NAMPT-Derived NAD+ Fuels PARP1 to Promote Skin Inflammation Through

bioRxiv preprint doi: https://doi.org/10.1101/2021.02.19.431942; this version posted February 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

1 NAMPT-derived NAD+ fuels PARP1 to promote skin inflammation

2 through parthanatos

3 4 5 Francisco J. Martínez-Morcillo1,2, Joaquín Cantón-Sandoval1,2, Francisco J. Martínez- 6 Navarro1,2, Isabel Cabas1,2, Idoya Martínez-Vicente2,3, Joy Armistead4, Julia Hatzold4, 7 Azucena López-Muñoz1,2, Teresa Martínez-Menchón2,5, Raúl Corbalán-Vélez2,5, Jesús 8 Lacal6, Matthias Hammerschmidt4, José C. García-Borrón2,3, Alfonsa García-Ayala1,2, 9 María L. Cayuela2,5, Ana B. Pérez-Oliva1,2, Diana García-Moreno1,2, Victoriano 10 Mulero1,2,* 11 12 1Departmento de Biología Celular e Histología, Facultad de Biología, Universidad de 13 Murcia, Spain 14 2Instituto Murciano de Investigación Biosanitaria (IMIB)-Arrixaca, Murcia, Spain. 15 3Departamento de Bioquímica y Biología Molecular A e Inmmunología, Facultad de 16 Medicina, Universidad de Murcia, Murcia, Spain. 17 4Institute of Zoology, Cologne Excellence Cluster on Cellular Stress Responses in 18 Aging-Associated Diseases and Center for Molecular Medicine Cologne, University of 19 Cologne, Cologne, Germany. 20 5Hospital Clínico Universitario Virgen de la Arrixaca, Murcia, Spain. 21 6 Departamento de Microbiología y Genética, Facultad de Biología, Universidad de 22 Salamanca, Spain. 23 24 *To whom correspondence should be sent at: [email protected]. 25 26

27 Summary

28 Several studies have revealed a correlation between chronic inflammation and 29 NAD+ metabolism but the precise mechanism involved is unknown. Here we report that 30 the genetic and pharmacological inhibition of nicotinamide phosphoribosyltransferase 31 (Nampt), the rate-limiting enzyme in the salvage pathway of NAD+ biosynthesis, 32 reduced oxidative stress, inflammation, and keratinocyte DNA damage, 33 hyperproliferation and cell death in zebrafish models of chronic skin inflammation, 34 while all these effects were reversed by NAD+ supplementation. Similarly, genetic and 35 pharmacological inhibition of poly ADP-ribose (PAR) polymerase 1 (Parp1), 36 overexpression of PAR glycohydrolase, inhibition of apoptosis-inducing factor 1, 37 inhibition of NADPH oxidases and reactive oxygen species (ROS) scavenging, all 38 phenocopied the effects of Nampt inhibition. Pharmacological inhibition of NADPH 39 oxidases/NAMPT/PARP/AIFM1 axis decreased expression of pathology-associated 40 genes in human organotypic 3D skin models of psoriasis. Consistently, an aberrant 41 induction of both NAMPT amounts and PARP activity was observed in lesional skin 42 from psoriasis patients. In conclusion, hyperactivation of PARP1 in response to ROS- 43 induced DNA damage, fueled by NAMPT-derived NAD+, mediates skin inflammation 44 through parthanatos cell death.

45 Keywords: inflammation, psoriasis, neutrophils, NAD+, PARP1, NAMPT, ROS, 46 NADPH oxidases, DNA damage, parthanatos.

47 Highlights

48 • NAMPT inhibition alleviates inflammation in zebrafish and human epidermis 49 organoid models of psoriasis. 50 • NADPH oxidase-derived ROS mediates keratinocyte DNA damage and Parp1 51 overactivation. 52 • Inhibition of parthanatos cell death phenocopies the effects of NAMPT 53 inhibition in zebrafish and human psoriasis models. 54 • NAMPT and PAR metabolism is altered in psoriasis patients.

56 Introduction 57 Psoriasis is a non-contagious chronic inflammatory skin disease with global 58 prevalence of 0.1-3 % (Guttman-Yassky and Krueger, 2017). Despite being a relapsing 59 and disabling disease that affects both physical and mental health, is not usually life 60 threatening. However, the cytokines and chemokines produced in the lesion may reach 61 the blood and consequently cause comorbidities (Furue and Kadono, 2017). Although 62 the etiology is still undetermined, external agents trigger inflammation in genetically 63 predisposed epithelium (Greb et al., 2016; Weidinger et al., 2018). Cytokines released 64 by keratinocytes stimulate dendritic/Langerhans cells that drive specific Th17 cell 65 immune response and additional cytokines and chemokines close the inflammatory 66 feed-back loop that result in the skin lesion (Dainichi et al., 2018). 67 Nicotinamide adenine dinucleotide (NAD+) is the most important hydrogen 68 carrier in redox reactions in the cell, participating in vital cellular processes such as 69 mitochondrial function and metabolism, immune response, inflammation and DNA 70 repair, among others (Rajman et al., 2018). NAD+ levels are tightly regulated by Preiss- 71 Handler, de novo and salvage pathways (Canto et al., 2015). Different tissues 72 preferentially employ a distinct pathway regarding available precursors. The most 73 important NAD+ precursor is dietary niacin (also known as vitamin B3), consisting of 74 nicotinamide (NAM), nicotinic acid (NA) and NAM riboside (NR) (Houtkooper et al., 75 2010). NAM is also the product of NAD+-consuming enzymes, that is why most 76 mammalian tissues rely on NAM to maintain the NAD+ pool, via the NAD+ salvage 77 pathway (Canto et al., 2015; Rajman et al., 2018). The rate-limiting enzyme in the 78 NAD+ salvage pathway is NAM phosphoribosyltransferase (NAMPT) that converts 79 NAM into nicotinamide mononucleotide (NMN). After that, NMN adenylyltransferases 80 (NMNAT 1-3) transform NMN into NAD+ (Houtkooper et al., 2010). NAMPT has been 81 associated with oxidative stress and inflammation (Garten et al., 2015), being identified 82 as a universal biomarker of chronic inflammation, including psoriasis (Mesko et al., 83 2010). FK-866 is a noncompetitive highly specific NAMPT pharmacological inhibitor 84 that induces a progressive NAD+ depletion (Hasmann and Schemainda, 2003). FK-866 85 has demonstrated anti-inflammatory effects in different experimental settings, including 86 murine models of colitis and collagen-induced arthritis (Busso et al., 2008; Gerner et al., 87 2018). 88 Several enzymes depend on NAD+ to accomplish their biological functions. 89 Poly(ADP-Ribose) (PAR) polymerases (PARPs) are major NAD+-consuming enzymes

90 which transfer ADP-ribose molecules (linear or branching PAR) to proteins or itself 91 (auto-PARylation) (Qi et al., 2019). PARPs are implicated in DNA repair and chromatin 92 organization, gene transcription, inflammation and cell death or stress responses, among 93 others (Canto et al., 2015; Qi et al., 2019). However, the main PARP biological function 94 is to orchestrate the spatio-temporal repair of DNA damage; that is why PARP1 is 95 predominantly localized in the nucleus (Canto et al., 2015), being responsible for 96 approximately 90 % of PAR biosynthesis (Qi et al., 2019). PARP1-3 are recruited and 97 activated upon single- and double-strand DNA breaks (ssBs and dsBs) (Qi et al., 2019). 98 Several PARP inhibitors have been developed, such as olaparib, niraparib, rucaparib, 99 talazoparib and veliparib (Kukolj et al., 2017; Nesic et al., 2018). Once PARP1 is 100 recruited to a ssB, the inhibitors prevent PARP enzymatic activity, entrapping and 101 accumulating inactive PARP on DNA and triggering the collapse of replication forks 102 resulting in dsB generation during replication (Kukolj et al., 2017). 103 Under physiological conditions, DNA damage provoked by cellular metabolism 104 is successfully handled by PARP1. However, alkylating DNA damage, oxidative stress, 105 hypoxia, hypoglycemia or activation of inflammatory pathways can trigger PARP1 106 hyperactivation. Excessive PARylation depletes cellular NAD+ and ATP stores, 107 although it does not directly imply cell death. However, the accumulation of PAR 108 polymers and PARylated proteins reach the mitochondria causing depolarization of the 109 membrane potential and apoptosis-inducing factor (AIFM1) release into the cytosol 110 (Fatokun et al., 2014; Galluzzi et al., 2018). AIFM1 then recruits macrophage migration 111 inhibitory factor (MIF) to the nucleus where AIFM1-MIF nuclease activity executes a 112 large-scale DNA fragmentation resulting in a cell death pathway known as parthanatos 113 (Wang et al., 2016). 114 In this work, we report a critical role played by NAD+ and PAR metabolism in 115 skin oxidative stress and inflammation. We found that hyperactivation of PARP1 in 116 response to ROS-induced DNA damage, and fuelled by NAMPT-derived NAD+, 117 mediates inflammation through parthanatos cell death in preclinical zebrafish and 118 human epidermis organoid models of psoriasis. Consistent with this, clinical data 119 support the alteration of NAD+ and PAR metabolism in psoriasis, pointing to NAMPT 120 and PARP1 as novel therapeutic targets to treat skin inflammatory disorders. 121

122

123 Results

124 NAD+ metabolites regulate skin oxidative stress and inflammation

125 In order to determine if NAD+ metabolism has any role in the regulation of skin 126 inflammation, we decided to perform functional experiments in the transgenic zebrafish 127 line lyz:dsRED, which labels neutrophils. Manually dechorionated lyz:dsRED larvae 128 were treated by bath immersion with different concentrations of NAD+ from 24 hpf to 129 72 hpf (Figure 1A) . Incubation with 1 mM NAD+ resulted in a statistically significant 130 increased neutrophil dispersion from the caudal hematopoietic tissue (CHT) compared 131 to vehicle (DMSO)- and 0.25 and 0.5 mM NAD+-treated larvae (Figure 1A-1C). 132 Despite the altered pattern of neutrophil distribution, some of which were present in the 133 skin, both the integrity of the skin and its morphology were not affected (Figure 1C).

134 Given the role of H2O2 in driving neutrophil mobilization to acute (Niethammer

135 et al., 2009) and chronic (Candel et al., 2014) insults, we used the H2O2 fluorescent 136 probe acetyl-pentafluorobenzene sulphonyl fluorescein to know if this molecule was + 137 involved in the observed phenotype. NAD treatment was able to enhance H2O2 138 production in skin in a dose-dependent manner compared to the control group (Figure 139 1D, 1E). Similar results were obtained with NAM (Figures 1F, 1G), a well-known 140 NAD+ booster (Rajman et al., 2018), while NMN precursor was unable to increase skin 141 oxidative stress (Figures 1F, 1G). Nevertheless, no differences in neutrophil 142 redistribution were observed (Figure 1G). 143 We next wondered if the depletion of cellular NAD+ stores by the well- 144 characterized NAMPT inhibitor FK-866 (Hasmann and Schemainda, 2003) could also

145 have an impact on skin oxidative stress and inflammation using the H2O2 probe and the 146 transgenic line nfkb:eGFP, which accurately reports the activity of the master 147 inflammation transcription factor NFKB (Kanther et al., 2011). FK-866 promoted a 148 robust induction of NFKB activity in the muscle at the highest concentration used (100 149 µM) compared to control group (Figures 1H, 1J). Despite the NAD+ ability to induce 150 skin oxidative stress when used at 1 mM, it was unable to activate NFKB transcriptional 151 activity in any tissue. Importantly, NAD+ effectively restored muscle NFKB activity in 152 FK-866-treated larvae (Figures 1I, 1J), confirming the specificity of the inhibitor. 153 The inflammatory effect of FK-866 in muscle was confirmed by the robust

154 neutrophil infiltration (Figure 1K, 1M). Furthermore, H2O2 production by skin 155 keratinocytes was almost abolished by 1 µM of FK-866 (Figure 1L, 1M). Collectively,

156 these results suggest that not only NAD+ metabolite levels regulate oxidative stress in 157 the skin and neutrophil infiltration, but also that low levels of NAD+ trigger muscle 158 inflammation. 159 160 Inhibition of Nampt alleviates oxidative stress and skin inflammation in a zebrafish 161 model of psoriasis 162 The influence of NAD+ metabolism on skin oxidative stress and inflammation in 163 wild type zebrafish, encouraged us to study its effect on the zebrafish psoriasis model 164 with an hypomorphic mutation of spint1a (allele hi2217), which encodes the serine

165 protease inhibitor, kunitz-type, 1a. Spint1a-deficient larvae showed increased H2O2 166 release in the skin compared with their wild type siblings (Figures 2A, 2B). As 167 described above for wild type larvae, pharmacological inhibition of Nampt with FK-866

168 robustly decreased in a dose-dependent manner H2O2 production by Spint1a-deficient 169 skin keratinocytes (Figures 2A, 2B). 170 Spint1a-deficient larvae show neutrophil infiltration in the skin (Carney et al., 171 2007; LeBert et al., 2015; Mathias et al., 2007). We observed that 40% of neutrophils 172 were out of the CHT in the mutants compared to 10% in wild type larvae (Figures 2C, 173 2D). Mutant larvae treated with 10 or 50 µM FK-866 displayed a strong reduction of 174 neutrophil dispersion (Figures 2C, 2D). However, 100 µM FK-866 induced muscle 175 neutrophil infiltration, as observed in wild type animals (Figures 2C, 2D). Importantly, 176 epithelial integrity and keratinocyte aggregate foci were almost completely rescued in 177 Spint1a-deficient larvae treated with 10 µM FK-866 (Figures 2E, 2F) or with another 178 FK-866 inhibitor (GMX1778) (Figure S1A, S1B). These results were further confirmed 179 by genetic inhibition of the 2 zebrafish Nampt paralogues, namely Nampta and Namptb 180 (Figure S1C-S1F). In addition, NAD+ supplementation exerted a negative effect on 181 Spint1a-deficient skin. Thus, NAD+ aggravates skin morphology alterations and 182 neutrophil infiltration compared with wild type animals (Figures 2G, 2H). In addition, 183 NAD+ treatment neutralized the beneficial effects of FK-866 on the spint1a mutant, 184 worsening skin alterations and neutrophil infiltration (Figures 2G, 2H). Consistently, the 185 high NFKB transcriptional activity observed in the skin of Spint1a-deficient larvae was 186 reduced by FK-866 (Figures 2I, 2J). As expected, FK-866 and NAD+ supplementation 187 decreased and increased, respectively NAD+/NADH levels (Figure 2K). However, no 188 statistically significant differences between NAD+/NADH levels in wild type and 189 Spint1a-deficient larvae were found (Figure 2K). Collectively, these results indicate that

