DOCSLIB.ORG

Discovery and Characterisation of Castlerea Virus, a New Species Of

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Discovery and Characterisation of Castlerea Virus, a New Species Of EVB0010.1177/1176934317691269Evolutionary BioinformaticsO’Brien et al 691269research-article2017 Evolutionary Bioinformatics Discovery and Characterisation of Castlerea Virus, a 1–14 © The Author(s) 2017 New Species of Negevirus Isolated in Australia Reprints and permissions: sagepub.co.uk/journalsPermissions.nav Caitlin A O’Brien1*, Breeanna J McLean1*, Agathe M G Colmant1, DOI:https://doi.org/10.1177/1176934317691269 10.1177/1176934317691269 Jessica J Harrison1, Sonja Hall-Mendelin2, Andrew F van den Hurk2, Cheryl A Johansen3,4, Daniel Watterson1, Helle Bielefeldt-Ohmann1, Natalee D Newton1, Benjamin L Schulz1, Roy A Hall1 and Jody Hobson-Peters1 1Australian Infectious Diseases Research Centre, School of Chemistry & Molecular Biosciences, The University of Queensland, St Lucia, QLD, Australia. 2Public Health Virology, Forensic and Scientific Services, Department of Health, Queensland Government, Coopers Plains, QLD, Australia. 3School of Pathology and Laboratory Medicine, The University of Western Australia, Nedlands, WA, Australia. 4Department of Health – Pathwest Laboratory Medicine WA, Nedlands, WA, Australia. ABSTRACT: With advances in sequencing technologies, there has been an increase in the discovery of viruses that do not group with any currently described virus families. The newly described taxon Negevirus encompasses a group of viruses displaying an insect-specific phenotype which have been isolated from multiple host species on numerous continents. Using a broad-spectrum virus screening assay based on the detection of double-stranded RNA and next-generation sequencing, we have detected a novel species of negevirus, from Anopheles, Culex, and Aedes mosquitoes collected in 4 geographically separate regions of Australia. Bioinformatic analysis of the virus, tentatively named Castlerea virus, revealed that it is genetically distinct from previously described negeviruses but clusters in the newly proposed Nelorpivirus clade within this taxon. Analysis of virions confirmed the presence of 2 proteins of 24 and 40 kDa which support previous bioinformatic predictions of negevirus structural proteins. KEYWOrds: Virus discovery, negevirus, mosquito, insect-specific virus RECEIVED: September 30, 2016. ACCEPTED: December 7, 2016. DECLaratiON OF CONFLictinG intEREsts: The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this PEER REviEW: Five peer reviewers contributed to the peer review report. Reviewers’ article. reports totalled 1655 words, excluding any confidential comments to the academic editor. CORRESPONDING AUTHOR: Jody Hobson-Peters, Australian Infectious Diseases TYPE: Original Research Research Centre, School of Chemistry & Molecular Biosciences, The University of Queensland, St Lucia, QLD 4072, Australia. Email: [email protected] FUndinG: The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This study was funded by the Australian Research Council (ARC DP120103994). Introduction Recently, a vast number of insect-only viruses (ISVs) have been methyltransferase (MTase), viral MTase, helicase, and RNA- isolated from multiple mosquito species globally.1–3 Making up dependent RNA polymerase (RdRP). Open reading frames 2 a large percentage of these viruses are insect-specific flavivi- and 3 are approximately 1.5 kb and 600 base pairs (bp), respec- ruses (ISFs) that have predominately been found within Aedes tively, and it has been hypothesised that they encode structural and Culex species mosquitoes. However, isolations of Palm proteins, although little physical evidence has been provided to Creek virus from Coquillettidia sp. and Nakiwogo virus from