two families of effectors are conserved in multiple fungal species. The

Ecp6 family, first identified in Cladosporium fulvum, contains multiple lysin motifs known to bind carbohydrates. In 2008, this family consisted of 17 proteins from 12 species

(Bolton et al., 2008). Later, this family was shown to prevent chitin-triggered immunity

(de Jonge et al., 2010). The Hce2 superfamily was identified bioinformatically and is comprised of homologs of the Cladosporium fulvum Ecp2 effector protein. While Hce2 has 153 homologs, only 52 species are represented as many of them contain multiple paralogs (Stergiopoulos et al., 2012).

Functional analysis revealed that when BEC1019 is silenced, B. graminis is significantly less capable of forming mature haustoria (Pliego et al., 2013), and less able to produce secondary hyphae and conidiophores (this study, Figure 1). The ability to assay fungal biomass via LeafQuant is a major advantage of BSMV-VIGS systemic silencing of genes as compared to single cell assays. Furthermore, the systemic nature of viral infection enables qRT-PCR verification of transcript knockdown. In addition, the

Xanthomonas type III secretion system is exploited to deliver individual fungal effectors from bacterial cells directly to host cells. Using this system, BEC1019 suppresses cultivar specific and cultivar non-specific HR which is consistent with the silencing

phenotype (Figure 2 and Figure 3). It is possible that silencing of BEC1019 enables the plant to initiate HR that is not possible in the presence of the effector.

In addition to sequence conservation among the 96 fungal species, functional conservation of BEC1019 is exhibited by C. albicans Pra1, which can suppress HR when delivered by Xcr (Figure 6). Therefore, Pra1 is active in plants despite no conservation of the known interactors in barley. Moreover, C. albicans is a divergent fungal relative and opportunistic fungal pathogen of humans suggesting research on this effector could influence both medicine and agriculture.

Conservation of multiple amino acid residues across such a broad range of fungi

(Figure 5) led to the hypothesis that these residues were important in function of the protein. Site-directed mutagenesis of selected residues identified V132 and C134 from the ETVIC motif as required for HR suppression in the type III secretion system assay

(Figure 7). Moreover, random forest analysis of the BEC1019 multiple sequence alignment identified two positions flanking ETVIC as highly correlated with fungal lifestyles (Figure 8). Further experiments, including site-directed mutagenesis, could reveal if indeed specificity of proteins is associated with these lifestyle specific residues.

For example, suppression of HR by Pra1 in barley might be more effective if the amino acids flanking ETVIC were mutated to the corresponding amino acids in BEC1019.

Notably, several NB-LRR R-proteins contain an EDVID motif in the CC domain.

Mutation of the acidic residues (E and D) has been shown to compromise binding of the

CC domain to the NB-ARC-LRR (Rairdan et al., 2008) and abolish HR activation by

Mla10 full length proteins (Bai et al., 2012). It is tempting to speculate similar functions of these two motifs given that EDVID is required by R-proteins to initiate HR while

ETVIC is required by BEC1019 to suppress HR. Also interesting is the presence of an

EIVIC motif in Avr-Pita, one of the earliest fungal effectors to be characterized.

Alignment amino acid sequences illustrates that EIVIC is in the same region of Avr-Pita as ETVIC is in BEC1019. To our knowledge, no mutagenesis studies have been done on this motif in Avr-Pita. The fact that both effectors are predicted metalloproteases encourages further investigation.

HRxxH is currently characterized as a “fungal allergen domain with unknown function” (Punta et al., 2012) (http://pfam.janelia.org/family/PF13933) and it is conserved in all but two of the identified BEC1019 orthologs. The two histidines in the highly conserved metalloendoprotease signature HExxH represent two of three zinc binding residues; the third residue is typically a glutamic acid (Vallee and Auld, 1990).

Given that AspF2 has been shown to play a role in zinc acquisition (Amich et al., 2010) and that Pra1 can directly bind zinc (Citiulo et al., 2012), a similar function of BEC1019 may be expected. HExxH is also the active site of metalloendoprotease domains.

Though no protease activity against the tested substrate casein (Citiulo et al., 2012) has been shown for Pra1, or AspF2 (Amich et al., 2010), cleavage of a different substrate may occur. More detailed protease assays would be needed to determine if this family of effectors has protease activity. Yet another possible function of the HRxxH motif is facilitation of independent translocation across the host cell membrane. B. graminis secretes effector proteins from the haustorial membrane into the extrahaustorial matrix.

The method of translocation across the host cell membrane is currently unknown, however, oomycete effectors commonly use an RxLR motif. HRxxH falls under a broad definition of an RxLR (Kale et al., 2010). The lack of an altered HR suppression phenotype by our tested HRxxH alanine substitution mutants is consistent with a translocation hypothesis. Because the type III secretion system delivers effectors

directly to the host cell cytoplasm, any mutation in a motif responsible for translocation across the membrane would not be detected.

Having demonstrated a significant role for BEC1019 in the interaction between

B. graminis and H. vulgare, we would next like to study its role in other agronomically important host-pathogen systems. Virus-induced gene silencing and the Xanthomonas type III secretion system are powerful and readily transferrable tools to continue this work. Another significant step would be the identification of host proteins that interact with BEC1019. These would help determine the specific role of this effector in the host and guide the development of engineered resistance proteins.

Materials and Methods BSMV silencing constructs Fungal effector candidate genes were silenced in B. graminis by infecting HOR

11358 (Mla9) barley leaves with BSMV-VIGS silencing constructs (Meng et al., 2009).

Sequence information for BEC1019 was used to design primers for amplification of two separate ~250bp regions of the gene. During amplification, PacI and a NotI restriction sites were added to the 5’ end and 3’ end, respectively, of each fragment. These sites enabled ligation of the fragments in antisense orientation into the BSMV:γ vector.

BSMV:BEC10195’ contains a 229 bp fragment from the 5’ end of the gene and

BSMV:BEC1019mid contains a 264 bp fragment from the middle of the gene. Primers used for amplification can be found in Supplementary Table 3.

Transformation by microprojectile bombardment Biolistic bombardment was conducted according to (Halterman and Wise, 2004) using a biolistic PDS-1000/He system (Bio-Rad, Hercules, CA, USA) with minor modifications. BSMV:α, BSMV:β, and BSMV:γ (or BSMV:BEC10195’ or

BSMV:BEC1019mid) were coated onto 1.6 micron gold particles (InBio Gold, Eltham,

Victoria, Australia) at a 1:1:1 molar ratio. These particles were co-delivered using 900 psi rupture discs and macrocarriers (both InBio Gold, Eltham, Victoria, Australia) and a

Hepta adaptor (Bio-Rad, Hercules, CA, USA). Soil was gently removed from the roots of six 7-day-old Black Hull-less barley seedlings. These plants were placed on foam blocks below the Hepta adapter in the gene gun during bombardment. After bombardment the plants were repotted in 7.5 cm x 7.5 cm pots. These plants were maintained in a growth chamber (Percival Scientiﬁc, Perry, IA, USA) at 24°C with 16 hours of light (550 µmol m-2 s-1) and 8 hours darkness at 20°C.

Mechanical infection of BSMV and powdery mildew inoculation Seven to ten days after bombardment, plants displaying a BSMV infection phenotype (brown streak on the ﬁrst leaf and chlorotic mosaics on the second leaf) were selected. Two inches of an infected leaf was ground in 900µl 0.05 M phosphate buffer (pH 7.2) and 0.05 g carborundum (Sigma-Aldrich, St. Louis, MO, USA) in an ice- cold mortar. This infectious sap was used to infect 10 seven-day-old HOR 11358 (Mla9) seedlings with the appropriate constructs. Using clean gloves for each construct, each leaf was rubbed four to six times between the index finger (dipped in sap) and thumb.

These plants were maintained for twelve days in a growth chamber (Percival Scientiﬁc,

Perry, IA, USA) with 16 hours of light at 24°C (550 µmol m-2 s-1) and 8 hours darkness at 20°C. Plants were then inoculated with B. graminis isolate 5874 (avra9) conidiospores (compatible interaction with HOR 11358) and maintained in a growth chamber 16 h of light/ 8 h of darkness always at 18°C. The infection phenotype was monitored for 7 days.

Imaging of B. graminis infection phenotypes From the ten plants in each pot, five leaves of each treatment (Mock, BSMV:00 and BSMV:1019) were arbitrarily selected as a set for imaging; this resulted in two high resolution images of 15 leaves. When analyzed by LeafQuant (see below), the replicate ID (1 or 2) refers to the set of two images taken for each replication. These leaves were placed on black felt in groups, and were secured with double-sided tape.

Images were taken using a Canon PowerShot SX110 IS and the Vidpro professional

Photo and Video LED light kit model Z-96K. Immediately after imaging the leaves were frozen in liquid nitrogen and stored at -80°C. This process was repeated for the second set of 5 leaves.

LeafQuant image analysis Images of B. graminis infection phenotypes had three important qualities: (1) there was high color contrast between the background (i.e. the black felt) and the leaves, (2) the reflections of surroundings and the leaves themselves were avoided off of the double-sided tapes used to secure the leaves, and (3) images were high resolution (~9 megapixels at 4:3 aspect ratio). An application (here on referred to as

LeafQuant) was developed using MathWorks® MATLAB® 7.14 and Image Processing

Toolbox™ 8.0 to analyze these images to find discoloration on leaves. LeafQuant assumes that the quantification of discoloration of leaves would be considered quantification of B. graminis biomass accumulation.

LeafQuant performs following steps to convert a RGB image from the camera into a gray scale image where discoloration of leaves is proportional to the gray scale.

i. User inputs parameters for Experiment id, replication id, crop image first, show

histogram, number of leaves, and exposure value

The Matlab function is LeafQuant_v1(exprID, repID, cropImageFirst,

showHistogram, numOfLeaves, exposureVal). ExprID and repID are strings

representing experiment and replicate identification for reference.

CropImageFirst is a true/false command where if true the interface will let the

user choose an area of the image to analyze and if false the application will

process the entire image. ShowHistogram is a Boolean flag; if true a histogram

of infection level per leaf will be shown. NumOfLeaves is an integer specifying

the number of leaves that expected in the image or cropped region.

ExposureVal is a multiplier for the non-green pixel colors that would be

subtracted from the green channel. For example, a value of 2 would subtract

the color contribution of the red and blue channels from the green channel twice. ii. Detect the background and leaves as separate components in the image.

This is achieved by utilizing the fact that there is a high color contrast between

the background and the leaves. Otsu’s method (Otsu, 1979) is a histogram-

based threshold selection method. LeafQuant uses its implementation provided

in the Image Processing Toolbox to separate the background from the

foreground (i.e. leaves). Leaves are detected using 8-connected neighborhood

method implemented in Image Processing Toolbox. iii. Make the background behind the leaves uniformly black.

Using the results from previous step, LeafQuant makes the background

uniformly black before beginning to convert the image to gray scale for the

purpose of quantification. iv. Convert the leaves from RGB to gray scale colors.

Every pixel of an RGB image shows a color based on the contribution from three

primary colors (red, green, blue). To find the amount of discoloration of a pixel

on a green leaf, the contribution from green color has to be removed. Following

formula is used to remove the contribution of green channel from each of the red

and blue color channels, and the resulting value is stored in a separate channel.

This transforms the image into a gray scale image.

PixelValue = GVal – [exposureVal * ((GVal – RVal) + (GVal – BVal))]

Once the image is ready in gray scale, a count of pixels in various gray intensity levels is saved. LeafQuant provides histograms of discoloration distribution per leaf, and it calculates several statistical values and provides the results as a csv file (comma separated values) for further processing.

Quantitative Real-Time PCR Third leaves from BSMV-VIGS silenced plants were harvested, numbered and imaged prior to being frozen in liquid nitrogen. These leaves were cut in half (top and bottom) and total RNA was extracted using Trizol-like reagent (Caldo et al., 2004).

Genomic DNA was degraded by RNase-free DNase I (Ambion, Austin, TX, U.S.A.).

SuperScript III reverse transcriptase (Invitrogen, Grand Island, NY, USA) was used to synthesize first strand cDNA using 2 µg total RNA and oligo(dT)20 primer. This cDNA was used as a template for qRT-PCR to determine expression of BEC1019 relative to

B. graminis β-tubulin. Barley contig_3802 (GenBank ID dbj|AK356480.1|) was also included as a plant internal control. All primer sequences can be found in

Supplemental Table 3. Primers for RNAi targeted genes were designed outside the targeted regions (Figure 1). The qRT-PCR was performed using a Bio-Rad iCycler

(Bio-Rad, Hercules, CA, USA). Conditions for 20 µL reactions using PerfeCTa®

SYBR® Green FastMix® for iQ (Quanta Biosciences, Gaithersburg, MD) were 95 C for

3 min, followed by 40 cycles of 95 C for 15 sec and 60 C for 1 min, then a melt curve was determined by starting at 55 C for 10 sec and then increasing by 0.5 C every 10 sec for 80 cycles. After the melt curve was determined, a final 4 C step was held until the plate was removed from the thermalcycler. Three technical replicates for each biological sample in addition to four or five biological samples per treatment were included in each experiment. Target gene expression was calculated using the 2-∆CT method in individual silencing construct-treated and BSMV:00-treated plants. The fold change due to silencing was presented by dividing the individual expression value for each BSMV:1019 treated leaf by the mean value measured in BSMV:00 treated plants

(Schmittgen and Livak, 2008).

BEC1019 informatics The amino acid sequence of BEC1019 from Blumeria graminis f. sp. hordei was used as a query for a blastp search (April, 2012) of the non-redundant protein sequence database at NCBI (Johnson et al., 2008), the Broad Institute Fungal Genome Initiative and the Department of Energy Joint Genome Institue (Grigoriev et al., 2012). Ninety-six hits had an e-value below 1x10-15. The default settings in MegAlign, sequence analysis software by Lasergene (DNASTAR, Madison, WI), were used to generate a multiple sequence alignment and phylogenetic tree. The multiple sequence alignment also served as input to generate a WebLogo (Schneider and Stephens, 1990 Crooks, 2004,

WebLogo: A Sequence Logo Generator) that illustrates the degree of conservation of a specific residue at a specific position. After identification of six conserved cysteines,

DISULFIND (Ceroni et al., 2006) was used to predict disulfide bonds in the B. graminis

BEC1019 amino acid sequence.

Xanthomonas strains and growth Escherichia coli strains DH5, Top10, and DB3.1 were grown on Luria–Bertani agar containing the appropriate antibiotics at 37°C. Xcr and Xoc were grown on

Glycerol- Yeast Extract agar (1% glucose, 0.5% yeast extract, 1.5% ) containing the appropriate antibiotics at 28°C. Barley plants were grown at 21°C, 16 hours light/8 hours dark cycle until 10 days old.

Plasmid constructs For Blumeria candidate effector delivery via Xanthomonas type III secretion system, a destination gateway vector, designated pYM5, was constructed. Using pDD62 as backbone, the promoter and signal peptide (codons 1-97) of of Xanthomonas type III effector gene avrBs2 (Minsavage et al., 1990) were amplified by PCR. An HA epitope TAG is maintained as a translational fusion onto the C terminus of various pCR®8 (Invitrogen, Grand Island, NY, USA) clones when the destination cassette is cloned in later. This intermediate plasmid containing the ccdB cassette reading frame A

(Invitrogen, Grand Island, NY, USA) between the avrBs2 type III secretion system leader sequence and the HA epitope plus stop codon sequence was used to make the

Xanthomonas type III secretion system signal peptide destination vector pYM5. An LR recombination reaction (Invitrogen, Grand Island, NY, USA) was conducted to move

BECs into pYM5.

Xanthomonas inoculation assay Xcr carrying the binary vector with the gene of interest and Xoc were grown on

GYE agar at 28°C for 48 hours. Bacteria were then harvested with a wooden stick and suspended in 10 mM MgCl2 solution. The Xcr solution was diluted to an optical density

(O.D.) of 0.8, while Xoc was diluted to an O.D. of 0.05. These two solutions were mixed

1:1 (vol/vol) resulting in final concentrations of Xcr (O.D.) 0.4:Xoc (O.D.) 0.025. After

testing several ratios, this minimized non-specific cell death resulting from too many bacteria in the leaf. In addition, this ratio uses the least amount of Xoc required to elicit

HR in barley line CI 16151 (Mla6) and maximizes the amount of Xcr delivering the gene of interest. For pressure infiltration into barley leaves, a needleless syringe was used and about 100 µL cell suspension per spot was infiltrated into the leaf. To assay cell death suppression, symptom development was monitored visually 3 to 6 days after infiltration. Scoring was done and photographs were taken at 5 days. Each assay consisted of at least three plants inoculated on three leaf spots: tip, middle, and base

(nine spots total).

