Secretory Leukocyte Protease Inhibitor Is a Survival and Proliferation Factor for Castration-Resistant Prostate Cancer

ORIGINAL ARTICLE Secretory leukocyte protease inhibitor is a survival and proliferation factor for castration-resistant prostate cancer

D Zheng1, B Gui2, KP Gray3, I Tinay2,SRaﬁei2, Q Huang1, CJ Sweeney4, AS Kibel2 and L Jia2

Androgen receptor (AR)-mediated gene expression continues to have a critical role in promoting castration-resistant prostate cancer (CRPC) survival and growth even after androgen deprivation therapy. AR cistrome analyses in CRPC cells have identified a large number of AR target genes involved in proliferative and cell cycle-related functions, and hold promise for development of novel therapeutic approaches for CRPC. However, there is little understanding of how these genes function in vivo and what the clinical implications are. We previously reported that secretory leukocyte peptidase inhibitor (SLPI) is regulated by the AR in a ligand- independent manner in CRPC cells and required for CRPC cell proliferation under androgen-deprived conditions. SLPI is a secreted serine protease inhibitor, which is overexpressed in a number of cancers, including lung, breast and ovarian cancer, and involved in tumor progression. However, the oncogenic potential of SLPI in prostate cancer remains unknown. Here we provide the first evidence that SLPI is upregulated in a subset of CRPC cell lines and CRPC patient tumors. In addition, serum SLPI levels are significantly elevated in metastatic CRPC patients compared with hormone naive patients, raising the possibility that this could serve as a biomarker. We demonstrated that SLPI expression has functional significance, as it promotes CRPC cell survival and growth after androgen withdrawal in vivo and in vitro. Last, we demonstrated that the oncogenic effect of SLPI may be due to protection of growth factor progranulin from enzymatic cleavage or suppression of CRPC cell apoptosis independent of anti-protease activity of SLPI. These findings implicate SLPI as a potential biomarker of resistance to AR inhibition and therapeutic target for CRPC treatment.

Oncogene (2016) 35, 4807–4815; doi:10.1038/onc.2016.13; published online 15 February 2016

INTRODUCTION environment where androgen levels within the cancer cell are Prostate cancer (PCa) is the most commonly diagnosed cancer in reduced to extremely low levels. American males. As many as 220 800 American men will be We previously discovered a distinct androgen-independent AR 8 diagnosed with PCa and nearly 27 540 will die of the disease in signaling pathway in CRPC cells. We identified a subset of genes 2015.1 Although better screening and treatments have resulted in regulated through a persistent AR-mediated transcription pro- improved outcomes, a subset of patients still develops metastatic gram without androgen stimulation, which is necessary for CRPC disease and requires treatment with androgen deprivation cell proliferation after androgen withdrawal. Of the newly therapy (ADT). Despite initial response and durable remission, identified AR-regulated genes, secretory leukocyte peptidase nearly all patients progress to incurable castration-resistant inhibitor (SLPI) is one of the top AR target genes in CRPC cells, prostate cancer (CRPC) in 2–3 years.2 A variety of mechanisms which is overexpressed and required for CRPC cell proliferation are responsible for CRPC progression, including androgen under androgen-derived conditions in cell culture. SLPI is a serine receptor (AR) amplification and overexpression, AR mutations, protease inhibitor and belongs to the family of whey acidic increased intratumoral androgen synthesis and constitutively proteins, of which most members are encoded on a single locus active AR splice variants.3,4 In most cases, despite low levels of on chromosome 20q12-13.9 Amplification of this region is serum androgens, the cancer cells often still rely on androgens for common in breast and ovarian cancer indicating its role in AR activation. Two principal therapeutic strategies have focused carcinogenesis.10 Highly elevated SLPI expression has been on improved (1) inhibition of androgen production; and reported in a number of cancers (lung, gastric, ovarian, breast – (2) blockade of the AR from ligand binding. New therapies including and pancreatic)11 15 and is associated with more aggressive forms – abiraterone and enzalutamide represent breakthroughs in CRPC of the disease.16 18 SLPI is produced and secreted by the mucosal treatment, but their activity is mostly short term, and response is not epithelial cells lining the respiratory, gastrointestinal and repro- universal.5–7 Nearly half of the patients do not respond, and those ductive tracts. Physiologically, SLPI is an anti-inflammatory agent who initially respond favorably inevitably develop resistance. and have a role in tissue regeneration. It normally functions as a The initial response to these agents indicate that androgen- protease inhibitor that protects epithelial tissues from the dependent AR signaling continues to have an important role in degradative actions of serine proteases such as neutrophil – the early stages of CRPC, whereas the eventual escape for elastase, cathepsin G and trypsin.19 22 The mechanisms underlying androgen blockade indicates that androgen-independent activa- SLPI-mediated oncogenic effects are not completely understood. tion of AR or AR-independent pathways may predominate in an Current evidence supports the notion that SLPI is important in