support these potential functions to date.6,10,12 Open reading Mansonia sp. suggest that ISFs exhibit a broad mosquito host frame 3 encodes a small protein which contains a domain with range.2–4 Interestingly, multiple other ISVs have been isolated similarity to the p24 and p23 membrane proteins found in the from other virus families, including Bunyaviridae, Reoviridae, plant virus genera Cilevirus, Higrevirus, and Blunervirus.12–14 Togaviridae, Mesoniviridae, and most recently from a newly More recently, with the use of sequence profile-based domain described taxon, Negevirus.5–9 prediction programs, such as PSI-BLAST and HHblits, ORF2 The taxon Negevirus was first proposed by Vasilakis and col- has been reported to contain a small glycoprotein domain indi- leagues who described 6 viruses that were distantly related to cating that it may function as a spike protein.13,14 plant-infecting viruses of the genus Cilevirus.10 Viruses in the To date, 12 viruses have been described which are thought Negevirus taxon are enveloped, positive-sense single-stranded to represent individual species of negeviruses. These viruses RNA viruses ((+) ssRNA) with a 9- to 10-kb genome that is have been isolated from multiple mosquito genera, as well as polyadenylated at the 3′ end and encodes 3 open reading frames Lutzomyia sandflies from Europe, Africa, and the United (ORFs) flanked by noncoding intergenic regions (IGRs).10,11 States, with numerous isolates of some virus species being iso- Open reading frame 1 is approximately 7 kb and codes for the lated from several different geographic locations and from RNA-replication machinery domains: ribosomal RNA (rRNA) multiple host species.6,10-12,15 Recent bioinformatic analyses undertaken by Kallies et al16 * C.A.O. and B.J.M. contributed equally. revealed that negeviruses can be classified into 2 distinct clades Creative Commons Non Commercial CC-BY-NC: This article is distributed under the terms of the Creative Commons Attribution-NonCommercial 3.0 License (http://www.creativecommons.org/licenses/by-nc/3.0/) which permits non-commercial use, reproduction and distribution of the work without further permission provided the original work is attributed as specified on the SAGE and Open Access pages (https://us.sagepub.com/en-us/nam/open-access-at-sage). 2 Evolutionary Bioinformatics within the taxon. The Nelorpivirus clade consists of viruses that virus (NWTV), a negevirus isolated from Culex vishnui mos- cluster with Negev (NEGV), Loreto (LORV), and Piura quitoes collected in Indonesia.10 This virus was tentatively (PIUV) viruses, whereas the Sandewavirus clade includes the named Castlerea virus after Castlerea street in Tingalpa more divergent Santana (SANV), Dezidougou (DEZV), where the mosquitoes from pool B185775 were collected. Wallerfield (WALV), and related viruses.6,11,16 Based on the prototype sequence, a CsV-specific reverse tran- In virus culture using the dicer-2–deficient C6/36 and scription polymerase chain reaction (RT-PCR) using primers C7/10 (Aedus albopictus) cell lines, these viruses can cause to the rRNA MTase domain of ORF1 was designed to per- extensive cytopathic effect (CPE) from 24 hours post infection form retrospective analysis of the cohort of 24 MAVRIC- (hpi), characterised by cell rounding and detachment of the positive pools collected in 2012. This analysis yielded an monolayer.10,15,17,18 Additional analysis using vertebrate cell additional 12 isolates from Cx annulirostris and Cq xan- culture (Vero, African green monkey; BHK, baby hamster kid- thogaster mosquitoes (Figure 1A, Table 1). ney; and HEK 293, human adrenal ganglion/neuron-derived MAVRIC positive mosquito pools from the cohort of cell line) and intracerebral inoculation of newborn mice has mosquitoes collected in Brisbane in 2012 were further