Bacterial counts and quantification Leaf spots infiltrated with Xanthomonas were assayed at 0, 3 and 6 days after infiltration. 1cm2 sections of leaf containing an infiltrated spot were cut and ground in

-1 -4 300 ul 10 mM MgCl2 solution. Serial dilutions from 10 to 10 were made and 1 ul of each dilution was plated on GYE agar. Plates were incubated 48-72 hours until single colonies could be observed. The number of single colonies on each plate was used to calculate the total number of bacteria in the original leaf spot according to the formula

Total bacteria = # single colonies x dilution x 10 x 300. Analysis of Variance (ANOVA) was performed to determine significance of the difference between bacterial counts.

Site-directed mutagenesis Primers for mutagenesis were designed using the QuikChange Primer Design online software https://www.genomics.agilent.com/CollectionSubpage.aspx?PageType=

Tool&SubPageType=ToolQCPD&PageID=15 (Supplemental Table 3). Point mutations were introduced into a pCR8/GW/TOPO vector (Invitrogen, Grand Island, NY,

USA) containing BEC1019 via PCR amplification according to the QuikChange Site-

Directed Mutagenesis (Agilent Technologies, Santa Clara, CA, USA) protocol.

Acknowledgments We thank Greg Fuerst for his many technical contributions. We also thank the multiple labs that provided BEC1019 orthologous sequences in the form of plasmids/genomic DNA/RNA; specifically, Dr. Malcom Whiteway for providing Pra1, Dr.

José Calera for providing AspF2, and Dr. Martin Schmidt for providing Saccharomyces cerevisiae DNA.

This research was supported by National Science Foundation Plant Genome grant 09-22746. This article is a joint contribution of the Iowa Agriculture and Home

Economics Experiment Station and the Corn Insect and Crop Genetics Research Unit,

USDA-Agricultural Research Service. Mention of trade names or commercial products in this publication is solely for the purpose of providing specific information and does not imply recommendation or endorsement by the U.S. Department of Agriculture and/or the National Science Foundation.

Author Contributions Conceived and designed the experiments: EW SQ AB RW. Performed the experiments: EW SQ. Analyzed the data: EW SQ RW AB RX DN. Contributed reagents/materials/analysis tools: PS LB DM. Wrote the paper: EW SQ AB RW.

References Ade, J., DeYoung, B.J., Golstein, C., and Innes, R.W. (2007). Indirect activation of a plant nucleotide binding site-leucine-rich repeat protein by a bacterial protease. Proc Nat Acad Sci USA 104, 2531-2536.

Altschul, S.F., Gish, W., Miller, W., Myers, E.W., and Lipman, D.J. (1990). Basic local alignment search tool. J Mol Biol 215, 403-410.

Amich, J., Vicentefranqueira, R., Leal, F., and Calera, J.A. (2010). Aspergillus fumigatus survival in alkaline and extreme zinc-limiting environments relies on the induction of a zinc homeostasis system encoded by the zrfC and aspf2 genes. Eukaryotic Cell 9, 424-437.

Bai, S., Liu, J., Chang, C., Zhang, L., Maekawa, T., Wang, Q., Xiao, W., Liu, Y., Chai, J., Takken, F.L.W., Schulze-Lefert, P., and Shen, Q. (2012). Structure- function analysis of barley NLR immune receptor MLA10 reveals its cell compartment specific activity in cell death and disease resistance. PLoS Pathogens 8, e1002752.

Bent, A.F., and Mackey, D. (2007). Elicitors, Effectors, and R Genes: The New Paradigm and a Lifetime Supply of Questions. Annual Review of Phytopathology 45, 399-436.

Boller, T., and Felix, G. (2009). A renaissance of elicitors: Perception of microbe- associated molecular patterns and danger signals by pattern-recognition receptors. Annual Review of Plant Biology 60, 379-406.

Boller, T., and He, S.Y. (2009). Innate immunity in plants: An arms race between pattern recognition receptors in plants and effectors in microbial pathogens. Science 324, 742-744.

Bolton, M.D., Esse, H.P.v., Vossen, J.H., Jonge, R.d., Stergiopoulos, I., Stulemeijer, I.J.E., Berg, G.C.M.v.d., Borrás-Hidalgo, O., Dekker, H.L., Koster, C.G.d., Wit, P.J.G.M.d., Joosten, M.H.A.J., and Thomma, B.P.H.J. (2008). The novel Cladosporium fulvum lysin motif effector Ecp6 is a virulence factor with orthologues in other fungal species. Molecular Microbiology 69, 119- 136.

Breiman, L. (2001). Random Forests. Machine Learning 45, 5-32.

Brunke, S., and Hube, B. (2013). Two unlike cousins: Candida albicans and C. glabrata infection strategies. Cellular Microbiology 15, 701-708.

Caldo, R.A., Nettleton, D., and Wise, R.P. (2004). Interaction-dependent gene expression in Mla-specified response to barley powdery mildew. Plant Cell 16.

Ceroni, A., Passerini, A., Vullo, A., and Frasconi, P. (2006). DISULFIND: a disulfide bonding state and cysteine connectivity prediction server. Nucleic Acids Research 34, W177-W181.

Citiulo, F., Jacobsen, I.D., Miramon, P., Schild, L., Brunke, S., Zipfel, P., Brock, M., Hube, B., and Wilson, D. (2012). Candida albicans scavenges host zinc via Pra1 during endothelial invasion. Plos Pathogens 8.

Crooks, G.E., Hon, G., Chandonia, J.-M., and Brenner, S.E. (2004). WebLogo: A Sequence Logo Generator. Genome Research 14, 1188-1190. de Jonge, R., van Esse, H.P., Kombrink, A., Shinya, T., Desaki, Y., Bours, R., van der Krol, S., Shibuya, N., Joosten, M.H.A.J., and Thomma, B.P.H.J. (2010). Conserved fungal LysM effector Ecp6 prevents chitin-triggered immunity in plants. Science 329, 953-955.

Grigoriev, I.V., Nordberg, H., Shabalov, I., Aerts, A., Cantor, M., Goodstein, D., Kuo, A., Minovitsky, S., Nikitin, R., Ohm, R.A., Otillar, R., Poliakov, A., Ratnere, I., Riley, R., Smirnova, T., Rokhsar, D., and Dubchak, I. (2012). The Genome Portal of the Department of Energy Joint Genome Institute. Nucleic Acids Research 40, D26-D32.

Halterman, D.A., and Wise, R.P. (2004). A single-amino acid substitution in the sixth leucine-rich repeat of barley MLA6 and MLA13 alleviates dependence on RAR1 for disease resistance signaling. Plant Journal 38, 215-226.

Johnson, M., Zaretskaya, I., Raytselis, Y., Merezhuk, Y., McGinnis, S., and Madden, T.L. (2008). NCBI BLAST: a better web interface. Nucleic Acids Research 36, W5-W9.

Kale, S.D., Gu, B., Capelluto, D.G.S., Dou, D.L., Feldman, E., Rumore, A., Arredondo, F.D., Hanlon, R., Fudal, I., Rouxel, T., Lawrence, C.B., Shan, W., and Tyler, B.M. (2010). External lipid PI3P mediates entry of eukaryotic pathogen effectors into plant and animal host cells. Cell (Cambridge) 142, 284- 295.

Kamoun, S., Kamdar, H.V., Tola, E., and Kado, C.I. (1992). Incompatible interactions between crucifers and Xanthomonas campestris involve a vascular hypersensitive response: role of the hrpX locus. Molecular Plant-Microbe Interactions 5.

Kjemtrup, S., Nimchuk, Z., and Dangl, J.L. (2000). Effector proteins of phytopathogenic bacteria: bifunctional signals in virulence and host recognition. Current Opinion in Microbiology 3, 73-78.

Luo, S., Poltermann, S., Kunert, A., Rupp, S., and Zipfel, P.F. (2009). Immune evasion of the human pathogenic yeast Candida albicans: Pra1 is a Factor H, FHL-1 and plasminogen binding surface protein. Molecular Immunology 47.

Mayer, K., Waugh, R., Langridge, P., Close, T.J., Wise, R.P., Graner, A., Matsumoto, T., Sato, K., Schulman, A., Muehlbaueer, G.J., Stein, N., Ariyadasa, R., Schulte, D., Poursarebani, N., Zhou, R., Steuernagel, B., Mascher, M., Scholz, U., Shi, B., Madishetty, K., Svensson, J.T., Bhat, P., Moscou, M., Resnik, J., Hedley, P., Liu, H., Morris, J., Frenkel, Z., Korol, A., Berges, H., Taudien, S., Felder, M., Groth, M., Platzer, M., Himmelbach, A., Lonardi, S., Duma, D., Alpert, M., Cordero, F., Beccuti, M., Ciardo, G., Ma, Y., Wanamaker, S., Cattonaro, F., Vendramin, V., Scalabrin, S., Radovic, S., Wing, R., Morgante, M., Nussbaumer, T., Gundlach, H., Martis, M., Poland, J.A., Spannagl, M., Pfeifer, M., Moisy, C., Tanskanen, J., Zuccolo, A., Russell, J., Druka, A., Marshall, D., Bayer, M., Sampath, D., Febrer, M., Caccamo, M., Tanaka, T., Platzer, M., Fincher, G., and Schmutzer, T. (2012). A physical, genetic and functional sequence assembly of the barley genome. Nature 491, 711-716.

Meng, Y., and Wise, R.P. (2012). HvWRKY10, HvWRKY19, and HvWRKY28 Regulate Mla-Triggered Immunity and Basal Defense to Barley Powdery Mildew. Molecular Plant-Microbe Interactions 25, 1492-1505.

Meng, Y., Moscou, M.J., and Wise, R.P. (2009). Blufensin1 negatively impacts basal defense in response to barley powdery mildew. Plant Physiology 149.

Minsavage, G.V., Dahlbeck, D., Whalen, M.C., Kearney, B., Bonas, U., Staskawicz, B.J., and Stall, R.E. (1990). Gene-for-gene relationships specifying disease resistance in Xanthomonas campestris pv. vesicatoria - pepper interactions. Molecular Plant-Microbe Interactions 3, 41-47.

Otsu, N. (1979). A threshold selection method from gray-level histograms. Systems, Man and Cybernetics, IEEE Transactions on 9, 62-66.

Pal, M. (2005). Random forest classifier for remote sensing classification. International Journal of Remote Sensing 26, 217-222.

mildew reveals a class of ribonuclease-like effectors. Molecular Plant-Microbe Interactions.

Punta, M., Coggill, P.C., Eberhardt, R.Y., Mistry, J., Tate, J., Boursnell, C., Pang, N., Forslund, K., Ceric, G., Clements, J., Heger, A., Holm, L., Sonnhammer, E.L.L., Eddy, S.R., Bateman, A., and Finn, R.D. (2012). The Pfam protein families database. Nucleic Acids Research 40, D290-D301.

Qi, D., DeYoung, B.J., and Innes, R.W. (2012). Structure-function analysis of the coiled-coil and leucine-rich repeat domains of the RPS5 disease resistance protein. Plant Physiology 158, 1819-1832.

Rairdan, G.J., Collier, S.M., Sacco, M.A., Baldwin, T.T., Boettrich, T., and Moffett, P. (2008). The coiled-coil and nucleotide binding domains of the potato Rx disease resistance protein function in pathogen recognition and signaling. Plant Cell 20, 739-751.

Rentel, M.C., Leonelli, L., Dahlbeck, D., Zhao, B.Y., and Staskawicz, B.J. (2008). Recognition of the Hyaloperonospora parasitica effector ATR13 triggers resistance against oomycete, bacterial, and viral pathogens. Proc Natl Acad Sci USA 105, 1091-1096.

Schmittgen, T.D., and Livak, K.J. (2008). Analyzing real-time PCR data by the comparative CT method. Nat. Protocols 3, 1101-1108.

Schneider, T.D., and Stephens, R.M. (1990). Sequence logos: a new way to display consensus sequences. Nucleic Acids Research 18, 6097-6100.

Shao, F., Golstein, C., Ade, J., Stoutemyer, M., Dixon, J.E., and Innes, R.W. (2003). Cleavage of Arabidopsis PBS1 by a bacterial type III effector. Science (Washington) 301, 1230-1233.

Shi, T., Seligson, D., Belldegrun, A.S., Palotie, A., and Horvath, S. (2005). Tumor classification by tissue microarray profiling: random forest clustering applied to renal cell carcinoma. Modern Pathology 18, 547-557.

Simonich, M.T., and Innes, R.W. (1995). A disease resistance gene in Arabidopsis with specificity for the avrPph3 gene of Pseudomonas syringae pv. phaseolicola. Mol Plant Microbe Interact 8, 637-640.

Sohn, K., Lei, R., Nemri, A., and Jones, J.D.G. (2007). The downy mildew effector proteins ATR1 and ATR13 promote disease susceptibility in Arabidopsis thaliana. Plant Cell 19, 4077-4090.

Soloviev, D.A., Fonzi, W.A., Sentandreu, R., Pluskota, E., Forsyth, C.B., Yadav, S., and Plow, E.F. (2007). Identification of pH-regulated antigen 1 released from Candida albicans as the major ligand for leukocyte integrin alpha(M)beta(1)(2). Journal of Immunology 178.

Spanu, P.D., Abbott, J.C., Amselem, J., Burgis, T.A., Soanes, D.M., Stüeber, K., van Themaat, E.V.L., Brown, J.K.M., Butcher, S.A., Gurr, S.J., Lebrun, M.- H., Ridout, C.J., Schulze-Lefert, P., Talbot, N.J., Ahmadinejad, N., Ametz, C., Barton, G.R., Benjdia, M., Bidzinski, P., Bindschedler, L.V., Both, M., Brewer, M.T., Cadle-Davidson, L., Cadle-Davidson, M.M., Collemare, J., Cramer, R., Frenkel, O., Godfrey, D., Harriman, J., Hoede, C., King, B.C., Klages, S., Kleemann, J., Knoll, D., Koti, P.S., Kreplak, J., López-Ruiz, F.J., Lu, X., Maekawa, T., Mahanil, S., Micali, C., Milgroom, M.G., Montana, G., Noir, S., O'Connell, R.J., Oberhaensli, S., Parlange, F., Pedersen, C., Quesneville, H., Reinhardt, R., Rott, M., Sacristán, S., Schmidt, S.M., Schön, M., Skamnioti, P., Sommer, H., Stephens, A., Takahara, H., Thordal- Christensen, H., Vigouroux, M., Weßling, R., Wicker, T., and Panstruga, R. (2010). Genome expansion and gene loss in powdery mildew fungi reveal tradeoffs in extreme parasitism. Science 330.

Stergiopoulos, I., and Wit, P.J.G.M.d. (2009). Fungal effector proteins. Annual Review of Phytopathology 47, 233-263.

Stergiopoulos, I., Kourmpetis, Y.A.I., Slot, J.C., Bakker, F.T., Wit, P.J.G.M.d., and Rokas, A. (2012). In silico characterization and molecular evolutionary analysis of a novel superfamily of fungal effector proteins. Molecular Biology and Evolution 29, 3371-3384.

Vallee, B.L., and Auld, D.S. (1990). Active-site zinc ligands and activated H2O of zinc enzymes. Proc Natl Acad Sci USA 87, 220-224.

Yin, C.T., Jurgenson, J.E., and Hulbert, S.H. (2011). Development of a host-induced RNAi system in the wheat stripe rust fungus Puccinia striiformis f. sp. tritici. Molecular Plant-Microbe Interactions 24, 554-561.

Zhang, J., Li, W., Xiang, T., Liu, Z., Laluk, K., Ding, X., Zou, Y., Gao, M., Zhang, X., Chen, S., Mengiste, T., Zhang, Y., and Zhou, J.-M. (2010). Receptor-like cytoplasmic kinases integrate signaling from multiple plant immune receptors and are targeted by a Pseudomonas syringae effector. Cell host & microbe 7, 290-301.

Zipfel, P.F., Skerka, C., Kupka, D., and Luo, S. (2011). Immune escape of the human facultative pathogenic yeast Candida albicans: The many faces of the Candida Pra1 protein. International Journal of Medical Microbiology 301.