190 Spint1a-deficient animals were more susceptible to NAD+ supplementation than their 191 wild type siblings and that the beneficial effects of FK-866 on the skin were mediated 192 by reducing skin NAD+ availability. 193 194 NADPH oxidase-derived ROS promote skin inflammation in Spint1a-deficient larvae 195 The higher levels of ROS in the skin of Spint1a-deficient larvae, together with 196 their drastic reduction by pharmacological inhibition of Nampt, led us to hypothesize 197 that Nampt-derived NAD+ was fuelling NADPH oxidases. We therefore used N- 198 acetylcysteine (NAC), which can scavenge ROS directly and replenish reduced 199 glutathione levels (Atkuri et al., 2007; Dean et al., 2011). Spint1a-deficient larvae 200 treated from 1-3 dpf with 100 µM NAC displayed a statistically significant reduction in 201 skin neutrophil infiltration together with reduced skin alterations (Figures 3A, 3B, S2A, 202 S2B). We next tested mito-Tempo, an antioxidant that specifically accumulates in the 203 mitochondria imitating superoxide dismutase activity against superoxide and alkyl 204 radical (Ni et al., 2016), and tempol, a nitroxide antioxidant that acts against the 205 peroxynitrite decomposition compounds, nitrogen dioxide and superoxide radical anion 206 (Mustafa et al., 2015). Whereas both antioxidants were able to reduce skin neutrophil 207 infiltration (Figures 3C, 3D), NFKB activity (Figures 3E, 3F) and morphological 208 alterations (Figures S2C, S2D) in Spint1a-deficient larvae, tempol was found to be 209 much more potent than mito-Tempo (100 µM vs. 100 nM). The relevance of cytosolic 210 rather than mitochondrial ROS was further confirmed by the ability of pharmacological 211 inhibition of NAPDH oxidases with apocynin to alleviate skin neutrophil infiltration of 212 Spint1a-deficient larvae (Figures 3G, 3H) and skin alterations (Figures S2E, S2F). In 213 addition, genetic inhibition of Nox1, Nox4 and Nox5 showed that all contributed to 214 ROS production and skin inflammation (Figures 3I-3M, S2G-S2J, S3). Collectively, 215 these results demonstrate that NADPH oxidase-derived ROS promote skin 216 inflammation in Spint1a-deficient larvae. 217 218 Inhibition of Parp1 alleviates oxidative stress and skin inflammation of Spint1a- 219 deficient larvae 220 Due to the pleiotropic roles of NAD+ that participates in more than 500 221 enzymatic reactions and regulates several key cellular processes (Rajman et al., 2018), 222 we analyzed major NAD+ consuming enzymes, namely Cd38 and sirtuins (Canto et al., 223 2015). Pharmacological inhibition of either Cd38 with 78C (Haffner et al., 2015) or

224 sirtuin 1 with EX527 (selisistat) (Napper et al., 2005) were unable to rescue skin 225 inflammation of Spint1a-deficient larvae (data not shown). We then hypothesized that 226 PARPs, which are other NAD+-consuming enzymes, could be involved in skin 227 inflammation. Pharmacological inhibition of Parps with olaparib efficiently rescued 228 skin neutrophil infiltration (Figures 4A, 4B), NFKB activation (Figures 4C, 4D) and 229 morphological alterations (Figures S4A, S4B) in Spint1a-deficient larvae. Consistently, 230 genetic inhibition of Parp1 (Figures S4C-S4F) and treatment of larvae with other Parp 231 inhibitors (veliparib and talazoparib) (Figures 4E, 4F) gave similar results, although the 232 inhibitors showed different potencies (500 µM veliparib > 100 µM olaparib >1 µM 233 talazoparib). Furthermore, increased PAR levels were found by western blot in the tail 234 tissue of Spint1a-deficient larvae compared with their wild type siblings (Figure S4G), 235 which could be attenuated by both FK-866 and olaparib (Figure S4H). Similarly, Nampt 236 (FK-866) and Parp (olaparib) inhibition significantly reduced skin epithelial lesions in 237 the psoriasis mutant (Figures S5A-S5C), which share the skin inflammation and 238 keratinocyte hyperproliferation phenotypes with the Spint1a-deficient line but has a 239 loss-of-function mutation in atp1b1a, which encodes the beta subunit of a Na,K-ATPase 240 pump (Hatzold et al., 2016; Webb et al., 2008). 241 242 Inhibition of Nampt and Parp1 dampens keratinocyte hyperproliferation and cell death 243 of Spint1a-deficient larvae 244 As the Spint1a-deficient phenotype starts with basal keratinocyte aggregation, 245 mesenchymal-like properties acquisition and cell death, leading to uncontrolled 246 proliferation (Carney et al., 2007; Mathias et al., 2007), we next analyzed whether 247 Nampt or Parp1 inhibition affected keratinocyte proliferation and/or cell death. As early 248 as 24 hours of treatment, pharmacological inhibition of either Nampt or Parps robustly 249 reduced keratinocyte hyperproliferation in Spint1a-deficient larvae, assayed as BrdU 250 incorporation (Figures 4G-4I), confirming the ability of both Nampt and Parp inhibition 251 to reduce keratinocyte aggregates. Unexpectedly, olaparib also reduced the high number 252 of terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL)+ 253 keratinocytes found in Spint1a-deficient larvae (Figures 4J, 4K), despite the fact that 254 Parp1 inhibition is expected to lead to the accumulation of DNA lesions and eventually 255 to cell death (Schreiber et al., 2006). We, therefore, investigated DNA damage 256 analyzing the presence of the phosphorylated histone variant H2AX (pH2Ax), which 257 label dsBs and is independent of PARP1 (Schreiber et al., 2006), and performing a

258 comet assay, which under alkaline conditions can detect both ssBs and dsBs (Pu et al., 259 2015). The results showed higher keratinocyte DNA damage, assayed by either pH2Ax 260 staining (Figures 4L, 4M) or by comet assay (Figure 4N), in Spint1a-deficient 261 keratinocytes. In line with previous studies, inhibition of Parp activity with olaparib 262 increased DNA damage in wild type and Spint1a-deficient larvae (Figures 4L, 4M). 263 Remarkably, olaparib-induced DNA lesions were higher in Spint1a-deficient larvae 264 (Figures 4L, 4N), suggesting increased susceptibility to Parp inhibition. Another 265 interesting result was the reduced pH2Ax staining in Spint1a-deficient keratinocytes in 266 response to FK-866 treatment (Figures 4L, 4M). Taken together, these results suggest 267 that Spint1a-deficient keratinocytes accumulate DNA breaks and have increased 268 susceptibility to DNA stressors. 269 270 Inhibition of parthanatos rescues skin inflammation of Spint1a-deficient larvae 271 Although the initial characterization of the Spint1a-deficient line revealed high 272 keratinocyte cell death, it was refractory to inhibition of caspase or pro-apoptotic 273 factors, suggesting an unidentified programmed cell death pathway (Carney et al., 2007; 274 Mathias et al., 2007). Similarly, we did not find active caspase-3+ keratinocytes in 2 dpf 275 Spint1a-deficient or wild type larvae (Figures 5A-5C). In addition, FK-866 or olaparib 276 treatments did not induce apoptosis (Figures 5A-5C). 277 The absence of apoptosis in Spint1a-deficient larvae, together with the ability of 278 Parp inhibitors to robustly reduce keratinocyte cell death in this model, led us to 279 hypothesize that Parp1 overactivation in response to extensive ROS-mediated DNA 280 damage would promote parthanatos cell death. To test this hypothesis, we used N- 281 phenylmaleimide (NP), a chemical inhibitor of Aifm1 translocation from the nucleus to 282 the mitochondria (Susin et al., 1996). Treatment of Spint1a-deficient larvae with 10 nM 283 NP showed statistically significant reduced skin neutrophil infiltration (Figures 5D-5F) 284 and keratinocyte aggregates (Figures S6A, S6B). Similar results were found upon 285 genetic inhibition of Aifm (Figures 5G-5I and S6C, S6D) and forced expression of 286 parga, which encodes PAR glycohydrolase a (Figures 5J-5L and S6E-S6G). 287 Collectively, these results further confirm that overactivation of Parp1 in Spint1a- 288 deficient animals mediates keratinocyte cell death through parthanatos rather than via 289 depletion of ATP and NAD+ cellular stores. 290

291 Pharmacological inhibition of NADPH oxidases/NAMPT/PARP/AIFM1 axis decreased 292 expression of pathology-associated genes in human organotypic 3D skin models of 293 psoriasis 294 The results obtained in zebrafish prompted us to study the impact of inhibition 295 of oxidative stress, NAMPT and PARP1 in organotypic 3D human psoriasis models 296 (Figure 6A). The results showed robust increase of NAMPT transcript levels in psoriatic 297 epidermis, i.e. stimulated with cytokines IL17 and IL22 (Figure 6B). Pharmacological 298 inhibition of NADPH oxidases with apocynin significantly reduced the mRNA levels of 299 the inflammation marker defensin 4 (DEFB4) (Figure 6A), while it did not affect those 300 of the differentiation markers filaggrin (FLG) and loricrin (LOR) (Figure 6C). Similarly, 301 inhibition of NAMPT, PARP and AIFM1 reduced the transcript levels DEFB4 and 302 S100A8, another inflammation marker-associated to psoriasis (Figure 6B), while all 303 treatments further reduced LOR and FLR mRNA levels, as did all-trans retinoic acid 304 (ATRA) (Figure 6C). These results confirmed that inhibition of parthanatos cells death 305 with NADPH oxidases, NAMPT, PARP and AIFM1 inhibitors also reduced 306 inflammation in human psoriasis models. 307 308 The expression of genes encoding NAD+ and PAR metabolic enzymes is altered in 309 psoriasis in humans 310 Transcriptomic analysis of human psoriasis lesional skin data collected in the 311 GEO database revealed differential expression profile of genes encoding enzymes 312 involved in NAD+ and PAR (Figures S7, S8) metabolism. The mRNA levels NAMPT 313 were upregulated (Figure S8), while those of NMNAT3 were downregulated in psoriasis 314 lesional skin (Figures S8). The transcript levels of NRK2, which is involved NR 315 conversion (Nikiforov et al., 2015), were upregulated in psoriasis lesional skin (Figures 316 S8). Preiss-Handler pathway seemed to show an intensified activity only in psoriasis 317 lesional skin, since upregulation of the mRNA levels of genes encoding its components 318 NAPRT, encoding nicotinate phosphoribosyltransferase, and NADSYN, encoding NAD 319 synthetase, was observed (Figures S8). Finally, the genes coding for NAD+ biosynthetic 320 enzymes involved in de novo pathway were also altered: while the transcript levels of 321 IDO1, encoding indoleamine 2,3-dioxygenase 1, and TDO2, encoding tryptophan 2,3- 322 dioxygenase, were induced in lesional skin, QPRT, encoding quinolinate 323 phosphoribosyltransferase, slightly decreased in psoriasis compared to healthy skin

324 (Figures S7A). As regards genes encoding enzymes involved in NAD+ degradation, 325 increased CD38 transcript levels were observed in psoriasis lesional skin (Figures S8). 326 We next analyzed the transcript levels of PARP1, AIFM1 and MIF, which 327 encode three indispensable parthanatos components (Wang et al., 2016) as well as those 328 encoding different PAR hydrolases that negatively regulate protein PARylation. 329 Transcriptomic data revealed strong increased mRNA levels of PARP1, AIFM1 and 330 MIF in psoriasis lesional skin (Figures S9). Although no alteration in the expression 331 profile of the gene encoding PARG was found, the transcript levels of the genes 332 encoding several PAR hydrolases, namely MACROD1, MACROD2 and TARG1 were 333 lower in psoriasis lesional skin (Figures S9). Furthermore, genes encoding other PAR 334 hydrolases were specifically upregulated in psoriasis lesional skin (ARH3) or 335 downregulated (NUDT16 and ENPP1) (Figures S9). In addition, psoriasis lesional skin 336 also showed enhanced transcript levels of ARH1 (Figures S9), whose product cleaves 337 the terminal bond but only for targets PARylated on arginine (Qi et al., 2019). These 338 results taken together indicate that psoriasis may display increased PARylation. 339 340 NAMPT and PAR increase in the nucleus of human keratinocytes from psoriasis lesions 341 Immunohistochemical analysis of samples from healthy skin and psoriasis 342 lesions showed that NAMPT was hardly detected in healthy epidermis and dermis 343 (Figure 6D). However, NAMPT was widely overexpressed in the spinous layer and in a 344 few basal keratinocytes and dermal cells in psoriasis lesional skin (Figure 6D). 345 Curiously, NAMPT immunoreactivity was mainly found in the nucleus of keratinocytes 346 but a fainter immunoreactivity was also observed in their cytoplasm (Figure 6D). 347 Consistently, although PAR immunoreactivity was found in the nuclei of scattered 348 keratinocytes of the spinous layer from healthy skin subjects, it was widely observed in 349 the nuclei of most keratinocytes of the spinous layer and dermal fibroblasts from 350 psoriasis lesional skin (Figure 6E), demonstrating increased PARylation in psoriasis 351 lesional skin. 352 353 Discussion 354 NAD+ metabolism plays a fundamental role in maintaining organism 355 homeostasis. NAMPT, the rate-limiting step enzyme in the NAD+ salvage pathway, has 356 been associated to oxidative stress and inflammation (Garten et al., 2015), being 357 identified as a universal biomarker of chronic inflammation, including psoriasis (Mesko