indicated that negeviruses likely exhibit an insect-specific assessed by RT-PCR of extracted RNA from the virus cul- phenotype.10 tures using a panel of specific primers generated to viruses Little is known about the mode of transmission of negevi- that are frequently present in Australian mosquito popula- ruses in nature. Isolation of Okushiri virus (OKV) from mos- tions1,22,23 These analyses confirmed the presence of Liao quito larvae suggests the potential for vertical transmission of ning virus (LNV) and Alphamesonivirus 1 in many of the some negeviruses,13 whereas horizontal transmission via blood mosquito pools and co-isolation of LNV in all CsV-positive meal has been demonstrated to be possible, but fairly ineffi- pools (Table 1). cient, for the prototype strain of NEGV (EO-329).10 Although attempts to culture these viruses in vertebrate cell lines have CsV is present in mosquito populations of a large thus far been unsuccessful, the isolation of some negeviruses geographic range and in archival mosquito pools from multiple host species and genera indicates the potential for horizontal transmission via a cryptic vertebrate host or a MAVRIC positive virus cultures obtained from an additional host range that includes plants.6,10,12 10 mosquito pools collected from the Peel region of Western Further isolations of negeviruses will provide crucial infor- Australia (WA) in 2014, at a distance of over 4000 km from mation about the evolution and persistence of these viruses and where the prototype was isolated (Figure 1B), were analysed by interactions that occur within the mosquito virome, such as the Illumina sequencing. This resulted in 10 additional negevirus potential to interfere with the transmission of secondary infec- sequences from a range of host species, including a single male tions with pathogenic vertebrate-infecting viruses, as has been Culex mosquito (Table 2). All sequences shared 97.42% to shown for the ISFs.19,20 Herein, we describe a putative
Load more

Recommended publications
  • Soybean Thrips (Thysanoptera: Thripidae) Harbor Highly Diverse Populations of Arthropod, Fungal and Plant Viruses
    viruses Article Soybean Thrips (Thysanoptera: Thripidae) Harbor Highly Diverse Populations of Arthropod, Fungal and Plant Viruses Thanuja Thekke-Veetil 1, Doris Lagos-Kutz 2 , Nancy K. McCoppin 2, Glen L. Hartman 2 , Hye-Kyoung Ju 3, Hyoun-Sub Lim 3 and Leslie. L. Domier 2,* 1 Department of Crop Sciences, University of Illinois, Urbana, IL 61801, USA; [email protected] 2 Soybean/Maize Germplasm, Pathology, and Genetics Research Unit, United States Department of Agriculture-Agricultural Research Service, Urbana, IL 61801, USA; [email protected] (D.L.-K.); [email protected] (N.K.M.); [email protected] (G.L.H.) 3 Department of Applied Biology, College of Agriculture and Life Sciences, Chungnam National University, Daejeon 300-010, Korea; [email protected] (H.-K.J.); [email protected] (H.-S.L.) * Correspondence: [email protected]; Tel.: +1-217-333-0510 Academic Editor: Eugene V. Ryabov and Robert L. Harrison Received: 5 November 2020; Accepted: 29 November 2020; Published: 1 December 2020 Abstract: Soybean thrips (Neohydatothrips variabilis) are one of the most efficient vectors of soybean vein necrosis virus, which can cause severe necrotic symptoms in sensitive soybean plants. To determine which other viruses are associated with soybean thrips, the metatranscriptome of soybean thrips, collected by the Midwest Suction Trap Network during 2018, was analyzed. Contigs assembled from the data revealed a remarkable diversity of virus-like sequences. Of the 181 virus-like sequences identified, 155 were novel and associated primarily with taxa of arthropod-infecting viruses, but sequences similar to plant and fungus-infecting viruses were also identified.