CHAPTER 3: ITAG BARLEY: A 9-12 CLASSROOM MODULE TO

EXPLORE GENE EXPRESSION AND SEGREGATION USING

OREGON WOLFE BARLEY

Lance Maffin1,5 Garrett Hall2,5 Taylor Hubbard3,5 Ehren Whigham4,5 Roger P. Wise4,6

1Bondurant-Farrar Community High School, 1000 Grant Street N., Bondurant, IA 50035 2Southeast Polk Community High School, 7945 NE University Avenue, Pleasant Hill, IA 50327 3Ankeny Community High School, 1155 SW Cherry Street, Ankeny, IA 50023 4Department of Plant Pathology and Microbiology, Center for Plant Responses to Environmental Stresses, Iowa State University, Ames, Iowa 50011–1020 5Research Experience for Teachers, Iowa State University, Ames, IA, 50011 http://www.eeob.iastate.edu/plantgenomeoutreach/ 6Corn Insects and Crop Genetics Research Unit, U.S. Department of Agriculture- Agricultural Research Service, Iowa State University, Ames, Iowa 50011–1020

Curriculum published at American Society of Plant Biologists K-12 Resources

Ehren Whigham drafted protocols and piloted at Roosevelt High School. Mentored later RETs through continued curriculum development and protocol modification.

I. Overview One of the basic concepts in biology is that an organism’s physical traits are controlled by its DNA. In other words, one’s genotype for a particular trait controls the phenotype that is expressed. Yet, this connection between DNA and physical characteristic is not always made by students. The ‘Inheritance of Traits and Genes in Barley’ (iTAG Barley) Project is a module of laboratory and classroom activities designed to help students make this connection.

The laboratory portion begins with students planting and growing barley plants so that phenotypic variation can be observed first hand. One trait in particular, the difference between “awned” and “hooded” plants, is the focus of the basic Learning Module. The barley plants in the photos below exhibit these two phenotypes. The Learning Module also includes protocols for DNA Extraction, Polymerase Chain Reaction, and Gel Electrophoresis. Students get the opportunity to experience these basic biotechnology

techniques, and the final results of the electrophoresis allow students to see DNA polymorphisms among plants with different phenotypes.

In addition, several extension activities are provided in the Extension Module. These protocols can be used in addition to the Learning Module, or separately in whatever way that helps teachers to meet their curriculum. Some of the activities may be useful if you are working with younger or more inexperienced students, while others move beyond the Learning Module and work best with more advanced students.

“Awned” “Hooded” Recessive Dominant

Why Oregon Wolfe Barley? The Oregon Wolfe Barleys (OWBs) are a model resource for genetics research and instruction (http://barleyworld.org/oregonwolfe ; http://wheat.pw.usda.gov/ggpages/OWB_gallery/ISS-OWB/index.htm). The population of 94 doubled haploid lines was developed from an F1 of a cross between dominant and recessive marker stocks advanced by Dr. Robert Wolfe. Segregating plants from the OWB doubled haploid (DH) population are easily grown on a lighted window bench in the classroom. These lines originate from a wide cross and have exceptionally diverse and dramatic phenotypes, making the population attractive for teaching basic plant development, genetics, and genomics in high school biology.

Students can observe the spikes for seed-coat color, two row vs. six row (encoded by Vrs, a domestication trait), hooded vs. non-hooded (Kap: encoded by BKn3 of the Knox gene family - a homoeotic mutation where the awn is replaced by another floret), and long awn vs. short awn traits (encoded by Lks2). In addition, plants homozygous for the recessive allele at lks2, the expression of the hooded phenotype is masked, resulting in the expression of a short-awned, rather than hooded, phenotype.

Thus, students gain experience in phenotype observation and first hand knowledge of genetic history related to cellular pathways, grain domestication, and developmental mutations in plants. Students perform the polymerase chain reaction (PCR) to amplify the Kap and Vrs1 (HvHox1) genes using DNAs they isolate from the segregating plants, size fractionate the products on agarose gels, and document their results. Interactive exercises are presented on co-segregation of PCR products and whole plant phenotypes in the OWB population.

This module grew out of conversations between high school science teachers and USDA-ARS researchers at Iowa State University. During the summer NSF-sponsored, Research Experience for Teachers program (RET), discussions on how to incorporate research into the classroom were common. Everyone agreed that high school students were capable of understanding and conducting PCR; the challenges were how to fund and implement the concept. We decided on the OWB population barley because it is easy to grow, the plants are phenotypically diverse and easy to score, and the DNA extraction is straightforward. This module was included as a “broader impacts” component of NSF Grant #0922746. As of spring 2012, this module has been used successfully in twenty-five Iowa high school biology classrooms, impacting >600 students. We hope you and your students have as much fun with these incredible plants as we have!

Goals: After completing the ITAG BARLEY module students will: • Understand the role of DNA in an organism.

• Understand the relationship between a genotype and a phenotype, including homeotic mutations, epistatic interactions, and the impact of phenotype on yield. • Experience science as it is done in a research laboratory. • Understand that science takes time.

Organization: This module is sequential in that each activity, in most cases, must be completed before the next activity can be started. Two exceptions are the Strawberry DNA extraction and Tip Top Electrophoresis, which are included to help students understand concepts before attempting more technical procedures.

Students begin by planting a population of Oregon Wolfe Barley. By placing the responsibility of planting, watering, fertilizing, etc. on the students they develop a vested interest in the plants. If students have little or no prior experience using digital pipettes, the Pipette Technique and Practice activity can be used to introduce them to this tool. In addition, this will help ensure that the pipettes are in good working order.

The leaf tissue DNA Extraction is simple in theory but complex in practice. Therefore, Strawberry DNA Extraction introduces students to concepts before exposing them to more challenging techniques. Similarly, Tip Top Electrophoresis develops the schema necessary for understanding genomic electrophoresis. Tip Top also visualizes movement of bands of molecules through a gel. This is helpful later when attempting to convince students that the bands they see are actually the DNA they amplified.

Because one of the goals of this module is for students to understand the relationship between an individual’s genotype and phenotype, amplification of a single gene is done via PCR. The genotype of each plant in the population can be compared to the phenotype to observe cosegregation. The primers utilized to amplify the Kap gene take advantage of different size introns, thus, polymorphic products are produced to distinguish dominant or recessive alleles by electrophoresis. Gel Green DNA stain is used, along with the Vernier Transilluminator, to visualize bands of DNA. The Gel Green is both non-toxic and light insensitive, making it safe and convenient to use.

Modifications: This module is designed for use in K-12 and undergraduate classrooms. Alignment to the National Core Curriculum can be found in Appendix C. In elementary or middle school classrooms the students might only plant barley to observe, or extract DNA from strawberries, or watch Tip Top Electrophoresis to understand the role of DNA. In a high school classroom, students might grow barley, extract its DNA, amplify the Kap gene using PCR, and use the product to perform electrophoresis. Advanced high school or college classrooms may also use PCR to amplify the Vrs1 gene, perform a restriction enzyme digest, and use electrophoresis to distinguish genotypes. In college classrooms the concept of epistasis can be discussed in light of Lks2 epistasis of the Kap gene in a few individuals.

Extensions: Barley is the experimental organism in this module, however the concepts can be applied to all plants. In many areas of the country, the economy is largely dependent upon agriculture. Because genes determine traits, discussion of genetic engineering and its influence on agriculture is a simple but meaningful application.

Agriculture is important, but human health may be more important to high school students. The same principles used to associate the Kap gene with the hooded phenotype are used regularly to associate genes with human genetic diseases such as Sickle Cell or Tay Sachs. These extensions make this module cross curricular since topics in history, social studies, psychology, sociology, and food science are influenced by genetics and segregation of traits. If you are interested in conducting the module contact the developers at [email protected] Want to learn more about double haploid production? Check out this YouTube video http://www.youtube.com/watch?v=V2jOEuZjjrg

II. The Learning Module In this section you will find the protocols to successfully run the core activities of ‘Inheritance of Traits and Genes in Barley’ (iTAG Barley). This module can be used in both a traditional (50 minute) class period, or in block scheduling (90 minute). The module can be made to fit into existing curriculum, or it can also be modified to be shorter or longer (see Extensions to the Module section).

It is best to plant your “phenotype plants” (see Growing Instructions for Oregon Wolfe Barley) about two months prior to beginning the module. Barley needs 6-8 weeks to grow and mature to the point where its traits are easily identifiable to students. A second planting should be done about 8-10 days prior to the module. These week-old plants will provide the “harvest tissue” for extracting DNA. You will need at least 20 clay pots for plants to be phenotyped, and one tray (with a minimum of 20 cells or seedling containers) to plant your OWBs for DNA extraction.

The two plantings could be used as part of an ecology or plant anatomy unit. Based on our experiences, the more ownership the students have in the module, the better it runs. Time Frame for Running the Module

Protocol Time Needed Preparations Planting OWB 20 minutes Have soil, seeds, markers, planting tags, and pots ready for student use.

DNA Extraction 3 – 45 minute Each lab station should contain 2mL tubes, markers, class periods fresh slide and razor blade, pestle. Protocol ingredients should be easily accessible for each lab group.

Kap PCR 45 minutes Creating the primer mix ahead of time, with exception to adding in the Taq, will help speed up the process. You may want to aliquot the primer mix for each group.

Gel 45 minutes Gel can be made by students or prepared ahead of Electrophoresis time. Gel takes 30 minutes to run and can be run during or after class.

Viewing of Gel 45 minutes Have viewing equipment set up for the students.

1 - Growing Instructions for Oregon Wolfe Barley Containers: In general, the larger the pot, the larger the plant. You will obtain a good grow-out with 13 cm (5- inch) pots. When the plants become larger, a dowel rod and twist ties or other support maybe needed to hold the stalks up right.

Soil: Use a standard potting mix. Barley is less tolerant of acid than alkaline soil conditions, so if you have reason to believe your soil is acidic, have it tested and adjust the pH to 7.0 with lime. 2 x 4 frame with adjustable light bank Seeding: Prepare your containers with soil and sow 1-3 seeds per pot at a depth of approximately 2.5 centimeters (one inch). Lightly compact the soil over the seeds and water generously without causing the seed to float to the top. Seedlings should emerge within one week.

Fertilizer: Fertilize with a dilute solution of liquid fertilizer, such as Rapid Grow or Peters (20-20-20). The plants should be fertilized once per week starting when the plant reaches two leaves of growth, and then fertilized twice per week when the plants start flowering. Continue at this rate until the plants start to dry down.

Watering: Barley is less tolerant of over-watering than under-watering. Treat your OWBs like houseplants, watering when the surface of the soil is moist but not dry to the touch. It is better to water infrequently but generously (until water flows through drain holes at the bottom of the pot) than to water lightly at frequent intervals.

Propagation conditions: Provide supplemental lighting for 16 hours per day. Fluorescent lights will work, but they should be numerous and no further than 1.5 m (5 feet) from the canopy surface. Sufficient light quantity and quality are essential.

Culture: The OWBs will show a stunning array of plant growth and development patterns. The first plants will head within 30 days of planting and the last will head at about 90 days. Plant height at heading can range from 40 to 120 centimeters (16 to 48 inches). Taller plants may require supplemental support. Use bamboo or dowel stakes and wire ties.

*Modified from www.barleyworld.org

2 - Leaf Tissue DNA Extraction Materials Tube pestle or glass rod Glass slide Razor blade Gloves 2.0 ml micro centrifuge tubes 0.3 g of leaf tissue Vortex Centrifuge

Reagents and Buffers 2X CTAB Buffer 20% (w/v) sodium dodecyl sulfate (SDS) 5M potassium acetate (stored at –20°C) Absolute isopropanol (stored at -20°C) 70% ethanol (stored at -20°C) TE Buffer

Day One: Before beginning protocol add 400 µl 2- Mercaptoethanol to 19.6 ml of 2x CTAB = 20 ml total. 1. Collect three 7-10 day old leaves to obtain ~0.3 g leaf tissue. 2. Place tissue on a clean glass slide. Chop the tissue into very small pieces using a clean single edge razor blade. 3. Immediately transfer tissue to a 2.0 ml microcentrifuge tube and further grind tissue with a tube pestle (Kontes #749521- 590) or glass rod. 4. Once the sample is prepared add 800 µl CTAB Buffer and 100 µl SDS. (Can store overnight @4C)

Day Two: 5. Remove samples from refrigerator, then vortex (or flick the tube) to mix the contents. Next incubate at 65˚C for 10 min. (Preheat the bath ahead of time so it is ready) 6. Place tube on ice and add 410 µl cold potassium acetate. Mix by inversion (10 times) and place tube back on ice for 3 min.

7. Centrifuge at 13,200 rpm for 15 min. at room temp. 8. Using a pipette, transfer approximately 1 ml of the supernatant to a new 2.0 ml microcentrifuge tube. Avoid sucking up plant tissue, as it will interfere with the DNA. Add 540 µl of ice cold absolute isopropanol, invert several times to mix, and incubate on ice for 20 min. (Can store overnight @4°C). Allow the opened plant tissue tubes to dry in a fume hood before discarding; this can take several days.

Day Three: 9. Centrifuge at 10,200 rpm for 10 min. Discard the supernatant. A pellet of DNA should be visible near the bottom of the tube as shown in the picture on the right. Decant the excess isopropanol down the sink. Be careful not to pour out the DNA pellet, if it has become detached from the wall of the tube. Wash the pellet once in 500 µl 70% ethanol. Gently invert tube several times; do not break up the pellet. Decant excess ethanol and let drops on side of tube dry. 10. Resuspend the dry pellet in 200 µl of TE. The tubes can now be stored at 4°C.

Source: Protocol modified from Keb-Llanes et al. Plant Molecular Biology Reporter 20: 299a-299e. 2002.

3 - Polymerase Chain Reaction of the Kap Gene Materials Thermalcycler 0.2 ml PCR tubes 1.5 ml centrifuge tubes Micropipettes Pipette Tips Ice Molecular Grade Water Master Mix (as defined below) Kap PCR primers DNA Template(s) Taq DNA Polymerase Gel Loading Dye

Procedure 1. Thaw DNA template, primers and Master Mix on ice. (This can take several minutes with large volumes.) 2. Label PCR tube(s) with line #, initials, primer set, and class period. 3. Create primer mix in a 1.5 ml centrifuge tube by adding enough Master Mix, water, Kap PCR primers and Taq polymerase for all reactions (plus two to compensate for pipetting error). See chart below for determining primer mix amounts. 4. Transfer 24 µl primer mix to appropriate PCR tubes. 5. Add 1 µl DNA template to each PCR tube (Be sure to use a clean tip each time!). 6. Store tubes on ice until all students are done. 7. Verify thermalcycler program. 8. Transfer tubes to thermalcylcer. 9. Start thermalcycler.

Cycling Parameters Step 1: 94˚C for 3 minutes Step 2: 94˚C for 30 seconds, 54˚C for 30 seconds, 72˚C for 1 min 30 sec (35x) Step 3: 72˚C for 10 minutes Step 4: 4˚C for ∞ (hold forever)

PCR start stop Primer(s) Template(s)

Preparing Primer Mix: Reagent Volume Number of Total Volume for all rxns (µl per rxn) Reactions Molecular Grade 10.5 µl 22 = 231 µl H2O Master Mix 12.5 µl 22 = 275 µl

Primer 1 0.5 µl 22 = 11 µl

Primer 2 0.5 µl 22 = 11 µl

Taq Polymerase 0.125 µl 22 = 2.75 µl

Total Primer Mix = 530.75 µl

Preparing Samples for PCR: Reagent Volume (µl per rxn) Primer Mix 24 µl Template DNA 1.0 µl Total = 25 µl

Primer Information Name Sequence Kap = 3BF CCCCTCAAAGTTCAGGTCAATCCT 24 bps 3DR ATAAAACCAGAAGAGTGTGGAGTA 24 bps

Reference for Kap primers: Williams-Carrier, R., Lie, Y., Hake, S., and Lemaux, P. (1997). Ectopic expression of the maize kn1 gene phenocopies the Hooded mutant of barley. Development. 124: 3737-3745.

Note: Primers can be ordered through Invitrogen or any other supplier of oligonucleotides. Primers are supplied to teachers working with the Wise Lab (USDA- ARS/Iowa State University).

4 - Pouring and Running an Electrophoresis Gel Materials 1X TBE 500 ml flask Wax Paper Gel Box Agarose Gel Loading Dye Lab Tape Balance or Scale Micropipettor and tips Microwave Hot Glove Gel Green DNA stain

Procedure – Preparing the Gel 1. First, determine the volume of the gel to be used. This will depend on the length and width of the gel tray, as well as the approximate depth of the gel you want. Multiply the gel volume by 0.01 to determine the number of grams of agarose needed for a 1% gel. For example, an 80 ml gel will require 0.8 grams of agarose.

