Molecular Phylogeny and Classification of The

ARTICLE IN PRESS

Protist, Vol. ], ]]]–]]], ]] ]]]] http://www.elsevier.de/protis Published online date 10 December 2009

ORIGINAL PAPER

Molecular Phylogeny and Classiﬁcation of the Mamiellophyceae class. nov. (Chlorophyta) based on Sequence Comparisons of the Nuclear- and Plastid-encoded rRNA Operons

Birger Marin1, and Michael Melkonian

Biowissenschaftliches Zentrum, Botanisches Institut, Lehrstuhl I, Universitat¨ zu Koln,¨ Otto-Fischer-Str. 6, 50674 Koln,¨ Germany

Submitted August 10, 2009; Accepted October 19, 2009 Monitoring Editor: David Moreira

Molecular phylogenetic analyses of the Mamiellophyceae classis nova, a ubiquitous group of largely picoplanktonic green algae comprising scaly and non-scaly prasinophyte unicells, were performed using single and concatenated gene sequence comparisons of the nuclear- and plastid-encoded rRNA operons. The study resolved all major clades within the class, identified molecular signature sequences for most clades through an exhaustive search for non-homoplasious synapomorphies [Marin et al. (2003): Protist 154: 99-145] and incorporated these signatures into the diagnoses of two novel orders, Monomastigales ord nov., Dolichomastigales ord. nov., and four novel families, Monomastigaceae fam. nov., Dolichomastigaceae fam. nov., Crustomastigaceae fam. nov., and Bathycoccaceae fam. nov., within a revised classification of the class. A database search for the presence of environmental rDNA sequences in the Monomastigales and Dolichomastigales identified an unexpectedly large genetic diversity of Monomastigales confined to freshwater, a novel clade (Dolicho_B) in the Dolichomastigaceae from deep sea sediments and a novel freshwater clade in the Crustomastigaceae. The Mamiellophyceae represent one of the ecologically most successful groups of eukaryotic, photosynthetic picoplankters in marine and likely also freshwater environments. & 2009 Elsevier GmbH. All rights reserved.

Key words: prasinophytes; SSU rDNA; LSU rDNA; ITS2; systematics; freshwater; Monomastigales; Dolichomastigales; Mamiellales; Monomastigaceae; Dolichomastigaceae; Crustomastigaceae; Bathycoccaceae.

Introduction

The prasinophytes or scaly green flagellates have pioneer Irene Manton (Manton and Parke 1960; attracted the attention of protistologists and review: Sym and Pienaar 1993). Other small, phycologists ever since their major attribute, the essentially dorsiventral uni- or biflagellate green ‘‘garniture’’ of organic scales on cell and flagellar algae from both fresh- and seawater habitats surfaces, was discovered by electron microscopy lacking scales altogether or displaying cell surface structures not resembling prasinophyte scales (e.g. 1Corresponding author; fax: +49 221 470 5181 Monomastix, Pedinomonas tuberculata) were initi- e-mail [email protected] (B. Marin). ally combined with asymmetrical (dorsiventral)

Please cite this article as: Marin B; Melkonian M. Molecular Phylogeny and Classiﬁcation of the Mamiellophyceae class. nov. (Chlorophyta) based on Sequence Comparisons of the Nuclear- and Plastid-encoded rRNA Operons, Protist (2009), doi:10.1016/j.protis.2009.10.002 ARTICLE IN PRESS

2 B. Marin and M. Melkonian scaly green flagellates within a class separate from 1998; Karol et al. 2001; Lemieux et al. 2007; Marin the prasinophytes, the Loxophyceae (Christensen and Melkonian 1999; Melkonian et al. 1995; 1962), which later was emended to include only the Rodrı´guez-Ezpeleta et al. 2007). While the three genera, Monomastix, Pedinomonas, and Loxophyceae sensu Moestrup (1982) were soon Scourfieldia (Moestrup 1982). While a consider- abandoned (Moestrup 1991; Moestrup and able body of knowledge has accumulated on the Throndsen 1988), and two of its three structure, biogenesis and chemical composition of genera, Pedinomonas and Scourfieldia distributed prasinophyte scales over time (e.g. Becker et al. into different classes (Pedinophyceae and 1994; Wustman et al. 2004), their functional and Prasinophyceae, respectively; Moestrup 1991), thus evolutionary significance has, for the most Monomastix remained in limbo. Only very recently part, eluded us. Interest in prasinophytes, never- has the phylogenetic position of Monomastix and theless, gained momentum also among plant Pedinomonas been studied by molecular meth- scientists, when Pickett-Heaps (1968) and Turner ods, and Monomastix shown to be affiliated with (1968) described scales, structurally identical to a the Mamiellales, an order of marine, mostly scale type (small, square-shaped underlayer picoplanktonic prasinophytes (Turmel et al. scales) previously found in several prasinophytes, 2009a), whereas Pedinomonas, based on a on the flagellar surface of the spermatozoids of plastid-encoded multigene data set, was surpris- Chara and Nitella, i.e. in stoneworts (Charales), a ingly positioned in the Trebouxiophyceae, nested group of macroscopic, multicellular green algae, within the Chlorellales (Turmel et al. 2009b). that had been and still are, often regarded as the With the advent of molecular analyses of green likely sister group of the embryophyte land plants algal phylogeny in the early 1990s, it was soon (Lewis and McCourt 2004; McCourt et al. 2004). evident that green algae constituted two major Since that time, textbook knowledge holds that groups, previously referred to as Chlorophyta and scaly green flagellates were likely ancestral to all Streptophyta (Bremer 1985) and that the latter other Viridiplantae [small square-shaped scales included the embryophyte land plants thus corro- similar to the ones found in the Charales had also borating the conclusions from ultrastructural ana- been discovered on zoospores of the marine, lyses (for a summary of the early molecular filamentous green algae Trichosarcina and Pseu- phylogenetic data, see Melkonian and Surek dendoclonium by Mattox and Stewart (1973)]. 1995). The prasinophytes (except Mesostigma, When Manton (1965) in her review on phylogenetic see above) formed several early branching, para- aspects of flagellar structure in algae and plants phyletic lineages within the Chlorophyta concluded that ‘‘the fundamental asymmetry of (Steinkotter¨ et al. 1994; Melkonian et al. 1995). the motile cells of land plants points to an By 1998 Nakayama et al. had recognized four anisokont ancestry within the Chlorophyta, for independent lineages in the prasinophytes which which therefore Chlamydomonas is not on the they termed clades I-IV and which roughly direct line’’ (p. 21), scaly and naked asymmetric corresponded to four prasinophyte ‘orders’ infor- green flagellates soon became the focus of mally recognized earlier by Melkonian (1990) as attention for algal electron microscopists during Pyramimonadales (clade I, but excluding Mesos- the 1960s and 1970s in search of the ‘‘primitive tigma), Mamiellales (clade II), Pseudoscourfiel- flagellate’’ (Manton 1965) or the ‘‘Ancestral Green diales (clade III; Pseudoscourfieldia marina CCMP Flagellate’’ (Mattox and Stewart 1984). The search 717 was, however, misidentified and the strain struck gold with the discovery that the freshwater, refers to Nephroselmis pyriformis; Fawley et al. biflagellate, scaly green alga Mesostigma viride 1999), and Chlorodendrales (clade IV; the thecate shared several ultrastructural features (among prasinophyte genera Scherffelia and Tetraselmis). them the presence of a cruciate flagellar root In addition, the coccoid picoplanktonic system with two opposing d-roots that display Pycnococcus provasolii formed an individual proximal MLS structures, the latter hitherto known branch, later shown to form a separate clade only from reproductive cells of charophyte algae (clade V) with Pseudoscourfieldia marina K0017 and embryophyte land plants) with motile cells of (Fawley et al. 2000; in fact, P. marina and P. embryophytes (Melkonian 1983; Rogers et al. provasolii are genetically identical and presumably 1981) suggesting that Mesostigma could be the represent different life history stages of a single earliest offshoot in the evolutionary radiation taxon; unpubl. observations). A sixth clade leading to the embryophyte plants (Melkonian of entirely coccoid prasinophytes comprising 1982), a proposal later corroborated by molecular the genera Prasinococcus (Miyashita et al. 1993) phylogenetic evidence (e.g. Bhattacharya et al. and Prasinoderma (Hasegawa et al. 1996) was

3 Phylogeny and Classification of the Mamiellophyceae class. nov. established by Fawley et al. (2000; see also Potter lyses using these sequences demonstrate that the et al. 1997 and Courties et al. 1998 for initial Monomastigales comprise a group of freshwater studies on members of this clade); finally an Mamiellophyceae that is genetically at least as additional coccoid prasinophyte (strain CCMP1205) diverse as their marine counterpart, the Mamiel- formed another independent branch in the prasi- lales. In the Dolichomastigales, family Crustomas- nophyte radiation (Fawley et al. 2000). With the tigaceae, phylogenetic analyses of environmental addition of these novel clades, the previously well- sequences of nuclear-encoded SSU rDNA identi- supported paraphyletic branching order of prasi- fied the first freshwater lineage in this order. nophyte lineages as revealed by SSU rDNA sequence comparisons (Nakayama et al.1998) Results collapsed. In a comprehensive phylogenetic analysis including both cultured strains as well as Revisions sequences from environmental clone libraries, Guillou et al. (2004) identified a novel clade (clade Mamiellophyceae Marin et Melkonian classis VII), that, in addition to the coccoid CCMP1205 nova (subclade A) contained also the genus Picocystis Diagnosis: Algae eukaryoticae, aquatiles. Cel- (Lewin et al. 2000; subclade C) and two environ- lulae plerumque solitariae, flagella duo (aequalita mental sequences from the Equatorial Pacific ad subaequalita aut inaequalita), vel flagellum (subclade B). The internal branching order of unicum, vel nullum flagellum. Chloroplastus uni- nearly all prasinophyte clades (except for clade cus, duibus membranis circumcinctus, chloro- IV, Chlorodendrales), however, remained unre- phyllis a et b, persaepe cum prasinoxanthin. solved in SSU rDNA sequence comparisons Cellulae interdum cum duis chloroplastis. Stigma (Guillou et al. 2004). Recent studies on the genetic postice positum, aut stigma nullum. Cellulae et/vel diversity of picoplanktonic green algae in the flagella squamis in 1-2 strata dispositis vestita, vel Mediterranean Sea using viridiplant-targeted pri- sine squamis. Squamae complanatae, rotundatae mers for clone library constructions uncovered ad ellipticae, plerumque similis reticulo araneo additional genetic diversity within picoplanktonic ornatae cum costis concentricis, vel uniformiter prasinophytes (Viprey et al. 2008) identifying yet reticulatae. Cellulae et flagella sine strato interioro two more novel clades (clades VIII and IX). All ex parvulis squamis quadratis. Algae plerumque clades (except clade VII) were well supported habitantes aqua marina, set etiam aqua dulcis. (although only 887 positions were used in the Par primum helicis E23_12 in 18S rRNA nuclei est alignment of the SSU rDNA) but resolution among G-U vice A-U. clades was non-existent stressing the importance Eukaryotic algae, growing in water. Cells usually of large data sets and a balanced taxon sampling solitary, with 2 flagella (equal to subequal, or in phylogenetic studies of prasinophytes. unequal), or a single flagellum, or lacking a In this contribution, we analyzed the molecular flagellum. A single chloroplast, surrounded by phylogeny of one of the ecologically most impor- two membranes, with chlorophylls a and b, nearly tant groups of marine picoeukaryotes, the Mamiel- always with prasinoxanthin. Cells sometimes with lales (clade II) (Not et al. 2004, 2008; Worden 2006; two chloroplasts. Eyespot posterior, or lacking. Worden et al. 2004; review: Vaulot et al. 2008)by Cells and/or flagella covered by scales in 1-2 sequence comparisons of nuclear- and plastid- layers, or without scales. Scales flattened, encoded genes of the rDNA operon. We included rounded to elliptical, mostly ornamented like a four strains of the freshwater genus Monomastix spider web with concentric ribs, or uniformly (with its type species M. opisthostigma) in the reticulate. Cells and flagella lacking an inner layer analysis and show that this genus represents the of small square scales. Algae predominantly earliest divergence in the lineage that is now inhabiting marine water, but also freshwater. The described as the Mamiellophyceae classis nova. first pair of Helix E23_12 in the nuclear 18S rRNA The orders Monomastigales and Dolichomasti- is G-U instead of A-U. gales (with new families Dolichomastigaceae and Mamiellales Moestrup 1984, Nord. J. Bot. 4: Crustomastigaceae) and the family Bathycocca- p. 112 emend. Marin et Melkonian ceae (Mamiellales) are newly established. Further- Emended diagnosis: Unicellular algae, living in more, we identify, targeting plastid-encoded SSU marine habitats. Cell dimensions about 0.5-7 mm, rDNA in the databases, environmental sequences cells with 1 or 2 flagella, or without flagella. of Monomastigales that originate from a wide Covered with spider web scales, composed of range of freshwater habitats. Phylogenetic ana- concentric and radiating ribs, or without scaly

4 B. Marin and M. Melkonian covering. Chloroplasts with prasinoxanthin, micro- Lys. ITS2 nuclei cum helice additicia inserta inter monal, and Unidentified M1 (Latasa et al. 2004; helices 3 et 4. Zingone et al. 2002). Unique molecular synapomor- Cells small, solitary or not, spherical or elliptical, phies: spacer between Helices E23_13 and E23_14 about 0.5-2.5 mm in size, without eyespot. Flagella (reverse strands) in the nuclear 18S rRNA comprising and basal bodies absent. Cells either covered by 8 (usually UUGGUCUC) instead of 9 nucleotides; spider-web scales arranged in a single layer, or single stranded nucleotide nt 890 in Helix H885 of the without scales. 23S rRNA of chloroplasts with plastid-encoded 16S rRNA is U instead of G; base a unique signature in the third position of pair 1005/1138 within Helix H1005 of plastid- the terminal loop of Helix D16 [H946: nt 958]: encoded 23S rRNA is U-A instead of C-G; amino C instead of U. Amino acid 14 of RuBisCO (large acid 340 of RuBisCO (large subunit) is Asn instead subunit) is Gln instead of Lys. Nuclear ITS2 with of Glu. additional helix inserted between helices 3 and 4. Mamiellaceae Moestrup 1984, Nord. J. Bot. 4: Genus typificum (type genus): Bathycoccus p. 112 emend. Marin et Melkonian Eikrem et Throndsen 1990, Phycologia 29: Emended diagnosis: Unicellular flagellates p. 345; Species typificum (type species): with two basal bodies and with one or two Bathycoccus prasinos Eikrem et Throndsen 1990, emergent flagella. Eyespot, if present, located Phycologia 29: p. 345, figs 1-14 (type: fig. 5); opposite to the flagellar insertion, consisting of Authentic strain: SCCAP K-0417. a single layer of globules. Cell dimensions ca. Other genera: Ostreococcus Courties et Chre´ - 1-7 mm. Spider web scales and flagellar hairs tiennot-Dinet 1995 present or absent; lateral T-hairs, if present, with Dolichomastigales Marin et Melkonian ordo two parallel rows of subunits. The second nucleo- novus tide in the internal loop of Helix B12 (reverse Diagnosis: Cellulae solitariae, rotundatae ad strand) in the plastid-encoded 23S rRNA [H235: nt phaseoliformes, magnitudine circiter 1.5-6 mm. 255] is G instead of A. Flagella duo, fere aequalita ad inaequalita, circiter Genus typificum (type genus): Mamiella 10-30 mm longae, angulum acutatum cum pagina Moestrup 1984, Nord. J. Bot. 4: p. 110; Species cellulae formantes. Chloroplastus cum pyrenoide typificum (type species): Mamiella gilva (Parke et singularis aut sine pyrenoide. Stigma oppositum Rayns) Moestrup 1984,Nord.J.Bot.4:p.110 flagellorum locatum, vel destituum. Pigmentum Basionym: Nephroselmis gilva Parke et Rayns micromonal carens. Cellulae et flagella squamis 1964, J. Mar. Biol. Ass. U.K. 44: pp. 209, 211; arachnoideis tectae, vel crusta obtectae, vel Lectotype (designated here): fig. 1 in Parke and nudae. Squamae cum costis concentricis, sed Rayns (1964); Authentic strain: Plymouth collec- plerumque sine distinctis costis radiantibus. Fla- tion no. 197 gella diversis pilis tecta: breves T-pili laterales, Other genera: Mantoniella Desikachary 1972, T-pili terminales, et pauci Pl-pili limitati ad partem Micromonas Manton et Parke 1960, undescribed basilarem unius ex flagellis. T-pili non capientes prasinophyte strain RCC 391. duo series globulis terminalis. Praecipue in aqua Mantoniella squamata (Manton et Parke) salina, raro in aqua dulcis. Par ultimum helicis 33 Desikachary 1972, Curr. Sc. 41: p. 447 [H939: bp 943/1340] in 16S rRNA chloroplastorum Basionym: Micromonas squamata Manton et est A-U vice U-A. Parke 1960, J. Mar. Biol. Ass. U.K. 39: pp. 293, Cells solitary, rounded to bean-shaped, about 298; Lectotype (designated here): fig. 42 in 1.5-6 mm in size. Two flagella, almost equal to Manton and Parke (1960); Authentic strain: unequal, about 10-30 mm long, forming an acute CCAP 1965/1. angle with the cell surface. Chloroplast with a Bathycoccaceae Marin et Melkonian familia single pyrenoid or without pyrenoid. Stigma nova opposed to the flagella, or lacking. The pigment Diagnosis: Cellulae parvae, solitariae aut micromonal absent. Cells and flagella covered by plures, sphaericae vel ellipsoideae, magnitudine spider-web scales, covered by a crust, or naked. circiter 0.5-2.5 mm longa, sine stigma. Flagella et Scales with concentric ribs, but usually without corpora basilaria nulla. Cellulae squamis arachnoi- distinct radiating ribs. Flagella covered by various deis in uno strato dispositis vestita, vel sine hairs: short lateral T-hairs, terminal T-hairs, and a squamis. 23S rRNA chloroplastorum cum signo few Pl-hairs confined to the basal part of one singulario in positione tertio in hemicyclo termina- flagellum. T-hairs not containing two rows of lio helicis D16 [H946: nt 958]: C vice U. Aminoa- terminal globular subunits. Mainly in saline water, cidum 14 in RuBisCO (magna parte) est Gln vice rarely in freshwater. The last pair of Helix 33 [H939:

5 Phylogeny and Classiﬁcation of the Mamiellophyceae class. nov.

6 B. Marin and M. Melkonian

bp 943/1340] in the chloroplast-encoded 16S bus. Par secundum helicis 41 in 16S rRNA rRNA is A-U instead of U-A. chloroplasti [H1086: bp 1088/1097] est U-A vice Dolichomastigaceae Marin et Melkonian G-C. familia nova Cells solitary, swimming in freshwater, about Diagnosis: Characteres ordinis; cellulae et 3.5–21 mm long. A single immature (no. 2) flagel- flagella semper squamis arachnoideis tectae, lum accompanied by a mature (no. 1) basal body. chloroplastus cum pyrenoide. Algae marinae. Cells with one chloroplast, or sometimes with two With the characters of the order; cells and chloroplasts. Eyespot posterior, or lacking. Scales flagella always covered by spider-web scales, mainly consisting of protein, flattened, rounded to chloroplast with pyrenoid. Marine algae. elliptical, uniformly reticulate. Cells mostly with Genus typificum (type genus): Dolichomastix trichocysts. The second base pair of Helix 41 in Manton 1977, Phycologia 16: p. 433; Species the plastid-encoded 16S rRNA [H1086: bp 1088/ typificum (type species): Dolichomastix nummu- 1097] is U-A instead of G-C. lifera Manton 1977, Phycologia 16: pp. 433, 434, Monomastigaceae Marin et Melkonian familia figs 1-8 (type: fig 3) nova Crustomastigaceae Marin et Melkonian familia Synonym: Monomastigaceae Huber-Pestalozzi nova 1950, Das Phytoplankton des Sußwassers¨ 3: p. 2 Diagnosis: Characteres ordinis (Dolichomasti- (nomen nudum) gales), cellulae et flagella sine squamis, chloro- Diagnosis: Characteres ordinis (Monomasti- plastus sine pyrenoide. Praecipue in aqua salina, gales). Characters of the order (Monomastigales). raro in aqua dulcis. Genus typificum (type genus): Monomastix Characters of the order (Dolichomastigales); cells Scherffel 1912, Arch. Protistenkd. 27: p. 107; and flagella without scales, chloroplast without Species typificum (type species): Monomastix pyrenoid. Mainly in saline water, rarely in freshwater. opisthostigma Scherffel 1912, Arch. Protistenkd. Genus typificum (type genus): Crustomastix 27: p. 107, pl. 6: figs 1-46, 59 Nakayama, Kawachi et Inouye 2000, Phycologia 39: p. 338; Species typificum (type species): Phylogenetic Analyses Crustomastix didyma Nakayama, Kawachi et Inouye 2000, Phycologia 39: p. 339, fig. 10 For the present study, sequence data of several Monomastigales Marin et Melkonian ordo key taxa were newly generated (taxa in bold in novus Figs 1–3), including the type species and/or type Synonym: Monomastigales Norris 1982, in cultures of Mamiella, Bathycoccus and Monomastix. Parker (ed.) 1982, Synopsis and Classification of Three data sets have been assembled and used for Living Organisms. McGraw-Hill, New York. Vol. 1: phylogenetic analyses: (1) a taxon-rich viridiplant p. 162 (nomen nudum) alignment of nuclear-encoded 18S rRNA gene Diagnosis: Cellulae solitariae, in aqua dulcis sequences, (2) nuclear 5.8S rDNA and ITS2 natantes, circiter 3.5–21 mm longa. Immaturum sequence data of the Mamiellophyceae, and (3) (no. 2) flagellum solitarium maturo (no. 1) corpore an alignment of complete plastid-encoded rRNA basali concomitatum. Cellulae cum chloroplasto operon sequences of 47 Viridiplantae, i.e. four unico, aut interdum cum duis chloroplastis. rRNA/tRNA genes. These data sets have been Stigma postice positum, aut stigma nullum. analyzed separately as well as combined by Squamae praecipue ex proteio constantes, com- maximum likelihood (ML), distance (neighbor planatae, rotundatae ad ellipticae, uniformiter joining; NJ), maximum parsimony (MP) and reticulatae. Cellulae plerumque cum trichocysti- Bayesian inference (BI).

Figure 1. Molecular phylogeny of 105 Viridiplantae using 18S rDNA sequence comparisons, highlighting the new class Mamiellophyceae and related ‘prasinophyte’ green algae. New sequences are in bold; taxon names are combined with strain designations and (for published sequences) accession numbers. Clade designations (clade I-VII) refer to Guillou et al. (2004) and Viprey et al. (2008). Bold branches were maximally supported by all methods (=100/100/100/1.00). An asterisk (n) indicates support from only one of the two parallel runs in the Bayesian analysis. Note that 18S rDNA analyses were uninformative with respect to one of the three orders of the Mamiellophyceae, i.e. the Dolichomastigales, whereas Monomastigales and Mamiellales were signiﬁcantly supported. Intron positions named after Jackson et al. (2002). Nomenclature of Ostreococcus-clades A-D and Micromonas-clades A-E after Rodriguez et al. (2005) and Slapeta et al. (2006).

7 Phylogeny and Classiﬁcation of the Mamiellophyceae class. nov.

Nuclear 18S rDNA. The 18S rDNA alignment Chlorophyceae, and Ulvophyceae (Fig. 1). Three contained 105 Viridiplantae including 32 members clades occupied the base of the Chlorophyta (the of the new class Mamiellophyceae (Fig. 1). This Prasinococcus/Prasinoderma-clade, Pyramimo- gene provided 1683 aligned characters for phylo- nadales, and the Mamiellophyceae), whereas the genetic analyses. Using 11 streptophyte green remaining ‘prasinophyte’ groups appeared as an algae as outgroup, the Chlorophyta formed intermediate divergence i.e. the Pycnococcaceae several basal lineages (often named ‘prasino- (Pseudoscourﬁeldia, Pycnococcus), the Nephro- phytes’), and four classes in a derived position, selmidophyceae, Picocystis, and the coccoid i.e. Chlorodendrophyceae, Trebouxiophyceae, CCMP 1205-clade (Fig. 1). However, relationships

Figure 2. Phylogenetic analysis and secondary structure of ITS2 in the Mamiellophyceae. A. Phylogeny of nuclear 18S rDNA, 5.8S rDNA, and ITS2 sequences of 28 taxa. New sequences are in bold. Note that the tree topology originated from a Bayesian analysis with three predeﬁned data partitions, instead of ML as all other trees shown in this study. Nomenclature of Ostreococcus-clades and Micromonas-clades (A-E) as in Fig. 1; Micromonas clades I-III and V sensu Worden et al. (2009). B. Secondary structure of ITS2 from Bathycoccus prasinos with four universal helices, compared with homologous helices from Ostreococcus strains. An additional helix between helices 3 and 4 is present only in the Bathycoccaceae. Compensatory base changes (CBCs) and ‘hemi-CBCs’ (only one of the paired nucleotides exchanged) are highlighted by bold or thin grey lines. Some regions are not comparable (n.c.), and some pairings are only tentative (dotted lines). C. Position of genes and ITS regions in the nuclear rRNA operon.

8 B. Marin and M. Melkonian among basal chlorophyte lineages were largely (M. opisthostigma), Dolichomastix, Crustomastix, unresolved by 18S rDNA phylogenies (bootstrap and a derived lineage comprising the remaining 5 support generally o80%; Fig. 1). genera, including the type species of Mamiella Three strains of Monomastix formed a well- (M. gilva). Relationships among these subclades supported clade together with 7 genera previously were unresolved by 18S rDNA data (Fig. 1); classiﬁed within the order Mamiellales Moestrup, however, plastid rDNA sequence analyses and i.e. Dolichomastix, Crustomastix, Mamiella, synapomorphy searches revealed Dolichomastix Mantoniella, Micromonas, Bathycoccus, and and Crustomastix as a single lineage (see below). Ostreococcus (Fig. 1). This clade was described Therefore, the class Mamiellophyceae was sub- here as the new class Mamiellophyceae (see divided here into three orders: Monomastigales Revisions). Within the Mamiellophyceae, 18S ord. nov., Dolichomastigales ord. nov., and rDNA analyses resolved four major subclades: Mamiellales (emended; see Revisions). Within the Monomastix spp., including the type species Mamiellales, a basal dichotomy separated the

Figure 3. Phylogeny of the Viridiplantae using complete plastid-encoded rRNA operon sequences. A. Analyses of 47 taxa, revealing Monomastix as the basal divergence of the Mamiellophyceae, and resolving Dolichomastix and Crustomastix as sister taxa, thus classiﬁed as a single order, Dolichomastigales. B. The Monomastix subtree after addition of sequences from the plastid genome of Monomastix sp. OKE-1, which was released during preparation of this manuscript.

9 Phylogeny and Classiﬁcation of the Mamiellophyceae class. nov.

flagellates (=family Mamiellaceae emend.) from a clade of uniflagellate genera (Mantoniella, and non-flagellate taxa (=family Bathycoccaceae fam. Micromonas). Within the genetically diverse genus nov.). The Mamiellaceae received only moderate Micromonas, clade D was sister to clade E and support (ML: 73%), and contained biflagellate clades A+B+C (Fig. 1). The family Bathycocca- taxa that topologically formed two basal diver- ceae comprised two coccoid sister genera, gences (Mamiella, and prasinophyte RCC391) and Bathycoccus and Ostreococcus, the latter

0.05 substitutions/site 66/54 Pseudendoclonium akinetum UTEX 1912 -/0.99 Acrosiphonia sp. SAG 127.80 Ulvophyceae 100/97/95/1.00 16 Ignatius tetrasporus UTEX 2012 Oltmannsiellopsis viridis NIES-360 97/67/85/1.00 Chlamydomonas reinhardtii CC400 88/98/86/1.00 Chlorophyceae 17 100/97/99/1.00 Lobochlamys segnis SAG 9.83 95/74/73/1.00 Chlamydomonas applanata UTEX 225 (SAG 11-9) Scenedesmus obliquus SAG 276-3a (UTEX 72) + UTEX 393 (SAG 15 Stigeoclonium helveticum UTEX 441 276-6) Tetraselmis striata SAG 41.85 Chlorodendrophyceae Scherffelia dubia SAG 17.86 13 Prototheca wickerhamii SAG 263-11 Trebouxiophyceae Chlorella vulgaris SAG 211-11b (UTEX 259) 100/92 14 86/1.00 Pseudochlorella sp. ('Chlorella ellipsoidea') SAG 211-1a (C87) Picocystis salinarum CCMP 1897 ("SSFB") coccoid green alga CCMP 1205 Pseudoscourfieldia marina SCCAP K-0017 98/69/87/1.00 Nephroselmis olivacea NIES-483 52/82/54/- Nephroselmis rotunda M 0932 Nephroselmidophyceae Nephroselmis astigmatica NIES-252 12 Nephroselmis pyriformis CCMP 717 100/99/94/1.00 Ostreococcus tauri OTTH 0595 (RCC 116/745) 83/76 7 Bathycoccus prasinos SCCAP K-0417 67/1.00 97/81 98/1.00 Micromonas pusilla M 1681 Mamiellophyceae 11 4 Micromonas pusilla CCMP 489 classis nova 99/99/64/1.00 6 Mantoniella squamata CCAP 1965/1 2 92/100/100/1.00 5 Mamiella gilva PLY 197 100/98 89/- 88/1.00 50/1.00 Crustomastix stigmatica CCMP 2493 1 3 Dolichomastix tenuilepis M 1680 97/100/100/0.99 Monomastix sp. M 0722 9 Monomastix minuta NIES-255 86/98 71/1.00 99/99 Monomastix opisthostigma M 2844 99/1.00 Prasinoderma coloniale CCMP 1413 8 Prasinococcus capsulatus CCMP 1202 Pyramimonas olivacea M 1668 Pyramimonadales Sequence data: 60/-/76/0.97 Pyramimonas parkeae CCMP 726 nuclear 18S rRNA gene, and 100/96/99/1.00 Pyramimonas disomata M 1802 plastid-encoded rRNA-operon: Pyramimonas tetrarhynchus SCCAP K-0002 - 16S rRNA gene 10 Cymbomonas tetramitiformis M 1669 - tRNA_Ile gene Mesostigma viride SAG 50-1 streptophyte - tRNA_Ala gene Chlorokybus atmophyticus UTEX 2591 (SAG 48.80) + SAG 34.98 green algae - 23S rRNA gene 100/99/96/1.00 Chaetosphaeridium globosum CCAC 0044 (M 1311) · = 5833 aligned characters; Coleochaete nitellarum SAG 3.91 2876 variable characters Staurastrum punctulatum SAG 679-1 Significances at branches: 100/99 Mesotaenium caldariorum UTEX 41 (SAG 648-1) ML/NJ (both GTR+I+G) 98/1.00 Klebsormidium flaccidum SAG 335-1a (UTEX 321) MP/MrBayes (GTR+I+G Entransia fimbriata UTEX 2353 + covarion) Figure 4. Combined analysis of nuclear 18S rDNA and plastid-encoded rRNA operon sequences from 47 Viridiplantae. All branches concerning the new classiﬁcation of the Mamiellophyceae received high support values by all methods (except for the Dolichomastigales). Encircled numbers indicate 17 clades that have been re-analyzed by smaller partitions, as summarized in Table 1. Note that two apparently well-supported clades, no. 9 and 11, collapsed when non-viridiplant outgroup taxa were added to the data set (see Results and Table 1).