    [Show full text]
  • Evidence to Support Safe Return to Clinical Practice by Oral Health Professionals in Canada During the COVID-19 Pandemic: a Repo
    Evidence to support safe return to clinical practice by oral health professionals in Canada during the COVID-19 pandemic: A report prepared for the Office of the Chief Dental Officer of Canada. November 2020 update This evidence synthesis was prepared for the Office of the Chief Dental Officer, based on a comprehensive review under contract by the following: Paul Allison, Faculty of Dentistry, McGill University Raphael Freitas de Souza, Faculty of Dentistry, McGill University Lilian Aboud, Faculty of Dentistry, McGill University Martin Morris, Library, McGill University November 30th, 2020 1 Contents Page Introduction 3 Project goal and specific objectives 3 Methods used to identify and include relevant literature 4 Report structure 5 Summary of update report 5 Report results a) Which patients are at greater risk of the consequences of COVID-19 and so 7 consideration should be given to delaying elective in-person oral health care? b) What are the signs and symptoms of COVID-19 that oral health professionals 9 should screen for prior to providing in-person health care? c) What evidence exists to support patient scheduling, waiting and other non- treatment management measures for in-person oral health care? 10 d) What evidence exists to support the use of various forms of personal protective equipment (PPE) while providing in-person oral health care? 13 e) What evidence exists to support the decontamination and re-use of PPE? 15 f) What evidence exists concerning the provision of aerosol-generating 16 procedures (AGP) as part of in-person
    [Show full text]
  • RNA/RNA Interactions Involved in the Regulation of Benyviridae Viral Cicle Mattia Dall’Ara
    RNA/RNA interactions involved in the regulation of Benyviridae viral cicle Mattia Dall’Ara To cite this version: Mattia Dall’Ara. RNA/RNA interactions involved in the regulation of Benyviridae viral cicle. Vegetal Biology. Université de Strasbourg; Università degli studi (Bologne, Italie), 2018. English. NNT : 2018STRAJ019. tel-02003448 HAL Id: tel-02003448 https://tel.archives-ouvertes.fr/tel-02003448 Submitted on 1 Feb 2019 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Université de Strasbourg et Università di Bologna Thèse en co-tutelle Présentée à la FACULTÉ DES SCIENCES DE LA VIE En vue de l'obtention du titre de DOCTEUR DE L'UNIVERSITÉ DE STRASBOURG Discipline : Sciences de la Vie et de la Santé, Spécialité : Aspects moléculaires et cellulaires de la biologie Par Mattia Dall’Ara RNA/RNA interactions involved in the regulation of Benyviridae viral cicle Soutenue publiquement le 18 mai 2018 devant la Commission d'Examen : Dr. Stéphane BLANC Rapporteur Externe Dr. Renato BRANDIMARTI Rapporteur Externe Dr. Roland MARQUET Examinateur Interne Dr. Mirco IOTTI Examinateur Interne Pr. David GILMER Directeur de Thèse Dr. Claudio RATTI Co-directeur de Thèse DISTAL Dipartimento di Scienze e Tecnologie Agro-Alimentari Bologne Italie Acknowledgments First of all I want to thank my tutors David and Claudio.
    [Show full text]
  • Multipartite Viruses: Organization, Emergence and Evolution
    UNIVERSIDAD AUTÓNOMA DE MADRID FACULTAD DE CIENCIAS DEPARTAMENTO DE BIOLOGÍA MOLECULAR MULTIPARTITE VIRUSES: ORGANIZATION, EMERGENCE AND EVOLUTION TESIS DOCTORAL Adriana Lucía Sanz García Madrid, 2019 MULTIPARTITE VIRUSES Organization, emergence and evolution TESIS DOCTORAL Memoria presentada por Adriana Luc´ıa Sanz Garc´ıa Licenciada en Bioqu´ımica por la Universidad Autonoma´ de Madrid Supervisada por Dra. Susanna Manrubia Cuevas Centro Nacional de Biotecnolog´ıa (CSIC) Memoria presentada para optar al grado de Doctor en Biociencias Moleculares Facultad de Ciencias Departamento de Biolog´ıa Molecular Universidad Autonoma´ de Madrid Madrid, 2019 Tesis doctoral Multipartite viruses: Organization, emergence and evolution, 2019, Madrid, Espana. Memoria presentada por Adriana Luc´ıa-Sanz, licenciada en Bioqumica´ y con un master´ en Biof´ısica en la Universidad Autonoma´ de Madrid para optar