Expression of Estrogen Receptor Alpha and Beta Is Decreased in Hypospadias Liang Qiao,* Esequiel Rodriguez, Jr.,* Dana A

Home , MAX (gene)

Expression of Estrogen Receptor Alpha and Beta is Decreased in Hypospadias Liang Qiao,* Esequiel Rodriguez, Jr.,* Dana A. Weiss, Max Ferretti, Gail Risbridger, Gerald R. Cunha and Laurence S. Baskin†

From the Division of Pediatric Urology, University of California, San Francisco Children’s Hospital, San Francisco, California, and Department of Anatomy and Developmental Biology, Monash University, Clayton, Victoria, Australia (GR)

␣ ␤ Purpose: Estrogenic endocrine disruptors acting via estrogen receptors and Abbreviations have been implicated in the etiology of hypospadias. However, the expression and and Acronyms ␣ ␤ distribution of estrogen receptors and in normal and hypospadiac human ER ϭ estrogen receptor foreskins is unknown. We characterized the location and expression of estrogen ESR1 ϭ estrogen receptor alpha receptors ␣ and ␤ in normal and hypospadiac foreskins. ϭ Materials and Methods: We prospectively collected excess foreskin from 35 ESR2 estrogen receptor beta patients undergoing hypospadias repair and 15 patients undergoing elective GADPH ϭ glyceraldehyde-3- circumcision. Hypospadias was classified as severe in 18 patients and mild in 17 phosphate dehydrogenase based on the ectopic position of the meatus. mRNA expression levels in estrogen IHC ϭ immunohistochemical receptors ␣ and ␤ were quantified using reverse transcriptase polymerase chain PCR ϭ polymerase chain reaction reaction. Receptor location was characterized by immunohistochemical analysis. RT ϭ reverse transcriptase Additionally immunohistochemical analysis was performed in 4 archived human fetal penises. Ϯ Ϯ Submitted for publication August 14, 2011. Results: Mean SD ages were similar for the circumcision (9.5 3 months) and Study was approved by University of Califor- hypospadias repair groups (9 Ϯ 3 months, p ϭ 0.75). mRNA expression levels in nia, San Francisco human research committee. estrogen receptors ␣ and ␤ were significantly decreased in hypospadiac foreskin Study was supported by NIH Grant RO1 Ͻ DK0581050. cases compared to controls (p 0.001), while no statistically significant differ- * Each author contributed equally to the study. ences were seen between foreskins with severe and mild hypospadias. Estrogen † Correspondence: Division of Pediatric Urol- receptor ␤ immunostaining was strong in normal foreskin but weak in hypospa- ogy, University of California, San Francisco Chil- diac foreskin. Estrogen receptor ␤ immunoreactivity was most intense in the dren’s Hospital, San Francisco, California 94143 (e-mail: [email protected]). stratum basale and stratum spinosum. Estrogen receptor ␣ immunostaining was weak in normal and mild hypospadias foreskin, and undetectable in severe hypospadias. Fetal penises expressed strong estrogen receptor ␤ immunopositivity in the urethral plate epithelium, corpus spongiosum, corpora cavernosa and penile skin, while estrogen receptor ␣ immunostaining was not detected. Conclusions: These data demonstrate a difference in estrogen receptor ␣ and ␤ expression and location in the foreskin of patients with hypospadias compared to controls. These findings are consistent with aberrant estrogenic effects having a role in the etiology of hypospadias.