358 et al., 2010). PARPs are major NAD+ consuming enzymes involved in DNA repair, 359 although their involvement in inflammation has also been widely recognized (Canto et 360 al., 2015; Qi et al., 2019). We have shown here using the unique advantages of the 361 zebrafish embryo/larval model for in vivo imaging and drug/genetic screening a crucial 362 contribution of NAMPT and PARP1 to skin inflammation through the induction of 363 parthanatos cell death (Figure 7). Consistently, inhibition of parthanatos also alleviated 364 inflammation in human organotypic 3D models of psoriasis. To the best of our 365 knowledge, this is the first study demonstrating the existence of parthanatos in vivo. In 366 these models, the ability of NAD+ and its precursors to induce oxidative stress can be 367 explained by their capacity to boost NADH/NADPH intracellular levels that would fuel 368 NADPH oxidases to generate ROS (Figure 7). Consistently, pharmacological and

369 genetic inhibition of NADPH oxidases or NAMPT efficiently counteracted skin H2O2 370 synthesis and inflammation in both zebrafish and human models. The relevance of 371 oxidative stress in psoriasis has not been demonstrated definitively but psoriasis patients 372 show increased levels of oxidative stress markers, decreased levels of antioxidant 373 molecules and reduced activity of main antioxidant enzymes, such as superoxidase 374 dismutase and catalase (Lin and Huang, 2016; Nemati et al., 2014). Additionally, high 375 levels of oxidized guanine species, a marker of DNA/RNA damage, were found in the 376 serum of psoriasis patients (Borska et al., 2017), further highlighting the relevance of 377 the Spint1a-deficient line to study psoriasis. Curiously, high doses of FK-866 triggered 378 NFKB and neutrophil infiltration into the muscle, probably reflecting disruption of the 379 cellular bioenergetics in this tissue due to critically low NAD+ levels. This would need 380 further investigation but it is out of the scope of this study. 381 We also revealed new features of the Spint1a-deficient zebrafish line that may 382 be useful in future studies. This model is of relevance for the study of human skin 383 inflammatory disorders, since exacerbated serine protease activity is responsible for 384 skin barrier defects and chronic inflammation in Netherton syndrome, a rare but severe 385 autosomal recessive form of ichthyosis caused by mutation in SPINK5, which encodes 386 the serine protease inhibitor LEKTI (Sarri et al., 2017). Notably, ablation of matriptase 387 from LEKTI-deficient mice rescues skin barrier defects and inflammation (Sales et al., 388 2010). Furthermore, mutations in SPINK5 have also been associated with atopic 389 dermatitis (Liang et al., 2016), further highlighting the relevance of the Spint1a-

390 deficient zebrafish model. We found that this model exhibited increased H2O2 release in 391 the skin, a well-known signal for leukocyte recruitment to acute (Niethammer et al.,

392 2009) and chronic (Candel et al., 2014) insults. H2O2 was released at high levels in 393 keratinocyte aggregates; precisely where higher NFKB levels were also observed and 394 neutrophils were actively recruited. The relevance of oxidative stress in the skin 395 inflammation of this line was confirmed by ROS scavenging and inhibition of NADPH 396 oxidases and Nampt, being all able to restore skin morphology (Figure 7). We also 397 found that Spint1a-deficient larvae exhibited extensive DNA damage, evaluated by 398 pH2Ax staining and comet assay, and had increased susceptibility to olaparib, a DNA 399 damage inducer (Kukolj et al., 2017). This is an important observation from a clinical 400 point of view, since psoriasis patients receiving PUVA have a significantly increased 401 risk for the development of skin cancers (primarily squamous cell carcinomas) 402 (Gasparro, 2000). Pharmacological inhibition of Nampt not only reduced oxidative 403 stress, skin inflammation and keratinocyte hyperproliferation but also DNA damage. 404 However, inhibition of Parp1 with olaparib increased keratinocyte DNA damage, 405 despite being able to reduce at the same time cell death and PARylation. Moreover, 406 neither olaparib nor FK-866 treatments promoted keratinocyte apoptosis, contrasting 407 previous studies where PARP inhibitors were reported to induce apoptosis in 408 proliferating cells (Schreiber et al., 2006). Therefore, olaparib induced an undesirable 409 situation from a clinical point of view, where keratinocytes accumulated DNA damage 410 but did not suffer apoptosis or another form of cell death. This is not surprising, since 411 psoriatic keratinocytes are highly resistant to apoptosis (Kastelan et al., 2009) and its 412 induction by PUVA may be involved in its therapeutic effects (Laporte et al., 2000). 413 The depletion of NAD+ cellular stores by Nampt inhibition might have also 414 resulted in a direct inhibition of keratinocyte proliferation in the Spint1a-deficient and 415 human organotypic 3D skin models of psoriasis. Indeed, it is known that cancer cells 416 are more sensitive to the loss of NAMPT, a distinctive feature that was proposed to be 417 used clinically in combination with other anticancer agents (Garten et al., 2015). 418 Moreover, various treatments for psoriasis target proliferation of keratinocytes and 419 immune cells, such as acitretin, PUVA, methotrexate and cyclosporine, among others 420 (Greaves and Weinstein, 1995). However, no developmental alterations or delay were 421 observed in larvae treated with Nampt or Parp inhibitors in 3 dpf larvae. Therefore, 422 although these inhibitors caused a blockage in cell proliferation, the results are 423 consistent with a recovery of the mutant phenotype by the inhibition of oxidative stress 424 and parthanatos.

425 One of the most interesting observations of this study is that Parp1 inhibition 426 was able to restore epithelial homeostasis and to alleviate skin inflammation in both 427 Spint1a- and Atp1b1a-deficient models. The ability of Aifm1 inhibition and Parga 428 overexpression to phenocopy the effects of Nampt and Parp inhibition in the Spint1a- 429 deficient model further confirmed that parthanatos induced by Parp1 overactivation, 430 rather than by depletion of ATP and NAD+ keratinocyte stores, mediated skin 431 inflammation (Figure 7). This is consistent with the results obtained with Nampt 432 inhibition, which resulted in depleted NAD+ levels, but was also able to rescue skin 433 inflammation and keratinocyte cell death and hyperproliferation in both zebrafish 434 models. However, Nampt inhibition would simultaneously hamper NADPH oxidases 435 and Parp1 enzymatic activities, while Parp inhibition would only suppress the latter. 436 Anyway, prevention of cell death by either strategy might reduce danger signal and 437 cytokine release, limiting immune cell recruitment and dampen inflammation (Kunze 438 and Hottiger, 2019) by blocking the inflammatory loop that propagates in psoriasis 439 (Dainichi et al., 2018). 440 The analysis of human transcriptomic data from psoriasis lesional skin showed 441 altered expression profiles of genes encoding NAD+ metabolic enzymes, including 442 salvage, Preiss-Handler and de novo pathways, and of genes encoding key enzymes 443 involved in PAR metabolism and parthanatos. As both diseases are characterized by an 444 important cellular immune infiltration and growth of other cell types like nerves or 445 blood vessels, the genes whose expression is altered in lesional skin may be expressed 446 in different tissues other than keratinocytes. Our immunohistochemical analysis of 447 psoriasis lesional skin confirmed the drastic induction of NAMPT at protein level and 448 PAR accumulation in the nucleus of epidermal keratinocytes and dermal cells. 449 In conclusion, we report that hyperactivation of Parp1 in response to ROS- 450 induced DNA damage, and fuelled by NAMPT-derived NAD+, mediates inflammation 451 through parthanatos cell death in preclinical zebrafish and human organotypic 3D skin 452 models of psoriasis. The altered expression of genes encoding key enzymes involved in 453 NAD+ and PAR metabolism in psoriasis lesional skin, and in particular the robust 454 induction of NAMPT and the accumulation of PAR in psoriasis lesional skin, point to 455 NAMPT, PARP1 and AIFM1 as novel therapeutic targets to treat psoriasis and probably 456 other skin inflammatory disorders. 457 458

459 Methods 460 461 Ethics statement 462 The experiments performed comply with the Guidelines of the European Union 463 Council (Directive 2010/63/EU) and the Spanish RD 53/2013. Experiments and 464 procedures were performed as approved by the Bioethical Committees of the University 465 of Murcia (approval numbers #75/2014, #216/2014 and 395/2017) and Ethical Clinical 466 Research Committee of The University Hospital Virgen de la Arrixaca (approval 467 number #8/13). 468 469 Animals 470 Wild-type zebrafish (Danio rerio H.) lines AB, TL and WIK obtained from the 471 Zebrafish International Resource Center (ZIRC) were used and handled according to the 472 zebrafish handbook (Westerfield, 2000). The transgenic zebrafish line 473 Tg(lyz:dsRED2)nz50 (Hall et al., 2007) and Tg(NFκB-RE:eGFP) (Kanther et al., 2011) 474 were described previously. The mutant zebrafish lines spint1ahi2217Tg/hi2217Tg (Amsterdam 475 et al., 1999) and the atpb1am14/m14 (Webb et al., 2008) were isolated from insertional and 476 ehyl methanesulfonate induced mutagenesis screens, respectively. 477 478 479 Genetic inhibition in zebrafish 480 The crispr RNA (crRNA) obtained from Integrated DNA technologies (IDT) 481 with the following target sequence were used: aifm1 crRNA: 5'- 482 CTTGCCAAGGTGGAGAACGG-3', parp1 crRNA: 5'- 483 TGGATTTACTGACCTCCGCT-3', nampta 5'-AGTAAAGAGCACATTTCCCCG-3'; 484 namptb 5'-GGAGTAGACTTTATTTATAT-3'; nox1 crRNA: 485 CAAGCTGGTGGCCTACATGA; nox4 crRNA: TTCGCTTGTGTCCTTCAAGC and 486 nox5 crRNA: GAGGTCATGGAAAATCTCAC. They were resuspended in duplex 487 buffer at 100 µM and 1 µl was incubated with 1 µl of 100 µM trans-activating CRISPR 488 RNA (tracrRNA) at 95ºC for 5 minutes and then 5 minutes at room temperature to form 489 the complex. One µl of this complex was mixed with 0.25 µl of recombinant Cas9 (10 490 mg/ml) and 3.75 µl of duplex buffer. The efficiency of each crRNA was determined by 491 the TIDE webtool (https://tide.deskgen.com/) (Brinkman et al., 2014) or T7 nuclease 492 assay. Crispant larvae of 3 dpf were used in all studies.

493 Chemical treatments in zebrafish 494 Zebrafish embryos were manually dechorionated at 24 hpf. Larvae were treated 495 from 24 hpf to 48 hpf or 72 hpf by chemical bath immersion at 28 C. Incubation was 496 carried out in 6- or 24-well plates containing 20-25 larvae/well in egg water (including 497 60 µg/mL sea salts in distilled water) supplemented with 1% dimethyl sulfoxide 498 (DMSO). The inhibitors and metabolites used, the concentrations tested and their targets 499 are shown in Table S1. 500 501 Imaging of zebrafish larvae 502 Live imaging of 72 hpf larvae was obtained employing buffered tricaine (200 503 µg/mL) dissolved in egg water. Images were captured with an epifluorescence LEICA 504 MZ16FA stereomicroscope set up with green and red fluorescent filters. All images 505 were acquired with the integrated camera on the stereomicroscope and were analyzed to 506 determine number of neutrophils and their distribution in the larvae. The transcriptional 507 activity of NF-κB was visualized and measured with the zebrafish line NFκB-RE:eGFP.

508 H2O2 release was quantified employing the live cell fluorogenic substrate acetyl- 509 pentafluorobenzene sulphonyl fluorescein (Cayman Chemical) (Candel et al., 2014; de 510 Oliveira et al., 2015). Briefly, about 20 embryos of 72 hpf were rinsed with egg water 511 and collected in a well of a 24-well plate with 50 µM of the substrate in 1% DMSO for 512 1 hour. ImageJ software was employed to determine mean intensity fluorescence of a

513 common region of interest (ROI) placed in the dorsal fin for H2O2 production 514 quantification. Similarly, a ROI located in muscle or skin was used to obtain mean 515 intensity fluorescence of NFκB-RE:eGFP transgenic line. 516 517 Whole-mount immunohistochemistry in zebrafish 518 BrdU incorporation assay was used to determine cell proliferation. Embryos of 519 48 hpf were incubated in 10 mM of BrdU dissolved in egg water for 3 hours at 28 C 520 followed by a one-hour wash out with egg water and fixation in 4% paraformaldehyde 521 (PFA) overnight at 4C or 2 hours at room temperature (RT). For the rest of 522 immunofluorescence techniques, embryos/larvae were directly fixed in 4% PFA, as 523 indicated above. Embryos/larvae were then washed with phosphate buffer saline (PBS) 524 with 0.1% tween-20 (PBST) 3 times for 5 minutes. In order to dehydrate the sample 525 progressively, 25%/75% methanol (MeOH)/PBST, 50%/50% MeOH/PBST and

526 75%/25% MeOH/PBST and 100% MeOH were employed each for 5 minutes. At this 527 point, embryos were stored at -20 C. To proceed with the immunofluorescence, 528 samples were re-hydrated in decreasing solutions of MeOH/PBST, as previously 529 described, and then washed 3 times for 5 minutes with PBST. For BrdU staining next 530 step consisted on applying 30 minutes a solution of 2N HCl in PBS supplemented with 531 0.5 % Triton X-100 (PBSTriton), followed by 3 wash with PBSTriton for 15 minutes. 532 Blocking step was carried out for at least 2 hours at RT with a PBSTriton solution 533 supplemented with 10 % fetal calf serum (FBS) and 0.1 % DMSO. The primary 534 antibody incubation in blocking solution was done overnight at 4 C or 3-4 hours at 535 room temperature. After that, larvae were washed 6 times for 5 minutes. Incubation in 536 secondary antibody in blocking solution was performed for 2-3 hours in the dark. In 537 order to remove unbound secondary antibody, embryos were washed 3 times for 10 538 minutes with PBST. In this step, the sample was ready for 2-(4-Amidinophenyl)-6- 539 indolecarbamidine (DAPI) staining with a DAPI solution (1:1000) in PBST for 20 540 minutes followed by a wash out step of 3 times for 10 minutes with PBST. Finally, 541 embryos were transferred to 80% glycerol/20% PBST and stored in the dark at 4 C 542 until imaging. 543 The following primary antibodies were used: rabbit anti-BrdU (Abcam, 544 ab152095, 1:200), mouse anti-p63 (Santa Cruz Biotechnology, sc-7255, 1:200), rabbit 545 Anti-Active Caspase-3 (Bd Bioscience, #559565, 1:250) and rabbit anti- 546 H2AX.XS139ph (phospho Ser139) (GeneTex, GTX127342, 1:200). Secondary 547 antibodies were goat anti-rabbit Alexa Fluor-488 (Molecular probes, CAT#A11008, 548 1:1000) and goat anti-mouse Cyanine 3 (Life technologies, A10521, 1:1000). Images 549 for BrdU staining were taken using a Zeiss Confocal (LSM710 META), the other stains 550 were acquired by ZEISS Apotome.2. All images were processed using ImageJ software. 551 552 TUNEL Assay 553 Emrbyos/larvae were fixed and dehydrated as described above. Afterwards, 554 embryos/larvae were rinsed with pre-cooled (-20 C) 100% acetone and then incubated