10 B. Marin and M. Melkonian diverged into four genotypes (named clades A-D) Complete plastid-encoded rRNA operon. The with clade D (strain RCC 501) as the basal branch four linked plastid genes encoding 16S rRNA, (Fig. 1). tRNA_Ile (GAU), tRNA_Ala (UGC), and 23S rRNA No introns were observed in the 18S rRNA offered 4150 unambiguously aligned characters genes of the Mamiellophyceae and most other for combined phylogenetic analyses. Phylogenies prasinophytes investigated here; however, two presented here contained 47 Viridiplantae that unrelated strains revealed two rRNA introns per represented all major clades of the Chlorophyta, gene, i.e., Pycnococcus sp. MBIC 10615, and including 11 Mamiellophyceae, and 8 strepto- Nephroselmis rotunda M 0932 (Fig. 1). Two of phyte algae as outgroup. As in Figure 1, the split these introns occurred in unique positions (941 between four derived chlorophyte classes vs. a and 959), which were previously unknown from paraphyletic divergence of prasinophyte groups other eukaryotes (Jackson et al. 2002). was well supported (Fig. 3); however, the branch- ITS2 phylogeny and secondary structure ing order among prasinophyte lineages differed analysis. The internal transcribed spacer 2 from 18S rDNA phylogenies, albeit again without (ITS2) was characterized by very low sequence convincing support. All major prasinophyte clades conservation, but displayed a defined secondary supported by 18S rDNA data were recovered and structure that allowed an ITS2 alignment of confirmed by plastid-encoded rRNA and tRNA 28 Mamiellophyceae (Fig. 2). ITS2 data were genes, and received comparable support (Figs 1 combined with 18S rDNA and 5.8S rDNA and 3). sequences, and analyzed either as a concate- The plastid rRNA operon again recovered the nated ‘supergene’ (ML, NJ, MP), or as three new class Mamiellophyceae as a robust clade, independent partitions (MrBayes; Fig. 2). Using and furthermore revealed a branching pattern these data, interrelationships and significances at within the class that was previously unresolved the order and family level were generally con- by 18S rDNA phylogenies. First, Monomastix gruent with previous results (Figs 1, 2). Especially, (order Monomastigales) was resolved as sister of the relationship between Dolichomastix and Crus- the remaining Mamiellophyceae, supported by all tomastix still remained unresolved since these methods except MP (Fig. 3). Second, Dolicho- genera again formed two independent (paraphy- mastix and Crustomastix formed a single clade letic) branches, albeit with a reverse order of (compare with Fig. 1), albeit with only moderate divergence (Crustomastix as the more basal support from ML (80 %) and BI, and were taxon; Fig. 2A). Intrageneric relations within the accordingly recognized as a single order (Dolicho- genera Micromonas and Ostreococcus were well mastigales). The branching pattern within the resolved (Fig. 2A). In contrast to the partitioned order Mamiellales (emend.), especially the split Bayesian tree shown in Figure 2, a ML analysis of into two families, was congruent with the 18S concatenated sequences placed Mamiella as rDNA tree. Within the derived Chlorophyta, the sister to all remaining Mamiellales (without sup- classes Chlorophyceae and Ulvophyceae port; tree not shown), which was inconsistent with revealed a sister group relationship, separated other phylogenies (Figs 1–4) and highlighted the from the Chlorodendrophyceae and Trebouxio- importance of using appropriate model phyceae. parameters for partitions with extremely different As is obvious from Figure 3, 16S and/or 23S evolutionary rates (rRNA genes vs. ITS2). rRNA genes of derived Chlorophyta were char- The ITS2 secondary structure of Mamiellophy- acterized by up to 7 introns per operon (e.g. ceae followed the standard pattern of 4 helices Lobochlamys), and only few Trebouxiophyceae, separated by short spacer regions (Fig. 2B). Chlorodendrophyceae and Ulvophyceae dis- Comparison of ITS2 helices across taxa revealed played no rDNA intron (e.g. Acrosiphonia). In several compensatory base changes (CBCs) as contrast, plastid rRNA genes of basal prasino- shown for Bathycoccus and Ostreococcus in phyte clades and streptophyte algae were con- Figure 2B. All members of the Bathycoccaceae tiguous, i.e. not interrupted by introns (Fig. 3). were uniquely characterized by a short extra helix However, two strains of Monomastix formed located between the two universal helices 3 and 4, an exception: Monomastix strains M0722 and and the comparison of this extra helix across taxa OKE-1 contained 3 and 4 introns respectively in again revealed CBCs that retained a conserved the 3’ half of the 23S rRNA gene (regions E and G folding pattern (Fig. 2B). This extra helix was thus sensu Wuyts et al. 2001). Other Monomastix integrated in the diagnosis of the new family strains displayed no introns, especially the closest Bathycoccaceae. relative of strain M0722, Monomastix minuta

11 Phylogeny and Classiﬁcation of the Mamiellophyceae class. nov.

NIES-255 (Fig. 3). Unfortunately, PCR amplifica- 23S rDNA sequence of this taxon. Support values tion of the 3’ half of the 23S rDNA failed in of 17 major lineages (encircled numbers in Fig. 4) Monomastix opisthostigma, and thus, presence of were summarized in Table 1. introns, perhaps shared with OKE-1, remained The Mamiellophyceae (clade 1) received inde- unknown. pendent support from nuclear (18S rDNA) and Figure 3 further revealed a single gain of introns plastid data (the complete operon; Table 1). Only a in the plastid genes encoding tRNA_Ile and few lineages were homogeneously supported by tRNA_Ala. These introns were characteristic for all partitions (e.g. clades 4, 10), whereas several almost all derived streptophyte algae and the clades received no or low support from single Embryophyta, in contrast to the basal strepto- gene phylogenies (e.g. clades 2, 3, 9, 11-14, 16, phyte divergence (Mesostigma and Chlorokybus) 17), often with the lowest overall significance in as well as the Chlorophyta with intron-less tRNA 16S rDNA analyses (e.g. clades 2, 12, 13; Table 1). genes (Fig. 3). In some cases, plastid genes contributed the Combined nuclear + plastid analyses. By complete phylogenetic signal (especially in clades combining the alignment of plastid genes with a 2, 17). The largest combined data set (5833 congruent data set of nuclear 18S rDNA characters) provided high support for all 17 clades sequences (i.e. data from the same strains (as in Fig. 4), except for the still moderately or from genetically indistinguishable strains), supported Dolichomastigales (clade 3). 5833 aligned characters could be used for Two clades, 9 and 11, were unsupported by phylogenetic analyses of 47 Viridiplantae (Fig. 4). nuclear 18S rDNA, and were still only moderately The class Mamiellophyceae and practically all supported by the plastid rRNA operon; however, nested subclades (orders, families, genera) these clades received high significance after received very high support values. The basal combination of nuclear and plastid genes split between the Monomastigales and the (Table 1, Fig. 4). To assess the robustness of Dolichomastigales + Mamiellales was again these clades under an extended taxonomic recovered with high significance (Fig. 4). The only environment, non-viridiplant outgroup taxa were clade with still moderate support was the order added to the 5833 character data set, i.e. 3 Dolichomastigales with bootstrap values of 50% ‘Glaucoplantae’P (=Glaucophyta) and 3 Rhodoplan- (MP) and 89% (ML; Fig. 4), or without support tae ( =52 taxa; Rhodo/Glauco-root in Table 1). (NJ). The 52 taxa analysis showed two dramatic The ‘concatenated’ Bayesian analysis, which effects: 1) the common branch of the Prasino- used averaged model parameters for the whole derma/ Prasinococcus-clade plus Mamiellophy- 5833 character alignment, provided high support ceae (clade 9) collapsed almost completely for most lineages including the Dolichomastigales (supported only by NJ), and 2), branch 11, (1.00; Fig. 4). For comparison, a second, ‘parti- suggesting the Pyramimonadales as basal diver- tioned’ Bayesian analysis was performed with gence of the Chlorophyta, collapsed entirely three unlinked partitions for 18S (1683), 16S (Table 1). In contrast, significances of the remain- (1420), and 23S rRNA genes (2583 characters; ing clades, including the weakly supported Doli- tRNAs were not used), allowing all model para- chomastigales, were practically unaffected by meters to vary across partitions (model: addition of the glaucoplant/rhodoplant outgroup GTR+I+G+covarion). However, the partitioned (Table 1). Bayesian analysis revealed the same high support Synapomorphy support for clades. An for clades as the non-partitioned, ‘concatenated’ exhaustive search for non-homoplasious molecu- analysis (Fig. 4), including the Dolichomastigales lar synapomorphies sensu Marin et al. (2003) in all (1.00; tree not shown). rRNA/ tRNA genes investigated here revealed 46/52 taxa-analyses of single-gene and sin- unique characters for the class Mamiellophyceae gle-operon partitions. To compare the support and for all subordinate taxa (Fig. 5, Table 2). RNA values for clades, single-gene partitions and synapomorphies were described by their various gene-combinations were used for phylo- positions in the conserved RNA secondary genetic reconstructions, in addition to the pre- structure, i.e. either as base pairs in helices, or viously described large data sets. The taxon as single-stranded nucleotides (spacer, internal or sampling always comprised 46 Viridiplantae and terminal loop). Some of these synapomorphies corresponded to taxa used for Figures 3 and 4, were used as taxonomic characters, and were albeit to the exclusion of Monomastix opisthos- integrated in new (Latin) or emended diagnoses, in tigma to prevent impact of the partially determined combination with morphological and ecological

12 B. Marin and M. Melkonian , Glaucocystis 95/93/97/79/1.00 100 100 100 -/89/82/-/- 100 100/99/96/92/ 1.00 89/100/100/99/ 1.00 100 100 100/99/100/95/ 1.00 Rhodo/Glauco- root 52 taxa, 5833 char , Cyanophora 1.00 100 1.00 100 1.00 1.00 100 1.00 18S + 16S +rDNA+ 23S tRNAs char . For the 52 taxa analysis (Rhodo/ 73/92/86/71/0.99 95/98/90/86/1.00 95/98/92/85/1.00 86/77/85/-/0.98 100/93/96/86/ 100 78/-/-/-/1.00 85/-/-/-/1.00 77/-/-/-/1.00 tRNAs (plastid) ) and 3 Glaucoplantae ( Monomastix opisthostigma Porphyridium 63/-/-/-/- -/-/-/-/- 93/90/98/72/1.00 91/93/96/62/1.00 100 53/57/72/-/0.9696/99/96/76/1.00 64/-/52/-/1.00 98/99/96/78/1.00 89/76/90/68/1.00 100 -/-/-/-/- -/88/90/50/-96/99/100/99/1.00 58/92/92/51/0.96 100 92/98/100/72/ 52/87/53/-/0.98 88/96/82/75/1.00 99/99/99/99/1.00 97/99/99/99/1.00 65/-/-/-/0.98100 91/95/79/-/1.00 99/99/88/62/1.00 97/99/87/67/1.00 Fig. 4 ) inferred by single-gene and combined sequence analyses. The Compsopogon , , -/-/-/-/- -/-/-/-/- -/-/-/-/- -/-/-/-/- 94/98/98/98/1.00 97/95/100/100/1.00 99/100/100/100/1.00 100 -/51/-/-/- 61/68/56/-/-100 57/-/-/-/- Figures 3 and 4 , albeit without Cyanidioschyzon 75/56/-/75/1.0080/63/-/-/1.00 99/100/100/99/1.00 100/100/100/96/1.00 52/55/59/-/0.96 100 77/-/-/-/1.00 91/89/86/73/1.00 99/96/97/93/1.00 99/96/97/94/1.00 -/-/-/-/- -/-/-/-/- 88/85/93/93/1.00 -/-/-/-/0.97 100 80/-/65/-/0.97 -/86/100/73/- 92/90/100/100/1.00 74/99/100/100/- 89/100/100/100/ 59/52/-/-/- 100 46 taxa, 1683 char 46 taxa, 1420 char 46 taxa, 2583 char 46 taxa, 4150 char 46 taxa, 5833 18S rDNA (nuclear) 16S rDNA (plastid) 23S rDNA (plastid) 16S + 23S rDNA + + / / Micromonas / Monomastix ) were added as outgroup taxa for 46 Viridiplantae, resulting in the collapse of two clades (9, 11). Significances were calculated Confidence measures for 17 clades (encircled numbers in Pyramimonadales Prasinoderma Prasinococcus Mamiellophyceae Prasinoderma Prasinococcus Mantoniella without Taxa 151617 Chlorophyceae Ulvophyceae Chloro-/Ulvophyceae -/-/-/-/- 14 Trebouxiophyceae 72/-/67/61/1.00 -/-/51/-/- 13 Derived Chlorophyta 100 12 Nephroselmidophyceae 99/96/100/98/1.00 -/-/-/-/- 1011 Pyramimonadales Chlorophyta without 97/100/100/98/1.00 100 9 8 6 7 Bathycoccaceae 92/77/72/73/- 98/87/75/81/1.00 100/73/63/63/1.00 100/94/73/89/1.00 100/99/96/95/ 35 Dolichomastigales Mamiellaceae -/-/-/-/- 4 Mamiellales 2 Mamiellophyceae Cyanoptyche by five methods: ML (GTR+I+G)/NJ (GTR+I+G)/NJ (LogDet+I)/MP/MrBayes (covarion). Glauco-root) 3 Rhodoplantae ( 1 Mamiellophyceae 95/83/88/68/1.00 74/-/52/-/1.00 73/-/-/-/1.00 99/70/68/61/1.00 100/98/99/88/ taxon sampling (46 Viridiplantae) corresponds to Table 1.

13 Phylogeny and Classiﬁcation of the Mamiellophyceae class. nov.

14 B. Marin and M. Melkonian data. The uniqueness of 16S/18S rRNA mental sequence data bases by BLAST searches synapomorphies could be tested against using Monomastix 16S rDNA sequence data as hundreds/thousands of published viridiplant input revealed several related, albeit non-identical homologues, and thus, they were the preferred sequences. To test whether these sequences choice for taxonomic diagnoses, rather than tRNA were false positives or genuine relatives of or 23S rRNA characters. Two families Monomastix, they were integrated in a 16S rDNA (Mamiellaceae, Bathycoccaceae) without unique alignment that contained hundreds of viridiplant 16S/18S rRNA synapomorphies were defined by taxa, and pre-analyzed by various methods 23S rRNA synapomorphies in their diagnoses. (results not shown). After removal of false posi- It should be noted that the order tives, 16 environmental sequences were added to Dolichomastigales, which always yielded only mod- data sets used for Figures 3 and 4, and subjected erate numerical support in phylogenetic analyses to phylogenetic analyses with ML, MP, and (Figs 3, 4, Table 1) or even appeared paraphyletic Bayesian methods (Fig. 6A). All environmental (Figs 1, 2), displayed several unique synapomor- Monomastix relatives formed a 100% supported phies in the plastid-encoded rRNA molecules, e.g. lineage together with 4 Monomastix strains, compensatory base changes (CBCs) in three representing the order Monomastigales (Fig. 6A). different helices (Table 2). One CBC in Helix 33 of As a first result, environmental sequence data the 16S rRNA (Fig. 5) was accordingly added to the revealed clear habitat preferences within the diagnosis of the Dolichomastigales. Mamiellophyceae. The Monomastigales occurred To test the synapomorphy support for alterna- exclusively in freshwater environments, and tive topologies, we generated 2 different spanned a wide range of oligotrophic (e.g. ‘user-defined trees’ that both showed the M. opisthostigma) vs. eutrophic, cold (e.g. snow Dolichomastigales paraphyletic by enforcing pit) vs. temperate or subtropical, and running vs. either a [Crustomastix+Mamiellales] clade (as in stagnant water. In contrast, the Dolichomastigales Fig. 1), or a [Dolichomastix+Mamiellales] clade (as and Mamiellales analyzed were confined to marine in Fig. 2A), and analyzed these user-defined clades habitats (Fig. 6A), as also indicated by few for unique synapomorphies in the plastid-encoded (Dolichomastigales, but see below) or many rRNA genes. As a result, [Crustomastix+Mamiellales] sequences (Mamiellales, for the most part related to the exclusion of Dolichomastix would be sup- to Micromonas or Ostreococcus) in marine envir- ported by a single unique CBC only (23S rRNA - bp onmental databases (results of BLAST-searches 6 of Helix D16: U-A ) C-G). Vice versa, [Dolicho- using various 16S rDNA sequences of these two mastix + Mamiellales] would also display a single orders as Query entries revealed no freshwater unique synapomorphy (23S rRNA - nt 7 of the representatives; data and trees not shown). Many spacer Helices E1-F1: G ) A). Thus, the monophyly environmental sequences assigned to the Mono- of Dolichomastigales, i.e., [Dolichomastix + Crusto- mastigales were annotated in the database as mastix](asinFigs 3, 4) was much better supported bacterial or cyanobacterial, and at least some of by several unique synapomorphic signatures than them resulted from investigations of the pico- these alternative evolutionary scenarios. plankton (e.g. Crater Lake; Urbach et al. 2001). In addition to rRNA genes, the plastid-encoded The geographical origin of the Monomastigales RuBisCO large subunit was analyzed for presence sequences included four continents (Europe, of unique synapomorphies at the amino acid level North America, Asia, Australia) suggesting a (4500 Viridiplantae; trees not shown), and results worldwide distribution of this order. were integrated in two taxonomic diagnoses Furthermore, the genetic diversity within the (Mamiellales, Bathycoccaceae; Table 2). Monomastigales was surprisingly high. Only a Analyses of environmental Monomastigales single environmental sequence (clone TH_d343) by 16S rDNA data, demonstrating their strict clearly belonged to the genus Monomastix, which freshwater preference. Screening of environ- formed a robust lineage together with two high

Figure 5. Synapomorphy support for the new class Mamiellophyceae and subordinate taxa (orders, families) in rRNA and tRNA secondary structures. Nomenclature of rRNA secondary structures after (1) The European Ribosomal RNA Database (ERRD; http://bioinformatics.psb.ugent.be/webtools/rRNA/), and (2) [nomenclature in brackets] the Gutell Lab CRW site (http://www.rna.ccbb.utexas.edu/). Plastid rRNA alignments contain Escherichia coli as reference sequence, and as reference numbering system. Synapomorphies are highlighted by grey shades in alignments as well as structural diagrams. Secondary structure diagrams are based upon the ﬁrst taxon in alignments intercepted by black lines.