Key Words: foreskin; hypospadias; penile diseases; penis; receptors, estrogen

HYPOSPADIAS is a common congenital dias is associated with penile curva- abnormality characterized by an ecto- ture and incomplete development of pic urethral meatus along the ventral the ventral foreskin.1,2 Hypospadias surface of the penis proximal to the affects approximately 1 in 200 to 300 normal glanular location. Hypospa- live male births,1 although recent ep-

0022-5347/12/1874-1427/0 Vol. 187, 1427-1433, April 2012 ® THE JOURNAL OF UROLOGY Printed in U.S.A. www.jurology.com 1427 © 2012 by AMERICAN UROLOGICAL ASSOCIATION EDUCATION AND RESEARCH,INC. DOI:10.1016/j.juro.2011.12.008 1428 ESTROGEN RECEPTORS ALPHA AND BETA IN PATIENTS WITH HYPOSPADIAS

idemiological data suggest an increasing inci- eliminate DNA contamination by using proteinase K (1.3 dence.3–5 Although the etiology remains elusive, a mg, Roche Diagnostics GmbH, Mannheim, Germany) and possible explanation for the increasing incidence of RNase-free DNase I (20 ␮l, Qiagen, Inc., Valencia, Cali- hypospadias in industrialized countries is fetal ex- fornia). A NanoDrop® spectrophotometer was used to posure to estrogenic compounds or other environ- measure the quantity and purity of RNA. mental endocrine disruptors.4,6 Supporting this the- RT-PCR was performed according to standard protocol. Briefly 2.5 ␮g RNA were reverse transcribed in a reaction ory is the observation that male offspring of women volume of 20 ␮l and diluted with Tris-ethylenediaminetet- exposed to diethylstilbestrol during pregnancy have 7 raacetic acid buffer (10 mM Tris HCl, pH 8, 1 mM ethyl- a higher incidence of hypospadias, consumption of enediaminetetraacetic acid). PCR primers were designed phytoestrogens (such as genistein) during gestation according to the specific target gene sequence published in is associated with a higher incidence of hypospadias PubMed and were synthesized by IDT®. The RT-PCR 8 in boys, and in laboratory models neonatal expo- primers are outlined in the Appendix. SYBR® Green real- sure to estrogens and genistein causes hypospa- time quantitative PCR was performed using a 7300 fast dias.9–11 Consistent with this theory is the discovery sequence detection system (Applied Biosystems™) accord- of estrogen receptors ␣ and ␤, crucial for signal ing to the manufacture instructions. Primer titration and transduction of estrogenic substances, in the penile dissociation experiments were performed so that no tissue of rat,12 mouse13 and humans.14,15 primer dimers or false amplifications would interfere with Human skin contains ESR1 and ESR2, and is an the result. Cycle threshold number was extracted for the important estrogen responsive organ.16 Although reference (GADPH) and target genes with auto baseline foreskin may have similar characteristics, to date and manual thresholds. PCR was repeated 3 times for each sample. Expression levels of ESR1 and ESR2 are the exact location and expression of estrogen recep- reported relative to GADPH using a 2 delta-delta cycle tors have not been defined in normal or hypospadiac threshold.18 There was no difference in the amplification human foreskin. Characterizing the cellular location kinetics of GADPH and ESR1/ESR2. and expression patterns of estrogen receptors in normal and hypospadiac human foreskin may expand Immunohistochemical Staining our understanding of the causes of hypospadias be- Foreskin samples were fixed in formalin, paraffin embed- ␮ yond the murine model. In this study we used real- ded and sectioned at 5 m. Antigens were retrieved with time polymerase chain reaction to qualify the mRNA antigen unmasking solution (Vector Laboratories, Inc., Burlingame, California). After blocking, slides were incu- expression of ESR1 and ESR2, and immunohisto- bated overnight at 4C with rabbit anti-ER␤ antibody (1:100 chemical staining to determine receptor location. We dilution, Upstate Biotechnology, Inc., Lake Placid, New hypothesize that the location and expression of York), and mouse anti-ER␣ antibody (1:30 dilution, cloneID5, ESR1 and ESR2 differ between normal and hypos- Dakocytomation, Carpinteria, California). Staining of the padiac foreskin. tissue was performed with the Elite ABC kit (Vector Labo- ratories, Inc.), followed by hematoxylin counterstaining. Adult mouse uterus and prostate served as positive con- MATERIALS AND METHODS trols for ER␣ and ER␤. Sections exposed to all steps except This study was approved by the University of California, application of the primary antibodies were used as nega- San Francisco human research committee. Any subject tive controls. Four human fetal penises from our tissue younger than 14 months undergoing initial hypospadias bank were also processed in a similar protocol. To confirm ␣ repair or elective circumcision at the University of Cali- our results concerning the lack of detectable ER in the fornia, San Francisco between 2005 and 2010 was eligible human fetal tissue, we repeated the analysis using a dif- ␣ for the study. All subjects were prospectively enrolled, and ferent mouse monoclonal anti-ER antibody (1:100 dilu- informed consent was obtained preoperatively from par- tion, ab2746, abcam®). Stained serial sections were exam- ents/legal guardians. Excess preputial tissue was obtained ined using a DM4000B brightfield microscope (Leica from 35 male subjects with hypospadias undergoing sur- Microsystems, Inc., Buffalo Grove, Illinois). Digital im- gical repair and 15 patients undergoing elective circumci- ages were acquired with a DFC500 camera (Leica Micro- sion. The degree of hypospadias was determined by the systems, Inc.). Once images were taken, the density of position of the ectopic urethral meatus and was classified nuclear staining was graded on a subjective scale as none as mild (at or distal to mid shaft of penis) in 17 patients (0), weak (ϩ), intermediate (ϩϩ) or strong (ϩϩϩ). Each and severe (proximal to mid shaft of penis) in 18. Four determination was based on the agreement of 2 observers human fetal penises were obtained from our archived who were blinded to the treatment group when inspecting tissue bank. Estimated gestational ages based on last the images. menstrual period, head circumference and femur length Statistical Analysis were approximately 8 to 10, 14, 20 and 24 weeks. The difference in mRNA expression levels of ESR1 and RNA Extraction, and RT and Real-Time PCR ESR2 between controls, subjects with mild hypospadias RNA extraction was performed using a protocol similar to and subjects with severe hypospadias was determined using those described previously.17 Briefly an RNeasy® Midi Kit ANOVA with Bonferroni correction. Statistical analysis was was used to isolate RNA. The protocol was modified to performed with SPSS® Statistics, version 17. ESTROGEN RECEPTORS ALPHA AND BETA IN PATIENTS WITH HYPOSPADIAS 1429