2. In an Erlenmeyer flask, add your calculated amount of agarose to a volume of 1X TBE buffer equal to the desired gel volume. So, using the example from above, you would measure out 0.8 g of agarose and 80 ml of 1X TBE and pour them both in the flask.

3. Add 1 µl of Gel Green stain for every 10 ml of buffer used. Again, using our example, the 80 ml of 1X TBE we used in Step 2 would require 8 µl of Gel Green. The Gel Green will dissolve quickly simply by swirling the contents of the flask. However, the agarose will not dissolve so easily.

4. Dissolve the agarose using a microwave oven. Use 45-60 second intervals, gently swirling in-between each interval, but be careful not to create bubbles, as this will interfere with pouring of the gel. When solution is clear, the agarose is dissolved.

5. Let the flask stand on the tabletop until it is warm (but not below 55°C because the gel will start to solidify). A good indicator is if you can touch the bottom of the flask for several seconds without your hand getting too hot. While you are waiting for the solution to cool, tape the ends of the gel tray with labeling tape or masking tape.

6. Make sure the gel comb(s) is (are) inserted into the gel box. Now pour the agarose solution into the gel tray. Let it stand until the solution completely cools and becomes semi-solid. A good indicator that the gel is ready is if you notice it has become a whitish-cloudy color.

7. Remove the combs and tape from the gel tray before placing into the gel box. Pour 1X TBE into the gel box until both reservoirs are full and the gel is slightly submerged (about 1 mm over the top of the gel).

Procedure – Preparing the DNA for Loading Before the DNA can be loaded into the gel, a loading dye must be added. The loading dye molecules will run ahead of the DNA during electrophoresis and give you a visual indication of when to shut off the electric current.

1. Place a 3 µl drop of loading dye on a piece of wax paper. Add to this drop 10 µl of your DNA sample. Using your pipette, draw up and dispense this mixture several times to insure adequate mixing. The mixture will turn blue as the loading dye reacts with salts present in the DNA sample.

2. Repeat Step 1 for each sample you want to load onto the electrophoresis gel. If you are going to be loading numerous samples, it may be helpful to draw a grid on your wax paper to indicate which DNA samples are which. The diagram below shows

you what this might look like. The numbers in each square of the grid correspond to a different sample of the Oregon Wolfe Barleys.

Dom Rec 4 2 18 6 9 10 11 14 15 16 70 39 44 46 49 55 57 90

Procedure – Loading, Running, and Visualizing the Gel 1. Record in each sample in your lab notebook to document which DNA samples are in which gel wells. Using a micropipettor, transfer the 10 µl of each DNA sample you just prepared into its own gel well. Be sure to use a new tip for each sample! Don’t worry about getting the micropipette tip point down into the gel well. Hold the tip over the gel well you are targeting and dispense the DNA. The loading dye contains glycerol, which adds weight to the blue solution and causes it to sink down into the well.

2. Repeat Step 1 for each of your samples.

3. When all the samples have been loaded and recorded, place the lid on the gel box. Plug the leads connected to the lid into the power source and turn on the current. Run the gel for 30 minutes at 100 volts.

4. The DNA is not visible at this point, but during the electrophoresis the Gel Green stain has adhered to the DNA. In order to see the DNA, gently remove the gel from the gel box and place it upon the blue platform of the Vernier Transilluminator (see below). Lower the orange lid and turn the light knob. The DNA bands should become visible. The darker the surroundings, the better the bands show up. Turning off the room lights room can help.

5. To store the gel, wrap it in plastic wrap (or place it in a zip-lock bag) and place it in the refrigerator. The cool temperature will prevent the DNA bands from diffusing throughout the gel and becoming difficult to see.

Example of gel stained with Gel Green and visualized by the Vernier transilluminator. Amplified products display the size polymorphism in the Kap gene.

III. Extensions to the Module This section includes several optional extension activities for teachers. You may want your students to perform one (or more) of these extension activities in addition to those in the learning module, or you may decide to use them separately in a way that fits your time, curriculum, and equipment needs the best.

The first three activities should be conducted before the Learning Module to provide students with a foundation in basic techniques. Pipette Calibration (Protocol 5) is a useful activity if you question the accuracy of your micropipettes, or if your students do not have experience using these important tools. The Strawberry DNA Extraction (Protocol 6) exercise is a fun and low-tech way to introduce the process of DNA extraction to younger students or to those who have never performed such a procedure before. Tip Top Electrophoresis (Protocol 7) is a “homemade” electrophoresis exercise. Using everyday materials, you can set up your own electrophoresis equipment. This activity is a great hands-on way to help your students understand how electrophoresis works.

PCR of the Vrs1 Gene (Protocol 8) and Restriction Digest of Vrs1 (Protocol 9) provide options to go beyond the Learning Module with advanced students or if you have extra time. The Vrs1 gene has two alleles, one of which codes for a two-row seed spike in the adult barley plant, and the other which codes for a six-row seed spike. The two-row phenotype is dominant over the six-row. The two alleles, however, are the same length in terms of DNA base pairs. In order to determine the genotype of a plant, the DNA must first be amplified using PCR and then digested with a restriction enzyme. The enzyme used in this activity, NciI, cleaves the dominant two-row allele in three places, resulting in four DNA bands during electrophoresis. NciI cuts the recessive six- row allele in two places; thus, only three fragments are produced. Protocol 9 includes instructions for both the restriction enzyme digest and the subsequent electrophoresis of the resulting DNA fragments. Along with the Learning Module activities, these two exercises are a great way to help your students make the connection between an organism’s expressed phenotype and the DNA that makes it happen.

5 - Pipette Technique and Practice The micropipette is a basic tool for transferring small volumes. These exercises are provided to help familiarize your students with its proper use.

Materials Micropipettes Deionized water Weigh boat Analytical balance

How to Adjust and Read the Micropipette It is important for your students to be able to adjust and read the volume setting on a micropipette. Brands may vary, but every pipette has some kind of knob to adjust volume and a window to read the volume. To adjust the micropipette to the volume you want, simply turn the knob until the correct reading shows up in the window. The trick is reading the window correctly. How you

make a reading depends on which size of pipette you are using. For example, if you are using a 0.5-10 µl micropipette, the top number in the window represents the tens digit; the middle number represents the ones digit; and the bottom number is the tenths place. So if the reading looks like this,

0 5 6

the micropipette is set to take up and dispense 5.6 µl.

A 2-20 µl micropipette is the same. The top number is the tens place; the middle is the ones place; and the bottom number is the tenths. If your reading looks like this,

1 3 4

your micropipette is set to transfer 13.4 µl.

Larger pipettes are a bit different. For a 20-200 µl pipette, the top number is the hundreds digit; the middle number is the tens digit; and the bottom number is the ones digit. If you need to transfer 125 µl, you should turn the knob to make the reading look like so: 1 2 5

For a 100-1000 µl micropipette, the top number is the thousands digit; the middle number is the hundreds, and the bottom number is the tens. If your protocol calls for 500 µl, you should set the micropipette to look like this:

Seem strange? The best way to become familiar with each of the pipettes is to practice setting volumes. You’ll get the hang of it quickly. One final note, although a pipette can be dialed above or below it’s stated range; doing so will throw off the calibration and result in inaccuracy. NEVER DIAL A PIPETTE ABOVE OR BELOW IT’S RANGE.

How to Transfer a Sample The plunger of the micropipette has two “stops”. As you press down, you reach the first stop. If you apply a little more pressure, the plunger continues to the second stop. It is important for students to recognize both stops in order to transfer volumes.

This is how to take up a sample with your micropipette: 1. Put a fresh tip on the end of your micropipette. 2. Press the plunger down to the first stop. 3. Insert the tip into the solution to be transferred. 4. Gently allow the plunger to lift back to its original position. This draws solution up into the tip.

To dispense your volume: 1. Place the tip into the container to which you are transferring the solution. 2. Smoothly press the plunger all the way down to the second stop. This will eject the solution from the tip. 3. Draw your tip out of the container before releasing the plunger back to its original position. If you release the plunger too soon, you may take up solution into the tip that you don’t want. 4. Use the ejector button to get rid of the tip.

Procedure – Pipette Practice 1. Adjust the dial on your pipette to the highest volume.

2. Pipette deionized water into a weigh boat on an analytical balance. Weigh and record the volume. Repeat five times. 3. Adjust the dial to the lowest volume. Repeat Step 2. 4. Adjust the dial to a middle range. Repeat Step 2. 5. One microliter of water should weigh one microgram (1ul = 1 ug). If your pipette is delivering incorrect volumes consistently it should be calibrated. If the volume is randomly inconsistent technique should be improved.

Modified from http://www.ehow.com/how_2044881_calibrate-pipette.html

For more information, check out: http://www.benchfly.com/video/151/how-to-use-a- pipetman/

For general information on various lab techniques see the parent web site: http://www.benchfly.com/

6 - Strawberry DNA Extraction Materials 50 ml centrifuge tubes Bleached coffee filters (white) Styrofoam or plastic cups (8 oz.) 95% ethanol (ice cold) Zip-lock sandwich bags Whole strawberry Lysis buffer Detergent (ex. Dawn dish soap) Salt (iodized or non-iodized) Distilled water For each 100 ml of lysis buffer, add ¼ teaspoon of salt to 90 ml of distilled water. Stir the buffer until the salt is dissolved. Add 10 ml of detergent and stir until mixed.

Procedure 1. Take off the leaves on the top of the fruit and place the fruit in a sandwich bag. 2. Seal the sandwich bag and pulverize the fruit. Smash the fruit by hand and then roll a pen or marker back and forth over the bag to make the fruit as liquid as possible.

3. Add 10 ml of the lysis buffer to the bag and reseal. 4. Continue to roll the fruit tissue in the lysis buffer for two minutes. 5. Place a coffee filter in an 8 oz cup. 6. Pour the contents of the sandwich bag into the filter and set aside for 10 minutes. 7. Discard the coffee filter and its contents. 8. Pour 30 ml of ice cold 95% ethanol into a 50 ml centrifuge tube. 9. Pour the contents of the 8 oz. cup into the tube, cap the tube, wait for the DNA to start precipitating in the ethanol (the process begins almost immediately and the DNA will continue to condense for the next few minutes). *Protocol by Julie Townsend, Parkview Middle School, Ankeny, Iowa.

7 - Tip Top Electrophoresis Objective Simulate the process of DNA fingerprinting by using electric current to separate colored dyes.

Materials For the electrophoresis chamber: Small plastic box approximately 8x12cm (empty micropipette tip boxes are perfect) 2 regular popsicle sticks 2 narrow popsicle sticks (coffee stirrer kind) Scissors Masking tape Two 5” pieces of stainless steel wire (11” stainless steel wire ties can be found at Lowes) 2 electrical leads with alligator clips Five 9V batteries

For the gel and buffer: Water Baking soda

Agar-agar powder (available from Asian grocery stores) or agarose (available from chemical supply companies) Mat knife or razor blade

For the samples: Water Food coloring Glycerin (available from pharmacies) Needle-tip disposable pipette or micropipetter and tips (Optional) beaker of water for rinsing tips between samples

Assembly 1. Make a comb to create wells in the gel that will eventually hold the samples. Cut the narrow popsicle sticks so that they sit just above the bottom of the base when hung from a regular popsicle stick (~3-4 cm depending on the depth of your box). Cut 5 teeth and tape them to a regular popsicle stick so that they are evenly spaced and hang down to the same level. Tape the other regular popsicle stick on the other side to secure the teeth, and check to see that they hang evenly when placed on the box without touching the bottom. Place the comb vertically in the top of your box. (Have your students come up with their own design giving them certain parameters. A wood comb does not pull out of the gel very well.)

2. Make a 0.2% sodium bicarbonate buffer by dissolving 2 g of baking soda in 1 L of water. You will need ~100 ml per set up. Just enough buffer to cover the gel and fill in the wells.

3. Make a 1% gel solution by adding 1 g of agar-agar powder to 100 ml of sodium bicarbonate buffer. You will need 40-50 ml of gel solution per set up. To dissolve the powder, heat the solution in the microwave, stopping every so often to swirl the solution. Watch the solution carefully as it will quickly boil over when too hot. When you see bubbles, stop the microwave, and swirl the solution until the agar-agar particles completely dissolve. The solution should be translucent when heating should stop.

4. Once the solution is cool enough to pour, add just enough into the box so that ~0.5 cm of the comb teeth are submerged. Poor the gel when it is warm to the touch.

Adjust the comb by sliding it so that it is ~1.5 cm from the top of the box. Thinner gels will yield better separations.

5. The actual gel only needs to be half the size of the box. In addition, you need to make space to place the electrodes. Once the gel sets (~5-10 min), use a knife or blade of some kind to cut off the bottom half of the gel. Also, without disturbing the comb, cut out a thin strip from the top of the gel to make room for a wire electrode. Your gel should now be around 6 cm long and 8 cm wide (still the full width of your box). The extra pieces of gel can be recycled by reheating them in the microwave.

6. Bend each piece of stainless steel wire to run along the width of the box and hook over the side. Place one on either side of the gel. Use tape to secure them to the box if you need to. These will be the positive and negative electrodes.

7. Make a high voltage power supply by connecting the five 9V batteries. Clip two batteries together by inserting the positive terminal of one into the negative terminal of another. Attach the remaining batteries one by one in this way until you have a five-battery pack. Clip an electrical lead to each of the exposed terminals of the pack. You should now be able to use the battery pack to power the gel box by attaching the other ends of the electrical leads. 8. Prepare 5 different samples by mixing 1-2 drops of food coloring with 1 ml glycerin and 1 ml water in a small tube. We used blue, red, green, yellow, and purple (made by mixing blue and red food coloring).

Procedure 1. When your gel set-up is ready, pour just enough buffer to cover the solidified gel. Make sure you fill up the space left from the cut gels and that the gel is completely submerged.

2. Gently remove the comb by pulling straight up without tearing the gel. The wells should fill with buffer.

3. Use the needle tip pipette to transfer ~10 µl of each sample to an empty well. The volume of the thin tip of the pipette is about 10 µl. Submerge the tip in the buffer directly above the well and gently squeeze the sample into the well. It should fall into the well since it is denser

than the surrounding buffer. You should use a new pipette for each sample to prevent contamination between samples. If you only have a few pipettes, rinse out the tip well in a large beaker of water before re-using.

4. Once all the samples are loaded, connect the leads from the power supply to the stainless steel wire electrodes attached to the box. Connect the negative terminal to the electrode at the top of the gel (near the combs) and the positive terminal to the electrode at the bottom of the gel. You should see bubbles forming along the electrodes when a complete circuit is made.

5. Allow the samples to run for 15-20 minutes and make observations.

Additional Information Molecular Cell Biology by Lodish et. al., W. H. Freeman (2000) A classic molecular biology text available FREE online at: http://www.ncbi.nlm.nih.gov/books/bv.fcgi?rid=mcb http://en.wikipedia.org/wiki/Gel_electrophoresis http://en.wikipedia.org/wiki/Food_dye Gel Electrophoresis - Draft Julie Yu, Exploratorium, 2007

8 - Polymerase Chain Reaction of the Vrs1 Gene In this activity, the barley DNA samples are amplified by Polymerase Chain Reaction using Vrs1 primers. This PCR amplification, along with the electrophoresis of the PCR amplicons performed in Protocol 9, allows students to visualize the DNA difference between barley plants that have a two-row seed spike and those that have a six-row seed spike.

Working with the Vrs1 gene is a bit more complex than working with Kap gene. The dominant and recessive alleles of the Kap gene have length polymorphisms, meaning they are coded by DNA sequences of different lengths. You will be able to distinguish the allele of each sample by your electrophoresis results. However, the alleles of the Vrs1 gene are the same length. In order to distinguish the genotype of the Vrs1 samples, the amplified DNA must be digested with a restriction enzyme to uncover the restriction enzyme length polymorphisms (RFLPs), before electrophoresis is done (Protocol 9).

Note that the amounts of reagents and DNA sample used in this protocol are different than Protocol 3. This is so you have enough PCR product to do an electrophoresis both before and after the enzyme digest. Also, notice the program for the thermalcycler is slightly different.

Materials Thermalcycler 0.2 ml PCR tubes 1.5 ml centrifuge tubes Micropipettes Tips Ice Molecular Grade Water Master Mix Vrs1 primers DNA Template(s) Taq Polymerase Gel Loading Dye

Procedure 1. Thaw DNA template, primers and Master Mix on ice. (This can take several minutes with large volumes) 2. Label PCR tube(s) with line #, initials, primer set, and class period. 3. Create primer mix in a 1.5 ml centrifuge tube by adding enough Master Mix, water, Vrs1 primers and Taq polymerase for all reactions (plus two samples to compensate for pipetting error). Add the Taq last because it is the most temperature sensitive. 4. Transfer 48 µl of primer mix to appropriate PCR tubes. 5. Add 2 µl DNA template to each PCR tube. (Be sure to use a clean tip each time!) 6. Store tubes on ice until all students are done. 7. Verify thermalcycler program. 8. Transfer tubes to thermalcylcer. 9. Start thermalcycler program.