555 in 100% acetone at -20 C for 10 minutes. Samples were then washed 3 times for 10 556 minutes with PBST and incubated in a solution of 0.1% TritonX-100 and 0.1% sodium 557 citrate (10%) in PBS for 15 minutes to further permeabilize the embryos/larvae. Next 558 step consisted of rinsing specimens 2 times for 5 minutes in PBST. Following complete

559 removal of PBST from samples, it was added 50 µL of fresh TUNEL reaction mixture 560 composed of 5 µL of enzyme solution mixed with 45 µL of labeling solution (In Situ 561 Cell Death Detection kit, POD, ROCHE, version 15.0) for 1 hour at 37 C, followed by 562 5 wash with PBST for 5 minutes. Blocking step was carried out for at least 1 hour at 563 room temperature with blocking buffer. To proceed with TUNEL assay, blocking buffer 564 was removed and added 50 µL Converter-POD (anti-fluorescein antibody conjugated to 565 peroxidase) for 1 hour at room temperature or overnight at 4 C on rocker. Embryos 566 were rinsed 4 times for 30 minutes in PBST and incubated in 1 mL of 3,3´- 567 Diaminobenzidine (DAB) solution for 30 minutes in the dark and transferred to a 24

568 well-plate. Two µL of a fresh 0.3% H2O2 solution was added to initiate peroxidase 569 reaction that was monitored 10-20 minutes followed by rinsing and a wash out step of 2 570 times for 5 minutes with PBST. Finally, embryos were transferred to 80% glycerol/20% 571 PBST and stored in dark at 4 C until imaging. Images were acquired by ZEISS 572 Apotome.2 and processed using ImageJ software. 573 574 Comet assay in zebrafish 575 Zebrafish embryos at 48 hpf were anesthetized in tricaine (200 µg/mL) dissolved 576 in egg water and the end of the fin fold was amputated with a scalpel. Tissues collected 577 from around 60 embryos were pooled, then spun and resuspended in 1 mL PBS. 578 Liberase at 1:65/volume of PBS (Roche, cat # 05401119001) was added and tissues 579 were incubated at 28 C for 35 minutes, pipetting up and down every 5 minutes. To stop 580 the reaction, FBS was added to a final concentration of 5% in PBS. From now on, 581 samples were kept on ice. Disaggregated fin folds were filtered through a 40 µM filter 582 and washed using PBS + 5% FBS. Cell suspension was centrifuged at 650xg for 5 583 minutes and resuspended in 50 µL of PBS + 5% FBS. In order to determine cell 584 number, Trypan Blue-treated cell suspension was applied to Neubauer chamber and cell 585 were counted in an inverted microscope. Around 15,000 cells were employed to 586 perform the Alkaline Comet Assay according to the manufacturer's protocol (Trevigen). 587 Briefly, cells were added in low melting point agarose at 37 C at a ratio of 1:10 (v/v) 588 and then were placed onto microscope slides. After adhesion at 4 °C for 30 minutes in 589 the dark, slides were immersed in lysis buffer (precooled at 4 °C) overnight at 4 °C. 590 Next, DNA was unwound in alkaline electrophoresis solution pH>13 (200 mM NaOH, 591 1 mM EDTA) at room temperature for 20 min in dark, followed by electrophoresis run

592 in the same buffer at 25 V (adjusting the current to 300 mA) for 30 minutes. Slides were 593 washed twice in distilled water for 5 minutes and in 70% ethanol for 5 minutes, then 594 they were dried at 37 °C for 30 minutes. Finally, DNA was stained with SYBR™ Green 595 I Nucleic Acid Gel Stain 10,000X (Invitrogen) and images were taken using a Nikon 596 Eclipse TS2 microscope with 10x objective lens. Quantitative analysis of the tail 597 moment (product of the tail length and percent tail DNA) was obtained using 598 CASPLAB software. More than 100 randomly selected cells were quantified per 599 sample. Values were represented as the median of the tail moment of treated cells 600 relative to the median of the tail moment of untreated cells. 601 602 Western blot 603 Zebrafish embryos at 72 hpf were anesthetized in tricaine (200 µg/mL) dissolved 604 in egg water and the end of the fin fold was amputated with a scalpel. Tissues collected 605 from around 120 embryos were pooled, then spun and resuspended in 80 µL of 10 mM 606 Tris pH 7.4 + 1% Sodium Dodecyl Sulfate (SDS). Samples were then incubated at 95 607 oC for 5 min with 1400 rpm agitation, followed by maximum speed centrifugation for 5 608 min. Supernatants were frozen at – 20 C until proceeding. BCA kit was employed to 609 quantify protein using BSA as a standard. Fin lysates (10 μg) in SDS sample buffer 610 were subjected to electrophoresis on a polyacrylamide gel and transferred to PVDF 611 membranes. The membranes were incubated for 1 h 30 min with TTBS containing 5% 612 (w/v) skimmed dry milk powder and immunoblotted in the same buffer 16 h at 4 C 613 with the mouse monoclonal antibody to human poly(ADP-ribose) (1/400, ALX-804- 614 220, Enzo). The blot was then washed with TTBS and incubated for 1 h at room 615 temperature with secondary HRP-conjugated antibody diluted 2500-fold in 5% (w/v) 616 skimmed milk in TTBS. After repeated washes, the signal was detected with the 617 enhanced chemiluminescence reagent and ChemiDoc XRS Biorad. 618 619 Total NAD+ and NADH determination 620 Zebrafish embryos at 72 hpf were anesthetized in tricaine (200 µg/mL) dissolved 621 in cold PBS in order to amputate the tail at the end of the yolk sac extension with a 622 scalpel. Tissues from around 120 embryos were pooled and collected in lysis buffer 623 provided by the kit (ab186032, Abcam) according to the manufacturer's protocol. 624 Tissues were homogenized and centrifuged at 1400 rpm for 5 minutes at 4 C.

625 Supernatants were collected and centrifuged at maximum speed for 10 minutes at 4 C. 626 Supernatants were employed to protein quantification with BCA kit using BSA as a 627 standard. To proceed with Total NAD and NADH determination, 50 µg of protein were 628 employed. 629 630 Gene Expression Omnibus (GEO) database 631 Human psoriasis (accession number: GSD4602) transcriptomic data collected in 632 the GEO database (https://www.ncbi.nlm.nih.gov/geo/). Gene expression plots were 633 obtained using GraphPad Prism Software. 634 635 Immunohistochemistry in human skin samples 636 Skin biopsies from healthy donors (n = 5) and psoriasis patients (n = 6) were 637 fixed in 4% PFA, embedded in Paraplast Plus, and sectioned at a thickness of 5 µm. 638 After being dewaxed and rehydrated, the sections were incubated in 10 mM citrate 639 buffer (pH 6) at 95 C for 30 min and then at room temperature for 20 min to retrieve 640 the antigen. Afterwards, steps to block endogenous peroxidase activity and nonspecific 641 binding were performed. Then, sections were immunostained with a 1 1/100 dilution of 642 mouse monoclonal antibodies to NAMPT (sc-166946, Santa Cruz Biotechnology) a 643 poly (ADP-ribose) (ALX-804-220; Enzo Life Sciences) followed by 1/100 dilution of 644 biotinylated secondary antibody followed by ImmunoCruz® goat ABC Staining System 645 (sc-2023, Santa Cruz Biotechnology) according to manufacturer’s recommendations. 646 Finally, after DAB staining solution was added, sections were dehydrated, cleared and 647 mounted in Neo-Mount. No staining was observed when primary antibody was omitted. 648 Sections were finally examined under a Leica microscope equipped with a digital 649 camera Leica DFC 280, and the photographs were processed with Leica QWin Pro 650 software. 651 652 Human organotypic 3D models 653 Insert transwells (Sigma-Aldrich MCHT12H48) were seeded with 105 human 654 foreskin keratinocytes (Ker-CT, ATCC CRL-4048) on the transwells in 300 µL CnT-PR 655 medium (CellnTec) in a 12 well format. After 48 hours, cultures were switched to CnT- 656 PR-3D medium (CELLnTEC) for 24 hours and then cultured at the air-liquid interface 657 for 17 days. From day 12 to 17 of the air-liquid interphase culture, the Th17 cytokines 658 IL17A (30 ng/mL) and IL22 (30 ng/mL) were added (Smits et al., 2017).

659 Pharmacological treatments were applied from day 14 to 17 and consisted of 100 µM 660 apocynin, 100 µM FK-866, 100 µM olaparib, 10 µM N-Phenylmaleimide and 1 µM 661 ATRA. Culture medium was refreshed every two days. At day 17, the tissues were 662 harvested for gene expression analysis and immunohistochemistry. 663 664 Statistical analysis 665 Data were analyzed by analysis of variance (ANOVA) and a Tukey multiple 666 range test to determine differences between groups with gaussian data distribution 667 (square-root transformation were employed for percentage data). Non-parametric data 668 were analyzed by Kruskal-Wallis test and Dunn's multiple comparisons test. The 669 differences between two samples were analyzed by the Student t-test. The contingency 670 graphs were analyzed by the Chi-square (and Fisher’s exact) test. 671 672 Conflict of interest 673 A patent for the use of parthanatos inhibitors to treat psoriasis and atopic 674 dermatitis has been registered by Universidad de Murcia and Instituto Murciano de 675 Investigación Biosanitaria (#PCT/EP2020/083380). 676 677 Acknowledgments 678 We warmly thank I. Fuentes and P. Martínez for their excellent technical 679 assistance and the staff of the Dermatology Service of the University Hospital Virgen de 680 la Arrixaca for patient blood collection. We also thank Profs. S.A. Renshaw and P. 681 Crosier for the zebrafish lines. This work was supported by the Spanish Ministry of 682 Science, Innovation and Universities (grants BIO2014-52655-R and BIO2017-84702-R 683 to VM and PI13/0234 to MLC, and PhD fellowship to FJMN), all co-funded with 684 Fondos Europeos de Desarrollo Regional/European Regional Development Funds), 685 Fundación Séneca-Murcia (grants 20793/PI/18 to VM and 19400/PI/14 to MLC) and the 686 University of Murcia (postdoctoral contracts to ABPO and DGM, and PhD fellowship 687 to FJMM). The funders had no role in the study design, data collection and analysis, 688 decision to publish, or preparation of the manuscript. 689 690 Author contributions 691 VM conceived the study; FJMM, JCS, ABPO, DGM and VM designed the 692 research; FJMM, JCS, FJMN, IC, IMV, JA, JH, ALM, ABPO and DGM performed the

693 research; FJMM, JCS, FJMN, IC, IMV, JA, JH, ALM, TMM, RCV, JL, MH, JCB, 694 AGA, MLC, ABPO, DGM and VM analyzed the data; and FJMM and VM wrote the 695 manuscript with minor contributions from other authors. 696 697 References 698 699 Amsterdam, A., S. Burgess, G. Golling, W. Chen, Z. Sun, K. Townsend, S. Farrington, M. 700 Haldi, and N. Hopkins. 1999. A large-scale insertional mutagenesis screen in zebrafish. 701 Genes Dev 13:2713-2724. 702 Atkuri, K.R., J.J. Mantovani, L.A. Herzenberg, and L.A. Herzenberg. 2007. N-Acetylcysteine-- 703 a safe antidote for cysteine/glutathione deficiency. Curr Opin Pharmacol 7:355-359. 704 Borska, L., J. Kremlacek, C. Andrys, J. Krejsek, K. Hamakova, P. Borsky, V. Palicka, V. 705 Rehacek, A. Malkova, and Z. Fiala. 2017. Systemic Inflammation, Oxidative Damage 706 to Nucleic Acids, and Metabolic Syndrome in the Pathogenesis of Psoriasis. Int J Mol 707 Sci 18: 708 Brinkman, E.K., T. Chen, M. Amendola, and B. van Steensel. 2014. Easy quantitative 709 assessment of genome editing by sequence trace decomposition. Nucleic Acids Res 710 42:e168. 711 Busso, N., M. Karababa, M. Nobile, A. Rolaz, F. Van Gool, M. Galli, O. Leo, A. So, and T. De 712 Smedt. 2008. Pharmacological inhibition of nicotinamide 713 phosphoribosyltransferase/visfatin enzymatic activity identifies a new inflammatory 714 pathway linked to NAD. PLoS One 3:e2267. 715 Candel, S., S. de Oliveira, A. López-Muñoz, D. García-Moreno, R. Espin-Palazón, S.D. 716 Tyrkalska, M.L. Cayuela, S.A. Renshaw, R. Corbalán-Vélez, I. Vidal-Abarca, H.-J. 717 Tsai, J. Meseguer, M.P. Sepulcre, and V. Mulero. 2014. Tnfa signaling through Tnfr2 718 protects skin against oxidative stress–induced inflammation. PLoS Biol 12:e1001855. 719 Canto, C., K.J. Menzies, and J. Auwerx. 2015. NAD(+) Metabolism and the Control of Energy 720 Homeostasis: A Balancing Act between Mitochondria and the Nucleus. Cell Metab 721 22:31-53. 722 Carney, T.J., S. von der Hardt, C. Sonntag, A. Amsterdam, J. Topczewski, N. Hopkins, and M. 723 Hammerschmidt. 2007. Inactivation of serine protease Matriptase1a by its inhibitor 724 Hai1 is required for epithelial integrity of the zebrafish epidermis. Development 725 134:3461-3471. 726 Dainichi, T., A. Kitoh, A. Otsuka, S. Nakajima, T. Nomura, D.H. Kaplan, and K. Kabashima. 727 2018. The epithelial immune microenvironment (EIME) in atopic dermatitis and 728 psoriasis. Nat Immunol 19:1286-1298. 729 de Oliveira, S., P. Boudinot, A. Calado, and V. Mulero. 2015. Duox1-derived H2O2 modulates 730 Cxcl8 expression and neutrophil recruitment via JNK/c-JUN/AP-1 signaling and 731 chromatin modifications. J Immunol 194:1523-1533. 732 Dean, O., F. Giorlando, and M. Berk. 2011. N-acetylcysteine in psychiatry: current therapeutic 733 evidence and potential mechanisms of action. J Psychiatry Neurosci 36:78-86. 734 Fatokun, A.A., V.L. Dawson, and T.M. Dawson. 2014. Parthanatos: mitochondrial-linked 735 mechanisms and therapeutic opportunities. British journal of pharmacology 171:2000- 736 2016. 737 Furue, M., and T. Kadono. 2017. "Inflammatory skin march" in atopic dermatitis and psoriasis. 738 Inflamm Res 66:833-842. 739 Galluzzi, L., I. Vitale, S.A. Aaronson, J.M. Abrams, D. Adam, P. Agostinis, E.S. Alnemri, L. 740 Altucci, I. Amelio, D.W. Andrews, M. Annicchiarico-Petruzzelli, A.V. Antonov, E. 741 Arama, E.H. Baehrecke, N.A. Barlev, N.G. Bazan, F. Bernassola, M.J.M. Bertrand, K. 742 Bianchi, M.V. Blagosklonny, K. Blomgren, C. Borner, P. Boya, C. Brenner, M. 743 Campanella, E. Candi, D. Carmona-Gutierrez, F. Cecconi, F.K. Chan, N.S. Chandel,