RESULTS tum basale (fig. 2). In contrast, in severe hypospadias there was no detectable expression. In normal Subject Characteristics foreskin ER␤ was strongly expressed in the keratin- Mean Ϯ SD ages were similar for the circumcision ocytes of the stratum basale and stratum spinosum. (9.5 Ϯ 3 months) and hypospadias repair groups (9 Ϯ 3 months, p ϭ 0.75). The meatal location in the In contrast, in mild and severe hypospadias foreskin 17 subjects with mild hypospadias was glanular in 2, immunoreactivity was weak. subcoronal in 4, distal shaft in 5 and mid shaft in 6. ␣ ␤ The meatal location in the 18 patients with severe ER and ER IHC Staining in Normal Fetal Penis ␣ hypospadias was proximal penile shaft in 8, penos- ER immunoreactivity was undetectable in all hu- crotal junction in 6 and perineal in 4. man fetal penile tissues examined (data not shown). In contrast, ER␤ was strongly expressed in human mRNA Expression of ESR1 and fetal penis, including the urethral plate epithelium, ESR2 in Normal and Hypospadiac Foreskins corpus spongiosum, erectile tissue, and penile epi- Ϯ In normal human foreskin the mean SD expres- thelium and foreskin (fig. 3). sion level of ESR1 mRNA (relative to GADPH) was 6.4% Ϯ 3.3%, while that of ESR2 was higher at 13.6% Ϯ 6.9% (fig. 1). Mean Ϯ SD ESR1 mRNA expression was significantly lower in mild (1.9% Ϯ DISCUSSION 1.2%) and severe hypospadias foreskin (1.0% Ϯ Skin is an important estrogen responsive organ and 0.7%) compared to normal foreskin (6.4% Ϯ 3.3%, has the capacity to synthesize active steroids from p Ͻ0.001). There was no significant difference be- inactive adrenal precursors.16 Hormone receptors tween mild and severe hypospadias in ESR1 mRNA have been described in normal human skin, and expression levels. Similarly mean Ϯ SD ESR2 estrogen receptors in particular have been associ- mRNA expression was significantly lower in mild ated with skin tag malformations.19–21 As foreskin (2.1% Ϯ 1.9%) and severe hypospadias foreskin abnormalities are part of the constellation of anom- (1.1% Ϯ 0.9%) vs normal foreskin (13.6% Ϯ 6.9%, alies that characterize hypospadias, a description of p Ͻ0.001). There was no significant difference be- the cellular location and expression patterns of es- tween mild and severe hypospadias in ESR2 mRNA trogen receptors in normal and hypospadiac human expression levels. Therefore, in normal foreskin foreskin in infants may lend insight into the etiology ESR1 and ESR2 mRNA expression was higher than of abnormal urethral development. in hypospadiac foreskin. To our knowledge this is the first study evaluat- ER␣ and ER␤ IHC Staining in ing ESR1 and ESR2 location and expression in nor- Normal and Hypospadiac Foreskins mal and hypospadiac foreskin in infants of similar In normal and mild hypospadias foreskin ER␣ im- age. Our study reveals that normal foreskin in male munoreactivity was weak and localized to the stra- infants contains ESR1 and ESR2 mRNA. Our im-