15 Phylogeny and Classiﬁcation of the Mamiellophyceae class. nov.

Table 2. Synapomorphic signatures of the Mamiellophyceae and nested subclades in nuclear 18S rRNA and plastid-encoded 16S rRNA tRNA, and 23S rRNA molecules. Nomenclature of rRNA helices after the European Ribosomal RNA Database (ERRD; in bold) and, as a second nomenclature system (in [brackets]), the Gutell Lab CRW site, referring to positional coordinates in 16/23S rRNA molecules of Escherichia coli (for reference secondary structure models, see Methods). Numbers of nucleotides (nt) in spacer regions and loops follow the 50to 30 orientation; base pair numbers (bp) refer to the forward strand of a helix (H). For rRNA and tRNA nomenclature, see also Figure 5. Unique signatures without known parallel changes in other Viridiplantae are flagged as NHS (Non-Homoplasious Synapomorphy) sensu Marin et al. (2003). Taxon/character Evolutionary change Characterization Mamiellophyceae 18S rRNA - Helix E23_12: basal bp A-U ) G-U - G- unique for Mamiellophyceae (NHS) 18S rRNA - Helix E23_12 (reverse C ) - - similar deletion in a few strand): unpaired nt before basal bp Chlorophyceae 16S rRNA - Helix 4: bp 3 G-C ) A-U ( ) U-A) - A-U and U-A unique (NHS) [H39: bp 41/401] - U-A confined to Crustomastix 23S rRNA - spacer Helices D4-D5: A ) U ( ) G) - U and G unique (NHS) nt 2 [nt 637] - G confined to Crustomastix

Mamiellales 18S rRNA - ﬁrst internal loop of Helix 8 50-UU-30 ) CA - CA almost unique (exception: (forward strand) CA in Prasinopapilla) 18S rRNA - Helix 8: last bp A-U ) G-C - G-C almost unique (G-C in Scenedesmaceae) 18S rRNA - Spacer Helices E23_13 UUGGUCUUC ) - deletion unique for Mamiellales and E23_14 (reverse strands): one UUGGUC-UC (NHS) nt deleted 16S rRNA - Helix 4: bp 6 [H39: bp A-U ) G-C - G-C unique for Mamiellales (NHS) 44/398] 16S rRNA - Helix 27: ﬁfth from last bp AOG ) U-G - U-G unique (NHS) (non-canonical base-pair) [H769: bp - G-U in Monomastix ) 782/800] 16S rRNA - spacer Helices 28-29: A ) C - C unique for Mamiellales (NHS) second nt [nt 828] 16S rRNA - Helix 31 (forward strand): G ) U - U unique for Mamiellales (NHS) nt 2 [H885: nt 890] 16S rRNA - Helix 31: last bp [H885: C-G ) U-A - U-A almost unique (U-A in plastids bp 897/902] of Euglenales) 16S rRNA - spacer Helices 36-37:nt C ) A - A unique for Mamiellales (NHS) 5 [nt 995] 16S rRNA - spacer Helices 40-41 U(A) ) C - C unique for Mamiellales (NHS) (single nt) [nt 1086] 16S rRNA - spacer Helices 32-49:nt C ) U - U almost unique (exception: U in 4 [nt 1400] Stigeoclonium) tRNA_Ala – V-arm (5 nt) (between U ) C - C also in Pyramimonas parkeae, Anticodon-Helix and TCC-Helix): Coleochaete orbic. nt 2 23S rRNA - spacer Helices B19 A ) C - C almost unique (C in Nephroselmis [H325]-B17: nt 3 [nt 340] olivacea) 23S rRNA - spacer C1-D1:nt1 G ) A - A also in Prototheca [nt 561] 23S rRNA - [H1005: bp 1005/1138] C-G ) U-A - U-A unique (NHS) 23S rRNA - Helix E4: bp 3 [H1303: C-G ) U-A(G-C) - U-A and G-C unique (NHS) bp 1305/1623] - G-C in Ostreococcus 23S rRNA - loop of Helix E10:nt3 A ) U - U almost unique (exception: U in [H1385: nt 1392] Klebsormidium) 23S rRNA - Helix E18: last bp [H1627: A-U ) U-A - U-A unique for Mamiellales (NHS) bp 1630/1636]

16 B. Marin and M. Melkonian Table 2. (continued ) Taxon/character Evolutionary change Characterization 23S rRNA - Helix E20: last but one AOG ) CxA - CxA almost unique (CxA also in (non-canonical) base-pair [H1682: Prasinococcus) bp 1690/1697] 23S rRNA - loop of Helix G7: last nt C ) U - U almost unique (U in Entransia, [H2259: nt 2275] Klebsormidium) RuBisCO (large subunit): amino acid Glu ) Asn - Asn unique (NHS) for Mamiellales 340

Mamiellaceae 23S rRNA - internal loop of Helix A ) G - G almost unique (exception: G in B12 (reverse strand): nt 2 [H235: Pyramimonas parkeae) nt 255]

Bathycoccaceae ITS2: between universal Helices 3 additional Helix (Fig. 2) - additional Helix unique within the and 4 Mamiellophyceae 23S rRNA - Helix B2: last but one bp C-G ) U-G - U-G unique for Bathycoccus and [H31: bp 31/474] Ostreococcus (NHS) 23S rRNA - Helix D1: bp 1 [H579: G-C ) U-A - U-A almost unique (U-A in bp 579/1261] Micromonas CCMP 489) 23S rRNA - loop of Helix D16:nt3 U ) C - C unique for Bathycoccus and [H946: nt 958] Ostreococcus (NHS) RuBisCO (large subunit): amino Lys ) Gln - Gln unique (NHS) acid 14

Dolichomastigales 16S rRNA - Helix 2: bp 2 (for most C-G ) [U?]-A - exception: U-A in crown Mamiellophyceae: forward strand Ulvophyceae (e.g. Acrosiphonia) unknown) [H17: bp 18/1007] 16S rRNA - Helix 33: last bp [H939: U-A ) A-U - A-U unique for Dolichomastigales bp 943/1340] (NHS) 23S rRNA - Helix B6: bp 5 [H76: bp G-C ) A-U - A-U almost unique (A-U in 80/106] Prasinoderma) 23S rRNA - Helix D8: sixth from last A-U ) U-A - U-A unique for Dolichomastigales bp [H687: bp 693/769] (NHS) 23S rRNA - [H1345: bp 4] G-C ) C-G - C-G unique (NHS) 23S rRNA - spacer Helices E23-E24: C ) U - U almost unique (exception: U in nt 1 [nt 1790] Mamiella)

Dolichomastigaceae clade Dolicho_A 18S rRNA - second nucleotide before A ) G - G parallel in Chlorosarcinopsis and Helix E10_1 [H184b-1] some Chaetophorales

Dolichomastigaceae clade Dolicho_B 18S rRNA - loop of Helix 41: ﬁrst and U ) C - both C’s unique (NHS) last nt [H1086: nt 1090, 1095] U ) C

Monomastigales (incl. environm. 16S rRNA sequences) 16S rRNA - Helix 32: bp 7 [H921: G-C ) A-U - exceptions: A-U in C. applanata, bp 928/1389] Prototheca, Entransia, Klebsormidium

17 Phylogeny and Classiﬁcation of the Mamiellophyceae class. nov. Table 2. (continued ) Taxon/character Evolutionary change Characterization 16S rRNA - Helix 41: bp 2 [H1086: G-C ) U-A - U-A unique (NHS); A-U in bp 1088/1097] Mamiellales and some Chlorophyceae; C-G in Pterosperma 16S rRNA - Helix 44: bp 5 [H1158: C(U)-G ) U-A - A unique (NHS) bp 1162/1174] Monomastigales clade Monomast_A (incl. Monomastix) 16S rRNA - Helix 19: last bp C-G ) U-A - U-A unique for Monomast_A (NHS) [H500: bp 504/541] Monomastix 18S rRNA - internal loop of Helix 28 U ) A - A unique for Monomastix (NHS) (4 nt; reverse strand): nt 1 16S rRNA - Helix 13: bp 4 [H289: bp G-C ) G-U - G-U unique (NHS); G-C in other 292/308] Monomastigales 16S rRNA - spacer Helices 28-29: A ) U - U unique (NHS); A in other second nt [nt 828] Monomastigales 16S rRNA - Helix 38: bp 7 [H1047: bp U-A ) CxA - CxA almost unique (CxA in 1056/1204] Stigeoclonium) 16S rRNA - Helix 50: third from last A-U ) U-A - U-A almost unique (U-A in bp [H1506: bp 1513/1522] Entransia) 23S rRNA - Helix A1: last but one bp A-U ) G-U - G unique for Monomastix (NHS) [H1: bp 5/2898] 23S rRNA - internal loop of Helix D9 G ) A - almost unique (A in some seed (reverse strand): nt 1 [H700: nt 725] plants and Prasinococcus) 23S rRNA - Helix D13: bp 4 [H822: bp G-C ) A-U - A-U unique for Monomastix (NHS) 825/832] 23S rRNA - Helix D16: last bp [H946: G-C ) C-G - C-G almost unique (C-G in bp 955/962] Lobochlamys) 23S rRNA - Helix D18: last bp G-C ) A-U - A-U unique for Monomastix (NHS) [H1030: bp 1055/1104] 23S rRNA – Helix between D19 and U-A ) UxC - UxC unique for Monomastix (NHS) D20 [H1082: bp 1082/1086] 23S rRNA – internal loop of Helix AOG ) UxU - UxU unique (NHS) D23: non-canonical base-pair [H1196: bp 1214/1235] 23S rRNA – bp between Helices E8 A-U ) U-G - U-G unique for Monomastix (NHS) and E9 [H1350: bp 1359/1372] 23S rRNA - Helix E19: bp 12 [H1648: U-G(A) ) C-G - C-G almost unique (C-G in bp 1663/1997] Entransia) 23S rRNA - Helix E21: bp 2 [H1707: C-G ) G-U - G-U unique (NHS) bp 1708/1750]

Monomastigales clade Monomast_B (environmental sequences) 16S rRNA – Helix 20: bp 1 [H505: bp G-C(U) ) A-U - A unique for Monomastigales 505/526] clade B (NHS)

Mamiellophyceae without Monomastix 16S rRNA - terminal spacer after C ) U - exceptions: U in strain CCMP 1205 Helix 50: nt 4 [nt 1533] and Oltmannsiellopsis

18 B. Marin and M. Melkonian

Figure 6. Phylogeny, habitat preferences, and synapomorphy characteristics of environmental 16S rDNA sequences of the Monomastigales. A. 16S rDNA phylogeny of Mamiellophyceae, highlighting preferences for marine (Mamiellales and Dolichomastigales; but see also Fig. 7) versus freshwater habitats (Monomasti- gales). Major lineages within the Monomastigales are named Monomast_A (including Monomastix) and Monomast_B. Signiﬁcances at branches: ML (GTR+I+G)/MP/MrBayes (covarion); bold branches have 100/ 100/1.00. B. Unique molecular synapomorphies of the entire order Monomastigales, and of Monomast_A and B in the 16S rRNA alignment and secondary structure.

19 Phylogeny and Classiﬁcation of the Mamiellophyceae class. nov. mountain sequences (Everest region) and clone and one of these synapomorphies (Helix 41) PRD18D01 from Parker River (USA), designated was integrated in the diagnosis of this new here as clade Monomast_A (Fig. 6A). The remaining order. The 16S rRNA also contained unique uncultured Monomastigales formed a weakly sup- synapomorphies of Monomast_A including Mono- ported sister lineage (Monomast_B), which again mastix (Helix 19), and Monomast_B (Helix 20; comprised several ecologically and genetically Figure 6B, Table 2). diverse subclades (Fig. 6A). Analyses of environmental Dolichomasti- To investigate whether the entire order gales by 18S rDNA data, revealing previously Monomastigales and its subclades received sup- unknown freshwater relatives of Crustomastix. port from unique molecular characters, the BLAST searches with 18S rDNA data of Mono- synapomorphy analysis (see above) was repeated mastix, Dolichomastix and Crustomastix resulted with the 16S rDNA alignment that now contained in only a single uncultured Monomastix-relative, environmental sequences (Fig. 6B, Table 2). This but revealed many environmental sequences analysis revealed one homoplasious and two non- of the Dolichomastigales, which in phylogenetic homoplasious (unique) synapomorphies of the analyses formed one major clade containing entire order Monomastigales (Fig. 6B, Table 2), Dolichomastix tenuilepis, and a sister clade with

Figure 7. Phylogenetic analysis of Monomastigales and Dolichomastigales using environmental 18S rDNA data, highlighting habitat preferences. In this ﬁgure, grey shading indicates a freshwater origin of environmental sequences or cultures. In contrast to 16S rDNA (Fig. 6), 18S rDNA sequences reveal an enormous genetic and ecological diversity that exists within the order Dolichomastigales, including the discovery of a freshwater clade within the Crustomastigaceae, comprising three sequences from France and China. Signiﬁcances at branches: ML (GTR+I+G)/MP/MrBayes; bold branches have 100/100/1.00.