Cycling Parameters Step 1: 94˚C for 3 minutes Step 2: 94˚C for 30 seconds, 60˚C for 30 seconds, 72˚C for 1 minute 30 seconds (35x) Step 3: 72˚C for 10 minutes Step 4: 4˚C for ∞

PCR start stop Primer(s) Template(s)

Preparing Primer Mix: Reagent Volume Number of Total Volume for all rxns (µl per rxn) Reactions Molecular Grade 21 µl 22 = 462 µl H2O Master Mix 25 µl 22 = 550 µl

Primer 1 1.0 µl 22 = 22 µl

Primer 2 1.0 µl 22 = 22 µl

Taq Polymerase 0.250 µl 22 = 5.5 µl

Total Primer Mix = 1061.5 µl

Preparing Samples for PCR: Reagent Volume (µl per rxn) Primer Mix 48 µl Template DNA 2.0 µl Total = 50 µl

Primer Information Name Sequence Vrs1 = HvHox1.01F CCGATCACCTTCACATCTCC 20 bps HvHox1.02R GGTTTCTGCCGATCTTGAAGC 21 bps

Reference for Vrs1 primers: Komatsuda, T., Pourkheirandish, M., He, C., Azhaguvel, P., Kanamori, H., Perovic, D., Stein, N., Graner, A., Wicker, T., Tagiri, A., Lundqvist, U., Fujimura, T., Matsuoka, M., Matsumoto, T., and Yano, M. (2007). Six- rowed barley originated from a mutation in a homeodomain-leucine zipper I-class homeobox gene. Proc. Natl. Acad. Sci. USA. 104: 1424-1429.

9 - Restriction Digest of the Vrs1 Amplicon

Materials Vrs1 PCR Product (DNA) New England Biolabs (NEB) Buffer 4 NciI Restriction Enzyme Molecular Grade Water Micropipettes Tips

0.2 ml PCR tubes 1.5 ml centrifuge tube Thermalcycler or 37°C Incubator or water bath

Procedure 1. Create a reaction mix of NEB Buffer 4, NciI, and H20 in a 1.5 ml centrifuge tube (example below). 2. Add 5 µl reaction mix to 20 µl PCR product for a 25 µl reaction. 3. Incubate at 37°C for 1 hour. 4. Store at 4°C until ready to electrophorese. 5. Electrophorese samples in a 1% agarose gel. 6. Follow Gel Green DNA staining procedure. (See Protocol 4.)

Restriction Enzyme Digests

Reagent Amt./Rxn # RXNs Mix Volume Final Conc. DNA 20 - - - NEB Buffer 4 (10x) 2.5 22 55 1X NciI (20 µg/µl) 0.5 22 11 10 units/RXN

H2O 2.0 22 44 - Total = 25 µl

Predicted Fragment Lengths

IV. Appendices Appendix A – Stock Solutions 2X CTAB Buffer: Per 500 ml Tris-HCl 100 mM NaCl 1.4 M EDTA (Ethylenediamine-tetraacetic acid) 20 mM CTAB (Hexadecyltriethyl-ammonium bromide) 10 g

2-Mercaptoethanol - added the day of extraction (19.6 ml 2X CTAB with 400 µl 2-Mercap)

1X TE Buffer:Per 100 ml 10 mM Tris-HCl (pH 8.0) (Use 1M stock) 1.0 ml 1 mM EDTA (Use 0.5M pH 8.0 stock) 50 µl

10X TBE Buffer: Per 1000 ml 0.89 M Tris 108 g 0.89 M Boric Acid 55 g 0.02 M EDTA 9.3 g Deionized Water Dilute 1:9 to prepare 1X TBE Buffer

Appendix B – Troubleshooting Kap Amplicon Gel Key – OWB segregating double haploid progeny

The characters above each well represent the parents (D for Dominant and R for Recessive), and the 18 lines of the OWB segregating double haploid progeny. The row of letters above the bands indicates the phenotype; K stands for the dominant “hooded” phenotype while k stands for the recessive “Awn” phenotype. The bands represent the DNA fragment amplified during PCR. The hooded phenotype has a 1500 bp band while the awn phenotype has a 1200 bp band.

Lines 16 and 44 have the 1500 bp band but show the awn phenotype. This is due to epistasis of the Kap gene by another gene named Lks2. A dominant Lks2 allele must be present for the hooded phenotype to occur. When a recessive Lks2 allele is present with a dominant Kap allele, the plant will have the awn phenotype. This is the case in lines 16 and 44. Vrs1 Amplicon Gel Key – OWB segregating double haploid progeny

D R 4 2 18 6 9 10 11 13 14 16 70 39 44 46 49 55 57 90

~1200bp

Unlike the Kap amplicons, the Vrs1 amplicons are not size polymorphic as seen in the previous gel. The difference in sequence can be visualized using the NciI restriction enzyme. This enzyme’s restriction site is present twice in the recessive allele(r) and three times in the dominant allele (R).

The letters below each lane represent the phenotype of each individual where R refers to a two-row and r refers to a six-row seed spike. NciI digestion cleaves the 1200 bp amplicon into four pieces in the dominant allele and three pieces in the recessive allele. The 700 bp band of the recessive allele is most obvious as it sits well above the smaller fragments.

Appendix C – Standards

Standard Benchmark Action Unifying concepts and Evidence, models, and explanation Students will use evidence they gather, both processes in science observationally and experimentally, to explain why some plants have trait A while other plants have trait B.

Science as Inquiry Understanding of scientific concepts The focus of this module is on understanding cosegregation of genotypes and phenotypes, not on memorizing terms like genotype and phenotype.

An appreciation of “how we know” what Students will experience “how we know” that we know in science genotypes determine phenotypes.

80 Understanding of the nature of science This module demonstrates many facets of the nature of science including, but not limited to, science takes time, experiments don’t always work the way in which they are expected, data is interpreted, etc.

Skills necessary to become independent The thought processes developed in this module inquirers about the natural world are able to be applied to all scientific endeavors.

The dispositions to use the skills, Students should collaborate, use scientific abilities, and attitudes associated with language, base arguments on data and evidence, science make observations, draw conclusions and write a lab report.

Life Science Standards Molecular basis of heredity This is the foundation of the Gene Expression and Segregation Analysis module.

Biological evolution Variation in organisms is heritable.

Science and Technology Understanding about science and The use of technology is not always required but technology often enables deeper understanding of fundamental concepts. Tip Top electrophoresis provides a simple scaffold for gel electrophoresis of PCR amplicons.

Science in Personal and Science and technology in local, Iowa’s economy is largely based on agriculture. Social Perspectives national, and global challenges Our nation is attempting to reduce dependence on foreign oil and develop more environmentally friendly sources of energy. The world’s population is rapidly increasing which requires much greater food production from the same size or smaller plots of land.

History and Nature of Science as a human endeavor Students will build understanding based on their Science own observations and evidence. This experience 81 can be broadened to explain the development of all scientific understanding.

Nature of scientific knowledge What is known is based only on the available data and its interpretation.

Appendix D – Student Handouts

Student Planting Instructions 1. Obtain a pot, marker, tag, tape, and seed packet from your instructor. Label your tag with your name, OWB # (from the seed packet), and the date. Label the tape the same way and apply it around the top of the pot. This will be used to identify your plant from the others. 2. Fill the pot to the top with soil in a scooping motion, but do not compact the soil into the container. 3. Place your finger into the soil, knuckle deep (~1 inch) three times to make three separate spaces for the seeds. 4. Drop one seed in each of the three holes that you created, lightly cover with remaining dirt. 5. Place the tag into the soil for easier identification. Place the pot under the light bank (or growing area). 6. Water your plant so that the soil is moist.

DNA Extraction Instructions **Before beginning make sure you have safety glasses and gloves.**

Day One: 1. Collect three leaves, around 3 to 4 inches in length. Find the mass of the leaves until you obtain ~0.3 g leaf tissue. Label the side of the 2.0 ml microcentrifuge tube with your OWB #, initials, class period, and date. Mark the top with the same information. 2. Place the leaves on a clean glass slide on top of a paper towel. Chop the tissue into very small pieces using a clean razor blade. The more finely chopped the better the DNA extraction will be. 3. Immediately transfer tissue to a 2.0 ml microcentrifuge tube and further grind tissue with a tube pestle or glass rod. Mash the tissue into a wet pulp for 2 minutes. 4. Add 800 µl CTAB Buffer and 100 µl SDS. 5. Place your microcentrifuge tube on ice and wait for further instructions from your instructor.

Day Two: 6. Allow your sample to thaw out. You can speed this up by holding the microcentrifuge tube in your hand. Use the vortex machine to mix up the contents by holding the microcentrifuge tube down on the rubber disc for 15 seconds or until all the material is mixed up 7. Incubate the tube at 65˚C for 10 min. Place the tube into a floating microcentrifuge tube holder in the water. Make sure not to disrupt other tubes. 8. After the 10 minutes has elapsed, obtain your tube, and place the tube on ice. Add 410 µl of cold potassium acetate (located in your ice bucket). Mix by inverting the

tube up and down 10 times. Then place the tube back on ice for 3 min. 9. Keep your tube on ice till all groups are ready. Then bring your tube to the instructor to place in the centrifuge. The tubes will spin at 13,200 rpm for 15 minutes at room temperature. While this is taking place, obtain a new 2.0 ml microcentrifuge tube and label it with your initials, OWB #, period # and date (same as the first tube). 10. When the centrifuge has stopped, obtain your tube and return to your lab bench. Transfer approximately 1 ml of the supernatant to the new 2.0 ml microcentrifuge tube. This can be tricky as you have to place the pipette tube past the film on top of the liquid and only draw up the liquid above the green plant matter (which should be clumped together at the bottom of the tube). There should not be any green material drawn up into the pipette. Use a P1000 set to 1000 µl and try to get as close to the full amount as possible. 11. Add 540 µl of ice cold absolute isopropanol (in your ice bucket), invert 10 times to mix, and place the tube back on ice for 20 minutes. Bring your used tube with plant tissue in it to the instructor for disposal (DO NOT THROW AWAY).

Day Three: 12. Obtain your tube from the teacher and place it in the centrifuge. Centrifuge at 10,200 rpm for 10 minutes. Your tube should now contain a clear solution and a small pellet that is stuck to the wall of the tube, just above the bottom. Discard the supernatant (fluid) by pipetting it out. Use a P1000 to do so, but be careful not to disturb the pellet. 13. Wash the pellet once with 500 µl 70% ethanol. Gently invert tube several times; do not break up the pellet. Decant the excess ethanol and let drops on side of tube dry. If there are still drops on the side of your tube, place a paper towel over the top and let it sit overnight. 14. Once the pellet has dried, add 200 µl of TE to the tube. Use the vortex to suspend the pellet in the TE. Give the tube to your instructor when you are finished. PCR Student Directions 1. Obtain your DNA in the 2.0 ml microcentrifuge tube. Begin to thaw it out. Obtain a PCR tube from your instructor and label it with your initials, OWB #, class period and date. 2. Your instructor will add 24 µl of the hooded/awn (Kap) primer mix to your PCR tubes. 3. Add 1ul DNA template to your PCR tube. 4. Store tubes on ice until further directed by your instructor. 5. Verify thermalcycler program. 6. Transfer tubes to thermalcylcer. 7. Start thermalcycler program Kap. Gel Electrophoresis Student Directions 1. Obtain your PCR product from the instructor. 2. On a piece of wax paper, combine 3 µl of loading dye with 10 µl of PCR product.

Take up and dispense the mixture with your pipette three to four times. Your product should now be a blue color once mixed. 3. Adjust your pipette to 13 µl and take up your blue mixture. 4. Dispense the mixture into the correct gel well as indicated by your instructor.

V. Acknowledgements Protocols 1 – Growing Instructions for Oregon Wolfe Barley (http://barleyworld.org/oregonwolfe.php) Modified from protocol at www.barleyworld.org. Seed can be obtained from http://barleyworld.org/oregonwolfe/plant-material. 2 – Leaf Tissue DNA Extraction Protocol developed by Wise Lab, USDA-ARS/Iowa State University, Ames, IA 3 – Polymerase Chain Reaction of Kap Gene Primer sequence provided by Patrick Hayes, Oregon State University Protocol developed by Wise Lab, USDA-ARS/Iowa State University, Ames, IA Reference for Kap primers: Williams-Carrier, R., Lie, Y., Hake, S., and Lemaux, P. (1997). Ectopic expression of the maize kn1 gene phenocopies the Hooded mutant of barley. Development. 124: 3737-3745.

4 – Pouring and Running an Electrophoresis Gel Modified from Gel Green Protocol 2011 5 – Pipette Calibration and Use Modified from: http://www.ehow.com/how_2044881_calibrate-pipette.html For more information see http://www.benchfly.com/ 6 – Strawberry DNA Extraction Protocol by Julie Townsend, Parkview Middle School, Ankeny, Iowa. 7 – Tip Top Electrophoresis Modified from Sandra Slutz, PhD, Science Buddies, http://www.sciencebuddies.org/science-fair- projects/project_ideas/BioChem_p028.shtml 8 – Polymerase Chain Reaction of Vrs1 gene Protocol developed by Wise Lab, USDA-ARS/Iowa State University, Ames, IA Reference for Vrs1 primers: Komatsuda, T., Pourkheirandish, M., He, C., Azhaguvel, P., Kanamori, H., Perovic, D., Stein, N., Graner, A., Wicker, T.,

Tagiri, A., Lundqvist, U., Fujimura, T., Matsuoka, M., Matsumoto, T., and Yano, M. (2007). Six-rowed barley originated from a mutation in a homeodomain-leucine zipper I-class homeobox gene. Proc. Natl. Acad. Sci. USA. 104: 1424-1429.

9 – Restriction Digest of Vrs1 Amplicon Protocol developed by Wise Lab, USDA-ARS/Iowa State University, Ames, IA 10 – Fun videos: http://www.youtube.com/watch?NR=1&v=khBmRuFc_P4 http://www.youtube.com/watch?v=IpMOrX1fzGM&feature=related 11 – The authors thank Eric Hall, Hoover High School, Des Moines, IA; Craig Walter, Ames High School, Ames, IA; Dr. Karri Haen, Research Institute for Studies in Education, ISU, Ames, IA; and Dr. Adah Leshem, Plant Genomics Education Outreach, Iowa State University, Ames, IA, for critical reading of the manual.

CHAPTER 4: CONCLUSIONS AND FUTURE DIRECTIONS

General Conclusions Effector biology is changing the way scientists approach host-pathogen interactions. Due in large part to the recent sequencing of both genomes, barley and powdery mildew have emerged as a model system to study the nature of obligate biotrophy. Through a combination of bioinformatics (Spanu et al., 2010; Pedersen et al., 2012) and proteogenomics (Bindschedler et al., 2009; Bindschedler et al., 2011), a suite of nearly 500 effectors has been identified in Blumeria graminis f. sp. hordei alone.

While the vast majority of these are unique to B. graminis and are assumed to play a role in obligate biotrophy and host specificity, a few are conserved in other fungal species. In particular, BEC1019 is conserved in 96 fungal species spanning three major phyla. This degree of conservation offers the hope of engineering broad- spectrum resistance.

BEC1019 was originally identified through proteogenomic analysis as uniquely expressed in haustoria (Bindschedler et al., 2011). Later, a host-induced gene silencing screen of 50 Blumeria effector candidates identified BEC1019 as one of only eight that significantly reduced haustorial development (Pliego et al., 2013). Here we show that virus induced gene silencing of BEC1019 via Barley stripe mosaic virus results in significantly lower percent infection in the B. graminis isolate 5874 (avra9)/Barley accession HOR 11358 (Mla9) interaction than in an empty vector control. Moreover,

BEC1019 is able to suppress cell death induced by Xanthomonas oryzae pv. oryzicola and the Pseudomonas syringae effector AvrPphB when delivered by the Xanthomonas campestris pv. raphani type III secretion system. Site-directed mutagenesis of highly conserved amino acids identified Val132 and Cys134 in the ETVIC motif as

independently required for cell death suppression activity. While this result does not link cell death suppression to virulence, it is tempting to speculate that the decreased virulence observed in the VIGS assay is due to the loss of cell death suppression observed in the type III secretion system assay.