al grado de doctor en Biociencias Moleculares del departamento de Biolog´ıa Molecular en la facultad de Ciencias de la Universidad Autonoma´ de Madrid Supervisora de tesis: Dr. Susanna Manrubia Cuevas. Investigadora Cient´ıfica en el Centro Nacional de Biotecnolog´ıa (CSIC), C/ Darwin 3, 28049 Madrid, Espana. to the reader CONTENTS Acknowledgments xi Resumen xiii Abstract xv Introduction xvii I.1 What is a virus? xvii I.2 What is a multipartite virus? xix I.3 The multipartite lifecycle xx I.4 Overview of this thesis xxv PART I OBJECTIVES PART II METHODOLOGY 0.5 Database management for constructing the multipartite and segmented datasets 3 0.6 Analytical
    [Show full text]
  • Evolutionary Continuum Between Small Rna and Dna Viruses
    EVOLUTIONARY CONTINUUM BETWEEN SMALL RNA AND DNA VIRUSES Mart Krupovic Institut Pasteur [email protected] 03.07.2014 100 nm 20 nm 100 nm Giant viruses versus tiny ones Mimivirus Porcine circovirus 1 Capsid diameter: ~400 nm Capsid diameter: ~17 nm Genome size: 1,181,404 bp Genome size: 1,758 nt # of genes: 1,018 # of genes: 2 2000 nm 100 nm Courtesy Prof D. Raoult Courtesy Prof S. McNulty The (described) virosphere: 120 distinct taxa Adenoviridae, Alloherpesviridae, Alphaflexiviridae, Alphatetraviridae, Alvernaviridae, Amalgaviridae, Ampullaviridae, Anelloviridae, Arenaviridae, Arteriviridae, Ascoviridae, Asfarviridae, Astroviridae, Bacilladnavirus, Bacillarnavirus, Baculoviridae, Barnaviridae, Benyviridae, Betaflexiviridae, Bicaudaviridae, Bidnaviridae, Birnaviridae, Bornaviridae, Bromoviridae, Bunyaviridae, Caliciviridae, Carmotetraviridae, Caulimoviridae, Chrysoviridae, Cilevirus, Circoviridae, Clavaviridae, Closteroviridae, Coronaviridae, Corticoviridae, Cystoviridae, Deltavirus, Dicistroviridae, Dinodnavirus, Emaravirus, Endornaviridae, Filoviridae, Flaviviridae, Fuselloviridae, Gammaflexiviridae, Geminiviridae, ‘Gemycircularvirus’, Globuloviridae, Guttaviridae, Hepadnaviridae, Hepeviridae, Herpesviridae, Higrevirus, Hypoviridae, Hytrosaviridae, Idaeovirus, Iflaviridae, Inoviridae, Iridoviridae, Labyrnavirus, Leviviridae, Lipothrixviridae, Luteoviridae, Malacoherpesviridae, Marnaviridae, Marseilleviridae, Megabirnaviridae, Mesoniviridae, Metaviridae, Microviridae, Mimiviridae, Myoviridae, Nanoviridae, Narnaviridae, Nimaviridae,
    [Show full text]
  • (Cilv-N) ST 06: Citrus Leprosis Virus Family
    Pest report Citrus leprosis virus C (CiLV-C) Citrus leprosis virus N (CiLV-N) ST 06: Citrus leprosis virus Family: Rhabdoviridae (CiLV-N), non-designated (CiLV-C) Genus: Dichorhabdovirus (CiLV-N), Cilevirus (CiLV-C) Approval date: 26-10-2015 Photo: Alanís-Martínez Synonym(s): leprosis de los cítricos, leprosis and lepra explosiva (Spanish), Citrus leprosis virus (English). Pest overview Citrus leprosis virus causes one the most destructive diseases of citrus in the Americas (Rodrigues et al. 2003). It is an endemic disease in several countries in South America that has recently spread as far north as Mexico (Bastianel et al. 2010). Citrus leprosis is associated with two different causal agents, Citrus leprosis virus cytoplasmic type (CiLV-C) and Citrus leprosis virus nuclear type (CiLV-N) (Freitas-Astúa et al. 2005), which are transmitted by mites from the genus Brevipalpus (Acari: Tenuipalpidae). Within the cytoplasmic type, there are two subtypes - cytoplasmic type 1 (CiLV-C1, the most prevalent one) and cytoplasmic 2 (CiLV-C2) that was found in Colombia (Roy et al. 2013a). The virus has been transmitted mechanically with some difficulty from sweet orange to sweet orange and some herbaceous hosts. The most important method for spread and transmission is through the mite vector. Geographic distribution of the pest Citrus leprosis has been reported in many of the citrus growing regions of the world (Mora-Aguilera et al. 2013; Table 1). Citrus leprosis virus 2 Table 1. Geographic distribution of Citrus leprosis virus Country Year detected Reference China (South) Beginning of the 20th Bastaniel et al. 2010 India (North) century Ceylon (presently Sri Lanka) Japan Philippines Indonesia (Java) Egypt South Africa US (Florida) Brazil 1930 Bastaniel et al.