20 B. Marin and M. Melkonian

Crustomastix spp. (Fig. 7). These clades represented revealed a wealth of novel eukaryotic protists the families Dolichomastigaceae and Crustomas- including novel lineages (clades VI-IX) of tigaceae (Fig. 7). Within the Dolichomastigaceae, prasinophytes (Guillou et al. 2004; Viprey et al. analyses revealed two highly supported sister 2008). These environmental surveys were accom- clades, named Dolicho_A (containing cultured panied by large-scale isolation efforts that resulted D. tenuilepis and Mediterranean environmental in the establishment of many picoplanktonic sequences) and Dolicho_B (environmental strains of prasinophytes that were subsequently sequence data only; Fig. 7). Whereas the entire characterized both molecularly and ecophysiolo- family Dolichomastigaceae received no synapo- gically (e.g. Cardol et al. 2008; Jancek et al. 2008; morphy support from 18S rDNA data, each of its Le Gall et al. 2008; Rodriguez et al. 2005; Six et al. two major subclades displayed rare (Dolicho_A) 2008; Slapeta et al. 2006). Second, because of or unique synapomorphies (Dolicho_B; Table 2). their ubiquitous and cosmopolitan occurrence in All Dolichomastigaceae sequences originated from the ocean, and their small genome size, pico- marine environments. planktonic prasinophytes, in particular species of The Crustomastigaceae diverged into at least Micromonas and Ostreococcus, have been pre- three clades, namely the weakly supported clade ferred organisms for genome sequencing projects Cr_A (containing the type species, C. didyma and and among the five green algal genomes environmental sequences), and clades Cr_B and sequenced and annotated to date, four are from Cr_C, which both consisted exclusively of marine picoplanktonic prasinophytes [O. tauri (Derelle (Mediterranean) environmental sequences (Fig. 7). et al. 2006), O. lucimarinus (Palenik et al. 2007), Surprisingly, three environmental sequences, Micromonas pusilla (two isolates; Worden et al. which formed a robust lineage within the Cr_A 2009)] thus considerably increasing our knowl- radiation, originated from freshwater habitats, i.e. edge about genome evolution in picoplanktonic Lake Bourget, France, and Lake Taihu, China, eukaryotes. At a much slower pace, formal whereas all remaining members of the entire order taxonomic revisions have been proposed in Dolichomastigales were marine algae (Fig. 7). prasinophytes in recent years. One likely reason Clone BA13 originated from the picoeukaryotic is that, as more prasinophyte clades were dis- plankton of Lake Bourget (size range 0.2-5 mm; covered by environmental DNA sequencing, the Lepere et al. 2008), and was accordingly desig- uncertainty about relationships among the nated ‘picoplankton clone’ (Fig. 7). prasinophyte clades increased (e.g. Guillou et al. 2004; Viprey et al. 2008), a consequence of low phylogenetic resolution using a limited data set Discussion (partial SSU rDNA). Only the derived, thecate prasinophytes (Chlorodendrales; Nakayama The Mamiellophyceae classis nova et al. 1998) and the morphologically well- circumscribed Nephroselmis-clade within prasi- Previous studies using molecular sequence com- nophytes have been formally proposed as new parisons and phylogenetic analyses of prasino- classes Chlorodendrophyceae (Massjuk 2006) phytes (scaly green flagellates and their non-scaly and Nephroselmidophyceae (Cavalier-Smith 1993; relatives) supported earlier conclusions based on Nakayama et al. 2007). The rationale for raising ultrastructural data that highlighted the ancestral prasinophyte clades (orders) to class status has status of the prasinophytes within the viridiplant been given by Nakayama et al. (1998) and derives radiation. Except for Mesostigma (an early diver- from the early paraphyletic divergence of prasino- ging streptophyte green alga), which resulted in phyte clades in the Chlorophyta, their genetic the prasinophytes being polyphyletic, all other distinctness based on rDNA sequences and prasinophyte taxa have been shown to form a the well-accepted recognition of three lineages of paraphyletic series of lineages in the Chlorophyta derived Chlorophyta as classes (Trebouxiophyceae, diverging before the derived classes Trebouxio- Ulvophyceae, Chlorophyceae). Although a rankless phyceae, Ulvophyceae and Chlorophyceae that classification according to the principles of the comprise the large majority of the taxa in the PhyloCode is a possible alternative to the traditional Chlorophyta. Since the study of Nakayama et al. hierarchical Linnean classification and has been (1998) two developments have shaped our current recently proposed e.g. for the classification of apprehension of the prasinophytes. First, large- the Volvocales (Chlorophyceae; Nakada et al. scale sequencing of environmental DNA, with 2008), this approach is not adopted here to avoid particular emphasis on marine picoplankton, taxonomic confusion and maintain stability.

21 Phylogeny and Classiﬁcation of the Mamiellophyceae class. nov.

With the discovery of the phylogenetic position long basal bodies (Z650 nm), and a ‘Mantoniella- of the enigmatic freshwater flagellate Monomastix type’ (Melkonian 1984) flagellar transitional region. It spp. as the earliest divergence in prasinophyte is quite likely, though, that both features are clade II (the Mamiellales; Nakayama et al. 1998) plesiomorphic in the Viridiplantae [the presumptive (Turmel et al. 2009a; this study), clade II is now sister group of the Mamiellophyceae, the Pyramimo- raised to class status (Mamiellophyceae class. nadales (Nakayama et al. 2007; Turmel et al. 2009a) nov.). It should be noted that one genus included share long basal bodies with the Mamiellophyceae, in the Mamiellophyceae, i.e. Micromonas, is the although their flagellar transitional region differs in ‘type’ of a previously described class, the Micro- the absence of the transverse septum and the monadophyceae (Mattox and Stewart 1984), presence of an additional ‘coiled fibre’; Melkonian which in 1984 was introduced to replace the 1984]. name Prasinophyceae by excluding Tetraselmis. According to the International Code of Botanical Nomenclature (ICBN), a class name The Mamiellophyceae in Relation to other must be based on a legitimate name of an Prasinophytes included family (Art. 16.1. in ICBN; http://ibot. sav.sk/icbn/main.htm). However, the family The present study did not attempt to resolve the Micromonadaceae’ (nomen nudum; Melkonian branching order of the prasinophyte clades. This 1990) was never validly described. Accordingly, would require establishment of cultures from two the class Micromonadophyceae is invalid. novel clades (VIII and IX; Viprey et al. 2008) that The monophyly of the Mamiellophyceae was are currently known only from environmental DNA robustly supported by all phylogenetic analyses sequences as well as a larger data set and an performed during this study using genes from the extended taxon sampling. Although we employed nuclear- or the plastid-encoded rDNA operon, and in over 5,800 characters for phylogenetic analyses in concatenated analyses of these genes (see Results). the concatenated data set, most of the internal In addition, three non-homoplasious molecular branches separating prasinophyte clades were synpaomorphies (NHS according to Marin et al. poorly supported or their support was sensitive to 2003) were identified in the 16S, 18S and 23S rRNA the choice of the outgroup (see Results; Fig. 4, of the Mamiellophyceae and one of them (the Table 1). For the concatenated data set, taxon basal base pair in Helix 23_12 of the 18S rRNA) sampling was congruent and focused on repre- was incorporated into the diagnosis of the class sentatives of the Mamiellophyceae (11 strains), for (seeResults).WiththeinclusionoftheMonomasti- other prasinophyte clades only representative gales in the Mamiellophyceae, however, the structural taxa were included (a total of 16 strains for all (morphological) features that had previously been other clades). In general, we distinguish a group of recognized in the Mamiellales as ‘loss of’ characters three ‘‘basal’’ divergences in the prasinophytes (Nakayama et al. 1998) are further diminished: (clades I, II and VI; Pyramimonadales, Mamiello- although Manton (1967) had reported the presence phyceae and Prasinococcus/Prasinoderma, of only two microtubular flagellar roots in Monomastix respectively), an ‘‘intermediate’’ group of prasino- (one associated with each basal body), a cruciate phyte clades (clades III, V and VII; Nephroselmi- (4-2-4-2) flagellar root system is apparently present dophyceae, Pycnococcaceae and Picocystis/ (unpublished observations on Monomastix sp. strain CCMP1205, respectively), and a late-diverging M0722) which should be regarded as the plesio- lineage (clade IV; Chlorodendrophyceae) that morphic state in flagellate cells of the Viridiplantae. was nested among the derived UTC-clades The lack of microtubular flagellar roots in basal body (Ulvophyceae, Trebouxiophyceae, and Chlorophy- no. 2 is then a synapomorphy of the Dolichomasti- ceae). The relationships among clades in each of gales and the flagellate members of the Mamiellales the three groups of clades containing prasino- (and has evolved as a homoplasy in flagellate phytes remained unresolved in all analyses (see reproductive cells of the Streptophyta). The loss of Results). We note that our 18S rDNA phylogenetic an underlayer of small square-shaped scales appears tree (see Results, Fig. 1) resembles similar 18S rDNA to be the only known synapomorphy of the trees published recently (Nakayama et al. 2007; Mamiellophyceae (such losses, however, have Turmel et al. 2009a; Viprey et al. 2008). In these occurred several times independently during the trees, clade VI (Prasinococcus/Prasinoderma) evolution of the Chlorophyta and Streptophyta). Other diverged basally and clade III (Nephroselmidophy- structural features that characterize the flagellate ceae) after the Mamiellophyceae/Pyramimona- members of the Mamiellophyceae are the relatively dales, whereas in the tree derived from the

22 B. Marin and M. Melkonian plastid-encoded rRNA operon (see Results, Fig. 3) gene analyses of plastid-encoded genes, how- the Nephroselmidophyceae occupied a more ever, the only other taxon in the Mamiellophyceae basal position branching between the Pyramimo- included, was Ostreococcus). In the present nadales and all other Chlorophyta (however, with study, the Mamiellophyceae excluding the Mono- little or no support; Fig. 3). This recalls the mastigales were highly supported in the plastid situation observed in phylogenetic analyses based data set (see Results; Fig. 3) and in the con- on concatenated plastid-encoded genes in which catenated analyses of the nuclear- and plastid- the Nephroselmidophyceae occupied a basal encoded rRNA operons irrespective of the outgroup position in the Chlorophyta (e.g. Turmel et al. used (see Results; Table 1). Our analysis of the 2009a). We tentatively conclude that in the plastid- Monomastigales included the type species of the encoded rDNA phylogeny the Nephroselmidophy- genus, M. opisthostigma (Scherffel 1912), which ceae were attracted to the Pyramimonadales by was brought into culture for this first time (Fig. 8). their relatively short-branch (compared to the Although morphological differences among the much longer branches of the Mamiellophyceae, Monomastix strains studied were prominent, their Prasinococcus/Prasinoderma and the Pycnococ- genetic diversity was relatively low compared to caceae; Fig. 3), whereas the Prasinococcus/ e.g. strains of Micromonas or Ostreococcus (see Prasinoderma clade was likely attracted to the Results; Fig. 1). In all analyses, the Monomastix Mamiellophyceae by its long branch. That the sequences exhibited a long, common branch that position of Prasinococcus/Prasinoderma as a displayed non-homoplasious molecular synapo- sister group to the Mamiellophyceae in the morphies at the 16S, 18S and 23S rRNA concatenated analysis (Fig. 4; branch 9) is likely level (Table 2). The next divergence in the artificial was further revealed when six rhodoplant/ Mamiellophyceae was represented by the glaucoplant sequences were added and used as Dolichomastigales. This order was not supported outgroup taxa (Table 1). In this case, the support at the 18S rDNA level (see also Nakayama et al. for the branches 9 and 11 (Fig. 4) disappeared 2007; Turmel et al. 2009a (BP in ML: 57%) and [except for phylogenetic methods (MP,NJ) that are Viprey et al. 2008; but see Guillou et al. 2004 and known to be sensitive to long-branch attraction: Zingone et al. 2002). Moderate support for the branch 9], whereas support for all other branches Dolichomastigales was only obtained in the in the tree remained essentially unaltered (Table 1) plastid-encoded rDNA data set (BP in ML: 80%; strongly suggesting that the phylogenetic position Fig. 3) and in the concatenated analyses of both of the Prasinococcus/Prasinoderma clade cannot nuclear- and plastid-encoded rRNA operons (BP be adequately identified when Streptophyta alone in ML: 89%; Fig. 4). Support for the common are used as an outgroup. branch uniting the two genera Dolichomastix and Crustomastix was relatively insensitive to the Classification of the Mamiellophyceae outgroup used (with rhodo- and glaucoplant sequences; BP in ML: 77%). Although the The present study focused on the molecular common branch of the Dolichomastigales was phylogeny and classification of the Mamiellophy- short (see Results, Fig. 4), especially in ceae, one of the ecologically most important comparison with the Monomastigales, three non- groups of photosynthetic picoeukaryotes in the homoplasious synapomorphies were detected in marine environment (e.g. Not et al. 2004; Vaulot the 16S and 23S rRNA for Dolichomastix and et al. 2008). Our analyses provided full phyloge- Crustomastix (see Results; Fig. 5 and Table 2) netic resolution (except for Dolichomastigales) of suggesting that the order is monophyletic. taxa in this group ranging from order to species Unfortunately, taxon sampling in the Doli- level using combined analysis of different coding chomastigales for the concatenated data set regions (and ITS2) of the plastid- and nuclear- was low and did not reflect the genetic diversity encoded rRNA operons. The Mamiellophyceae of taxa observed for this order in nature (see consisted of three major clades, here recognized below for environmental DNA sequences). The as orders. The Monomastigales represented the third order Mamiellales (Moestrup emend.) was earliest divergence in the Mamiellophyceae corro- well supported by molecular phylogeny (100%/ borating a recent report by Turmel et al. (2009a), 1.00 in all analyses; Table 1), 10 non-homo- who, based on nuclear-encoded 18S rDNA, plasious molecular synapomorphies in the 16S, reported moderate support (71% bootstrap [BP]) 18S, and 23S rRNAs and the plastid encoded for the Mamiellophyceae excluding Monomastix tRNA_Ala (Fig. 5; Table 2), a non-homoplasious (24 sequences of Mamiellophyceae; in their multi- synapomorphy at the amino acid level in the LSU

23 Phylogeny and Classiﬁcation of the Mamiellophyceae class. nov.

Figure 8. Light micrographs of Monomastix opisthostigma (strain M2844/1). The organism was isolated by MM from an enrichment culture of a plankton sample taken from an oligotrophic pond (Edlesberger Teich, Waldviertel) in Austria. An axenic clonal culture was established using fluorescence-activated cell sorting (FACS) according to Surek and Melkonian (2004). Cultures were grown in 100 ml Erlenmeyer flasks in SFM (Synthetic Freshwater Medium; www.ccac.uni-koeln.de)at151C, 20 mEm1 sec1 light intensity and 14:10 h L/D cycle. The strain is available through the Culture Collection of Algae at the University of Cologne (CCAC 0206). Photographs were taken with a Zeiss IM35 inverted light microscope equipped with a digital camera (Canon EOS 40D) and electronic flash illumination using differential interference contrast (DIC) microscopy. Black lines indicate the large ejectisomes (trichocysts; tr) of this species. of RuBisCO (see Results), as well as biochemical 2160 aligned positions) the support for the (the pigments micromonal and ‘unidentified M1’; Bathycoccaceae increased to 100%/1.00 Latasa et al. 2004) and morphological [T-hairs, if (whereas support for the Mamiellaceae was present (they were lost together with the flagella in diminished). This was apparently due to the the Bathycoccaceae) with two parallel rows of presence of a unique molecular synapomorphy subunits (Marin and Melkonian 1994)] characters. in the secondary structure of the ITS2 in the Phylogenetic resolution of clades within the Bathycoccaceae (an additional helix inserted Mamiellales was already largely achieved with between helices 3 and 4; see Results; Fig. 2). nuclear-encoded 18S rDNA (see Results: Fig. 1) Support for the two families was strengthened in corroborating earlier results by Guillou et al. phylogenies using plastid-encoded rRNA genes (2004), Nakayama et al. (2007) and Turmel et al. (Fig. 3 and Table 1) with most of the phylogenetic (2009a): The two families Mamiellaceae and signal being present in the 23S rRNA gene Bathycoccaceae received moderate support in (Table 1). The concatenated analysis with either nuclear-encoded 18S rDNA phylogenies (BP in streptophytes or rhodo- and glaucoplant ML: 73% for the Mamiellaceae and 81% for the sequences as outgroups gave further support Bathycoccaceae; Fig. 1). It is evident that the for the existence of the two families (although more sequences of the Mamiellales are included we recognize that taxon sampling in the in the analyses, the lower the support for the two plastid data set and in the concatenated families becomes [compare Fig. 1 (26 sequences) analysis could be improved). The Mamiellaceae with Table 1 (6 sequences; BP in ML: 80% for and Bathycoccaceae, of course, are well Mamiellaceae and 92% for Bathycoccaceae)], circumscribed by morphological characters (the reflecting the high genetic diversity of this gene Bathycoccaceae lack flagella, basal bodies and in the Mamiellales relative to the small data set eyespots, whereas the Mamiellaceae are flagellate, (1683 aligned positions). When the 5.8S rDNA and and except for the minute Micromonas,have the ITS2 were included in the analyses (Fig. 2; eyespots as well as T-hairs with two rows of distal