Another interesting observation involves the HRxxH fungal allergen motif.

Alanine substitutions for the three conserved residues in this motif have no impact on the cell death suppression assay when delivered via the Xanthomonas type III secretion system. This was perplexing because this motif is conserved in every ortholog identified. One explanation is that HRxxH is involved in translocation across the cell membrane. This motif falls under the broad definition of an RxLR which is known to facilitate translocation of oomycete effectors across cell membranes (Dou et al., 2008).

Because the type III secretion system delivers proteins directly from the bacterial cell to the host cell cytoplasm, mutations in a motif responsible for translocation would not be detected in this assay.

Future Directions BEC1019 orthologs include Aspergillus fumigatus major allergen AspF2 and

Candida albicans Pra1. While all orthologs are predicted to be M35-like metalloproteases, protease activity has never been demonstrated. An assay has been developed to investigate the proteolytic activity of Pra1 that could be exploited to determine if BEC1019 is or is not a protease (Citiulo et al., 2012). In addition, several studies have shown that both AspF2 and Pra1 are involved in zinc binding (Amich et al.,

2010; Citiulo et al., 2012). The extent to which BEC1019 binds zinc, the specific

residues responsible for binding, and the role of zinc binding in enhancing virulence are all important questions that still need answers.

In this study the ETVIC motif has been implicated in the cell death suppression phenotype through loss of function mutations V132A and C134S. HRxxH seems to play a role in translocation across the host cell membrane. Further study is warranted in both cases. Specifically, if protease activity is detected and if cell death suppression is dependent on protease activity, we would expect the loss of function mutants to exhibit lower protease activity than wild-type BEC1019. Likewise, if HRxxH is responsible for translocation, we would expect the alanine substitution mutants to be undetectable inside host cells when delivered just outside the host cell membrane. Alternatively, if

HRxxH is involved in zinc binding (as HExxH is) than we would expect mutants to bind zinc with much lower affinity or not at all.

While characterizing motifs is important, perhaps the most important focus would be on identification of BEC1019 host protein targets/interactors. This could be done through a yeast two-hybrid assay or through pull-downs with purified BEC1019 protein. Knowing what proteins BEC1019 interacts with in the host would indicate what defense or metabolic pathways are targeted and provide candidate host proteins that could be exploited in engineering resistance. Given the conservation of BEC1019 orthologs across the fungal kingdom, the possibility exists that a single R-protein could provide resistance to multiple fungal pathogens.

References Amich, J., Vicentefranqueira, R., Leal, F., and Calera, J.A. (2010). Aspergillus fumigatus survival in alkaline and extreme zinc-limiting environments relies on

the induction of a zinc homeostasis system encoded by the zrfC and aspf2 genes. Eukaryotic Cell 9, 424-437.

Dou, D.L., Kale, S.D., Wang, X., Jiang, R.H.Y., Bruce, N.A., Arredondo, F.D., Zhang, X.M., and Tyler, B.M. (2008). RXLR-mediated entry of Phytophthora sojae effector Avr1b into soybean cells does not require pathogen-encoded machinery. Plant Cell 20, 1930-1947.

APPENDIX – SUPPLEMENTAL DATA FOR CHAPTER 2

Taphrinomycotina Saitoella 1/1 incertae sedis 1/1 Taphrinomycotina 1/4 Schizosaccharomycetes 0/3 Schizosaccharomycetales 0/3

Saccharomycotina 21/39 Saccharomycetes 21/39 Saccharomycetales 21/39

Hypocreomycetidae 14/24 Sordariomycetes 21/39 Sordariomycetidae 5/12 Xylariomycetidae 2/3

Erysiphales 3/3

Leotiomycetes 7/10 Helotiales 4/5

Ascomycota 87/162 Leotiomycetes incertae sedis 0/2

Lecanoromycetes 1/2 Lecanoromycetidae 1/2 Pezizomycotina 65/119 Dothideomycetes incertae sedis 1/4 Dothideomycetes 19/32 Dothideomycetidae 7/11 Pleosporomycetidae 11/17

Eurotiomycetidae 16/33 Eurotiomycetes 17/34 Chaetothyriomycetidae 1/1 Pezizomycetes 0/2 Pezizales 0/2 Agaricomycetidae 1/27 Mucormycotina 0/4 Entomophthoromycota 0/1 Auriculariales 1/1 Kickxellomycotina 0/1 Cantharellales 0/2 Blastocladiomycota 0/2 Corticiales 0/4 Gloeophyllales 0/1 Agaricomycetes 2/52 Hymenochaetales 0/1

Phallomycetidae 0/1 Fungi 96/240 Polyporales 0/11 Agaricomycotina 3/57 Russulales 0/2

Sebacinales 0/2

Filobasidiales 0/1 Tremellomycetes 1/4 Tremellales 1/3 Dacrymycetes 0/1 Dacrymycetales 0/1 Basidiomycota Wallemiomycetes 1/1 Wallemiales 1/1 incertae sedis 1/1 Microbotryomycetes 2/2 Sporidiobolales 2/2

Basidiomycota 8/67 Pucciniomycotina 2/6 Mixiomycetes 0/1 Mixiales 0/1

Pucciniomycetes 0/3 Pucciniales 0/3 Exobasidiomycetes 0/1 Malasseziales 0/1 Ustilaginomycotina 2/3 Ustilaginomycetes 2/2 Ustilaginales 2/2

Monoblepharidomycetes 0/1 Monoblepharidales 0/1 Gonapodyaceae 0/1

Rhizophydiales Rhizophydiales 0/2 incertae sedis 0/2 Chytridiomycetes 1/3 Spizellomycetales 1/1 Spizellomycetaceae 1/1 Chytridiomycota 1/4 All classifications obtained from UniProt (http://www.uniprot.org/taxonomy/) Black taxa contain 1019 orthologs, Gray taxa lack 1019 orthologs Fractions indicate (# taxa containing orthologs) / (total # of taxa)

Supplemental Figure 1. Fungal taxonomy tree indicating presence/absence of BEC1019 orthologs in major taxa.

Variable importance of different positions

● H I 0.06 N P MeanDecreaseAccuracy 0.05 0.04

● 0.03 ● Importance ● ● ● ● ● ● ●

0.02 ● ●● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ●● ● ●● ● ● ● ● ● 0.01 ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ●● ● ● ●●● ● ● ● ● ● ●● ●●●●● ●●● ●● ● ● ●●● ●● ●● ● ●● ● ●●● ●●● ● ●●● ● ● ●●●● ● ● ●● ● ●● ● ● ● ●●● ● ● ●●● ● ●● ●●●●● ●●●● ●● ● ● ● ● ●● ●●●●●●●●●●●●●●●●●● ●●●●●●●●●●●●●●●●● ●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●● 0.00

0 100 200 300 400

Sequence

Supplemental Figure 2. Variable importance values for lifestyle associated positions plotted against location in the multiple sequence alignment used to generate the similarity tree (Figure 4) and Weblogo (Figure 5). H – Human pathogen; I – Insect pathogen; N – Non-pathogen; P – Plant Pathogen.

Supplemental Table 1. Virus-Induced Gene Silencing LeafQuant data and qRT-PCR expression. This table contains the raw data output from LeafQuant and the relative expression data, as determined by qRT-PCR, used to create the chart in Figure 1D.

Experiment Replication Total % Relative IDa IDb Treatmentc Leafd Areae Infectedf Expressiong 18864 1 BSMV:00 6 139175 32.93 18864 1 BSMV:00 7 155182 45.88 18864 1 BSMV:00 8 154106 85.44 18864 1 BSMV:00 9 151454 73.84 18864 1 BSMV:00 10 133439 80.79 18864 1 BSMV:1019 11 144511 23.18 0.776 18864 1 BSMV:1019 12 146240 43.73 18.809* 18864 1 BSMV:1019 13 130035 7.35 0.256 18864 1 BSMV:1019 14 130655 24.77 0.63 18864 1 BSMV:1019 15 141030 39.42 0.891

18864 2 BSMV:00 6 120545 47.78 18864 2 BSMV:00 7 177325 24.98 18864 2 BSMV:00 8 151308 61.58 18864 2 BSMV:00 9 151149 18.46 18864 2 BSMV:00 10 159825 73.25 18864 2 BSMV:1019 11 129154 1.66 0.734 18864 2 BSMV:1019 12 150991 59.66 2.224 18864 2 BSMV:1019 13 105748 56.32 1.467 18864 2 BSMV:1019 14 132627 81.93 1.038 18864 2 BSMV:1019 15 108391 28.29 0.484

18877 1 BSMV:00 5 168147 66.44 18877 1 BSMV:00 6 137931 87.76 18877 1 BSMV:00 7 142513 73.87 18877 1 BSMV:00 8 134725 58.72 18877 1 BSMV:1019 9 129888 39.91 2.845 18877 1 BSMV:1019 10 147595 27.66 1.524 18877 1 BSMV:1019 11 145685 43.24 2.477 18877 1 BSMV:1019 12 142893 53.47 1.524

18877 2 BSMV:00 5 157513 39.02 18877 2 BSMV:00 6 150801 76.18 18877 2 BSMV:00 7 145688 87.10 18877 2 BSMV:00 8 141648 81.55 18877 2 BSMV:1019 9 124283 74.72 1.103 18877 2 BSMV:1019 10 153573 50.16 0.679 18877 2 BSMV:1019 11 150366 75.47 0.944 18877 2 BSMV:1019 12 138242 46.33 1.182

Supplemental Table 1 continued 19141 1 BSMV:00 6 167640 88.51 19141 1 BSMV:00 7 192314 53.91 19141 1 BSMV:00 8 145675 50.04 19141 1 BSMV:00 9 146606 50.63 19141 1 BSMV:00 10 181954 40.06 19141 1 BSMV:1019 11 168315 36.15 0.308 19141 1 BSMV:1019 12 167405 60.00 1.072 19141 1 BSMV:1019 13 129796 30.76 0.5 19141 1 BSMV:1019 14 196263 31.10 0.933 19141 1 BSMV:1019 15 109037 48.49 0.536

19141 2 BSMV:00 6 124664 8.49 19141 2 BSMV:00 7 105277 6.09 19141 2 BSMV:00 8 178774 77.40 19141 2 BSMV:00 9 154586 76.41 19141 2 BSMV:00 10 126954 8.70 19141 2 BSMV:1019 11 174216 83.35 1.67 19141 2 BSMV:1019 12 179883 85.56 4.408 19141 2 BSMV:1019 13 147347 85.78 2.713 19141 2 BSMV:1019 14 157639 59.85 1.79 19141 2 BSMV:1019 15 137829 63.13 3.34

19161 1 BSMV:00 6 153297 17.29 19161 1 BSMV:00 7 133494 59.52 19161 1 BSMV:00 8 150349 30.38 19161 1 BSMV:00 9 134985 49.81 19161 1 BSMV:00 10 142002 79.45 19161 1 BSMV:1019 11 146771 63.19 1.678 19161 1 BSMV:1019 12 146662 28.42 2.066 19161 1 BSMV:1019 13 155828 27.02 0.783 19161 1 BSMV:1019 14 137748 33.84 0.839 19161 1 BSMV:1019 15 133651 38.38 0.636

19141 1 BSMV:00 6 162901 52.29 19141 1 BSMV:00 7 187828 15.90 19141 1 BSMV:00 8 141194 34.09 19141 1 BSMV:00 9 139335 31.19 19141 1 BSMV:00 10 177761 6.37 19141 1 BSMV:1019 5' 11 185439 33.75 125.656 19141 1 BSMV:1019 5' 12 148206 28.01 7.328 19141 1 BSMV:1019 5' 13 166404 57.44 0.282 19141 1 BSMV:1019 5' 14 151991 17.39 0.123 19141 1 BSMV:1019 5' 15 115088 6.67 0.029

Supplemental Table 1 continued 19141 2 BSMV:00 6 120834 1.84 19141 2 BSMV:00 7 100722 0.59 19141 2 BSMV:00 8 176894 29.99 19141 2 BSMV:00 9 149425 38.77 19141 2 BSMV:00 10 125850 2.46 19141 2 BSMV:1019 5' 11 184886 56.16 0.493 19141 2 BSMV:1019 5' 12 161298 55.89 0.566 19141 2 BSMV:1019 5' 13 134050 27.89 0.02 19141 2 BSMV:1019 5' 14 151537 33.85 0.107 19141 2 BSMV:1019 5' 15 102904 1.65 0.025

19161 1 BSMV:00 6 152219 10.52 19161 1 BSMV:00 7 132588 48.34 19161 1 BSMV:00 8 150523 18.32 19161 1 BSMV:00 9 133223 34.40 19161 1 BSMV:00 10 141694 66.70 19161 1 BSMV:1019 5' 11 148393 46.39 0.136 19161 1 BSMV:1019 5' 12 151923 40.65 0.11 19161 1 BSMV:1019 5' 13 138622 74.43 0.146 19161 1 BSMV:1019 5' 14 124891 17.01 0.883 19161 1 BSMV:1019 5' 15 141005 57.52 0.146

19161 2 BSMV:00 6 146108 13.84 19161 2 BSMV:00 7 163878 10.75 19161 2 BSMV:00 8 155175 7.02 19161 2 BSMV:00 9 125586 67.76 19161 2 BSMV:00 10 148708 53.93 19161 2 BSMV:1019 5' 11 142143 88.62 36.589 19161 2 BSMV:1019 5' 12 155503 75.75 36.589 19161 2 BSMV:1019 5' 13 156768 81.33 0.433 19161 2 BSMV:1019 5' 14 130205 89.02 0.054 19161 2 BSMV:1019 5' 15 146234 15.82 0.754

19217 1 BSMV:00 6 88215 5.66 19217 1 BSMV:00 7 66416 0.43 19217 1 BSMV:00 8 100380 14.09 19217 1 BSMV:00 9 74140 1.29 19217 1 BSMV:00 10 72104 0.29 19217 1 BSMV:1019 5' 11 114736 3.79 3.19 19217 1 BSMV:1019 5' 12 114877 7.48 4.209 19217 1 BSMV:1019 5' 13 124961 5.43 0.263 19217 1 BSMV:1019 5' 14 85051 8.14 1.388 19217 1 BSMV:1019 5' 15 85618 10.26 0.855

Supplemental Table 1 continued 19217 2 BSMV:00 6 62999 1.03 19217 2 BSMV:00 7 82718 1.87 19217 2 BSMV:00 8 87516 0.64 19217 2 BSMV:00 9 75929 3.96 19217 2 BSMV:00 10 75930 0.50 19217 2 BSMV:1019 5' 11 101407 37.60 0.741 19217 2 BSMV:1019 5' 12 106451 15.62 10.315 19217 2 BSMV:1019 5' 13 82321 5.33 0.198 19217 2 BSMV:1019 5' 14 99384 24.79 0.131 19217 2 BSMV:1019 5' 15 90367 27.18 0.281 aExperiment ID is a number unique to each VIGS experiment used for organization bReplication ID refers to which of the two images taken for each experiment (Methods) LeafQuant is analyzing cTreatment indicates the viral silencing construct used to infect the leaf dLeaf refers to the number written on the bottom of each leaf in the LeafQuant image eTotal Area of each individual leaf is reported by LeafQuant in pixels f% Infected is calculated by LeafQuant using the formula [(# of discolored pixels in leaf) / (# of total pixels in leaf)] gRelative Expression is determined by qRT-PCR conducted on cDNA produced from RNA extracted from individual leaves (Methods). This value is normalized to B. graminis β- tubulin and compared to the average expression of BEC1019 in the BSMV:00 treated leaves

Supplemental Table 2. BEC1019 Blast results. BEC1019 amino acid sequence was used as a BLASTp query against three genome databases. A threshold of 1E-15 was used as a cutoff.