744 E.H. Cheng, J.E. Chipuk, J.A. Cidlowski, A. Ciechanover, G.M. Cohen, M. Conrad, 745 J.R. Cubillos-Ruiz, P.E. Czabotar, V. D'Angiolella, T.M. Dawson, V.L. Dawson, V. De 746 Laurenzi, R. De Maria, K.M. Debatin, R.J. DeBerardinis, M. Deshmukh, N. Di Daniele, 747 F. Di Virgilio, V.M. Dixit, S.J. Dixon, C.S. Duckett, B.D. Dynlacht, W.S. El-Deiry, 748 J.W. Elrod, G.M. Fimia, S. Fulda, A.J. Garcia-Saez, A.D. Garg, C. Garrido, E. 749 Gavathiotis, P. Golstein, E. Gottlieb, D.R. Green, L.A. Greene, H. Gronemeyer, A. 750 Gross, G. Hajnoczky, J.M. Hardwick, I.S. Harris, M.O. Hengartner, C. Hetz, H. Ichijo, 751 M. Jaattela, B. Joseph, P.J. Jost, P.P. Juin, W.J. Kaiser, M. Karin, T. Kaufmann, O. 752 Kepp, A. Kimchi, R.N. Kitsis, D.J. Klionsky, R.A. Knight, S. Kumar, S.W. Lee, J.J. 753 Lemasters, B. Levine, A. Linkermann, S.A. Lipton, R.A. Lockshin, C. Lopez-Otin, 754 S.W. Lowe, T. Luedde, E. Lugli, M. MacFarlane, F. Madeo, M. Malewicz, W. Malorni, 755 G. Manic, J.C. Marine, S.J. Martin, J.C. Martinou, J.P. Medema, P. Mehlen, P. Meier, 756 S. Melino, E.A. Miao, J.D. Molkentin, U.M. Moll, C. Munoz-Pinedo, S. Nagata, G. 757 Nunez, A. Oberst, M. Oren, M. Overholtzer, M. Pagano, T. Panaretakis, M. Pasparakis, 758 J.M. Penninger, D.M. Pereira, S. Pervaiz, M.E. Peter, M. Piacentini, P. Pinton, J.H.M. 759 Prehn, H. Puthalakath, G.A. Rabinovich, M. Rehm, R. Rizzuto, C.M.P. Rodrigues, D.C. 760 Rubinsztein, T. Rudel, K.M. Ryan, E. Sayan, L. Scorrano, F. Shao, Y. Shi, J. Silke, 761 H.U. Simon, A. Sistigu, B.R. Stockwell, A. Strasser, G. Szabadkai, S.W.G. Tait, D. 762 Tang, N. Tavernarakis, A. Thorburn, Y. Tsujimoto, B. Turk, T. Vanden Berghe, P. 763 Vandenabeele, M.G. Vander Heiden, A. Villunger, H.W. Virgin, K.H. Vousden, D. 764 Vucic, E.F. Wagner, H. Walczak, D. Wallach, Y. Wang, J.A. Wells, W. Wood, J. Yuan, 765 Z. Zakeri, B. Zhivotovsky, L. Zitvogel, G. Melino, and G. Kroemer. 2018. Molecular 766 mechanisms of cell death: recommendations of the Nomenclature Committee on Cell 767 Death 2018. Cell Death Differ 25:486-541. 768 Garten, A., S. Schuster, M. Penke, T. Gorski, T. de Giorgis, and W. Kiess. 2015. Physiological 769 and pathophysiological roles of NAMPT and NAD metabolism. Nat Rev Endocrinol 770 11:535-546. 771 Gasparro, F.P. 2000. The role of PUVA in the treatment of psoriasis. Photobiology issues 772 related to skin cancer incidence. Am J Clin Dermatol 1:337-348. 773 Gerner, R.R., V. Klepsch, S. Macheiner, K. Arnhard, T.E. Adolph, C. Grander, V. Wieser, A. 774 Pfister, P. Moser, N. Hermann-Kleiter, G. Baier, H. Oberacher, H. Tilg, and A.R. 775 Moschen. 2018. NAD metabolism fuels human and mouse intestinal inflammation. Gut 776 67:1813-1823. 777 Greaves, M.W., and G.D. Weinstein. 1995. Treatment of psoriasis. N Engl J Med 332:581-588. 778 Greb, J.E., A.M. Goldminz, J.T. Elder, M.G. Lebwohl, D.D. Gladman, J.J. Wu, N.N. Mehta, 779 A.Y. Finlay, and A.B. Gottlieb. 2016. Psoriasis. Nat Rev Dis Primers 2:16082. 780 Guttman-Yassky, E., and J.G. Krueger. 2017. Atopic dermatitis and psoriasis: two different 781 immune diseases or one spectrum? Curr Opin Immunol 48:68-73. 782 Haffner, C.D., J.D. Becherer, E.E. Boros, R. Cadilla, T. Carpenter, D. Cowan, D.N. Deaton, Y. 783 Guo, W. Harrington, B.R. Henke, M.R. Jeune, I. Kaldor, N. Milliken, K.G. Petrov, F. 784 Preugschat, C. Schulte, B.G. Shearer, T. Shearer, T.L. Smalley, Jr., E.L. Stewart, J.D. 785 Stuart, and J.C. Ulrich. 2015. Discovery, Synthesis, and Biological Evaluation of 786 Thiazoloquin(az)olin(on)es as Potent CD38 Inhibitors. J Med Chem 58:3548-3571. 787 Hall, C., M.V. Flores, T. Storm, K. Crosier, and P. Crosier. 2007. The zebrafish lysozyme C 788 promoter drives myeloid-specific expression in transgenic fish. BMC Dev Biol 7:42. 789 Hasmann, M., and I. Schemainda. 2003. FK866, a highly specific noncompetitive inhibitor of 790 nicotinamide phosphoribosyltransferase, represents a novel mechanism for induction of 791 tumor cell apoptosis. Cancer research 63:7436-7442. 792 Hatzold, J., F. Beleggia, H. Herzig, J. Altmuller, P. Nurnberg, W. Bloch, B. Wollnik, and M. 793 Hammerschmidt. 2016. Tumor suppression in basal keratinocytes via dual non-cell- 794 autonomous functions of a Na,K-ATPase beta subunit. Elife 5: 795 Houtkooper, R.H., C. Canto, R.J. Wanders, and J. Auwerx. 2010. The secret life of NAD+: an 796 old metabolite controlling new metabolic signaling pathways. Endocrine reviews 797 31:194-223.

798 Kanther, M., X. Sun, M. Muhlbauer, L.C. Mackey, E.J. Flynn, 3rd, M. Bagnat, C. Jobin, and 799 J.F. Rawls. 2011. Microbial colonization induces dynamic temporal and spatial patterns 800 of NF-kappaB activation in the zebrafish digestive tract. Gastroenterology 141:197- 801 207. 802 Kastelan, M., L. Prpic-Massari, and I. Brajac. 2009. Apoptosis in psoriasis. Acta 803 Dermatovenerol Croat 17:182-186. 804 Kukolj, E., T. Kaufmann, A.E. Dick, R. Zeillinger, D.W. Gerlich, and D. Slade. 2017. PARP 805 inhibition causes premature loss of cohesion in cancer cells. Oncotarget 8:103931- 806 103951. 807 Kunze, F.A., and M.O. Hottiger. 2019. Regulating Immunity via ADP-Ribosylation: 808 Therapeutic Implications and Beyond. Trends Immunol 40:159-173. 809 Laporte, M., P. Galand, D. Fokan, C. de Graef, and M. Heenen. 2000. Apoptosis in established 810 and healing psoriasis. Dermatology 200:314-316. 811 LeBert, D.C., J.M. Squirrell, J. Rindy, E. Broadbridge, Y. Lui, A. Zakrzewska, K.W. Eliceiri, 812 A.H. Meijer, and A. Huttenlocher. 2015. Matrix metalloproteinase 9 modulates collagen 813 matrices and wound repair. Development 142:2136-2146. 814 Liang, Y., C. Chang, and Q. Lu. 2016. The Genetics and Epigenetics of Atopic Dermatitis- 815 Filaggrin and Other Polymorphisms. Clin Rev Allergy Immunol 51:315-328. 816 Lin, X., and T. Huang. 2016. Oxidative stress in psoriasis and potential therapeutic use of 817 antioxidants. Free Radic Res 50:585-595. 818 Mathias, J.R., M.E. Dodd, K.B. Walters, J. Rhodes, J.P. Kanki, A.T. Look, and A. Huttenlocher. 819 2007. Live imaging of chronic inflammation caused by mutation of zebrafish Hai1. J 820 Cell Sci 120:3372-3383. 821 Mesko, B., S. Poliska, A. Szegedi, Z. Szekanecz, K. Palatka, M. Papp, and L. Nagy. 2010. 822 Peripheral blood gene expression patterns discriminate among chronic inflammatory 823 diseases and healthy controls and identify novel targets. BMC Med Genomics 3:15. 824 Mustafa, A.G., M.A. Bani-Ahmad, A.Q. Jaradat, and M.Z. Allouh. 2015. Tempol protects blood 825 proteins and lipids against peroxynitrite-mediated oxidative damage. Exp Biol Med 826 (Maywood) 240:109-112. 827 Napper, A.D., J. Hixon, T. McDonagh, K. Keavey, J.F. Pons, J. Barker, W.T. Yau, P. 828 Amouzegh, A. Flegg, E. Hamelin, R.J. Thomas, M. Kates, S. Jones, M.A. Navia, J.O. 829 Saunders, P.S. DiStefano, and R. Curtis. 2005. Discovery of indoles as potent and 830 selective inhibitors of the deacetylase SIRT1. J Med Chem 48:8045-8054. 831 Nemati, H., R. Khodarahmi, M. Sadeghi, A. Ebrahimi, M. Rezaei, and A. Vaisi-Raygani. 2014. 832 Antioxidant status in patients with psoriasis. Cell Biochem Funct 32:268-273. 833 Nesic, K., M. Wakefield, O. Kondrashova, C.L. Scott, and I.A. McNeish. 2018. Targeting DNA 834 repair: the genome as a potential biomarker. J Pathol 244:586-597. 835 Ni, R., T. Cao, S. Xiong, J. Ma, G.C. Fan, J.C. Lacefield, Y. Lu, S. Le Tissier, and T. Peng. 836 2016. Therapeutic inhibition of mitochondrial reactive oxygen species with mito- 837 TEMPO reduces diabetic cardiomyopathy. Free Radic Biol Med 90:12-23. 838 Niethammer, P., C. Grabher, A.T. Look, and T.J. Mitchison. 2009. A tissue-scale gradient of 839 hydrogen peroxide mediates rapid wound detection in zebrafish. Nature 459:996-999. 840 Nikiforov, A., V. Kulikova, and M. Ziegler. 2015. The human NAD metabolome: Functions, 841 metabolism and compartmentalization. Crit Rev Biochem Mol Biol 50:284-297. 842 Pu, X., Z. Wang, and J.E. Klaunig. 2015. Alkaline Comet Assay for Assessing DNA Damage in 843 Individual Cells. Curr Protoc Toxicol 65:3 12 11-13 12 11. 844 Qi, H., B.D. Price, and T.A. Day. 2019. Multiple Roles for Mono- and Poly(ADP-Ribose) in 845 Regulating Stress Responses. Trends Genet 35:159-172. 846 Rajman, L., K. Chwalek, and D.A. Sinclair. 2018. Therapeutic Potential of NAD-Boosting 847 Molecules: The In Vivo Evidence. Cell Metab 27:529-547. 848 Sales, K.U., A. Masedunskas, A.L. Bey, A.L. Rasmussen, R. Weigert, K. List, R. Szabo, P.A. 849 Overbeek, and T.H. Bugge. 2010. Matriptase initiates activation of epidermal pro- 850 kallikrein and disease onset in a mouse model of Netherton syndrome. Nat Genet 851 42:676-683.