Figure 1. Expression levels of ESR1 and ESR2 mRNA in human foreskin evaluated with real-time RT-PCR were signiﬁcantly higher in normal vs hypospadiac foreskin (p Ͻ0.001). No statistically signiﬁcant differences were seen between severe and mild hypospadias foreskins. 1430 ESTROGEN RECEPTORS ALPHA AND BETA IN PATIENTS WITH HYPOSPADIAS

Figure 2. Expression of ESR1 and ESR2 in normal and hypospadiac foreskins. ER␣ immunostaining was weak in normal and mild hypospadias foreskins and limited to stratum basale. ER␣ immunostaining was undetectable in severe hypospadias. ER␤ immunostaining was strong in normal foreskin but weak in mild and severe hypospadias foreskin. ER␤ immunoreactivity was most intense in keratinocytes of stratum basale and stratum spinosum. H&E, reduced from ϫ100. munolocalization results demonstrate that ER␤ is man foreskins to determine if differences in ER strongly expressed in foreskin, whereas ER␣ is subtypes exist that may further our understand- weakly positive. ing of genitourinary development. We found that Our findings are in accordance with previous ste- foreskins of male infants with hypospadias have roid receptor studies where ER␤ was the major re- significantly decreased ESR1 and ESR2 expres- 19,20 ceptor expressed in normal human skin. ER␤ sion levels compared to normal controls of similar immunoreactivity was strongly positive and mostly ages. Although there was a trend toward lower limited to the nuclear compartment of keratinocytes estrogen receptor expression levels in severe localized in the stratum basale and stratum spino- grades compared to mild grades of hypospadias, sum, which is exactly what we observed in normal the difference did not reach statistical signifi- foreskin. In a related study using 12-week gestation cance. Our findings suggest that changes in estro- human fetal penile tissue IHC staining also showed gen receptor levels may be involved in normal and positivity for estrogen receptor in penile skin, al- abnormal foreskin development. As a corollary, though the exact location and expression and recep- this finding may be akin to the dermatology liter- tor subtypes were not further elucidated.15 Our hu- ature where ESR1 and ESR2 levels have been man fetal data reveal that ER␤ is expressed in fetal shown to be significantly higher in skin tags com- foreskin, with the highest intensity noted in the 21 stratum basale. In contrast to normal prepuce, our pared to normal human skin, or the breast cancer IHC results demonstrate that estrogen receptors are literature where ESR1 and ESR2 are differentially either weakly expressed or undetectable in the fore- expressed in benign tumors, primary cancers and re- 22 skin of boys with hypospadias. Taken together, current cancer. these observations suggest that estrogen receptors, In humans normal urethral development involves particularly ER␤, have a role in the normal devel- the midline fusion of the paired urethral folds with opment of human foreskin. subsequent formation and remodeling of an epithe- 23,24 Exposure to hormonally active substances during lial seam. The abnormalities seen in hypospa- external genitalia development is associated with dias can be viewed as an abortive midline fusion of increased risk of congenital genitourinary malfor- the urethral folds and corpus spongiosum. Endo- mations.4,6 We quantified mRNA expression levels crine disruptors interacting with estrogen receptors of ESR1 and ESR2 in normal and hypospadiac hu- have been implicated in the increasing incidence of ESTROGEN RECEPTORS ALPHA AND BETA IN PATIENTS WITH HYPOSPADIAS 1431