Query Sourcea Identification numberb Organismc coveraged E-valuee BRO SPPG_08209.2 Spizellomyces punctatus 63% 1.09E-29 185834|fgenesh1_pm.1 JGI _#_1543 Mycosphaerella fijiensis 86% 4.07E-65 JGI 36102|e_gw1.1.1218.1 Septoria musiva 67% 5.70E-64 JGI 99679|e_gw1.25.129.1 Septoria populicola 88% 8.37E-68 Macrophomina

NCBI EKG19071.1 phaseolina 88% 2.00E-76 84645|fgenesh1_pg.12 JGI _#_112 Cercospora zeae-maydis 87% 5.65E-61 49868|fgenesh1_pg.3_ JGI #_60 Zasmidium cellare 87% 2.80E-54 Mycosphaerella graminicola (Septoria

NCBI EGP87751.1 tritici) 100% 9.00E-59 475392|CE361278_197 JGI 52 Aureobasidium pullulans 95% 1.56E-58

NCBI CBY02100.1 Leptosphaeria maculans 79% 8.00E-64 Phaeosphaeria nodorum

NCBI XP_001793586.1 SN15 66% 4.00E-68 149521|e_gw1.28.404. Cochliobolus JGI 1 heterostrophus 66% 9.34E-63 23886|fgenesh1_pg.24 JGI _#_44 Cochliobolus miyabeanus 66% 1.62E-62 193060|estExt_fgenesh JGI 1_pg.C_140053 Cochliobolus sativus 66% 4.52E-62 114446|e_gw1.165.44. JGI 1 Cochliobolus victoriae 66% 5.37E-62 111103|e_gw1.356.18. JGI 1 Cochliobolus carbonum 66% 5.04E-62

NCBI AAQ87928.1 Cochliobolus lunatus 44% 4.00E-45

NCBI XP_003305448.1 Pyrenophora teres f. teres 80% 8.00E-65 Pyrenophora tritici-

NCBI XP_001932430.1 repentis Pt-1C-BFP 79% 5.00E-64 154234|fgenesh1_pm.3 JGI _#_58 Setosphaeria turcica 77% 9.05E-64

NCBI EHY59677.1 Exophiala dermatitidis 79% 4.00E-62 Aspergillus nidulans

NCBI XP_659436.1 FGSC A4 86% 1.00E-67 192408|estExt_Genewi JGI se1Plus.C_1_t50220 Aspergillus sydowii 85% 7.64E-60

Supplemental Table 2 continued Aspve1_all_proteins_2 JGI 0120621.aa Aspergillus versicolor 86% 3.27E-61 56120|estExt_fgenesh1 JGI _pm.C_1_t20102 Aspergillus wentii 86% 6.43E-60 549594|MIX14962_5_3 JGI 2 Eurotium herbariorum 86% 5.74E-64

NCBI XP_001271840.1 Aspergillus clavatus 87% 5.00E-60

NCBI XP_002373106.1 Aspergillus flavus 66% 1.00E-62 Aspergillus fumigatus

NCBI P79017.2 Af293 93% 4.00E-68

NCBI XP_001817942.1 Aspergillus oryzae 87% 2.00E-64 Aspergillus terreus

NCBI XP_001210878.1 NIH2624 25% 3.00E-15

NCBI XP_002562292.1 Penicillium chrysogenum 87% 1.00E-65

NCBI XP_001267052.1 Neosartorya fischeri 98% 1.00E-66 Blastomyces dermatitidis

NCBI XP_002624414.1 (Ajellomyces dermatitidis) 85% 3.00E-57

NCBI XP_001241166.1 Coccidioides immitis RS 95% 3.00E-70

NCBI XP_003070371.1 Coccidioides posadasii 95% 2.00E-69

NCBI XP_002542986.1 Uncinocarpus reesii 1704 78% 1.00E-54 JGI 63412|gm1.3067_g Xanthoria parietina 46-1 87% 2.33E-65 Blumeria graminis Erysiphe pisi Golovinomyces orontii

NCBI EKD18134.1 Marssonina brunnea 88% 1.00E-63

NCBI EHL00472.1 Glarea lozoyensis 98% 2.00E-43

NCBI XP_001550247.1 Botryotinia fuckeliana 98% 1.00E-93 Sclerotinia sclerotiorum

NCBI XP_001590788.1 1980 100% 1.00E-96

NCBI EFQ32132.1 Glomerella graminicola 94% 1.00E-67 Colletotrichum

NCBI CCF38197.1 higginsianum 87% 1.00E-64 1060774|Acral1_c3a.fg enesh2_kg.2_#_146_# JGI _Contig3869 Acremonium alcalophilum 89% 5.10E-69 Verticillium albo-atrum

NCBI XP_003005403.1 VaMs.102 88% 8.00E-60

NCBI AAS45249.1 Verticillium dahliae 99% 7.00E-61

NCBI EFY86413.1 Metarhizium acridum 99% 2.00E-65

NCBI EFY94514.1 Metarhizium anisopliae 100% 2.00E-65

NCBI EGX91105.1 Cordyceps militaris 74% 4.00E-63

NCBI ABG77526.1 Beauveria bassiana 74% 3.00E-65 Fusarium graminearum

NCBI XP_384130.1 (Gibberella zeae) 94% 9.00E-74

Supplemental Table 2 continued Fusarium

NCBI EKJ74570.1 pseudograminearum 88% 4.00E-68 Fusarium oxysporum

NCBI EGU72976.1 Fo5176 94% 1.00E-76 BRO FVEG_10119.3 Fusarium verticillioides 96% 0

NCBI XP_003042648.1 Nectria haematococca 74% 2.00E-66 Gaeumannomyces

NCBI EJT68474.1 graminis 88% 1.00E-75 Magnaporthe oryzae 70-

NCBI XP_360733.2 15 87% 8.00E-63 Chaetomium globosum

NCBI XP_001227763.1 CBS 148.51 66% 8.00E-60 Myceliophthora

NCBI XP_003665061.1 thermophila 67% 5.00E-61

NCBI XP_001904443.1 Podospora anserina 63% 4.00E-56 JGI 33455|gm1.7261_g Hypoxylon sp. CO27-5 89% 9.70E-69 38017|fgenesh1_pm.22 JGI 2_#_2 Hypoxylon sp. EC38 92% 2.37E-69 Ascoidea rubescens JGI 150652|CE57112_1854 NRRL Y17699 47% 7.44E-17

NCBI XP_457655.2 Debaryomyces hansenii 98% 1.00E-69 Meyerozyma

NCBI EDK40843.2 guilliermondii 88% 6.00E-70

NCBI CCE80559.1 Millerozyma farinosa 99% 6.00E-71

NCBI XP_001386401.1 Scheffersomyces stipitis 96% 6.00E-73 Hyphopichia burtonii JGI 89383|gw1.3.726.1 NRRL Y-1933 88% 1.42E-59

NCBI XP_715490.1 Candida albicans SC5314 98% 7.00E-65

NCBI XP_002420285.1 Candida dubliniensis 98% 1.00E-65 Candida tropicalis MYA-

NCBI XP_002549456.1 3404 87% 2.00E-63 Wickerhamomyces JGI 14357|gw1.5.244.1 anomalus 87% 1.83E-63

NCBI CCH41119.1 Wickerhamomyces ciferrii 99% 1.00E-58

JGI 126266|CE46370_7621 Pichia membranifaciens 56% 9.28E-16 Kluyveromyces lactis

NCBI XP_452206.1 NRRL Y-1140 75% 4.00E-23

NCBI XP_002492745.1 Komagataella pastoris 99% 1.00E-64 Lachancea

NCBI XP_002552246.1 thermotolerans 62% 3.00E-28 Saccharomyces

NCBI EJS41803.1 arboricola 62% 4.00E-33 Saccharomyces

NCBI EHM99590.1 cerevisiae 62% 4.00E-25

Supplemental Table 2 continued Saccharomyces

NCBI EJT41755.1 kudriavzevii 65% 3.00E-36

NCBI XP_003681486.1 Torulaspora delbrueckii 78% 3.00E-26 Hansenula polymorpha 69250|estExt_Genewis NCYC 495 leu1.1 (Pichia JGI e1Plus.C_7_t30081 angusta) 59% 1.85E-27 40074|fgenesh1_pg.2_ Nadsonia fulvescens var. JGI #_11 elongata DSM 6958 87% 1.90E-61 91295|estExt_Genewis JGI e1Plus.C_90004 Saitoella complicata 87% 3.65E-46 Moniliophthora perniciosa

NCBI XP_002396634.1 FA553 51% 7.00E-17

NCBI EJD50849.1 Auricularia delicata 97% 2.00E-34

NCBI EJT49801.1 Trichosporon asahii 45% 6.00E-33

NCBI EIM20085.1 Wallemia sebi 95% 5.00E-27 53328|estExt_Genemar Rhodotorula graminis JGI k1.C_6_t10259 strain WP1 85% 3.78E-49 JGI 9073|e_gw1.1.1101.1 Sporobolomyces roseus 83% 2.81E-40

NCBI CBQ73514.1 Sporisorium reilianum 90% 1.00E-37

NCBI XP_759256.1 Ustilago maydis 521 83% 3.00E-32 aOrtholog sequence source NCBI - National Center for Biological Information non- redundant database; JGI - Department of Energy Joint Genome Institute; and BRO - Broad Institute Fungal Genome Initiative. bNumber associated with BLAST hit cOrganisms’ genus and species name dPercent of query sequence (BEC1019) covered by BLAST hit eE-value returned by each database for associated BLAST hit

100

Supplemental Table 3. Primers used to investigate the function of BEC1019 and its orthologs. Listed below are primers used for BEC1019 site-directed mutagenesis, random forest site-directed mutagenesis, VIGS construct cloning, ortholog cloning, vector sequencing, and qRT-PCR.

BEC1019 Site-directed Mutagenesis of Primers Primer Name Primer Sequence 5’–> 3’ Plasmid name gatttcacaattcacgggtcaagtaatgctacacaga C38S_fp1 caaatg pCR8:1019_C38S catttgtctgtgtagcattacttgacccgtgaattgt C38S_rp1 gaaatc C105S_fp1 ggtgttaccttccgtagtgatgacccggaca pCR8:1019_C105S C105S_rp1 tgtccgggtcatcactacggaaggtaacacc C112S_fp1 ttgtgatgacccggacaaaaaaagtgcaaccgaga pCR8:1019_C112S C112S_rp1 tctcggttgcactttttttgtccgggtcatcacaa C134S_fp1 ccttcagagacggtcatcagtgatgtttccttctttg pCR8:1019_C134S C134S_rp1 caaagaaggaaacatcactgatgaccgtctctgaagg C148S_fp1 ttcctttggaggatttgagctcacgaggctacaaa pCR8:1019_C148S C148S_rp1 tttgtagcctcgtgagctcaaatcctccaaaggaa C203S_fp1 ccggggagggcagtgctggccaa pCR8:1019_C203S C203S_rp1 ttggccagcactgccctccccgg H169A_fp1 ggggggctgatctaatcgctcgcatgtttcatgtgg pCR8:1019_H169A H169A_rp1 ccacatgaaacatgcgagcgattagatcagcccccc gggggctgatctaatccatgccatgtttcatgtggac R170A_fp1 atc pCR8:1019_R170A gatgtccacatgaaacatggcatggattagatcagcc R170A_rp1 ccc ggctgatctaatccatcgcatgtttgctgtggacatc H173A_fp1 gtc pCR8:1019_H173A gacgatgtccacagcaaacatgcgatggattagatca H173A_rp1 gcc ctggggggctgatctaatcgctgccatgtttgctgtg HRH-AAA_fp1 gacatcgtcggtcag pCR8:1019_HRH-AAA ctgaccgacgatgtccacagcaaacatggcagcgatt HRH-AAA_rp1 agatcagccccccag

1019_E130A_fp1 gaaagatgctccttcagcgacggtcatctgtgatg pCR8:1019_E130A 1019_E130A_rp1 catcacagatgaccgtcgctgaaggagcatctttc 1019_T131A_fp1 aagatgctccttcagaggcggtcatctgtgatgtt pCR8:1019_T131A 1019_T131A_rp1 aacatcacagatgaccgcctctgaaggagcatctt 1019_V132A_fp1 gctccttcagagacggccatctgtgatgtttcc pCR8:1019_V132A 1019_V132A_rp1 ggaaacatcacagatggccgtctctgaaggagc tgctccttcagagacggtcgcctgtgatgtttccttc 1019_I133A_fp1 ttt pCR8:1019_I133A aaagaaggaaacatcacaggcgaccgtctctgaagga 1019_I133A_rp1 gca

101

Supplemental Table 3 continued Random Forest Site-directed Mutagenesis Primers gcgcgggaaagatgctcctgatgagacggtcatctgt 1019:S129D_fp1 gatg pCR8:1019_S129D catcacagatgaccgtctcatcaggagcatctttccc 1019:S129D_rp1 gcgc agacggtcatctgtgatgtttccttctttacgcggct 1019:E140T_fp1 tcctttggag pCR8:1019_E140T ctccaaaggaagccgcgtaaagaaggaaacatcacag 1019:E140T_rp1 atgaccgtct 1019:Q190E_fp1 atgcctcacatggttacgaggatgccctcaaccttgc pCR8:1019_Q190E 1019:Q190E_rp1 gcaaggttgagggcatcctcgtaaccatgtgaggcat ggctattggagaggttccaaccatagtagtcaaacta Pra1:D123S_fp1 ttatttgtgact pCR8:Pra1_D123S agtcacaaataatagtttgactactatggttggaacc Pra1:D123S_rp1 tctccaatagcc caaactattatttgtgacttatcttttgttgagagaa Pra1:T134E_fp1 gatacttatcccaactatgctcc pCR8:Pra1_T134E ggagcatagttgggataagtatcttctctcaacaaaa Pra1:T134E_rp1 gataagtcacaaataatagtttg attgaacattacgctgacacttatcaggaggttcttg Pra1:E184Q_fp1 aattg pCR8:Pra1_E184Q caattcaagaacctcctgataagtgtcagcgtaatgt Pra1:E184Q_rp1 tcaat

VIGS Primers

BSMV:BEC1019mid 1019VIGSmid_fp1 GCCACAAAAAGTCTCCTACGACTG BSMV:1019mid 1019VIGSmid_rp1 CGTATCGAACCATCCGATCACTG BSMV:BEC10195' 1019VIGS5p_fp1 CGGGAAAGATGCTCCTTCAGAG BSMV:10195' 1019VIGS5p_rp1 AGAGAGTCGGTATTTGTGGCAGTC

Ortholog Cloning Primers Pra1, Candida albicans PRA1pCR8_f1 ATGAATTATTTATTGTTTTGTT pCR8:Pra1_fl PRA1pCR8_r1 ACAGTGGACTTCACCATCTGCA Pra1_fp2 gcaccagttacggttaccagattt pCR8:Pra1_T3S Pra1_rp2 acagtggacttcaccatctgcatg Zps1, Saccharomyces cerevisiae Zps1_fp1 ATGAAGTTCTCTTCCGGCAAATCT pCR8:Zps1_fl Zps1_rp1 TTACAAGTTACCTAGACAGCCACC Zps1_fp2 GCTCCTGTCACTTACGACACCAAC pCR8:Zps1_T3S Zps1_rp2 CAAGTTACCTAGACAGCCACCAGG

102

Supplemental Table 3 continued AspF2, Aspergillus fumigatus Aspf2_fp1 ATGTACTCACAAATGGCTGCTCTC pCR8:Aspf2_fl Aspf2_rp1 CGTTAACATACGGCGTCAAGCATA AspF2_fp2 ACCCTCCCTACCTCCCCCGTCCCC pCR8:Aspf2_T3S AspF2_rp2 AGTGCAATGAAGCTGTCCACCTTC Fusarium verticillioides Fvert_Fp1 ATGATGTTCAAGACCACCGCCG pCR8:Fvert_fl Fvert_Rp1 TTAAGAGCAGTGGACGACACCATC Fvert_fp2 ACTCCCATCTTCGGCCGCGCAGAG pCR8:Fvert_T3S Fvert_rp2 AGAGCAGTGGACGACACCATCACT Fusarium graminearum Fgram_Fp1 ATGATGTTCAAGTCCACCACCG pCR8:Fgram_fl Fgram_Rp1 TTAAGAGCAGTGAACAACACCGTC Fgram_fp2 ACTCCCCTCTTTGGCCGTGCCGA pCR8:Fgram_T3S Fgram_rp2 AGAGCAGTGAACAACACCGTCGT Ustilago maydis UmaypCR8_f1 ATGCAGCTGATTGCGTCTTTTG pCR8:Umay_fl UmaypCR8_r1 CTAGTGGGTGCCGCAGTGAATG Umaydis_fp2 GCGCCTTTCAGCTCGTTGCTGGCG pCR8:Umay_T3S Umaydis_rp2 GTGGGTGCCGCAGTGAATGGAGCC

Sequencing Primers BSMV:y TEV-UTR-F CGAATCTCAAGCAATCAAGCA pRTL2-TerR AGCGAAACCCTATAAGAACCCT pCR®8 p233 GGGGACAAGTTTGTACAAAAAAGCAGGCT p234 GGGGACCACTTTGTACAAGAAAGCTGGGT pYM5 pYM5seq_f1 GTTGAACGACAGCGCGAT pYM5seq_r1 AACTGTTGGGAAGGGCGATCGG qRT -PCR Primers BEC1019 Target Gene 1019qRT_f3 AAAGTCACTCCGACTGATCCAAAC 1019qRT_r3 GCTTTTTTCTCAGGCTCGTCTTTC β-tubulin Fungal Internal Control Bgh_tubulin_f1 TGACATGCTCTGCCATTTTC Bgh_tubulin_r1 AGGCGGGATAGAACATAGGG Hv contig_3802 Plant Internal Control 3802_f2 GGATTTCCTTCACTGGTGGACC 3802_r2 TCCTTATTTCAGTTGAGGAGGCAG

103

Supplemental Table 4. Variable Importance values for each position and lifestyle in the multiple sequence alignment of BEC1019 and its orthologs. Random forest variable importance values by lifestyle for each position in the multiple sequence alignment. Positions 198, 211, and 267 (highlighted in gray) are most highly associated with specific lifestyles.