852 Sarri, C.A., A. Roussaki-Schulze, Y. Vasilopoulos, E. Zafiriou, A. Patsatsi, C. Stamatis, P. 853 Gidarokosta, D. Sotiriadis, T. Sarafidou, and Z. Mamuris. 2017. Netherton Syndrome: 854 A Genotype-Phenotype Review. Mol Diagn Ther 21:137-152. 855 Schreiber, V., F. Dantzer, J.C. Ame, and G. de Murcia. 2006. Poly(ADP-ribose): novel 856 functions for an old molecule. Nat Rev Mol Cell Biol 7:517-528. 857 Smits, J.P.H., H. Niehues, G. Rikken, I. van Vlijmen-Willems, G. van de Zande, P. Zeeuwen, J. 858 Schalkwijk, and E.H. van den Bogaard. 2017. Immortalized N/TERT keratinocytes as 859 an alternative cell source in 3D human epidermal models. Sci Rep 7:11838. 860 Susin, S.A., N. Zamzami, M. Castedo, T. Hirsch, P. Marchetti, A. Macho, E. Daugas, M. 861 Geuskens, and G. Kroemer. 1996. Bcl-2 inhibits the mitochondrial release of an 862 apoptogenic protease. J Exp Med 184:1331-1341. 863 Wang, Y., R. An, G.K. Umanah, H. Park, K. Nambiar, S.M. Eacker, B. Kim, L. Bao, M.M. 864 Harraz, C. Chang, R. Chen, J.E. Wang, T.I. Kam, J.S. Jeong, Z. Xie, S. Neifert, J. Qian, 865 S.A. Andrabi, S. Blackshaw, H. Zhu, H. Song, G.L. Ming, V.L. Dawson, and T.M. 866 Dawson. 2016. A nuclease that mediates cell death induced by DNA damage and 867 poly(ADP-ribose) polymerase-1. Science 354: 868 Webb, A.E., W. Driever, and D. Kimelman. 2008. psoriasis regulates epidermal development in 869 zebrafish. Dev Dyn 237:1153-1164. 870 Weidinger, S., L.A. Beck, T. Bieber, K. Kabashima, and A.D. Irvine. 2018. Atopic dermatitis. 871 Nat Rev Dis Primers 4:1. 872 Westerfield, M. 2000. The Zebrafish Book. A Guide for the Laboratory Use of Zebrafish 873 Danio* (Brachydanio) rerio. . University of Oregon Press., Eugene, OR. 874

Skin H O release (auf) N e u tro p h ils o u t o f th e C H T (% ) 2 2 S k in H O re le a s e (a u f) 2 4 6 8 0 0 1 1 2 2

2 2 D B F 0 0 0 0 0 0 0 1 1 2 2 ...... 0 5 0 5 0 5 ...... D 0 5 0 5 0 5 multiple Each production every or intensity channel) mediated 50 ( percentage treated Figure D M

brightfield M S D S O M O absence

* S µM 0 0 bioRxiv preprint . * O .2

1 * preprint (whichwasnotcertifiedbypeerreview)istheauthor/funder,whohasgrantedbioRxivalicensetodisplayin

* 5 dot

N * m 0 * *

group m A M . * * 2 M * for M 1 * 5 of *

N * range N * . m in of 1 * represents * m A 0 (D)

A M NAD * * .

M D 5 48 * of (L) D *

acetyl embryos of lyz and 0 m + + are .1 0 M .5 N 100 m hours : and test neutrophils m M dsRED

and M doi: +

red M 1 N shown - metabolites 1 m pentafluorobenzene . M m https://doi.org/10.1101/2021.02.19.431942 µM NAM

*p≤ M r channel) treated with epresentative one zebrafish FK 0 (J) . - 05 perpetuity. Itismadeavailableundera and /NMN NAD - . 866 out , Neutrophil with G C 0.25 0.25 E 0.25 0.25 ****p≤ of 0.5 0.5 0.1 0.1 DMSO DMSO DMSO NAD NAD 1 1 1 NAD NAD NAD NMN NMN t NAM NAM regulate he mM mM mM + of mM was mM mM mM lyz mM mM - larvae metabolites increasing mediated + + + + + mean the : merge dsRED assayed 0 . 0001 CHT sulphonyl of distribution skin ± images every S zebrafish . (F) Brightfield . doses E in (I) oxidative Green Redand Green Redand or . M induction embryos Representative group FK . ; (green fluorescein of for this versionpostedFebruary22,2021. and Redand - in A 866 FK larvae each CC-BY 4.0Internationallicense are zebrafish stress channel channel - 866 by and channel treated of shown group of bath ( H red 1 solution and every 2 , images O 10 embryos immersion channel) with (E, 2 is inflammation and in shown group G) the NAD for ( . 100 brightfield NFKB of zebrafish

of Skin H O release (auf) . 2 2 are 1 0 0 1 1 M u s c le N F K B a c tiv ity (a u f) µM) N e u tro p h ils o u t o f th e C H T (% ) M u s c le N F K B a c tiv ity (a u f) P + 1 1 . . . . 0 1 2 3 4 5 and

2 H K 0 5 0 5 3 . L I 0 5 0 5 lyz

0 hour ( D

values D

0 D M shown D dpf

M The copyrightholderforthis M M . S activity S : 25 O S S O (H) images dsRED . O O . * (A) * , treated * and Quantification *

. 1 1 0 skin * 1 N were µ µ * Additionally, . M (C) A

* µ M 5 Embryos

* M D * F * F * green * was

* * * K + F * K * obtained . and zebrafish 1

1 *

. * -

0 K * 1 1 * 0 - 8 *

0 * 8 µ *

Representative

* For with -

calculated µ 6 * M m 8

K µ * 6 M 6 M * 6 6 M

- determined

8 * 6 1 * 1

6 1 * 0 channel) 1 1 0 H 0

6 0 * 0 0

µ 0 * mM FK

M 0 µ of 2 µ M

O M  at M larvae - 2 the of 24 866 ) imaging, 72 using (B) fluorescence hpf influence of M hpf by (K), J . of + merge nfkb

were NAD 1 mM DMSO Representative 100 10 1 DMSO . quantification one every (B quantification embryos : - - eGFP M) way manually of images Brightfield group NAD Quantification intensity Green Redand ANOVA zebrafish were + are and Greenand (green of in dechorionated merge of fluorescence the incubated shown for and skin channel larvae presence channel and NAD images Tukey of H (M) 2 red the O of in + - 2 . ,

FK-866 (µM) FK-866 100 µM A B G H BF and Green channel

Brightfield and Red channel )

**** +/+

)

( f

**** * * * * u

3 T +/+

a * * * * * * * * * * * * * * H

( **** ****

DMSO 8 0

a h

DMSO t

e 2

6 0

t 2

u 4 0

2 1

- s

10 l

- 2 0

n i

- p

/ k

- o

mM r

S 0

t 0 1

- u + - - - - + M M M spint1a / e /+ + µ µ µ 50 + N + a 0 0 0 (µM) 866 a N A D 1 m M 1 1 5 0 - t 1 spint1a

1 t NAD in n p bioRxiv preprint doi: https://doi.org/10.1101/2021.02.19.431942FK ; this version posted February 22, i2021. The copyright holder for this s FK-866 p F K -8 6 6 1 0  M preprint (which was not certified by peer review) is the author/funder, who has granted bioRxivs a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. s p in t1 a -/- spint1a -/- 100 866 10 µM 10 866 - FK C D I J

Brightfield and Red channel

)

(

)

+/+

T u

H 30 Green channel

80 ** a

(

**** *** **** ***

y e

DMSO

h t

60 v

f t

20 +/+

a t

40 u

B DMSO

s 10

l i

20 -

10 N

/ / -

k r

t 0 0 S u - e + M M M /+ / µ µ + FK-866 10 M

µ spint1a N

50 FK-866 + spint1a a 0 0 0 a 1 1 5 0 t1 t 1 (µM) 866 10 µM - n in i spint1a -/- p p s FK-866 FK s spint1a -/- 100

E F )

g  / 0.12

Brightfield channel Brightfield and Red channel M ** **

i 

c ** **

(

f 0.10

e t 30 **** **** D

a 0.08 A

+/+

r 0.06

& g

g +

a 0.04

D e

DMSO

t y

N 0.02

c 10

a t

n 0.00

i o

/ t

- T a O M M O M M r 0 S  S 

e m m

M 0 1 M 0 + 1 K /+ D 1 + D 1 + FK-866 10 M 6 6 a 6 D 6 D t1 spint1a -8 A -8 A n N N i spint1a -/- 866 K K p - F F s 10 µM 10 FK spint1a +/+ spint1a -/-

Figure 2. Pharmacological inhibition of Nampt alleviates stress and skin inflammation in Spint1a-deficient larvae. (A)

Quantification of skin H2O2 production in wild type and Spint1a-deficient zebrafish larvae treated with FK-866 (0, 10, 50 and 100 µM). (B) Representative merge images (brightfield and green channel) of zebrafish larvae of every group are shown. The white arrow indicates

a keratinocyte aggregate where H2O2 release was high. (C) Neutrophil distribution of wild type and Spint1a-deficient zebrafish larvae treated with increasing doses of FK-866. (D) Representative merge images (brightfield and red channel) of lyz:dsRED zebrafish larvae of every group are shown. (E) Number of keratinocyte aggregates in the tail skin of larvae treated with 10 µM FK-866 (F) Detailed representative merge images (brightfield and red channel) of the tail of wild type and Spint1a-deficient larvae treated with vehicle (DMSO) or 10 µM FK-866. Black arrows indicate keratinocyte aggregates and immune cell recruitment presents in non-treated spint1a- deficient skin. (G) Neutrophil distribution of zebrafish embryos treated with 1 mM NAD+ in the presence or absence of 10 µM FK-866. (H) Representative merge images (brightfield and red channels) of lyz:dsRED zebrafish larvae of every group are shown. (I) Quantification of fluorescence intensity of wild type and spint1a mutant embryos treated with 10 µM FK-866. (J) Representative images (green channel) of NF-kB:eGFP zebrafish larvae of every group are shown. (K) Wild type and Spint1a-deficient larvae of 72 hpf treated for 48 h with 10 µM FK-866 and 1 mM NAD+ were used for total NAD+ and NADH determination by ELISA. Each dot represents one individual and the mean ± S.E.M. for each group is also shown. P values were calculated using one-way ANOVA and Tukey multiple range test .**p≤0.01, ***p≤0.001, ****p≤0.0001.

A B

)

% ( Brightfield and Red channel T * * * *

H 8 0 * * * * * * * *

e +/+

h 6 0

t DMSO

4 0

s l

i 2 0 h

- p

/ o

- r bioRxiv preprint doi: https://doi.org/10.1101/2021.02.19.431942t 0 ; this version postedGMX1778 February 22, 2021. The copyright holder for this preprint (which was not certifiedu by peer review)- is the author/funder, who has granted bioRxiv a license to display the preprint in e /+ M M +   100 µM N perpetuity.a It is made available under aCC-BY 4.0 International license. 1 0 0 t 0 1 spint1a in 1 6 p 8 6 s 7 8 7 - FK-866 1 K X F M 10 µM G s p in t1 a -/-

)

(

H 8 0 * * *

e E

h 6 0

f o

Brightfield and Red channel

t 4 0

s crRNA l

- i

2 0 / -

h Std

o r

t 0

u crRNA spint1a

e d t /b

N S ta nampta/b p m a n

c rR N A

s p in t1 a -/-

Figure S1, related to Figure 2. Genetic and pharmacological inhibition of Nampt alleviates skin inflammation and restores epithelial integrity in spint1a –deficient larvae. (A) Neutrophil distribution of wild type and Spint1a-deficient larvae treated with the pharmacological inhibitors of Nampt GMX1778 and FK-866. (B) Representative merge images (brightfield and red channels) of lyz:dsRED zebrafish larvae of every group are shown. (C) For genetic inhibition using CRISPR/Cas9 technology, one-cell stage zebrafish eggs were microinjected and imaging was performed in 3 dpf larvae (D). Quantification of the percentage of neutrophils out of the CHT in Spint1a-deficient larvae upon knockdown of Nampta/Namptb. (E) Representative merge images (brightfield and red channel) of lyz:dsRED zebrafish larvae of every group are shown (F) Agarose gel electrophoresis of namptb and nampta DNA genomic fragments (arrows) derived from Cas9 in vitro digestion in presence or absence of specific namptb or nampta crRNA. Each dot represents one individual and the mean ± S.E.M. for each group is also shown. P values were calculated using one-way ANOVA and Tukey multiple range test. ***p≤0.001, ****p≤0.0001.

) A B E F

(

)

f Green channel T

u 2 0 H

6 0 a * * * *

(

C * * * * * * * *

Brightfield and Red channel

y * * * * * *

e i +/+

h 1 5

f 4 0 c

o DMSO

+/+

t 1 0

u o

DMSO K

s 2 0

l 5

- h

- n /

/ i

- p

- k

o 0 MT

r S

t 0 + - 100 u - NAC / M M e M + µ n /+ 0 µM

µ spint1a a 0 spint1a N + 100 1 0 0 0 t 1 1 a 0 n 1 1 i T T t µM p T in C s M p A 100 s bioRxivN preprint doi: https://doi.org/10.1101/2021.02.19.431942; this version posted February 22, 2021. The copyrights p in t1 a holder-/- for this nM preprints p in t(which1 a -/- was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

C D G H

)

(

Brightfield and Red channel

T T

H 80 H 80 **** C **** ****

Brightfield and Red channel

**** ** e e

+/+

h h

t 60

f o

DMSO +/+

t t 40

40 u u

o DMSO

i i -

20 - 20 h /

/ h -

- p

p MT

r t

0 100 t 0 u

- u - e + M M µM e /+ M Apocynin spint1a /  spint1a

N n  + N + a 0 0 a 0 250 µM 1 0 0 T 1 5 t 1 1 t 2 in T T in p 100 p in s M s n nM y c spint1a -/- o p A spint1a -/- I

J L

)

(

( K T M

T ****

H 80 H 80 ****

*** Brightfield and Red channel C

h h

t 60 t 60 crRNA

Brightfield and Red channel

o o

Std

t 40 crRNA u

40 - u -

/ o

- Std

l l

crRNA i

i 20 20

h h

nox1 p

p crRNA

o o spint1a

spint1a

r t

0 t 0 nox4

u u

e 1 5 d e 4

t x x crRNA td x N S o o N S o n n nox5 n crRNA crRNA spint1a -/- spint1a -/-

Figure 3. NADPH oxidase-derived ROS promote skin inflammation in Spint1a-deficient larvae. Quantification of neutrophil dispersion out of CHT of wild type and Spint1a-deficient embryos treated with 100 µM N-acetylcysteine (NAC) (A), 100 µM mito- TEMPO (MT) and 100 nM tempol (C), 250 µM apocynin (G), or upon genetic inactivation of nox1 and nox5 (I, J) and nox4 (I, M) with CRISPR/Cas9. Representative merge images (brightfield and red channels) of lyz:dsRED zebrafish larvae of every group are shown (B, D, F, H, K, M). Determination of NFKB transcriptional activity in the skin of embryos treated with MT and T (E) and representative images (green channel) of nfkb:eGFP zebrafish larvae of every group (F). Each dot represents one individual and the mean ± S.E.M. for each group is also shown. P values were calculated using one-way ANOVA and Tukey multiple range test. ns, not significant, **p≤0.01, ****p≤0.0001.