24 B. Marin and M. Melkonian

Table 3. Accession numbers (EMBL/Genbank) of new sequence data determined for this study, and strain designations of green algal cultures. 5.8S rDNA and ITS sequences were determined only in the Mamiellophyceae. For accession numbers of published sequences (‘database’ in this Table) see Figures 1–3. Taxon; strain 18S rDNA [5.8S rDNA, 16S rDNA, tRNAs, ITS] 23S rDNA Ulvophyceae Acrosiphonia sp.; SAG 127.80 FN562430 FN563074 Oltmannsiellopsis viridis (Hargraves et Steele) FN562431 FN563075 Chihara et Inouye; NIES-360 Ignatius tetrasporus Bold et MacEntee; UTEX 2012 FN562432 FN563076 Chlorodendrophyceae Tetraselmis striata Butcher; SAG 41.85 database FN563077 Unclassiﬁed prasinophytes Picocystis salinarum Lewin; CCMP 1897 database FN563078, FN563079 coccoid prasinophyte; CCMP 1205 database FN563080 Pseudoscourﬁeldia marina (Throndsen) Manton; database FN563081, FN563082 SCCAP K-0017 Nephroselmidophyceae Nephroselmis pyriformis (Carter) Ettl; CCMP 717 database FN563083, database Nephroselmis astigmatica Inouye et Pienaar; NIES- FN562433 FN563084 252 Nephroselmis rotunda (Carter) Fott; CCAP 1960/1 FN562434 / Nephroselmis rotunda (Carter) Fott; M 0932 FN562435 FN563085 Nephroselmis olivacea Stein; NIES-483 FN562436 FN563086 Prasinococcus/Prasinoderma-clade Prasinococcus capsulatus Miyashita et Chihara; database FN563087, FN563088 CCMP 1202 Prasinoderma coloniale Hasegawa et Chihara; CCMP FN562437 FN563089 1413 Mamiellophyceae Monomastix opisthostigma Scherffel; M 2844 FN562445 FN563090 Monomastix minuta Skuja; NIES-255 FN562446 FN563091 Monomastix sp.; M 0722 FN562447 FN563092, database Crustomastix stigmatica Zingone; CCMP 2493 AJ629844, FN562448 FN563093 Dolichomastix tenuilepis Throndsen et Zingone; M FN562449 FN563094 1680 Mamiella gilva (Parke et Rayns) Moestrup; PLY 197 FN562450 FN563095 Mantoniella squamata (Manton et Parke) database, FN562451 FN563096 Desikachary; CCAP 1965/1 Micromonas pusilla (Butcher) Manton et Parke; M FN562452 FN563097 1681 Micromonas pusilla (Butcher) Manton et Parke; database FN563098 CCMP 489 Bathycoccus prasinos Eikrem et Throndsen; SCCAP FN562453 FN563099 K-0417 Pyramimonadales Cymbomonas tetramitiformis Schiller; M 1669 FN562438 FN563100 Halosphaera sp.; M 1670 FN562439 / Pyramimonas disomata Butcher; M 1802 FN562440 FN563101 Pyramimonas tetrarhynchus Schmarda; SCCAP K- FN562441 FN563102 0002 Pyramimonas olivacea Carter; M 1668 FN562442 FN563103 Pyramimonas parkeae Norris et Pearson; CCMP 726 FN562443 FN563104

25 Phylogeny and Classiﬁcation of the Mamiellophyceae class. nov.

Table 3. (continued ) Taxon; strain 18S rDNA [5.8S rDNA, 16S rDNA, tRNAs, ITS] 23S rDNA

Streptophyta Mesostigma viride Lauterborn; SAG 50-1 database FN563105, database Coleochaete nitellarum Jost; SAG 3.91 FN562444 database

Table 4. Sequences and names of primers used for PCR amplification and sequencing of the almost- complete plastid-encoded rRNA operon (44400 nt from 16S rDNA-Helix 4 [H39] to 23S rDNA-Helix H4 [H2735]). Since most algal cultures contained bacterial contaminants, PCR reactions were performed with primers specific for cyanobacterial/ plastid-encoded 23S rRNA genes (ptLSU; specific 3’-positions underlined). LSU Bathy_CR was applied only for Bathycoccus prasinos. Most primer designations refer to their location in the rRNA secondary structure. PCR-primer primer sequence (50 to 30) 16S_SG1_short_forw GCAGAGAGTTYGATCCTGGCTCAGG 16S H4_forw GATCCTKGCTCAGGATKAACGCTGGC ptLSU_B4F CTAGGBACYYAGAGNCGAWGAAGGG ptLSU_B21_forw CACGTGRAATYCCGTGTGAATCWGC ptLSU_D13_forw AGCTGGATCTCTYCGAAATGCGTTG 23S_H1-4_rev ACTYATCTTRRGGTRGGCTTC 23S_G20_rev CACCGGATATGGACCRAACTGTC ptLSU G4_rev GCCTYCCACCTADDCTGCG ptLSU D7_rev ACACATTTCGGGGAGAACCAGCTAG ptLSU C-D_rev GCCGGCTCATTCTTCAAC LSU Bathy_CR CAGGCATGCGGTCAGATGTGTTC 16S-50-rev AAGGAGGTGATCCANCCNCACC Sequencing-primer Seq_16S_H4_forw TKGCTCAGGATKAACGCTGGC Seq_16S_pos874_forw ACTCAAAGGAATTGACG Seq_16S_pos1400_forw CTGCCCTTTGTACACACCGCCCGTC Seq_23S_B21_forw AATYCCGTGTGAATCHGCGAGGACC Seq_23S_E3_forw GGTGARAATCCWATGCYCCG Seq_23S_E19_forw AACTCTYTCTAAGGAACTCGG Seq_23S_G2_forw GGACAGAAAGACCCTATGAAGC Seq_23S_H4_rev ATCTTRRGGTRGGCTTCCYAC Seq_23S_G17_rev GTCTCWCGACGTTYTGAACCCAGCTC Seq_23S_E23_rev TTWCRACTTHGCGGAGACCTGTG Seq_23S_E7_5_rev ACCTGTGTCRGTTTNNRGTACAG Seq_23S_C_D_rev TCGCCGGCTCATTCTTCAACAGGCAC Seq_16S_49_rev TACGGCTACCTTGTTACGACTTC Seq_16S_39_rev ACTTAACCCRACATCTCACGACACG Seq_16S_25_rev ATMTCTACGCATTTCACCGCTMCAC subunits; see also Table 8 in Zingone et al. 2002). In ‘almost unique’ (exception Pyramimonas parkeae; addition to the novel helix in the ITS2, the Table 2) synapomorphy was found in the 23S rRNA. Bathycoccaceae also reveal two non- In conclusion, the two families, in particular the homoplasious synapomorphies in the 23S rRNA Bathycoccaceae, appear to be well characterized (Table 2), whereas in the Mamiellaceae only one by molecular and morphological synapomorphies.

26 B. Marin and M. Melkonian

Finally, the genera currently recognized in the one unique CBC occurred in the novel helix located Mamiellales and the subgeneric clades in the between helices 3 and 4, strongly suggesting that genera Micromonas and Ostreococcus also these clades represent four distinct species (Coleman received support in the present analysis (see also 2009; Muller¨ et al. 2007). Representatives of the previous reports by Guillou et al. 2004; Nakayama putative sister clades A and C have already been et al. 2007; Turmel et al. 2009a; Viprey et al. 2008). given different species names (‘O. lucimarinus’and Bathycoccus (3 strains), Ostreococcus (7 strains), O. tauri, respectively; Chre´tiennot-Dinet et al. 1995; and Mamiella (2 strains; including for the first time Palenik et al. 2007), based on comparative genome the type species, M. gilva PLY 197) were mono- analyses and different ecophysiological niche adap- phyletic in 18S rDNA analyses (BP in ML: 100%/ tations (Jancek et al. 2008; Palenik et al. 2007). 1.00; Fig. 1), Micromonas was moderately sup- The five clades of Micromonas had previously ported as monophyletic (BP in ML: 86%; Fig. 1;10 been resolved in multigene analyses (18S rDNA, sequences) but the two Mantoniella species coxI and rbcL; Slapeta et al. 2006). Clades A-C (M. squamata and M. antarctica) were monophy- were most closely related, whereas clades E and letic only in NJ and MP analyses (Fig. 1). Strain D were more distant to each other and to clades RCC 391 that shares some structural features with A-C in an unrooted phylogeny (Slapeta et al. the genus Mamiella (Guillou et al. 2004) should be 2006). We recovered the same relationships using described as a new genus in the Mamiellaceae. In a rooted 18S rDNA phylogeny but also received our tree based on nuclear-encoded 18S rDNA, it moderate support (BP in ML: 75%) for a sister diverged between Mamiella and the Mantoniella/ group relationship between clade E and clades Micromonas clade (Fig. 1; see also Guillou et al. A-C. Among clades A-C, clade C appeared to be a 2004 and Turmel et al. 2009a). Environmental DNA sister to A+B (BP support for clade A+B in ML: sequencing indicates that there may be consider- 92%; Fig. 1) again corroborating the previous able genetic diversity within both Mamiella and three-gene analysis by Slapeta et al. (2006). In the RCC 391 (Viprey et al. 2008). combined 18S rDNA, 5.8S rDNA and ITS2 Previous phylogenetic analyses have revealed analyses (14 Micromonas strains; Fig. 2A) again considerable genetic heterogeneity within the genera three clades were supported by 100%/1.00 Ostreococcus and Micromonas leadingtothe (clades E, D and A-C), however, the branching recognition of four Ostreococcus clades order between clades D and E was reversed (A-D; Guillou et al. 2004; Rodriguez et al. 2005)and (compared to the 18S rDNA phylogeny; in the five Micromonas clades [A-E; Slapeta et al. 2006; combined analyses clade D represented the ear- renamed and partly rearranged as clades 1-5 in liest divergence: BP in ML for clades A-C+E 76%), Worden (2006) and I-V in Worden et al. (2009); and clade A was paraphyletic (Fig. 2A). The two see Fig. 2An]. We confirm that Ostreococcus strains analyzed in each of the clades B and C (8 strains) split into two groups using nuclear- were identical (clade C) or almost identical (clade encoded 18S rDNA (one comprised clade D and B) suggesting that clade B and C each represent a the other comprised clades A-C; see also Guillou single, presumably cosmopolitan species of et al. 2004; Viprey et al. 2008). In their study of 11 Micromonas (see also Slapeta et al. 2006). It is Ostreococcus strains based on ITS1 and ITS2 possible that in the future clades A-C as well as E sequences, Rodriguez et al. (2005) also recovered may have to be raised to genus status as they are four clades [although as in our study, they used only genetically as different from clade D (=Micromo- onesequenceofcladeC(O. tauri)] but were unable nas pusilla s. str.; containing the neotype culture to resolve the branching order among the clades. In designated by Manton and Parke 1960) as these the present study, we combined 18S rDNA, 5.8S are from e.g. Mantoniella (Figs 1, 2). rDNA and ITS2 sequences of 6 Ostreococcus strains If one maps evolutionary trends within the class (2160 aligned positions) and tentatively resolved the onto the phylogenetic tree (Fig. 4) of the Mamiel- branching order among the clades (clade B was lophyceae, some trends can be deduced that in sister to clades A+C; see Results; Fig. 2). Secondary part have been previously summarized by Melk- structure analysis of the ITS2 not only demonstrated onian and Surek (1995), Nakayama et al. (1998) significant differences between Bathycoccus and and Turmel et al. (2009a). The Mamiellophyceae Ostreococcus [including 8 CBC’s between Bath- can be regarded as a group of ancestrally scaly ycoccus prasinos SCCAP K-0417 and Ostreococcus green flagellates that evolved at least twice RCC 501 (clade D) in the conserved helices 2 and 3; independently towards a picoplanktonic life style Fig. 2] but also for the first time provided evidence by progressively becoming smaller in cell size that in each of the four Ostreococcus clades at least and by loosing cellular constituents. As suggested

27 Phylogeny and Classification of the Mamiellophyceae class. nov. earlier (Melkonian and Surek 1995), the ancestral (2002) were unable to detect these structures]. cell of the Mamiellophyceae was presumably After the split of the Monomastigales microtubular covered by small square-shaped underlayer flagellar roots were lost in the Dolichomastiga- scales (40-50 nm; Becker et al. 1990; Melkonian les+Mamiellales from basal body 2 (possibly a first and Robenek 1981), which were lost in the indication of the retardation of flagellar develop- common ancestor of the Monomastigales and ment from the younger basal body (Beech et al. the Dolichomastigales+Mamiellales. An outer 1991; Heimann et al. 1989). Interestingly, the layer of larger, flattened, spider web-like scales uniflagellate condition evolved in the Monomasti- was retained in the Dolichomastigales+Mamiel- gales and the Mamiellales by two radically lales (lost within the Dolichomastigales in the different mechanisms [in the Monomastigales the family Crustomastigaceae, and within the flagella-bearing basal body is the younger (no. 2), Mamiellales twice independently, in Ostreococcus whereas in Mantoniella/Micromonas it is the older and Micromonas), but was lost (or perhaps (no. 1) of the two (Heimann et al. 1989)]. This may transformed?) in the exclusively freshwater also explain why in the Monomastigales a cruciate Monomastigales. The large, imbricated oval flagellar root system has been retained in the scales of Monomastix cf. minuta, displaying a uniflagellate condition in contrast to the situation reticulate ‘woven’ pattern (Manton 1967), are in Mantoniella/Micromonas. devoid of 2-keto sugar acids, a molecular marker of prasinophyte scales (Becker et al. 1991). Whether these scales are a novel innovation of The Mamiellophyceae and Environmental the Monomastigales or have been chemically (and DNA Sequences structurally) modified from the spider web-like scales of other Mamiellophyceae remains Our search for environmental DNA sequences of unknown. As prasinophyte scales require consid- the Dolichomastigales and Monomastigales erable amounts of Ca2+ for their stability and for deposited in the database led to the discovery of scale-scale interactions (Becker et al. 1994), their genetically diverse and previously unknown loss or modification in the Monomastigales upon lineages in these two orders of the Mamiellophy- transfer to the freshwater habitat is not surprising. ceae (see Results). 18S rDNA genetic libraries Reduction in cell size has occurred independently constructed with universal eukaryotic primers are in several lineages of the Mamiellophyceae. The known to yield biased results either related to the largest cells are encountered in the early diverging organisms involved (e.g. presence of cell walls, Monomastigales, namely in the type species low gene copy numbers) or the PCR approach Monomastix opisthostigma [Fig. 8; cells can be taken (primer specificity, cloning efficiency). more than 20 mm long; however, small-celled Stoeck et al. (2006) demonstrated that a single species (7-13 mm long) have also been described]. PCR primer set failed to recover the full diversity of In the Dolichomastigales and the Mamiellales cells protist taxa in a given environment. Novel clades are usually no longer than 5 mm and in two of prasinophytes were recently discovered with a lineages (Bathycoccaceae and Micromonas)are targeted approach using specific primers for reduced to the size of the smallest eukaryotes picoplanktonic green algae (Viprey et al. 2008). (1 mm; Courties et al. 1994). Cell size reduction is The failure to detect environmental nuclear- accompanied by loss of the flagellar apparatus encoded 18S rDNA sequences of Monomasti- and eyespot (Bathycoccaceae) and/or the scaly gales (only one environmental sequence was covering (Ostreococcus and Micromonas). For the recovered related to Monomastix spp., Fig. 7) flagellar apparatus, it is likely that the last common may be related to one of the above-mentioned ancestor of the Mamiellophyceae had two flagella, biases. Viprey et al. (2008) suggested that new a cruciate microtubular flagellar root system, and molecular approaches specifically targeting a single centrin-containing nucleus-basal body photosynthetic organisms in the environment, i.e. connector (NBBC, rhizoplast) passing the nucleus analyses of the plastid-encoded rDNA genes and extending towards the chloroplast (Schulze (Fuller et al. 2006) could result in a better et al. 1987). It is possible that this ancestor also assessment of the diversity of the eukaryotic contained a cytoplasmic duct system, a duct fiber photosynthetic biosphere. Using the plastid- and a putative MLS (multi-layered structure) encoded 16S rDNA we discovered a surprising associated with the 1d root of basal body 1 [for diversity of genotypes in the Monomastigales Crustomastix didyma; Nakayama et al. 2000;in exclusively from freshwater habitats (Fig. 6). Many the related C. stigmatica, however, Zingone et al. of the sequences assigned to the Monomastigales