    [Show full text]
  • (12) Patent Application Publication (10) Pub. No.: US 2013/0267429 A1 GARDNER Et Al
    US 20130267,429A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2013/0267429 A1 GARDNER et al. (43) Pub. Date: Oct. 10, 2013 (54) BIOLOGICAL SAMPLE TARGET (60) Provisional application No. 61/628.224, filed on Oct. CLASSIFICATION, DETECTION AND 26, 2011. SELECTION METHODS, AND RELATED ARRAYS AND OLGONUCLEOTIDE PROBES (71) Applicant: Lawrence Livermore National Publication Classification Security, LLC, Livermore, CA (US) (51) Int. Cl. (72) Inventors: Shea GARDNER, Oakland, CA (US); G06F 9/20 (2006.01) CrystalKevin MCLOUGHILIN, J. JAING, Livermore, Oakland, CA CA(US); (52) s g4. (2006.01) US):A ity's Th SLEZAK. issurancisco, San Franci CPCAV e. we.............. G06F 19/20 (2013.01): CI2O 1/6876 Alameda, CA (US); Marisa Wailam (2013.01) TORRES, Pleasanton, CA (US) USPC ................................................. 506/8:506/16 (21) Appl. No.: 13/886,172 (22) Filed: May 2, 2013 (57) ABSTRACT Related U.S. Application Data (63) Continuation-in-part of application No. 13/304.276, Biological sample target classification, detection and selec filed on Nov. 23, 2011, which is a continuation-in-part tion methods are described, together with related arrays and of application No. 12/643,903, filed on Dec. 21, 2009. oligonucleotide probes. Patent Application Publication Oct. 10, 2013 Sheet 1 of 19 US 2013/0267429 A1 All Filter With genomes Vmatch to in family, reOWe as of nonspecific Family specific April 2007 regions & 17 nt regions only >g1 . > 25 nt (bacterial AATCCTGACAGGGACAG and human) >g 1 >g2 AATCCTGACAGGGACAGTTT, ........... G AGCAAAAACAAGCAGTT >g 2 >g3 AGCAA, , , ..., , , , , , , , , , ... AGTGACAGTCAT. GGGGTCAAACGGGAG >g3 A. GGGGCAATACTGGGA., , , , , , , , ACCCTA >g4 -as-a-do A.
    [Show full text]
  • Powerful Sequence Similarity Search Methods and In-Depth Manual Analyses Can Identify Remote Homologs in Many Apparently “Orphan” Viral Proteins
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Apollo Powerful Sequence Similarity Search Methods and In-Depth Manual Analyses Can Identify Remote Homologs in Many Apparently “Orphan” Viral Proteins Durga B. Kuchibhatla,a Westley A. Sherman,a Betty Y. W. Chung,b Shelley Cook,c Georg Schneider,a,d Birgit Eisenhaber,a David G. Karline,f ‹Bioinformatics Institute (BII), A*STAR (Agency for Science, Technology and Research), Matrix, Singaporea; Department of Plant Sciences, University of Cambridge, Cambridge, United Kingdomb; Life Sciences—Parasites and Vectors Division, Natural History Museum, London, United Kingdomc; IST Austria (Institute of Science and Technology Austria), Klosterneuburg, Austriad; Department of Zoology, Oxford University, Oxford OX1 3PS, United Kingdome; Division of Structural Biology, Oxford University, Oxford OX1 7BN, United Kingdomf The genome sequences of new viruses often contain many “orphan” or “taxon-specific” proteins apparently lacking homologs. However, because viral proteins evolve very fast, commonly used sequence similarity detection methods such as BLAST may overlook homologs. We analyzed a data set of proteins from RNA viruses characterized as “genus specific” by BLAST. More pow- erful methods developed recently, such as HHblits or HHpred (available through web-based, user-friendly interfaces), could detect distant homologs of a quarter of these proteins, suggesting that these methods should be used to annotate viral genomes. In-depth manual analyses of a subset of the remaining sequences, guided by contextual information such as taxonomy, gene or- der, or domain cooccurrence, identified distant homologs of another third. Thus, a combination of powerful automated meth- ods and manual analyses can uncover distant homologs of many proteins thought to be orphans.