1Center for Pharmacogenomics, Department of Medicine, Washington University School of Medicine, St Louis, MO, USA; 2Division of Urology, Department of Surgery, Brigham and Women’s Hospital and Harvard Medical School, Boston, MA, USA; 3Department of Biostatistics and Computational Biology, Dana-Farber Cancer Institute and Harvard School of Public Health, Boston, MA, USA and 4Department of Medical Oncology, Dana-Farber Cancer Institute and Harvard Medical School, Boston, MA, USA. Correspondence: Dr L Jia, Division of Urology, Department of Surgery, Brigham and Women's Hospital and Harvard Medical School, 45 Francis Street, ASB II-3, Boston, MA 02115, USA. E-mail: [email protected] Received 17 July 2015; revised 23 December 2015; accepted 27 December 2015; published online 15 February 2016 SLPI promotes prostate cancer progression D Zheng et al 4808 regulation of growth factors that promote cancer growth.23,24 results (Supplementary Figure S1). Lack of SLPI expression in CRPC Interestingly, SLPI is expressed at a relatively low level in normal DU145 and 22RV1 cells reflects that SLPI is likely upregulated in a prostate and primary prostate tumors.25 The oncogenic role of subset of CRPC tumors, consistent with known heterogeneity of SLPI in PCa has not been investigated. CRPC tumor deposits within and between patients. We then In this study, we demonstrate that SLPI is upregulated in a examined SLPI protein levels in AR-positive (LNCaP, C4-2 and subset of metastatic CRPC (mCRPC) tumors after ADT and C4-2B) and AR-negative (PC-3 and DU145) PCa cell lines, and used functions as a survival and proliferation factor for CRPC cells. classic AR target gene PSA as a positive control (Figure 1b). High Our data suggest a possibility of SLPI as a biomarker for resistance SLPI protein levels were detected in C4-2B and PC-3 cells. We to AR inhibition and therapeutic target for CRPC. previously reported that knockdown of SLPI using small interfer- ing RNA (siRNA) inhibited C4-2B cell growth in the absence of androgen.8 Using the same approach, we found knockdown of RESULTS SLPI inhibited PC-3 cell proliferation (Figure 1c). No inhibitory SLPI is overexpressed in a subset of CRPC cell lines and patients effect was observed in DU145 cells under the same conditions. We previously characterized the AR cistrome in androgen- We then asked whether SLPI is overexpressed in CRPC patients. dependent LNCaP and LNCaP-derived CRPC C4-2B cells.8 Prior work reported that the expression level of SLPI was low in We reported that SLPI is highly overexpressed in C4-2B cells at normal prostate and primary prostate tumors, and that reduced mRNA levels in contrast to LNCaP cells based on RNA sequencing expression of SLPI was considered permissive to PCa initiation.25 In (RNA-seq) and quantitative reverse transcription PCR (RT–qPCR) contrast, analyses of two publicly available microarray data sets data. SLPI expression is regulated by a distal AR enhancer in a revealed that SLPI was significantly overexpressed in mCRPC manner independent of androgen ligands through a long-range tissues compared with primary tumors27,28 (Figure 2a). Given the interaction. Specifically, in distinction to classic AR target genes fact that SLPI is a secreted protein like PSA and detectable in such as PSA, SLPI expression was not induced by androgen, but serum, we examined SLPI protein levels in serum samples from was markedly suppressed after RNA interference against AR, PCa patients using enzyme-linked immunosorbent assay (ELISA; demonstrating SLPI as an androgen-independent AR-dependent Figure 2b). The serum SLPI level in localized PCa patients (median gene. Here we examined SLPI mRNA levels in a number of PCa cell 47.18 ng/ml and interquartile range 41.76–56.38 ng/ml) was lines by RT–qPCR (Figure 1a). SLPI was expressed at a very low slightly lower compared with that in normal controls (55.77 and level in LNCaP and C4-2 cells, but was highly expressed in C4-2B 46.40–61.69 ng/ml; Mann–Whitney U-test, P = 0.0671). This is cells. C4-2 is a CRPC subline of LNCaP, but a predecessor of bone consistent with the results from previous microassay studies metastatic C4-2B line.26 This suggests that upregulation of SLPI that showed lower expression levels of SLPI in primary PCa.25 likely occurs in a late stage of CRPC progression. SLPI was also Metastatic hormone naive (mHN) patients have a SLPI level (54.87 overexpressed in AR-negative PC-3 cells, but not in DU145 cells, and 43.19–62.46 ng/ml) similar to that of the localized PCa further suggesting SLPI might also be regulated through an patients (P = 0.0982). We also examined 67 mCRPC serum samples AR-independent mechanism. SLPI was barely detected in LAPC4, from two different sources (mCRPC-1 cohort, n = 52; mCRPC-2 22RV1 and VCaP cells. SLPI mRNA levels in LNCaP, C4-2B, PC-3 and cohort, n = 15). The serum concentration of SLPI was significantly 22RV1 cells measured by RT–qPCR are in line with our RNA-seq elevated in both mCRPC groups (71.84, range 62.49–87.07 ng/ml