i A B

e 25 Brightfield channel Brightfield and Red channel

t **** ****

a g

20 +/+

r g

g 15

t 10 DMSO

y c

o 5

n i

- t /

- a

r 0 e - K /+ M + µ 0 a spint1a 1 0 NAC t 1 in C 100 µM p A s N bioRxiv preprint doi: https://doi.org/10.1101/2021.02.19.431942; this version posted February 22, 2021. The copyright holder for this preprint (which was not certified by peer review)sp iisn tthe1a -author/funder,/- who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

C D Brightfield channel Brightfield and Red channel

c o

+/+

e 40 **** t

a **** **** g

e 30

r DMSO

g a

y c

o 10 n

- i

/ t

- a

r 0 MT e - K + M M 100 µM /  n + a 0 0 spint1a 1 0 0 t 1 1 in T T p s M Tempol

spint1a -/- 100 nM i

c E F

e 40 t **** ****

a Brightfield channel Brightfield and Red channel g

e 30 r

+/+

g a

e t

y DMSO c

o 10

i t

- a

/ r

0 - e - K /+ M +  a 0 t1 5 2 spint1a in Apocynin p in s n 250 µM y c o p A spint1a -/-

G H

c o

f **** Brightfield channel Brightfield and Red channel

e 40

t ****

a g

e 30 crRNA r

g Std

g a

e t -

/ y

- c

o 10 crRNA

n i

t nox1

a r

0 spint1a e

K 1 5 td x x S o o n n crRNA crRNA nox5 spint1a -/-

i I J

o f

****

e 40

a g

e 30

r Brightfield channel Brightfield and Red channel

g a

20 crRNA

e t - / y Std

- c

o 10

a r

0 crRNA spint1a e

K 4 td x nox4 S o n crRNA spint1a -/- Figure S2, related to Figure 3. ROS scavenging and inhibition of NADPH-oxidases rescue skin neutrophil recruitment and skin morphological alterations of Spint1-deficient larvae. Quantification of keratinocyte aggregation foci in the tail of lyz:dsRED larvae shown in Figure 3 (A, C, E, G, I) and detailed representative merge images (brightfield and red channel) (B, D, F, H, J) upon their treatment with with vehicle (DMSO), 100 µM N-acetylcysteine (NAC) (A, B), 100 µM mito-TEMPO (MT) and 100 nM tempol (T) (C, D), 250 µM apocynin (E, F), or upon genetic inhibition of nox1 and nox5 (G, H), and nox4 (I, J). A nox1

B nox4

C nox5

Figure S3, related to Figure 3. Efficiency of crRNA for nox1, nox4 and nox5. Analysis of genome editing efficiency in larvae injected with control or nox1 (A), nox4 (B) and nox5 (C) crRNA/Cas9 complexes and quantification rate of non-homologous end-joining mediated repair (NHEJ) showing all insertions and deletions (INDELs) (https://tide.deskgen.com/).

A B E F

)

(

T T * * * * Brightfield and Red channel

H 8 0

* * * * * * * * H 8 0 * * * * * * * *

Brightfield and Red channel e

h h

6 0 6 0 +/+

t DMSO

4 0 +/+ 4 0

DMSO s

l i

i 2 0 2 0

h h -

p p /

/ o -

r t

r 0 0 t

u Veliparib

- u - e + M M e + M / µ µ / µ N + 500 µM N + Olaparib 0 1 spint1a 0 a 0 spint1a a 0 t1 5 ib 1 100 µM r t 1 in b n i a i ib p r p p r s a o Talazoparib s a ip z bioRxiv preprint doi: https://doi.org/10.1101/2021.02.19.431942; this version posted February 22, 2021.l The copyrighta holder for this p e l a a 1 µM preprintl (which was not certified by peer review) is the author/funder, who has granted bioRxiv a licenseV toT display the preprint in O perpetuity. It is made available under aCC-BY 4.0 International license.

C s p in t1 a -/- D J s p in t1 a -/- K

)

m u

2 0  a

* * * * * * * /

( s 6 0

l * * * * *

t e

i Green channel DMSO Olaparib 100 µM

1 5 c

i +

t 4 5 100 µm

a E 1 0

+/+ N

B 3 0

T F DMSO (

h 1 5

i a

k e 0 /

d S

0 - l + l / M - µ e + /+ M

a 0 C +  0 t1 a 0 1 Olaparib spint1a 0 in t1 ib 1 p r 100 µM in s ib a p r p s a spint1a +/+ spint1a -/- la p O la O s p in t1 a -/- s p in t1 a -/-

G H ) I

2 DMSO FK-866 10 µM Olaparib 100 µM m

 * * * * /

s 2 5 0 * * * * * * * *

e c

2 0 0

+ U

d 1 5 0

B (

1 0 0

o i

t 5 0

e f

i 0

l o

r - /+ M M spint1a +/+ spint1a -/- P +   a 0 0 1 1 0 t 1 6 in 6 ib p 8 r s - a K p F la O

s p in t1 a -/- ) L 2 m N

 **** /

s ** l l 300

e **** **** 1 0

)

. c

**** ******** * * *

. x

a 8

(

200 t

2 n

H 6



(

o 4

e 100

l a

i 2

m T

a 0 d

A - - M M M M + - N     / M +  D 0 0 0 0 1 0 1 0 a 0 1 1 0 6 6 t1 6 b 6 b 1 8 i 8 i in - r - r ib K a K a p r F p F p s a la la p O O la O spint1a +/+ spint1a -/- M s p in t1 a -/- DMSO FK-866 10 µM Olaparib 100 µM DMSO FK-866 10 µM Olaparib 100 µM

spint1a +/+ spint1a -/- Figure 4. Pharmacological inhibition of Nampt and Parp1 alleviates skin oxidative stress and inflammation, and keratinocyte cell death, hyperproliferation and DNA damage in Spint1a-deficient larvae. Analysis of neutrophil distribution (A, E) and NFKB transcriptional activity in the skin (C) of wild type and Spint1a-deficient larvae larvae treated with olaparib (A, C), and veliparib or talazoparib (E). Representative images (brightfield and red channel in B, F; green channel in D) of lyz:dsRED and nfkb:eGFP zebrafish larvae of every group are shown. Determination of BrdU positive cells from 48 hpf wild type and Spint1a-deficient zebrafish larvae treated for 24 hours with 10 µM FK-866 or 100 µM olaparib (G, H). Representative merge images maximum intensity projection of a confocal Z stack from zebrafish larvae of every group are shown (I). WIHC with anti-BrdU (green), anti-p63 (red, basal keratinocyte marker) were counterstained with DAPI (blue). Quantification of TUNEL positive cells from 48 hpf wild type and Spint1a-deficient zebrafish larvae treated for 24 hours with 100 µM Olaparib (J). Representative images of zebrafish larvae of every group are shown (K). Quantification of pH2Ax positive cells from 48 hpf wild type and Spint1a-mutant zebrafish larvae treated for 24 hours with 10 µM FK-866 or 100 µM olaparib (L). Similarly, around 60 zebrafish tail folds (red boxed area) were amputated and disaggregated into cells for comet assay analysis in alkaline conditions (N). Representative merge images of maximum intensity projection of an apotome Z stack from zebrafish larvae of every group are shown (M). WIHC with anti-pH2Ax (green), anti-P63 (basal keratinocyte marker, red) were counterstained with DAPI (blue). Scale bars, 100 µm. Each dot represents one individual. The mean ± S.E.M. (A-L) and median (N) for each group is shown. P values were calculated using one-way ANOVA and Tukey multiple range test (A-L) and Kruskal-Wallis test and Dunn's multiple comparisons test (N). *p≤0.05, **p≤0.01, ***p≤0.001, ****p≤0.0001. i

c A B

o f

4 0 e

t * * * * * * * * Brightfield channel Brightfield and Red channel

g e

3 0 +/+

g a

2 0

e t

y DMSO

c 1 0

i t

- a

/ r 0 - e - K + M / µ + a 0 1 0 t 1 Olaparib spint1a n i ib p r s a 100 µM p la O bioRxiv preprint doi: https://doi.org/10.1101/2021.02.19.431942s p in t1 a -/- ; this version posted February 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in

perpetuity. It is made available under aCC-BY 4.0 International license.

)

i c

% C D E

(

e 40

t ****

H 80 ****

g e

e 30 Brightfield channel Brightfield and Red channel

r h

t 60

20 t crRNA

40 e

t u

- y

o Std

- s

o 10

l i

20 n

a r o 0

spint1a

r e

t 0 crRNA K u d 1 t p e d 1 r parp1 t p S a

N r S a p p crRNA crRNA spint1a -/- spint1a -/- F

parp1

G H spint1a +/+ spint1a -/- 1 2 3 4

181.8 181.8

115.5 115.5 82.2 82.2 64.2 PAR PAR 64.2 48.8 1. spint1a +/+ -

48.8 / 37.1 2. Olaparib 100 µM - 37.1 3. FK-866 10 µM 25.9 25.9 4. - 19.4 19.4 spint1a

64.2 64.2 48.8 β-Actin 48.8 β-Actin

Figure S4, related to Figure 4. Genetic and pharmacological inhibition of Nampt and Parp1 diminishes PARylation, skin inflammation and restores epithelial integrity in Spint1a-deficient larvae. (A, B) Quantification of keratinocyte aggregates and detailed representative merge images (brightfield and red channels) of wild type and Spint1a-deficient zebrafish treated with vehicle (DMSO) or 100 µM olaparib shown in Figure 4A. (C-E) Neutrophil distribution (C) and keratinocyte aggregates (D) of Spint1a-deficient larvae injected with control or parp1 crRNA/Cas9 complexes. Representative images are shown in E. (F) Analysis of genome editing efficiency in larvae injected with control or parp1 crRNA/Cas9 complexes and quantification rate of non-homologous end-joining mediated repair (NHEJ) showing all insertions and deletions (INDELs) (https://tide.deskgen.com/). (G, H) Western blots with anti-PAR and anti-β-actin of tail fold (red boxed area) lysates from 3 dpf wild type and Spint1a-deficient zebrafish larvae treated for 48 hours with 10 µM FK-866 or 100 µM olaparib. Each dot represents one individual and the mean ± S.E.M. for each group is also shown. P values were calculated using one-way ANOVA and Tukey multiple range test. ns, not significant, **p≤0.01, ****p≤0.0001 (C). Representative merge images (brightfield and red channel) of lyz:dsRED zebrafish larvae of every group are shown (D). A

B C Brightfield channel bioRxiv preprint) doi: https://doi.org/10.1101/2021.02.19.431942; this version posted February 22, 2021. The copyright holder for this

preprint (which% was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in

(

t perpetuity. It is made available under aCC-BY 4.0 International license. 1 2 5 S tro n g

n * * * * e * * * * * M e d iu m +/+

m 1 0 0 s M ild s DMSO e 7 5

s N o p h e n o ty p e

s a

5 0

p y

t 2 5 o

- n / -

e 0 h - FK-866 P /+ M M   + 50 µM a 0 0 1 5 0 b 6 1 1 atp1b1a 6 ib tp 8 r a - a K p F la Olaparib O 100 µM a tp 1 b 1 a -/-

Figure S5, related to Figures 2 and 4. FK-866 and olaparib improve skin epithelial integrity in psoriasis mutants. Determination of the skin phenotype of 2.5 dpf zebrafish Atp1b1a-deficient larvae treated 1.5 days with 50 µM FK-866 or 100 µM olaparib (A, B). Representative bright field images of zebrafish larvae of every group are shown (C). P values were calculated using Chi-square and Fisher´s exact test *p≤0.05, ****p≤0.0001.