28 B. Marin and M. Melkonian were annotated in the database as bacterial or Ostreococcus as well as Micromonas may contain cyanobacterial. The genetic diversity of the Mono- meiotic genes and thus reproduce sexually (Derelle mastigales, based on the 16S rRNA gene, is at et al. 2006; Worden et al. 2009), but experimental least as high as that of the Mamiellales in the proof for sexual reproduction in the Mamiellophy- marine environment suggesting that the early split ceae is still lacking. of the Mamiellophyceae into Monomastigales and Dolichomastigales+Mamiellales led to the exploi- tation of the (pico)planktonic habitat in both Conclusions freshwater and seawater environments. Unfortu- nately, nothing is currently known about the The present molecular phylogenetic analysis of morphology and ecophysiology of the environ- genes (and ITS2) from the nuclear- and plastid- mental Monomastigales (let alone the genomes encoded rRNA operons of the Mamiellophyceae of any Monomastigales including Monomastix), class. nov., an abundant and ubiquitously dis- precluding any further discussion about the tributed group of (pico)planktonic green algae, has significance of these organisms in the freshwater yielded full resolution of clades and resulted in a environment. Establishment of cultures by serial revised classification with description of two new dilution or flow cytometric cell sorting is strongly orders, Monomastigales and Dolichomastigales encouraged to close this knowledge gap. We and four new families (Monomastigaceae, Doli- note, however, that the environmental sequences chomastigaceae, Crustomastigaceae, Bathycoc- originate from only seven different locations caceae). All clades except Dolichomastigaceae suggesting that more genetic diversity in the and Crustomastigaceae were characterized by Monomastigales is yet to be discovered. molecular synapomorphies, which were incorpo- Searching the database for environmental 18S rated into the diagnoses of the new taxa. A search rDNA sequences of the Dolichomastigales yielded for environmental DNA sequences in the data- many novel sequences (and a new clade Dolicho_B; bases for Dolichomastigales and Monomastigales for other clades in the Dolichomastigales previously identified an unexpectedly rich genetic diversity in identified, see Viprey et al. 2008)inboththe the Monomastigales defining this early diverging Dolichomastigaceae and the Crustomastigaceae lineage in the Mamiellophyceae as exclusively (see Results, Fig. 7). Although the sequences largely freshwater. Another freshwater clade was dis- derive from seawater, a subclade of the Crustomas- covered in the Crustomastigaceae, whereas tigaceae, clade Cr_A (to which also the type sequences from the novel clade Dolicho_B were species, C. didyma, belongs; Fig. 7), contains three recovered from deep-sea sediments. The Mamiel- environmental sequences from freshwater making lophyceae comprise not only the smallest eukar- the Mamiellales the only exclusively marine order in yotes known but also arguably some of the the Mamiellophyceae. Interestingly, the genus Crus- ecologically most successful photosynthetic tomastix lacks prasinophyte scales (a glycocalyx picoeukaryotes in the ocean (and perhaps also termed a ‘‘crust’’ covers the cell instead; Nakayama in freshwater). et al. 2000), which perhaps facilitated its transfer into freshwater (again, no information exists about the nature of the organisms involved, except that one of Methods the freshwater clones was derived from picoplankton). The clade Dolicho_B contained several Cultures, DNA isolation, gene amplification and sequen- sequences from deep sea or hydrothermal vent cing: 31 strains of the Viridiplantae including the Mamiello- phyceae were used for determination of new sequence data sediments (Fig. 7). We suspect that these (taxa in bold in Figs 1–3; Table 3). Monomastix opisthostigma sequences may derive from resting cells (cysts); strain M 2844 is also available as an axenic subisolate (CCAC no resting cells have, however, yet been described 0206). Organisms were grown in appropriate culture media for the Dolichomastigales (or the Mamiellales) from under standard conditions. The source of the strains (strain numbers) is provided in Figures 1–3. The following cultured organisms (Nakayama et al. 2000; Thrond- abbreviations refer to culture collections: CCAC=Culture sen and Zingone 1997; Zingone et al. 2002). Collection of Algae at the University of Cologne, Germany Scherffel (1912) described an ornamented cyst of (http://www.ccac.uni-koeln.de/); CCAP=Culture Collection of Monomastix opisthostigma (from natural samples, Algae and Protozoa, UK (http://www.ccap.ac.uk/); though) and Manton (1967) documented by electron CCMP=The Provasoli-Guillard National Center for Culture of Marine Phytoplankton (https://ccmp.bigelow.org/); M=Culture microscopy apparently a cyst of another Mono- Collection Melkonian, Botanical Institute, University of mastix sp. (from cultures). It has been proposed Cologne, Germany (strains available through CCAC); from genome sequencing and gene analyses that NIES=Microbial Culture Collection at National Institute for

29 Phylogeny and Classiﬁcation of the Mamiellophyceae class. nov.

Environmental Studies, Tsukuba, Japan (http://www.nies. evolution was determined using the Akaike criterion of go.jp/biology/mcc/home.htm); PLY=The Plymouth Culture ModelTest 3.7, or jModelTest 0.1.1 (Posada 2008; http:// Collection of Marine Algae (http://www.mba.ac.uk/ darwin.uvigo.es/software/jmodeltest.html), resulting in GTR+I+G culturecollection.php); SAG=Sammlung von Algenkulturen, as the best model for all data sets in this study. This model University of Gottingen,¨ Germany (http://www.epsag. was used for all analyses except MP. In addition, NJ analyses uni-goettingen.de/html/sag.html); SCCAP=The Scandinavian were performed using the LogDet+I model (the proportion of Culture Collection of Algae and Protozoa at the University invariants [I] was taken from the respective GTR+I+G model), of Copenhagen (http://www.sccap.dk/search/); UTEX= in order to correct possible base compositional bias inherent University of Texas Culture Collection of Algae, USA (http:// in plastid-encoded rRNA genes (shown in Table 1). Phyloge- www.bio.utexas.edu/research/utex/). Total genomic DNA was netic analyses were calculated using PAUPn4.0b10 (for ML, extracted with the DNeasy Plant Mini Kit from QIAGEN, and NJ, MP) and MrBayes 3.1.2 (Ronquist and Huelsenbeck 2003; used for gene amplification by polymerase chain reaction http://paup.csit.fsu.edu/; http://mrbayes.csit.fsu.edu/). To (PCR). For amplification and sequencing of nuclear 18S rDNA obtain tree topologies shown in Figures (except Fig. 2), three including 5.8S rDNA and ITS2, see Marin et al. (2003); for PCR independent heuristic searches were performed with star- and sequencing of the plastid-encoded rRNA operon (genes ting-trees calculated by NJ, MP, or obtained by sequential encoding 16S rRNA, tRNA_Ile, tRNA_Ala, 23S rRNA), see taxon addition; these searches always converged towards the Marin et al. (2005) and Table 4. EMBL/Genbank accession same tree. ML bootstrap analyses (100 replicates with numbers of new sequences determined for this study are NJ-start) were constrained towards 4000 rearrangements given in Table 3. per replicate; NJ and MP bootstrap analyses (1000 replicates) Taxon sampling and alignments: Phylogenetic analyses were not constrained. Bootstrap values below 50% were of the Mamiellophyceae started with 18S rDNA sequence ignored. For Bayesian analyses, two MCMC chains with comparisons that included all available sequence data of 500000 generations were performed, and the ‘burnin’ deter- prasinophyte lineages, albeit excluding environmental mined by the convergence criterion (Marin et al. 2005). sequences, and a few representatives of the Streptophyta Bayesian analyses of 18S rDNA sequences showed no (used as outgroup) and derived Chlorophyta (e.g. Chlorophy- obvious difference with or without the covarion option, and ceae; Fig. 1). Screening strategies for sequence databases thus, covarion was not used (Figs 1, 7). Other Bayesian (EMBL) included direct retrieval of sequence data (http:// analyses were performed with covarion. Some Bayesian srs.ebi.ac.uk/srsbin/cgi-bin/wgetz?-page+srsq2+-noSession) analyses (e.g. Fig. 2; see Results) used a partitioned data and BLAST searches (http://blast.ncbi.nlm.nih.gov/Blast.cgi). set, thus allowing independent model parameters (incl. The alignment of highly divergent ITS2 sequences (Mamiello- Gamma shape [G] and proportion of invariable positions [I]) phyceae only; Fig. 2) required the reconstruction of secondary for different partitions. Bayesian posterior probabilities below structures using Mfold (http://mfold.bioinfo.rpi.edu/). Mfold 0.95 were considered as non-significant, and were thus analysis of a single ITS2 often resulted in several alternative ignored. secondary structures; however, comparison with related taxa Unique molecular signatures of mamiellophycean revealed the ‘correct’ folding pattern by presence of com- clades, and reference rRNA secondary structure models: pensatory base changes (CBC) as shown in Figure. 2B (see The Mamiellophyceae and all nested subclades were ana- also Mai and Coleman 1997). In contrast, ITS1 sequences lyzed for molecular ‘non-homoplasious (=unique) synapomor- were not universally alignable among the Mamiellophyceae phies’ (NHS), which can be used to define a given clade and did not reveal any conserved secondary structural unambiguously. For this article, a ‘non-homoplasious syna- element. For combined analyses of the Viridiplantae, a 5-gene pomorphy’ (NHS) is defined as ‘unique within the Viridiplan- alignment was generated, consisting of 18S rDNA sequences tae’; i.e. a synapomorphic change (e.g. A-U ) U-G) occurred plus 4 genes of the plastid-encoded rRNA operon. All 5 genes uniquely in the common ancestor of a clade, without character have usually been determined from the same taxa and strains, reversals (e.g. U-G ) A-U) in derived members of the clade, and in only two cases, sequences from genetically (almost) and without known parallel synapomorphies in other viridi- identical strains were used in combination (Scenedesmus plants. Convergent synapomorphies in non-viridiplant eukar- obliquus, Chlorokybus atmophyticus). For one analysis, three yotes are irrelevant here. Methods to identify all non- Rhodoplantae and three Glaucoplantae were added to the homoplasious synapomorphies (exhaustive NHS search) have alignment and used as outgroup (Table 1): Cyanidioschyzon been described previously (Marin et al. 2003, 2005). In brief, merolae (accession numbers: AB158485, AB002583), Comp- NHS-candidates revealed by initial synapomorphy searches sopogon caeruleus (AF342748, AM084276), Porphyridium using PAUP were first verified using alignments with up to aerugineum (AJ421145, AM084277), Cyanophora paradoxa 1000 viridiplant taxa, and finally tested by BLAST searches (AY823716, U30821), Glaucocystis nostochinearum (X70803, against all published sequences (http://blast.ncbi.nlm.nih.gov/ AM084274), Cyanoptyche gloeocystis (AJ007275, AM084275). Blast.cgi). Genes were aligned manually in the SeaView sequence editor Synapomorphies were generally described by their sec- (Galtier et al. 1996; http://pbil.univ-lyon1.fr/software/sea- ondary structural positions (Fig. 5; Table 2). Two different rRNA view.html) on the basis of conserved rRNA and tRNA secondary structure models and nomenclature (helix number- secondary structures. Intron positions were determined after ing) systems were applied here for NHS characterization: (1) Jackson et al. (2002). Prior to phylogenetic analyses, the European Ribosomal RNA Database (ERRD; http:// hypervariable gene regions, which could not be unambigu- bioinformatics.psb.ugent.be/webtools/rRNA/), and (2) the ously aligned, as well as intron sequences and intergenic Gutell Lab CRW site (http://www.rna.ccbb.utexas.edu/). spacers were removed from the alignments. Alignments used Although CRW and ERRD secondary structures are generally for analyses are available upon request. congruent and differ only in their helix numbering systems, Phylogenetic analyses: Phylogenetic tree reconstructions several helices in CRW and ERRD models show rather used four different methods: maximum likelihood (ML), significant differences, or are even absent from ERRD distance (neighbor joining; NJ), maximum parsimony (MP), diagrams. Furthermore, both models (folding patterns as well and Bayesian analyses. The appropriate model of sequence as nomenclature) have undergone considerable changes over

30 B. Marin and M. Melkonian recent years. Therefore, only the following ‘reference’ sec- Bhattacharya D, Weber K, An SS, Berning-Koch W (1998) ondary structure diagrams were used to describe the position Actin phylogeny identifies Mesostigma viride as a flagellate of NHS-type synapomorphies unambiguously. ancestor of the land plants. J Mol Evol 47:544–550 ERRD - 18S rRNA: Funaria hygrometrica and Sacchar- omyces cerevisiae; 16S rRNA and 23S rRNA: Thermus Bremer K (1985) Summary of green plant phylogeny and thermophilus (supplementary material in Wuyts et al. 2001). classification. Cladistics 1:369–385 CRW - 18S rRNA: Apis mellifera (Fig. 2AinGillespie et al. Cardol P, Bailleul B, Rappaport F, Derelle E, Beal D, 2006); 16S rRNA and 23S rRNA: Escherichia coli, actual Breyton C, Bailey S, Wollman FA, Grossman A, Moreau H, sequence numbering diagrams available from the CRW Finazzi G (2008) An original adaptation of photosynthesis in website (http://www.rna.ccbb.utexas.edu/). the marine green alga Ostreococcus. Proc Natl Acad Sci USA Exhaustive searches for hitherto unidentified environ- 105:7881–7886 mental sequences of Mamiellophyceae: To find and identify uncultured relatives of the Mamiellophyceae, BLAST searches Cavalier-Smith T (1993) The Origin, Losses and Gains of were targeted to the ‘nucleotide collection (nr/nt)’ as well as Chloroplasts. In Lewin RE (ed) Origin of Plastids: Symbiogen- the ‘Environmental samples (env_nt)’ databases at NCBI. As esis, Prochlorophytes and the Origins of Chloroplasts. Chap- Query sequence entries, rRNA genes from mamiellophytes man & Hall, New York, pp 291–348 were used to identify possible relatives (single-gene BLAST searches), resulting in several environmental 16S and 18S Chre´ tiennot-Dinet M-J, Courties C, Vaquer A, Neveux J, rDNA sequences, but no 23S rDNAs. Most hits were Clasutre H, Lautier J, Machado MC (1995) A new marine redundant sequences of Mamiellales from marine habitats picoeukaryote – Ostreococcus tauri gen. et sp. nov. (Chlor- (mainly Micromonas and Ostreococcus), and thus, searches ophyta, Prasinophyceae). Phycologia 34:285–292 were confined to the Dolichomastigales and Monomastigales. Christensen T (1962) Alger. In Boscher¨ TW, Lange M, In addition, specific BLAST searches were performed using Sørensen T (eds) Systematisk Botanik, vol. 2, no 2. Munks- short, largely conserved sequences as Querys (20-40 nt gaard, Copenhagen length) that contained a single NHS-type signature. All apparently significant hits that emerged from these BLAST Coleman AW (2009) Is there a molecular key to the level of searches, irrespective of their often-misleading taxonomic ‘‘biological species’’ in eukaryotes? A DNA guide. Mol designation (e.g. as ‘bacterium’ or ‘cyanobacterium’), were Phylogenet Evol 50:197–203 integrated in single-gene alignments of viridiplants including ‘true’ Mamiellophyceae. Preliminary phylogenetic analyses Courties C, Perasso R, Chre´ tinnot-Dinet M-J, Gouy M, (not shown) easily identified ‘false positives’ (non-mamiello- Guillou L, Troussellier M (1998) Phylogenetic analysis and phytes), which were accordingly excluded. Finally, environ- genome size of Ostreococcus tauri (Chlorophyta, Prasinophy- mental sequences were integrated in alignments used for ceae). J Phycol 34:844–849 Figure 1 (18S rDNA) or Figure 3 (using only the 16S rDNA Courties C, Vaquer A, Toussellier M, Lautier J, Chre´ tien- partition), and analyzed with ML, MP, and Bayesian methods. not-Dinet M-J, Neveux J, Machado C, Claustre H (1994) Smallest eukaryotic organism. Nature 370:255 Acknowledgements Derelle E, Ferraz C, Rombauts S, Rouze P, Worden AZ, Robbens S, Partensky F, Degroeve S, Echeynie S, Cooke R, Saeys Y et al (2006) Genome analysis of the smallest free- The authors wish to acknowledge financial sup- living eukaryote Ostreococcus tauri unveils many unique port from the University of Cologne. We are features. Proc Natl Acad Sci USA 103:11647–11652 (26 indebted to Dr. Barbara Surek for providing algal authors) cultures from the CCAC and for supplying Figure 8. Fawley MW, Qin MB, Yun Y (1999) The relationship between We thank three anonymous reviewers for their Pseudoscourfieldia marina and Pycnococcus provasolii (Pra- helpful suggestions. sinophyceae, Chlorophyta): evidence from 18S rDNA sequence data. J Phycol 35:838–843 Fawley MW, Yun Y, Qin M (2000) Phylogenetic analyses of References 18S rDNA sequences reveal a new coccoid lineage of the Prasinophyceae (Chlorophyta). J Phycol 36:387–393 Becker B, Marin B, Melkonian M (1994) Structure, composi- Fuller NJ, Campbell C, Allen DJ, Pitt FD, Zwirglmaierl K, tion and biogenesis of prasinophyte cell coverings. Proto- LeGall F, Vaulot D, Scanlan DJ (2006) Analysis of photo- plasma 181:233–244 synthetic picoeukaryote diversity at open ocean sites in the Becker B, Becker D, Kamerling JP, Melkonian M (1991) 2- Arabian Sea using a PCR biased towards marine algal Keto-sugar acids in green flagellates: a chemical marker for plastids. Aquat Microb Ecol 43:79–93 prasinophycean scales. J Phycol 27:498–504 Galtier N, Gouy M, Gautier C (1996) SeaView and Phylowin, Becker D, Becker B, Satir P, Melkonian M (1990) Isolation, two graphic tools for sequence alignment and molecular purification, and characterization of flagellar scales from the phylogeny. Comput Appl Biosci 12:543–548 green flagellate Tetraselmis striata (Prasinophyceae). Proto- plasma 156:103–112 Gillespie JJ, Johnston JS, Cannone JJ, Gutell RR (2006) Characteristics of the nuclear (18S, 5.8S, 28S and 5S) and Beech PL, Heimann K, Melkonian M (1991) Development of mitochondrial (12S and 16S) rRNA genes of Apis mellifera the flagellar apparatus during the cell cycle in unicellular (Insecta: Hymenoptera): structure, organization, and retro- algae. Protoplasma 164:23–37 transposable elements. Insect Mol Biol 15:657–686