    [Show full text]
  • Citrus Virology- Introduction
    Citrus Virology- Introduction Amit Levy [email protected] 863-956-8704 What is a Virus? • Viruses are very small particles that can infect animals and plants and sometimes make them sick. • Viruses are made up of genetic materials like DNA or RNA and are protected by a coating of protein (CP). • Are all sub-microscopic • Viruses hijack the cells of living organisms. They then use the cell to replicate and take over more cells. Only reproduce in living organisms. • Are viruses alive? Most scientists will say they are non-living because they cannot reproduce without the aid of a host. Viruses also do not metabolize food into energy or have organized cells, which are usually characteristics of living things. Also do not divide like bacteria. Outline: • How are viruses packed? • How do viruses multiply? • How do viruses spread? Name Genus Genome Size particle Citrus leaf blotch Citrivirus Linear 8.7 kb helical virus ssRNA(+) 960 nm long genome Citrus chlorotic Geminiviridae circular, 3.64 kb capsid dwarf (family) ssDNA genome 38 nm length Citrus psorosis virus Ophiovirus Segmented RNA1- 7.8kb nucleocapsids negative- RNA2- 1.7kb stranded RNA RNA3- 1.5kb RNA4- 1.4kb Citrus tristeza virus Closterovirus Linear 19.3 kb helical ssRNA(+) 2000 nm long genome Citrus leprosis Cilevirus / Bipartite/ tripartite 8.7, 5 kb Higrevirus ssRNA(+) 8.4, 3.2, 3.1 kb genome 150 nm length Outline: • How are viruses packed? • How do viruses multiply? • How do viruses spread? Name Genus Genome Size particle Citrus leaf blotch Citrivirus Linear 8.7 kb helical virus
    [Show full text]
  • Electron Microscopy in Discovery of Novel and Emerging Viruses from the Collection of the World Reference Center for Emerging Viruses and Arboviruses (WRCEVA)
    viruses Review Electron Microscopy in Discovery of Novel and Emerging Viruses from the Collection of the World Reference Center for Emerging Viruses and Arboviruses (WRCEVA) Vsevolod L. Popov 1,2,3,4,5,*, Robert B. Tesh 1,2,3,4,5, Scott C. Weaver 2,3,4,5,6 and Nikos Vasilakis 1,2,3,4,5,* 1 Department of Pathology, University of Texas Medical Branch, 301 University Blvd, Galveston, TX 77555, USA; [email protected] 2 Center for Biodefense and Emerging Infectious Diseases, University of Texas Medical Branch, 301 University Blvd, Galveston, TX 77555, USA; [email protected] 3 Institute for Human Infection and Immunity, University of Texas Medical Branch, 301 University Blvd, Galveston, TX 77555, USA 4 Center for Tropical Diseases, University of Texas Medical Branch, 301 University Blvd, Galveston, TX 77555, USA 5 World Reference Center for Emerging Viruses and Arboviruses, University of Texas Medical Branch, 301 University Blvd, Galveston, TX 77555, USA 6 Department of Microbiology and Immunology, University of Texas Medical Branch, 301 University Blvd, Galveston, TX 77555, USA * Correspondence: [email protected] (V.L.P.); [email protected] (N.V.); Tel.: +1-409-747-2423 (V.L.P.); +1-409-747-0650 (N.V.) Received: 30 April 2019; Accepted: 24 May 2019; Published: 25 May 2019 Abstract: Since the beginning of modern virology in the 1950s, transmission electron microscopy (TEM) has been an important and widely used technique for discovery, identification and characterization of new viruses. Using TEM, viruses can be differentiated by their ultrastructure: shape, size, intracellular location and for some viruses, by the ultrastructural cytopathic effects and/or specific structures forming in the host cell during their replication.