Figure 3. ER␤ immunostaining. A and B, coronal sections of 8 to 10-week human fetal penis. Note strong ER␤ staining in urethral groove/plate, glans stroma and erectile tissue. C and D, transverse sections of 24-week human fetal penis at level of glans. Note strong ER␤ immunopositivity in foreskin epithelium, foreskin stroma, inner preputial lamina, urothelium and corpus spongiosum. H&E, reduced from ϫ200. Insets reduced from ϫ25. hypospadias.25–27 In a mouse model in utero estro- and penile skin in all of the human fetal specimens. gen exposure resulted in the failure of seam forma- Evrard and Balthazart reported that the corpus cav- tion and the developmental arrest of tissue sur- ernosum, corpus spongiosum and urethral epithe- rounding the urethra.9 In a related study using lium in humans expressed estrogen receptors ␣ and human fetal penile smooth muscle cells ER␣ and ␤, with ER␤ exhibiting stronger immunostaining ER␤ were reported to be functionally active recep- than ER␣.28 Similarly Crescioli et al reported es- tors.15 Furthermore, incubation of human fetal pe- trogen receptors in the urethra, glans and stromal nile smooth muscle cells with increasing concentra- cells of the corpus cavernosum of the developing tions of estrogen (17␤-estradiol) resulted in a dose human fetal penis.15 Furthermore, in a cellular dependent decrease in cell proliferation. Taken to- model of human fetal penile smooth muscle cells gether with our ﬁndings, these results suggest that ESR1 and ESR2 were observed, with higher mean estrogen and estrogen receptors may be involved in ESR2 mRNA expression compared to ESR1.15 penile malformations. When viewed in this context, our ﬁndings raise the Although the urethra and corpus spongiosum possibility that down-regulation of ESR1 and were not directly examined in our surgical cohort, it ESR2 may have a role in congenital penile mal- is possible that similar down-regulation of estrogen formations such as hypospadias. receptors occurs in the hypospadiac urethra and cor- Our results need to be interpreted with caution. pus spongiosum, as these penile tissues contain sim- Although our IHC and real-time PCR results corre- ilar receptors to those found in foreskin. Indeed, we lated well with each other, we did not directly study noted strong ER␤ immunostaining in the urothe- normal or hypospadiac urethral tissue in patients lium and corpus spongiosum, corpus cavernosum undergoing surgery. It is possible that events occur- 1432 ESTROGEN RECEPTORS ALPHA AND BETA IN PATIENTS WITH HYPOSPADIAS