A B C

) 2

d 3

e 

v DMSO FK-866 10 µM Olaparib 100 µM

s l

e 2

(

+ s

i 1

s a

p 0

a A

C -1

- /+ M M   + a 0 0 0 t1 1 1 in 6 6 ib p 8 r s - a K p F bioRxiv preprint doi: https://doi.org/10.1101/2021.02.19.431942; this versionla posted February 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, whoO has granted bioRxiv a licensespint1a to display+/+ the preprint in spint1a -/- perpetuity. It is made available under asCC-BYp in t1 a 4.0 -/- International license. D G

E F ) H I

)

(

( T

Brightfield and Red channel T

H 8 0 * * * * H 80 C

**** ****

h e 6 0

t Brightfield and Red channel

+/+ f

t 60

t crRNA

DMSO 4 0 -

t u /

40 Std -

s l

s i

/ 2 0 l

- i 20 h crRNA

spint1a

p p

o aifm1

r o

t 0 r

t 0 u

NP 10 spint1a u - e td 1 e + M m nM N S / n if N + a 0 a 1 1 t P in c rR N A p N s spint1a -/- s p in t1 a -/- J

K L

)

(

H 8 0 * * * * C

Brightfield and Red channel e

h 6 0

f o

GFP t -

4 0 / u

s l

i 2 0 h spint1a

p Parga

o r

t 0 u

e P a F g

N r G a P s p in t1 a -/-

Figure 5. Inhibition of parthanatos rescues skin inflammation of Spint1a-deficient larvae. Quantification of cleaved caspase 3 positive cells from 48 hpf wild type and Spint1a-deficient larvae treated for 24 hours with 10 μM FK-866 or 100 μM Olaparib (A, B). Representative merge images of maximum intensity projection of an apotome Z stack from zebrafish larvae of every group are shown (C). WIHC with anti-cleaved Casp3 (green), anti-P63 (basal keratinocyte marker, red) were counterstained with DAPI (blue) (C). Pharmacological and genetic inhibition experimental settings (D, G). Quantification of the percentage of neutrophils out of the CHT in embryos treated with 10 nM NP (Aifm1 translocation inhibitor) (E), aifm1 genetic inhibition (H) and parga mRNA overexpression (K). Representative merge images (brightfield and red channels) of lyz:dsRED zebrafish larvae of every group are shown (F, I, L). For mRNA overexpression, one-cell stage zebrafish eggs were microinjected and imaging was performed in 3dpf larvae (J). Each dot represents one individual and the mean ± S.E.M. for each group is also shown. P values were calculated using one-way ANOVA and Tukey multiple range test. ns, not significant, ****p≤0.0001.

i A B

o f 3 0

e * * * * * * * Brightfield channel Brightfield and Red channel

a g

+/+

e r

g 2 0

e DMSO t

y 1 0

c o

- n

/ i

t a

r 0 e - K /+ M + n NP spint1a 0 a 1 10 nM bioRxiv preprint doi: https://doi.org/10.1101/2021.02.19.431942t1 ; this version posted February 22, 2021. The copyright holder for this n P preprint (which was not certifiedi by peer review) isN the author/funder, who has granted bioRxiv a license to display the preprint in p sperpetuity. It is made available under aCC-BY 4.0 International license.

s p in t1 a -/- i

c C D

e 50 ****

t a

g 40

e r

g Brightfield channel Brightfield and Red channel

g 30

e crRNA t

20 -

/ y

Std - c

o 10

i t

crRNA spint1a a

r 0 aifm1 e

K d 1 t m S if a crRNA spint1a -/-

E aifm1

F G

o f ****

e 25

t a

g 20 Brightfield channel Brightfield and Red channel

r g

g 15

a GFP

/ e -

t 10

y c

o 5 n

spint1a i

t Parga a

r 0 e

K P a F rg G a P spint1a -/-

Figure S6, related to Figure 5. Inhibition of parthanatos rescues morphological skin alterrations of Spint1a-deficient larvae. Quantification of keratinocyte aggregates (A, C, F) and detailed representative merge images (brightfield and red channels) (B, D, G) of wild type and Spint1a-deficient larvae treated with vehicle (DMSO) or 10 nM N-phenylmaleimide (NP) (A, B), aifm1 genetic inhibition (C, D) and parga mRNA overexpression (F, G) of zebrafish larvae shown in Figure 5. Analysis of genome editing efficiency or larvae injected with control or aifm1 crRNA/Cas9 complexes and quantification rate of non-homologous end-joining mediated repair (NHEJ) showing all insertions and deletions (INDELs) (https://tide.deskgen.com/) (E). A

B Inflammatory markers C Differentiation markers

n 0.20 ns

n 10 0 **** ****

o **** 0 ****

n n

i 10 ns

o 10 ns

s B

**** **** **** i

**** i

s B

s -1

s T 8 s s 10

0.15 T

e s

s -1

B r

10 e

e r

T -2

A p

p 10

/ C

6 p

e A

0.10 e -2 -3

P 10 10

bioRxiv preprint doi: https://doi.org/10.1101/2021.02.19.431942B ; this version posted February 22, 2021. The copyright holder for this

e G

4 e

M v

v -4

L O

preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in v

v E

i 10

L t

0.05 t -3

D a

N perpetuity. It is made available under aCC-BY 4.0 International license1. 0

a l l 2

l -5 l

e 10

0.00 0 10 -4 10 -6 l l l O l O o H ro M M o O M M ro M M tr O t S  u tr S   t S   n T n M 0 1 n M 0 1 n M 0 1 E o D 0 o D 0 o D 0 o C 1 A C 1 A C 1 A C R R n R in T in T i T n n A n A IL17 + IL22 y A y y c c c o o o p p p A A A IL17 + IL22 IL17 + IL22 IL17 + IL22

*n**s* ns** **** **** **** **** ns

**** **** 0 ns 0 ns

n n

n **

5 40 n 10 **** **** 10 **** ***

o o **** **** **** o

o ns

i i

i ****

s B

B **** -1 -1

s s

4 s 10

T 10

B T

30 B

C r

A -2

p p

p -2

C A

3 / 10 10

e e

20 e

A B R -3

G -3

e e

2 0 10 10

t t 1 10

D -4

a a

a -4

l l

1 l 10 10

0 0 10 -5 10 -5 l l l l o H M O M M M o H M O M M M o H M O M M M o H M O M M M tr O  S    tr O  S    tr O  S    tr O  S    n T 0 0 0 1 n T 0 T n T 0 0 0 1 M 0 M 0 1 n 0 M 0 0 1 E M o E 1 D 0 0 A o E 1 D 0 0 A o E 1 D 0 0 o 1 D 0 0 A C P 1 1 C P 1 1 C 1 1 A C P 1 1 6 b R 6 b R P 6 b R 6 b R N 6 ri T N 6 ri T N 6 ri T N 6 ri T 8 a A 8 a A 8 a A 8 a A K p K p K p K p F la F la F la F la O O O O IL17 + IL22 IL17 + IL22 IL17 + IL22 IL17 + IL22

D E

Figure 6. Reduction of pathology-associated genes expression in human psoriatic epidermis organoids by inhibition of NADPH oxidases/NAMPT/PARP/AIFM1 axis, and robust increase of NAMPT protein amount and PARylation in lesional skin from psoriasis patients. (A-C) Transcript levels of the indicated genes encoding inflammation (B) and differentiation (C) markers were determined in human organotypic 3D skin models pre-treated with 30 ng/ml IL17A and IL22 in the presence of vehicles (ETOH and DMSO) or the indicated inhibitors. The mean ± S.E.M. for each group is shown. The results are representative of 3 independent experiments. P values were calculated using one-way ANOVA and Tukey multiple range test. ****p≤0.0001, *****p ≤0.00001. (C, D). Representative images of sections from healthy and psoriatic skin biopsies that have been immunostained with an anti-NAMPT monoclonal antibody (E) or anti-poly (ADP-ribose) monoclonal antibody (F) and then slightly counterstained with hematoxilin. Scale bar is 40 µm in E and 100 µm and 50 µm in left and right panels, respectively, in F. CL, Cornified layer; SL, Spinous layer; D, dermis. bioRxiv preprint doi: https://doi.org/10.1101/2021.02.19.431942; this version posted February 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

NAD+ Salvage pathway

de novo biosynthesis

Preiss-Handler pathway

NAD+-consuming enzymes

PAR hydrolases

Figure S7, related to Figure 6. NAD+ and PAR metabolic pathways. NAM, NMN and NAD+ can be taken up by specific transporters . NAD+ biosynthetic pathways generate NAD+ from different precursors, de novo pathway employs dietary tryptophan (Trp) or alternatively quinolinic acid (QA), NAD+ Salvage pathway mainly uses nicotinamide (NAM) but nicotinamide mononucleotide (NMN) and nicotinamide riboside (NR) can also act as precursors. However, Preiss-Handler pathway utilizes nicotinic acid (NA). NAD+ is consumed by CD38 yielding NAM and adenosine diphosphoribose (ADPR) or cyclic ADPR (cADPR). NNMT also reduces NAD+ pool mediating the reaction between NAM and S-adenosylmethionine (SAM) to produce N-methylnicotinamide (1-MNA) and S-adenosylhomocysteine (SAH). Finally, PARP1 synthesizes PAR by using NAD+ as a cofactor. PAR is degraded to ADPR mediated by different PAR hydrolases which cleave specific chemical linkages (exo- or endoglycosidically). Metabolic intermediates: N-formylkynurenine (NFK), nicotinic acid adenine dinucleotide (NAAD) and nicotinic acid mononucleotide (NAMN). NAD+ transporter: connexin 43 (CX43). bioRxiv preprint multiple individual (GEO) and Figure preprint (whichwasnotcertifiedbypeerreview)istheauthor/funder,whohasgrantedbioRxivalicensetodisplayin

atopic + S database de novo biosynthesis NAD Salvage pathway range 8 , and doi: related dermatitis ID O 1 tra n s c rip tio n le v e l N A M P T tra n s c rip tio n le v e l https://doi.org/10.1101/2021.02.19.431942

- test

0 t he . Non (A) mean to perpetuity. Itismadeavailableundera - Figure lesional and . Transcriptomic ± + t

S NAD -consuming enzymes - Preiss-Handler pathway

* Test .

* E 6

. NRK1 transcription level . and - -

* M 1 0 Differential 0 0 1

* . . . . . (B) 0 5 0 0 5 .

* N A P R T tra n s c rip tio n le v e l *

C D 3 8 tra n s c rip tio n le v e l - - -

* 1 1 0 0 0 1 1 for

0 lesional

* ......

. . 5 0 5 0 5 0 5

0 ns, each Healthy data not group psoriasis expression ; significant this versionpostedFebruary22,2021. from * * skin * * CC-BY 4.0Internationallicense *

* *

* is *

* N M N A T 3 tra n s c rip tio n le v e l

human T D O 2 tra n s c rip tio n le v e l

- *

* *

0 also *

* skin

0 *

* . * Non

* profiles *p≤ *

* shown were psoriasis - 0 lesional lesional skin . 05 . , compared of **p≤

* P Psoriasis

* genes

* values N R K 2 tra n s c rip tio n le v e l

* (

* GDS

NNMT transcription level *

. 0

- -

* N A D S Y N 1 tra n s c rip tio n le v e l

0 1

1 1 0 0 .

- .

0 01

. .

. . . .

5 0 5 0

5 0

. encoding The copyrightholderforthis

0 4602 , with were Lesional skin ***p≤ )

* heathy calculated

* samples

* 0 key . 001

* skin NAD ,

Q P R T tra n s c rip tio n le v e l *

****p≤ P N P tra n s c rip tio n le v e l

- - -

0 from

1 2 3

3 2 1 0

n using

s samples

* +

* metabolic the 0 one . 0001 Gene . - way Each .

* enzymes

* Expression

* ANOVA

* dot

* represents in and psoriasis Omnibus Tukey one dermatitis Figure significant for lesional bioRxiv preprint each preprint (whichwasnotcertifiedbypeerreview)istheauthor/funder,whohasgrantedbioRxivalicensetodisplayin S and group 9 , . . related *p≤ PAR hydrolases Parthanatos components Transcriptomic lesional is doi: 0 A R H 1 tra n s c rip tio n le v e l .

- 05

0 also P A R P 1 tra n s c rip tio n le v e l https://doi.org/10.1101/2021.02.19.431942

- -

0 0

0 to ,

. .

2 4

4 2

0 **p≤ psoriasis shown Figure perpetuity. Itismadeavailableundera 0 . 01 data . P 6 skin , . ***p≤ values

* Differential from

* were N U D T 1 6 tra n s c rip tio n le v e l M A C R O D 2 tra n s c rip tio n le v e l

- - -

1 2 3

3 2 1 0

. 0

* human were

* .

* 001

* compared

* , Healthy calculated ****p≤ expression psoriasis

* ;

* this versionpostedFebruary22,2021.

* with skin

* 0

* . CC-BY 4.0Internationallicense

0001 A R H 3 tra n s c rip tio n le v e l

* using

0 ( * A IF M 1 tra n s c rip tio n le v e l

* heathy

. GDS

* profiles

0 . Non one 4602 skin - - lesional skin way of )

* samples samples

* genes

* ANOVA

* Psoriasis

* E N P P 1 tra n s c rip tio n le v e l T A R G 1 tra n s c rip tio n le v e l *

* encoding

* . from .

* Each

* The copyrightholderforthis and Lesional skin the dot Tukey parthanatos

* Gene represents

* multiple

Expression MACROD1 transcription level

0 0 M IF tra n s c rip tio n le v e l

0 one components range individual Omnibus test

* (A)

* in and

* (GEO)

* and

* psoriasis

* t he t - Test mean database (B) and ± . S ns, . atopic . Non E . not M - . bioRxiv preprint doi: https://doi.org/10.1101/2021.02.19.431942; this version posted February 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

Figure 7. Model showing that hyperactivation of Parp1 in response to ROS-induced DNA damage, and fuelled by NAMPT- derived NAD+, mediates inflammation through parthanatos. The inhibitors used are depicted in red. bioRxiv preprint doi: https://doi.org/10.1101/2021.02.19.431942; this version posted February 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

Table S1. Compounds used in this study.

Compound Concentrations Commercial branch Catalog number Target 1 µM FK-866 (Daporinad) 10 µM Selleckchem S2799 NAMPT 100 µM 1 µM GMX1778 (CHS828) 10 µM Selleckchem S8117 NAMPT 100 µM 1 µM 10 µM 100 µM Olaparib Selleckchem S1060 PARPs 250 µM 500 µM 1 mM 1 µM 10 µM 100 µM 250 µM Veliparib Sigma-Aldrich S1004 PARPs 500 µM 1 mM 250 mM 500 mM 100 nM 1 µM Talazoparib Sigma-Aldrich S7048 PARPs 10 µM 100 µM bioRxiv preprint doi: https://doi.org/10.1101/2021.02.19.431942; this version posted February 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

100nM 1 µM ALX-430-081- Tempol 10 µM Enzo Life Sciences ROS G001 100 µM 1 mM 1 µM 10 µM ALX-430-150- Mito-Tempo 100 µM Enzo Life Sciences Mitochondrial ROS M005 250 µM 1 mM 10nM 100nM 1 µM Santa Cruz N-Phenylmaleimide (NP) sc-250486 AIFM1 translocation 10 µM Biotechnology 100 µM 1 mM 1 µM 10 µM Apocynin 100 µM TOCRIS 4663 NADPH oxidases 250 µM 500 µM 1 µM 10 µM N-Acetyl-cysteine (NAC) Sigma-Aldrich A9165 ROS 100 µM 1 mM 1 µM 78C 5387630001 CD38 10 µM Merck bioRxiv preprint doi: https://doi.org/10.1101/2021.02.19.431942; this version posted February 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

100 µM 1 µM EX 527 (Selisistat) 10 µM Selleckchem S1541 Sirtuin 1 100 µM 1mM Sigma-Aldrich Nicotinamide (NAM) 100 µM N0636 N/A 1mM Sigma-Aldrich Nicotine mononucleotide (NMN) 100 µM N3501 N/A 1mM Nicotinamide adenine dinucleotide 500 µM Sigma-Aldrich N3014 N/A (NAD) 250 µM