    [Show full text]
  • Plant Virus RNA Replication
    eLS Plant Virus RNA Replication Alberto Carbonell*, Juan Antonio García, Carmen Simón-Mateo and Carmen Hernández *Corresponding author: Alberto Carbonell ([email protected]) A22338 Author Names and Affiliations Alberto Carbonell, Instituto de Biología Molecular y Celular de Plantas (CSIC-UPV), Campus UPV, Valencia, Spain Juan Antonio García, Centro Nacional de Biotecnología (CSIC), Madrid, Spain Carmen Simón-Mateo, Centro Nacional de Biotecnología (CSIC), Madrid, Spain Carmen Hernández, Instituto de Biología Molecular y Celular de Plantas (CSIC-UPV), Campus UPV, Valencia, Spain *Advanced article Article Contents • Introduction • Replication cycles and sites of replication of plant RNA viruses • Structure and dynamics of viral replication complexes • Viral proteins involved in plant virus RNA replication • Host proteins involved in plant virus RNA replication • Functions of viral RNA in genome replication • Concluding remarks Abstract Plant RNA viruses are obligate intracellular parasites with single-stranded (ss) or double- stranded RNA genome(s) generally encapsidated but rarely enveloped. For viruses with ssRNA genomes, the polarity of the infectious RNA (positive or negative) and the presence of one or more genomic RNA segments are the features that mostly determine the molecular mechanisms governing the replication process. RNA viruses cannot penetrate plant cell walls unaided, and must enter the cellular cytoplasm through mechanically-induced wounds or assisted by a 1 biological vector. After desencapsidation, their genome remains in the cytoplasm where it is translated, replicated, and encapsidated in a coupled manner. Replication occurs in large viral replication complexes (VRCs), tethered to modified membranes of cellular organelles and composed by the viral RNA templates and by viral and host proteins.
    [Show full text]
  • Citrus Leprosis; a Complex Viral Disease Ron Brlansky • Citrus Leprosis (CL) Is an Economically Important Viral Disease Affecting Citrus
    Citrus Leprosis; a complex viral disease Ron Brlansky • Citrus leprosis (CL) is an economically important viral disease affecting citrus. • Leprosis is widely distributed in South and Central America, from Argentina to Mexico. • The disease is associated with different non-systemic viruses, which cause similar symptoms in the citrus hosts • The viruses are transmitted by false spider mites of the genus Brevipalpus; however the viruses have different genomes Symptoms of Citrus Leprosis • Localized symptoms in leaves, stems, and fruits. • In leaves, characteristic lesions are often circular (from 5 to 12 mm in diameter), chlorotic or necrotic, colored light yellow to dark brown. • In older lesions, a darker central point can also be observed. • In young stems, lesions are small, chlorotic and shallow but with time they become darker brown or reddish and prominent. • In old stems lesions can join together and appearing larger. • In fruits, dark and depressed lesions are found in large numbers and affecting only the external part. • Commercial losses result from undesirable appearance of fruits, premature absission of fruit and leaf loss with canopy thinning Symptoms of Citrus Leprosis • Chlorotic leaf lesions becoming brown with or without necrotic centers • Flat or slightly raised necrotic areas on twigs and leaves • Flat or depressed lesions on fruit with concentric patterns and gumming • Abscission of leaves and fruit and twig dieback due to extensive lesion development Citrus Leprosis Symptoms in Panama Citrus Leprosis Symptoms in Columbia Citrus Leprosis Disease Symptoms in Colombia 2011 Nuclear Leprosis Symptoms Types of Citrus Leprosis • Defined by where the virus is found in the cell • Nuclear – in the nucleus and cytoplasm • Cytoplasmic – only in the cytoplasm • Virus sequence Nuclear A B M NM CW N NI V Cytoplasmic A B CW CW CW Timeline on Leprosis • 1940.
    [Show full text]