31 Phylogeny and Classiﬁcation of the Mamiellophyceae class. nov.

Guillou L, Eikrem W, Chre´ tiennot-Dinet M-J, Le Gall F, Marin B, Melkonian M (1994) Flagellar hairs in prasinophytes Massana R, Romari K, Pedro´ s-Alio´ C, Vaulot D (2004) (Chlorophyta) – ultrastructure and distribution on the flagellar Diversity of picoplanktonic prasinophytes assessed by direct surface. J Phycol 30:659–678 nuclear SSU rDNA sequencing of environmental samples and novel isolates retrieved from oceanic and coastal marine Marin B, Melkonian M (1999) Mesostigmatophyceae, a new ecosystems. Protist 155:193–214 class of streptophyte green algae revealed by SSU rRNA sequence comparisons. Protist 150:399–417 Hasegawa M, Miyashita H, Kawachi M, Ikemoto H, Kurano M, Miyachi S, Chihara M (1996) Prasinoderma coloniale Marin B, Nowack ECM, Melkonian M (2005) A plastid in the gen. et sp. nov., a new pelagic coccoid prasinophyte from the making: evidence for a second primary endosymbiosis. Protist Western Pacific Ocean. Phycologia 35:170–176 156:425–432 Heimann K, Benting J, Timmermann S, Melkonian M (1989) Marin B, Palm A, Klingberg M, Melkonian M (2003) The flagellar developmental cycle in algae: two types of Phylogeny and taxonomic revision of plastid-containing flagellar development in uniflagellated algae. Protoplasma euglenophytes based on SSU rDNA sequence comparisons 153:14–23 and synapomorphic signatures in the SSU rRNA secondary structure. Protist 154:99–145 Jackson SA, Cannone JJ, Lee JC, Gutell RR, Woodson SA (2002) Distribution of rRNA introns in the three-dimensional Massjuk NP (2006) Chlorodendrophyceae class nov. (Chlor- structure of the ribosome. J Mol Biol 323:35–52 ophyta, Viridiplantae) in the Ukrainian flora: I. The volume, phylogenetic relations and taxonomical status. Ukr Bot J Jancek S, Gourbiere S, Moreau H, Piganeau G (2008) Clues 63:601–614 in Ukrainian about the genetic basis of adaptation that emerge from comparing the proteomes of two Ostreococcus ecotypes Mattox KR, Stewart KD (1973) Observations on the (Chlorophyta, Prasinophyceae). Mol Biol Evol 25:2293–2300 zoospores of Pseuendoclonium basiliense and Trichosarcina polymorpha (Chlorophyceae). Can J Bot 51:1425–1430 Karol KG, McCourt RM, Cimino MT, Delwiche CF (2001) The closest living relatives of land plants. Science 294: Mattox KR, Stewart KD (1984) Classification of the Green 2351–2353 Algae: a Concept Based on Comparative Cytology. In Irvine DEG, John DM (eds) Systematics of the Green Algae. Latasa M, Scharek R, Le Gall F, Guillou L (2004) Pigment Academic Press, London, pp 29–72 suites and taxonomic groups in Prasinophyceae. J Phycol 40:1149–1155 McCourt RM, Delwiche CF, Karol KG (2004) Charophyte algae and land plant origins. Trends Ecol Evol 19:661–666 Le Gall F, Rigaut-Jalabert F, Marie D, Garczarek L, Viprey M, Gobet A, Vaulot D (2008) Picopklankton diversity on the Melkonian M (1982) Structural and evolutionary aspects of South-East Pacific Ocean from cultures. Biogeosciences the flagellar apparatus in green algae and land plants. Taxon 5:203–214 31:255–265 Lemieux C, Otis C, Turmel M (2007) A clade uniting the green Melkonian M (1983) Mesostigma, a key organism in the algae Mesostigma viride and Chlorokybus atmophyticus evolution of two major classes of green algae and related to represents the deepest branch of the Streptophyta in the ancestry of land plants. Br Phycol J 18:206 chloroplast genome-based phylogenies. BMC Biol 5:2 Melkonian M (1984) Flagellar Apparatus Ultrastructure in Lepere C, Domaizon I, Debroas D (2008) Unexpected Relation to Green Algal Classification. In Irvine DEG, John DM importance of potential parasites in the composition of the (eds) Systematics of the Green Algae. Academic Press, freshwater small-eukaryote community. Appl Environ Micro- London, pp 73–120 biol 74:2940–2949 Melkonian M (1990) Phylum Chlorophyta: Class Prasinophy- Lewin RA, Krienitz L, Goericke R, Takeda H, Hepperle D ceae. In Margulis L, Corliss JO, Melkonian M, Chapman D (2000) Picocystis salinarum gen. et sp. nov. (Chlorophyta) – (eds) Handbook of Protoctista. Jones and Bartlett Publishers, new picoplanktonic green alga. Phycologia 39:560–565 Boston, pp 600–607 Lewis LA, McCourt RM (2004) Green algae and the origin of Melkonian M, Robenek H (1981) Comparative ultrastructure land plants. Am J Bot 91:1535–1556 of underlayer scales in four species of the green flagellate Mai JC, Coleman AW (1997) The internal transcribed spacer Pyramimonas: a freeze-fracture and thin section study. 2 exhibits a common secondary structure in green algae and Phycologia 20:365–376 44 flowering plants. J Mol Biol :258–271 Melkonian M, Surek B (1995) Phylogeny of the Chlorophyta: Manton I (1965) Some Phyletic Implications of Flagellar congruence between ultrastructural and molecular evidence. Structure in Plants. In Preston RD (ed) Advances in Botanical Bull Soc Zool Fr 120:191–208 Research, Vol II. Academic Press, London and New York, pp Melkonian M, Marin B, Surek B (1995) Phylogeny and 1–34 Evolution of the Algae. In Arai R, Kato M, Doi Y (eds) Manton I (1967) Electron microscopical observations on a Biodiversity and Evolution. The National Science Museum clone of Monomastix Scherffel in culture. Nova Hedwigia Foundation, Tokyo, pp 153–176 14:1–11 Miyashita H, Ikemoto H, Kurano N, Miyachi S, Chihara M Manton I, Parke M (1960) Further observations on small (1993) Prasinococcus capsulatus. gen. et sp. nov., a new green flagellates with special reference to possible relatives of marine coccoid prasinophyte. J Gen Appl Microbiol 39: Chromulina pusilla Butcher. J Mar Biol Assoc UK 39:275–298 571–582

32 B. Marin and M. Melkonian

Moestrup Ø (1982) Flagellar structure in algae: a review, with Rodriguez F, Derelle E, Guillou L, Le Gall F, Vaulot D, new observations particularly on the Chrysophyceae, Phaeo- Moreau H (2005) Ecotype diversity in the marine picoeukar- phyceae (Fucophyceae), Euglenophyceae, and Reckertia. yote Ostreococcus (Chlorophyta, Prasinophyceae). Environ Phycologia 21:427–528 Microbiol 7:853–859 Moestrup Ø (1984) Further studies on Nephroselmis and its Rodrı´guez-Ezpeleta N, Philippe H, Brinkmann H, Becker B, allies (Prasinophyceae); II. Mamiella gen. nov., Mamiellaceae Melkonian M (2007) Phylogenetic analyses of nuclear, fam. nov., Mamiellales ord. nov. Nord J Bot 4:109–121 mitochondrial, and plastid multigene data sets support the placement of Mesostigma in the Streptophyta. Mol Biol Evol Moestrup Ø (1991) Further studies of presumedly primitive 24:723–731 green algae, including the description of Pedinophyceae class.nov. and Resultor gen. nov. J Phycol 27:119–133 Rogers CE, Domozych DS, Stewart KD, Mattox KR (1981) The flagellar apparatus of Mesostigma viride (Prasinophy- Moestrup Ø, Throndsen J (1988) Light and electron micro- ceae): multilayered structures in a scaly green flagellate. Pl scopical studies on Pseudoscourfieldia marina, a primitive Syst Evol 138:247–258 scaly green flagellate (Prasinophyceae) with posterior flagella. Can J Bot 66:1415–1434 Ronquist F, Huelsenbeck JP (2003) MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics Müller T, Philippi N, Dandekar T, Schultz J, Wolf M (2007) 19:1572–1574 Distinguishing species. RNA 13:1469–1472 Scherffel A (1912) Zwei neue, trichocystenartige Bildungen Nakada T, Misawa K, Nozaki H (2008) Molecular systematics fuhrende¨ Flagellaten. Arch Protistenkd 27:94–128 of Volvocales (Chlorophyceae, Chlorophyta) based on exhaustive 18S rRNA phylogenetic analyses. Mol Phylogen Schulze D, Robenek H, McFadden GI, Melkonian M (1987) Evol 48:281–291 Immunolocalization of a Ca2+-modulated contractile protein in the flagellar apparatus of green algae: the nucleus-basal body Nakayama T, Kawachi M, Inouye I (2000) Taxonomy and the connector. Eur J Cell Biol 45:51–61 phylogenetic position of a new prasinophycean alga, Crusto- mastix didyma gen. & sp. nov. (Chlorophyta). Phycologia Six C, Finkel ZV, Rodriguez F, Marie D, Partensky F, 39:337–348 Campbell DA (2008) Contrasting photoacclimation costs in ecotypes of the marine eukaryotic picoplankter Ostreococcus. Nakayama T, Suda S, Kawachi M, Inouye I (2007) Phylogeny Limnol Oceanogr 53:255–265 and ultrastructure of Nephroselmis and Pseudoscourfieldia (Chlorophyta), including the description of Nephroselmis Slapeta J, Lopez-Garcia P, Moreira D (2006) Global anterostigmatica sp. nov. and a proposal for the Nephroselmi- dispersal and ancient cryptic species in the smallest marine dales ord. nov. Phycologia 46:680–697 eukaryotes. Mol Biol Evol 23:23–29 Nakayama T, Marin B, Kranz HD, Surek B, Huss VAR, Steinkotter¨ J, Bhattacharya D, Semmelroth I, Bibeau C, Inouye I, Melkonian M (1998) The basal position of scaly Melkonian M (1994) Prasinophytes form independent green flagellates among the green algae (Chlorophyta) is lineages within the Chlorophyta: evidence from ribosomal revealed by analyses of nuclear-encoded SSU rRNA RNA sequence comparisons. J Phycol 30:340–345 sequences. Protist 149:367–380 Stoeck T, Hayward B, Taylor GT, Varela R, Epstein SS Not F, Latasa M, Marie D, Cariou T, Vaulot D, Simon N (2006) A multiple PCR-primer approach to access micro- (2004) A single species, Micromonas pusilla (Prasinophyceae), eukaryotic diversity in environmental samples. Protist 157: dominates the eukaryotic picoplankton in the western English 31–43 channel. Appl Environ Microbiol 70:4064–4072 Surek B, Melkonian M (2004) CCAC – Culture collection of Not F, Latasa M, Scharek R, Viprey M, Karleskind P, algae at the University of Cologne: a new collection of axenic Balague V, Ontorio-Oviedo I, Cumino A, Goetze E, Vaulot algae with emphasis on flagellates. Nova Hedwigia 79: D, Massana R (2008) Protistan assemblages across the 77–91 Indian Ocean, with a specific emphasis on the picoeukaryotes. Deep Sea Res 55:1456–1473 Sym SD, Pienaar RN (1993) The Class Prasinophyceae. In Round FE, Chapman DJ (eds) Progress in Phycological Palenik B, Grimwood J, Aerts A, Rouze P, Salamov A, Research, Vol. 9. Biopress Ltd, Bristol, pp 281–376 Putnam N, Dupont C, Jorgensen R, Derelle E, Rombauts S, Zhou KM et al (2007) The tiny eukaryote Ostreococcus Throndsen J, Zingone A (1997) Dolichomastix tenuilepis sp. provides genomic insights into the paradox of plankton nov., a first insight into the microanatomy of the genus speciation. Proc Natl Acad Sci USA 104:7705–7710 (36 Dolichomastix (Mamiellales, Prasinophyceae, Chlorophyta). authors) Phycologia 36:244–254 Pickett-Heaps JD (1968) Ultrastructure and differentiation in Turmel M, Otis C, Lemieux C (2009b) The chloroplast Chara (fibrosa). IV. Spermatogenesis. Aust J Biol Sci 21: genomes of the green algae Pedinomonas minor, 655–690 Parachlorella kessleri and Oocystis solitaria reveal a shared ancestry between the Pedinomonadales and Chlorellales. Mol Posada D (2008) jModel test: phylogenetic model averaging. Biol Evol 26:2317–2331 Mol Biol Evol 25:1253–1256 Turmel M, Gagnon M-C, O’Kelly CJ, Otis C, Lemieux C Potter D, LaJeunesse TC, Saunders GW, Andersen RA (1997) (2009a) The chloroplast genomes of the green algae Convegrent evolution masks extensive biodiversity among Pyramimonas, Monomastix and Pycnococcus shed new light marine coccoid picoplankton. Biodivers Conserv 6:99–107 on the evolutionary history of prasinophytes and the origin of

33 Phylogeny and Classification of the Mamiellophyceae class. nov. the secondary chloroplasts of euglenids. Mol Biol Evol importance of the eukaryotic component. Limnol Oceanogr 26:631–648 49:168–179 Turner FR (1968) An ultrastructural study of plant spermato- Worden AZ, Lee JH, Mock T, Rouze P, Simmons MP, Aerts genesis. Spermatogenesis in Nitella. J Cell Biol 37:370–393 AL, Allen AE, Cuvelier ML, Derelle E, Everett MV, Foulon E Urbach E, Vergin KL, Young L, Morse A, Larson GL, et al (2009) Green evolution and dynamic adaptations Giovannoni SJ (2001) Unusual bacterioplankton community revealed by genomes of the marine picoeukaryote Micro- structure in ultra-oligotrophic Crater Lake. Limnol Oceanogr monas. Science 324:268–272 (51 authors) 46:557–572 Wustman BA, Melkonian M, Becker B (2004) A study of cell Vaulot D, Eikrem W, Viprey M, Moreau H (2008) The diversity wall and flagella formation during cell division in the scaly of small eukaryotic phytoplankton (r3 mm) in marine ecosys- green alga, Scherffelia dubia. J Phycol 40:895–910 tems. FEMS Microbiol Rev 32:795–820 Wuyts J, Van de Peer Y, De Wachter R (2001) Distribution of Viprey M, Guillou L, Ferre´ ol M, Vaulot D (2008) Wide genetic substitution rates and location of insertion sites in the diversity of picoplanktonic green algae (Chloroplastida) in the tertiary structure of ribosomal RNA. Nucleic Acids Res 29: Mediterranean Sea uncovered by a phylum-biased PCR 5017–5028 approach. Environ Microbiol 10:1804–1822 Zingone A, Borra M, Brunet C, Forlani G, WHCF Kooistra, Worden AZ (2006) Picoeukaryote diversity in coastal waters Procaccini G (2002) Phylogenetic position of Crustomastix of the Pacific Ocean. Aquat Microb Ecol 43:165–175 stigmatica sp. nov. and Dolichomastix tenuilepis in relation to Worden AZ, Nolan JK, Palenik B (2004) Assessing the the Mamiellales (Prasinophyceae, Chlorophyta). J Phycol dynamics and ecology of marine picophytoplankton: the 38:1024–1039