ring in the foreskin, whose epithelium is ectodermal estrogen receptors may have a significant role in in origin, may not be occurring in the urethra, normal and abnormal penile development. To our whose epithelium is endodermal in origin. Fur- knowledge this is the first study of the expression thermore, we did not study the events at the crit- and location of ESR1 and ESR2 in normal foreskin ical time of external genitalia development and and preputial tissue in patients with hypospadias. urethral malformation. To help circumvent differ- In normal foreskin there is strong ER␤ immuno- ences that may be attributed to postnatal hor- histochemical staining but weak ER␣ staining. In monal changes, we evaluated male infants of sim- hypospadiac foreskin ER␤ immunohistochemical ilar age. Finally, we did not detect ER␣ in fetal staining is weak and ER␣ is weak (mild hypospa- penile tissue, although it was seen in the normal dias) or undetectable (severe hypospadias). Simi- and mild hypospadias foreskins in the neonate but larly the mRNA expression levels of ESR1 and ␣ not in severe hypospadias. It may be that ER is ESR2 are significantly lower in hypospadiac fore- present in fetal penile tissue but our current skin compared to normal foreskin. The differential methods/antibodies simply did not detect it. Alter- expression of ESR1 and ESR2 in the foreskin of natively it is possible that prenatal receptor ex- patients with hypospadias merits further investi- pression levels may also change during develop- gation to elucidate the role of estrogen receptor ment in humans, as noted in mouse13 and rat subtypes in the etiology of hypospadias. models.29 Indeed, our laboratory continues to ex- plore different modern IHC techniques and use of different antibodies in hopes of clarifying ER␣ APPENDIX expression in human fetal penile development. Gene Primer Sequences Product Size (bp)

ESR1 F: AGATCTTCGACATGCTGCTGGCTA 137 CONCLUSIONS R: AGACTTCAGGGTGCTGGACAGAAA In view of past observations that ESR2 is ubiqui- ESR2 F: TGGGCACCTTTCTCCTTTAGTGGT 85 R: TCTTGCTTCACACCAGGGACTCTT tously expressed in human penile vasculature, cor- GADPH F: CATGTTCGTCATGGGTGTGAACCA 160 pus cavernosum, urothelium and now foreskin, as R: AGTGATGGCATGGACTGTGGTCAT seen in this study, we propose that estrogen and