MSA positiona Hb Ic Nd Pe 1 0 0 0 0 2 0 0 0 0 3 0 0 0 0 4 0 0 0 0 5 0 0 0 0 6 0 0 0 0 7 0 0 0 0 8 0 0 0 0 9 0 0 0 0 10 0 0 0 0 11 0 0 0 0 12 0 0 0 0 13 0 0 0 0 14 0 0 0 0 15 0 0 0 0 16 0 0 0 0 17 0 0 0 0 18 0 0 0 0 19 0 0 0 0 20 0 0 0 0 21 0 0 0 0 22 0 0 0 0 23 0 0 0 0 24 0 0 0 0 25 0 0 0 0 26 0 0 0 0 27 0 0 0 0 28 0 0 0 0 29 0 0 0.001 0 30 0 0 0 0 31 0 0 0 0 32 0 0 0 0 33 0.006 0.006 0.005 0.014 34 0 0 0.001 0.001 35 0.001 0 0 0.003 36 0.007 0 0.005 0.004 37 0.002 0.006 0.005 0.006

104

Supplemental Table 4 continued 38 0.01 0.006 0.004 0.005 39 0.026 0 0.006 0.001 40 0.005 0 0.003 0.007 41 0.01 0.006 0.013 0.004 42 0 0.012 0.009 0.002 43 0.002 0 0.008 0.003 44 0.003 0.018 0.017 0.004 45 0.006 0 0 0.003 46 0.012 0.031 0 0.003 47 0.013 0 0 0.005 48 0.009 0 0 0.004 49 0.008 0 0 0.005 50 0.022 0.018 0.001 0.005 51 0.005 0 0 0.004 52 0 0 0.014 0.002 53 0 0 0 0 54 0 0 0 0.001 55 0 0 0 0 56 0.003 0 0 0.003 57 0.015 0.025 0.016 0.016 58 0 0.008 0.01 0.005 59 0.012 0 0.007 0.006 60 0.005 0 0.009 0.006 61 0.002 0.012 0.006 0.001 62 0 0 0 0 63 0 0 0 0 64 0 0 0 0 65 0 0 0.001 0 66 0 0 0 0 67 0 0 0 0 68 0 0 0 0 69 0.001 0.018 0 0 70 0 0.018 0.001 0.002 71 0 0.012 0 0.001 72 0.003 0 0.01 0.01 73 0 0 0 0 74 0.003 0 0 0 75 0 0.006 0 0.003 76 0.003 0 0.003 0.001 77 0 0.004 0.008 0.005 78 0.006 0 0.006 0.006 79 0 0 0.003 0 80 0 0 0 0 81 0 0 0 0 82 0 0 0 0 83 0.002 0 0.007 0

105

Supplemental Table 4 continued 84 0.002 0.018 0.004 0.001 85 0.006 0 0.004 0.004 86 0.003 0.018 0.004 0.007 87 0.001 0 0 0.001 88 0.001 0 0 0 89 0 0 0.001 0 90 0.002 0 0 0 91 0 0 0.003 0.017 92 0 0 0 0 93 0 0 0 0 94 0 0 0 0 95 0.002 0.006 0 0.002 96 0 0 0 0 97 0.001 0 0 0.001 98 0.007 0 0.008 0.003 99 0.022 0.041 0.003 0.006 100 0.003 0 0 0.003 101 0.001 0 0.001 0 102 0.01 0 0 0.003 103 0.012 0.006 0.004 0.005 104 0.001 0 0 0 105 0.001 0 0 0 106 0.012 0 0.004 0.01 107 0 0 0 0 108 0 0 0.001 0.004 109 0 0 0 0 110 0.009 0.006 0.022 0.003 111 0 0 0 0.001 112 0 0 0 0 113 0.003 0 0.019 0.004 114 0.001 0 0.002 0 115 0 0 0 0 116 0 0 0 0 117 0 0 0.003 0.004 118 0 0 0.002 0 119 0.004 0 0 0.004 120 0 0 0 0 121 0.002 0 0 0.001 122 0.005 0 0 0.004 123 0 0 0 0 124 0 0 0 0.002 125 0.003 0.012 0.012 0.003 126 0.002 0 0.001 0.001 127 0.002 0 0.002 0.005 128 0 0.012 0.001 0 129 0.001 0 0.002 0

106

Supplemental Table 4 continued 130 0.023 0.012 0.002 0.003 131 0.002 0 0.012 0.001 132 0 0 0 0 133 0 0 0 0 134 0 0 0 0 135 0.003 0.012 0 0.001 136 0.005 0 0.002 0.002 137 0 0 0 0 138 0 0 0 0 139 0 0 0 0 140 0 0 0 0 141 0 0 0 0 142 0 0 0.001 0 143 0 0 0 0 144 0 0 0 0.001 145 0.005 0 0.017 0.009 146 0 0 0 0.003 147 0.006 0 0 0.025 148 0 0 0.001 0.004 149 0 0.012 0.003 0.002 150 0 0.012 0.02 0.006 151 0.001 0 0 0 152 0 0 0 0 153 0.015 0.006 0.013 0.005 154 0 0 0.002 0.001 155 0.003 0 0 0.001 156 0 0 0 0.016 157 0 0 0 0 158 0.001 0 0 0 159 0.007 0.037 0.001 0.007 160 0.003 0 0.002 0 161 0 0 0 0 162 0.002 0 0.001 0 163 0.002 0.012 0.019 0.013 164 0.001 0 0 0.001 165 0.014 0.025 0 0.005 166 0 0 0.002 0.001 167 0 0 0 0 168 0 0 0 0 169 0 0 0 0 170 0 0 0 0 171 0.002 0 0 0.001 172 0 0 0 0 173 0 0 0 0 174 0.008 0 0.002 0.004 175 0.002 0 0 0

107

Supplemental Table 4 continued 176 0 0 0 0 177 0.004 0 0.012 0.003 178 0.002 0.01 0 0.002 179 0.004 0 0 0.008 180 0.004 0 0.01 0.012 181 0.003 0 0.003 0.003 182 0 0 0 0 183 0 0 0 0 184 0 0 0 0.001 185 0.003 0 0 0 186 0 0 0 0.001 187 0 0 0.002 0.001 188 0 0 0 0 189 0 0 0 0.001 190 0 0 0 0 191 0 0 0 0 192 0 0 0.001 0 193 0.003 0.006 0.003 0.006 194 0 0 0 0 195 0 0 0 0 196 0 0 0.002 0.001 197 0.001 0 0 0 198 0.003 0 0.03 0.04 199 0 0 0 0 200 0 0 0 0 201 0 0 0 0 202 0 0 0 0 203 0 0 0 0 204 0.003 0 0.002 0.002 205 0.004 0 0 0.001 206 0 0 0 0 207 0 0 0 0 208 0.012 0.004 0.003 0.023 209 0 0 0 0 210 0 0 0 0 211 0.027 0.037 0.023 0.034 212 0 0 0 0 213 0.001 0.004 0.005 0.001 214 0.011 0.006 0.005 0.008 215 0 0 0 0 216 0 0 0 0.004 217 0 0 0.006 0.005 218 0.001 0 0 0.001 219 0 0 0 0 220 0.01 0.012 0.008 0.008 221 0.017 0.025 0.008 0.003

108

Supplemental Table 4 continued 222 0 0 0 0 223 0.003 0 0.008 0.003 224 0.004 0 0 0.003 225 0 0 0 0 226 0.008 0 0.007 0.017 227 0.01 0.018 0.005 0.02 228 0.017 0 0.004 0.008 229 0.003 0 0.001 0.015 230 0.005 0.006 0.005 0.006 231 0.003 0.006 0.021 0.002 232 0.006 0 0.003 0.005 233 0 0 0 0 234 0.004 0 0 0.002 235 0 0 0 0.001 236 0 0 0.006 0 237 0 0 0 0 238 0 0 0 0 239 0.001 0 0 0.001 240 0 0 0 0 241 0 0 0 0 242 0 0 0 0 243 0.002 0.006 0.003 0.002 244 0.006 0 0 0.002 245 0 0 0 0 246 0.001 0 0 0.004 247 0 0 0 0 248 0.007 0 0.002 0.004 249 0 0.006 0.001 0 250 0 0 0 0 251 0 0 0 0 252 0 0 0.001 0.001 253 0.003 0 0.004 0.002 254 0.001 0 0.005 0.006 255 0.003 0 0.001 0 256 0.002 0 0.009 0.002 257 0 0 0 0 258 0.001 0 0 0.001 259 0 0 0 0 260 0.009 0 0 0.003 261 0 0 0.012 0.002 262 0 0 0 0 263 0.001 0 0.001 0.002 264 0 0 0.001 0.001 265 0 0 0 0 266 0 0 0.002 0.001 267 0.025 0.012 0.001 0.035

109

Supplemental Table 4 continued 268 0 0 0.008 0.002 269 0.003 0 0.002 0.003 270 0 0 0 0 271 0 0 0.005 0.001 272 0 0 0 0 273 0.001 0 0.001 0 274 0 0 0.008 0.003 275 0.007 0 0.001 0.002 276 0 0 0 0 277 0.001 0.006 0.003 0.002 278 0 0.012 0 0.003 279 0.002 0.023 0.001 0.005 280 0.01 0.012 0.003 0.009 281 0 0 0.003 0 282 0.001 0.01 0 0.002 283 0.007 0.02 0.003 0.003 284 0.001 0 0.002 0 285 0 0.012 0 0.001 286 0.008 0.004 0.012 0.004 287 0.002 0.018 0.001 0.001 288 0 0 0 0.001 289 0.002 0 0.012 0.005 290 0 0 0 0 291 0 0 0.001 0 292 0 0 0 0 293 0 0.016 0.008 0.002 294 0 0 0 0 295 0.002 0 0 0 296 0 0 0.006 0 297 0 0 0.002 0 298 0.003 0 0 0.003 299 0 0 0.001 0 300 0 0.012 0.001 0.002 301 0.014 0 0.001 0.001 302 0.007 0.012 0.013 0.008 303 0 0 0 0 304 0 0 0 0 305 0 0 0.001 0 306 0 0 0 0 307 0.004 0 0.01 0.001 308 0 0 0 0 309 0 0 0 0 310 0.008 0.006 0 0.001 311 0 0 0.001 0 312 0.005 0.043 0.006 0.006 313 0.031 0.025 0 0.014

110

Supplemental Table 4 continued 314 0.003 0.012 0.002 0.001 315 0 0 0.003 0.002 316 0.003 0 0.001 0.002 317 0 0 0 0.001 318 0 0 0 0.002 319 0.001 0 0.001 0.001 320 0.001 0 0 0.001 321 0 0 0 0.002 322 0 0 0.001 0.001 323 0.003 0.006 0.001 0.001 324 0.001 0 0 0.001 325 0.002 0 0.009 0.002 326 0 0 0 0 327 0 0 0 0 328 0 0 0 0 329 0 0 0 0 330 0 0 0 0 331 0 0 0 0 332 0 0 0 0 333 0 0 0 0 334 0 0 0 0.002 335 0 0 0 0 336 0 0 0.001 0 337 0.001 0 0 0.001 338 0 0 0 0.001 339 0 0 0 0 340 0 0.006 0 0 341 0 0 0.002 0.002 342 0.012 0 0.007 0.001 343 0 0 0.017 0.005 344 0.011 0 0.019 0.017 345 0.006 0.018 0.01 0.011 346 0.003 0.006 0 0.003 347 0.018 0 0 0.009 348 0 0.012 0.007 0.004 349 0.003 0 0.004 0.005 350 0 0 0.001 0 351 0 0 0 0 352 0 0 0 0 353 0 0 0 0 354 0 0 0 0 355 0 0 0 0 356 0 0 0 0 357 0 0 0 0 358 0 0 0 0 359 0 0 0 0

111

Supplemental Table 4 continued 360 0 0 0 0 361 0 0 0 0 362 0 0 0 0 363 0.001 0 0.001 0 364 0.002 0 0.003 0.001 365 0.015 0 0.011 0.015 366 0.013 0 0.027 0.014 367 0.007 0 0.002 0.001 368 0 0 0.001 0.001 369 0 0 0 0 370 0 0 0 0.002 371 0 0 0 0 372 0 0 0 0 373 0 0 0 0 374 0 0 0 0 375 0 0 0 0 376 0 0 0.001 0.001 377 0 0 0 0 378 0 0 0.003 0 379 0 0 0 0 380 0 0 0 0.001 381 0 0 0.001 0 382 0 0 0 0 383 0 0 0 0 384 0 0 0.003 0.002 385 0.002 0 0.004 0.004 386 0 0.012 0.008 0.005 387 0.001 0 0 0 388 0.002 0 0 0.002 389 0 0 0.003 0.002 390 0 0 0.002 0.001 391 0 0 0 0 392 0 0 0 0 393 0 0 0 0 394 0 0 0 0 395 0 0 0 0 396 0 0 0 0 397 0 0 0 0 398 0 0 0 0 399 0 0 0 0 400 0 0 0 0 401 0 0 0 0 402 0 0 0 0 403 0 0 0 0 404 0 0 0 0 405 0 0 0 0

112

Supplemental Table 4 continued 406 0 0 0 0 407 0 0 0 0 408 0 0 0 0 409 0 0 0 0 410 0 0 0 0 411 0 0 0 0 412 0 0 0 0 413 0 0 0 0 414 0 0 0 0 415 0 0 0 0 416 0 0 0 0 417 0 0 0 0 418 0 0 0 0 419 0 0 0 0 420 0 0 0 0 421 0 0 0 0 422 0 0 0 0 423 0 0 0 0 424 0 0 0 0 425 0 0 0 0 426 0 0 0 0 427 0 0 0 0 428 0 0 0 0 429 0 0 0 0 430 0 0 0 0 431 0 0 0 0 432 0 0 0 0 433 0.003 0 0 0 434 0 0 0 0 435 0.001 0 0.001 0.004 436 0.004 0.006 0.011 0.009 437 0.003 0.006 0 0 438 0 0 0.001 0.001 439 0.004 0 0.008 0.005 440 0.011 0 0.009 0.004 441 0 0 0 0 442 0.005 0.043 0.009 0.005 443 0 0 0 0 444 0 0 0 0 445 0 0 0 0 446 0 0 0 0 447 0 0 0 0 448 0 0 0 0 449 0.002 0 0.001 0 450 0 0.006 0.01 0.002 451 0 0 0 0.001

113

Supplemental Table 4 continued 452 0.026 0 0 0.009 453 0.009 0.006 0.016 0.009 454 0.003 0 0 0 455 0.003 0 0 0 456 0 0 0.006 0.002 457 0 0 0.002 0.001 458 0.002 0 0.002 0 459 0 0 0.007 0.002 460 0.021 0 0.002 0.023 461 0 0 0 0 462 0.001 0 0.001 0 463 0 0 0 0 464 0.008 0 0.005 0.015 465 0.002 0 0.008 0.003 466 0.001 0 0.002 0.001 467 0 0 0.001 0 468 0 0.006 0.013 0.007 469 0 0 0 0 470 0 0 0.003 0 471 0 0 0 0 472 0 0 0 0 473 0 0 0 0 474 0 0 0 0 475 0 0 0 0 476 0 0 0 0 477 0 0 0 0 478 0 0 0 0.001 479 0 0 0 0 aPosition in the Multiple Sequence Alignment of 96 BEC1019 orthologous sequences. bVariable Importance values for residues from fungal pathogens of humans. cVariable Importance values for residues from fungal pathogens of insects. dVariable Importance values for residues from fungal non-pathogens. eVariable Importance values for residues from fungal pathogens of plants.