REFERENCES 1. Paulozzi LJ: International trends in rates of hy- Study of Pregnancy and Childhood. BJU Int 2000; sum and male urethra. J Histochem Cytochem pospadias and cryptorchidism. Environ Health 85: 107. 2004; 52: 355. Perspect 1999; 107: 297. 9. Yucel S, Cavalcanti AG, Desouza A et al: The 15. Crescioli C, Maggi M, Vannelli GB et al: Expres- 2. Leung AK and Robson WL: Hypospadias: an up- effect of oestrogen and testosterone on the ure- sion of functional estrogen receptors in human date. Asian J Androl 2007; 9: 16. thral seam of the developing male mouse genital fetal male external genitalia. J Clin Endocrinol tubercle. BJU Int 2003; 92: 1016. Metab 2003; 88: 1815. 3. Toppari J, Kaleva M and Virtanen HE: Trends in the incidence of cryptorchidism and hypospa- 10. Wisniewski AB, Cernetich A, Gearhart JP et al: 16. Thornton MJ: The biological actions of estrogens dias, and methodological limitations of regis- Perinatal exposure to genistein alters repro- on skin. Exp Dermatol 2002; 11: 487. try-based data. Hum Reprod Update 2001; 7: ductive development and aggressive behavior 282. in male mice. Physiol Behav 2005; 84: 327. 17. Qiao L, Tasian GE, Zhang H et al: ZEB1 is estrogen responsive in vitro in human foreskin 11. Vilela ML, Willingham E, Buckley J et al: Endo- 4. Baskin LS, Himes K and Colborn T: Hypospadias cells and is over expressed in penile skin in crine disruptors and hypospadias: role of and endocrine disruption: is there a connection? patients with severe hypospadias. J Urol 2011; genistein and the fungicide vinclozolin. Urology Environ Health Perspect 2001; 109: 1175. 185: 1888. 2007; 70: 618. 5. Paulozzi LJ, Erickson JD and Jackson RJ: Hypos- 18. Livak KJ and Schmittgen TD: Analysis of relative padias trends in two US surveillance systems. 12. Jesmin S, Mowa CN, Matsuda N et al: Evidence gene expression data using real-time quantitative Pediatrics 1997; 100: 831. for a potential role of estrogen in the penis: detection of estrogen receptor-alpha and -beta PCR and the 2(-Delta Delta C(T)) method. Meth- 6. Toppari J and Skakkebaek NE: Sexual differenti- messenger ribonucleic acid and protein. Endocri- ods 2001; 25: 402. ation and environmental endocrine disrupters. nology 2002; 143: 4764. Baillieres Clin Endocrinol Metab 1998; 12: 143. 19. Thornton MJ, Taylor AH, Mulligan K et al: The 13. Agras K, Willingham E, Shiroyanagi Y et al: distribution of estrogen receptor beta is distinct 7. Swan SH: Intrauterine exposure to diethylstilbes- Estrogen receptor-alpha and beta are differen- to that of estrogen receptor alpha and the andro- trol: long-term effects in humans. APMIS 2000; tially distributed, expressed and activated in gen receptor in human skin and the piloseba- 108: 793. the fetal genital tubercle. J Urol 2007; 177: ceous unit. J Investig Dermatol Symp Proc 2003; 2386. 8: 100. 8. North K and Golding J: A maternal vegetarian diet in pregnancy is associated with hypospadias. 14. Dietrich W, Haitel A, Huber JC et al: Expression 20. Thornton MJ, Taylor AH, Mulligan K et al: Oes- The ALSPAC Study Team. Avon Longitudinal of estrogen receptors in human corpus caverno- trogen receptor beta is the predominant oestro- ESTROGEN RECEPTORS ALPHA AND BETA IN PATIENTS WITH HYPOSPADIAS 1433

gen receptor in human scalp skin. Exp Dermatol 24. Kurzrock EA, Baskin LS and Cunha GR: Ontogeny 27. Beleza-Meireles A, Omrani D, Kockum I et al: 2003; 12: 181. of the male urethra: theory of endodermal differ- Polymorphisms of estrogen receptor beta gene entiation. Differentiation 1999; 64: 115. are associated with hypospadias. J Endocrinol 21. El Safoury O, Rashid L and Ibrahim M: A study of Invest 2006; 29: 5. androgen and estrogen receptors alpha, beta in 25. Couse JF, Dixon D, Yates M et al: Estrogen skin tags. Indian J Dermatol 2010; 55: 20. receptor-alpha knockout mice exhibit resistance 28. Evrard HC and Balthazart J: Aromatization of to the developmental effects of neonatal dieth- androgens into estrogens reduces response la- 22. Jensen EV, Cheng G, Palmieri C et al: Estrogen ylstilbestrol exposure on the female reproductive tency to a noxious thermal stimulus in male quail. receptors and proliferation markers in primary tract. Dev Biol 2001; 238: 224. Horm Behav 2004; 45: 181. and recurrent breast cancer. Proc Natl Acad Sci U S A 2001; 98: 15197. 26. Bektic J, Berger AP, Pfeil K et al: Androgen 29. Yonezawa T, Higashi M, Yoshioka K et al: Distri- receptor regulation by physiological concentra- bution of aromatase and sex steroid receptors in 23. Baskin LS, Erol A, Jegatheesan P et al: Urethral tions of the isoﬂavonoid genistein in androgen- the baculum during the rat life cycle: effects of seam formation and hypospadias. Cell Tissue Res dependent LNCaP cells is mediated by estro- estrogen during the early development of the 2001; 305: 379. gen receptor beta. Eur Urol 2004; 45: 245. baculum. Biol Reprod 2011; 85: 105.