Figure 1. SLPI expression is upregulated in CRPC cell lines. (a)RT–qPCR showing SLPI mRNA levels in PCa cell lines. Cells were grown in regular media with 10% fetal bovine serum (FBS). SLPI expression level in LNCaP cells was deﬁned as 1. (b) Western blot showing PSA and SLPI protein levels in LNCaP, C4-2, C4-2B, PC-3 and DU145 cells. LNCaP, C4-2 and C4-2B cells were grown in phenol-red-free RPMI 1640 media with 5% charcoal-stripped serum (CSS) for 3 days followed by the treatment with ethanol or 10 nM dihydrotestosterone for 16 h. PC-3 and DU145 cells were grown in RPMI 1640 media with 5% FBS. (c) PC-3 and DU145 cells were transfected with SLPI or non-speciﬁc (NS) siRNA for 3 days, cell proliferation was examined using CCK8 assay.

Figure 2. SLPI expression levels are significantly elevated in mCRPC patients. (a) SLPI expression was analyzed in primary tumors vs metastatic CRPC (mCRPC) using published microarray data sets from the NCBI GEO database GSE 6919 and GSE 3325. (b) The concentration of serum SLPI was measured by ELISA in patients and controls as indicated. (c) SLPI levels in eight matched serum samples before and after androgen deprivation therapy were measured by ELISA. and 74.03, range 59.55–98.77 ng/ml, respectively) as compared We next asked whether overexpression of SLPI can promote with the localized PCa (both Po0.0001) or mHN groups (Po0.0001 PCa cell growth under androgen-deprived conditions. We and P = 0.0007, respectively). Furthermore, we examined eight ectopically overexpressed SLPI in LNCaP cells that express mCRPC patients who had matched serum samples collected before endogenous SLPI at a very low level. The SLPI protein level in and after ADT (Figure 2c) from the mCRPC-1 cohort. The median LNCaP cells with stable SLPI overexpression or vector control was time interval between two sample collections is 43.5 months examined by western blot (Figure 4a). In cell culture, over- (range 7–74 months). The SLPI level was significantly increased after expression of SLPI was not sufficient to promote LNCaP cell ADT (Wilcoxon signed-rank test, P = 0.0078), implying a potential growth in the presence and absence of androgen (Supplementary role of SLPI in mCRPC progression. Figure S2). To determine whether overexpression of SLPI enhances LNCaP cell growth after castration in vivo, we injected SLPI-overexpressing LNCaP cells and control cells subcutaneously SLPI promotes CRPC survival and growth under androgen- into non-obese diabetic/severe combined immunodeficiency deprived conditions (NOD/SCID) mice (seven mice per group). We initially grew cancer We generated two SLPI knockdown stable C4-2B cell lines using cells in intact mice for 4 weeks before castration. Subsequently, two different sets of small hairpin RNA (shRNA). Knockdown tumor growth was monitored over time based on the photon flux fi fi ef ciency was con rmed by reduction of SLPI protein levels in from the luciferase reporter in LNCaP cells using the biolumines- these two stable cell lines using western blot (Figure 3a). Next, we cence imaging system (Figure 4b). We collected mouse serum examined the biological effect of decreased SLPI expression on samples and tumors 5 weeks after castration when SLPI- cell growth and invasion in vitro. We found SLPI knockdown C4-2B overexpressing tumors overgrew leading to early death in two cells grew significantly slower compared with control cells in the mice. Serum SLPI levels were detected at a very high level in the absence of dihydrotestosterone (DHT), but not in the presence of SLPI-overexpressing group (Figure 4c). Tumors were weighed DHT (Figure 3b). Accordingly, increased apoptosis was observed in (Figure 4d) and stained for proliferation mark Ki-67 (Figure 4e). We SLPI knockdown C4-2B cells after 5-day culture in the absence of observed significantly larger tumor growth in the SLPI- androgen (Figure 3c). Anchorage-independent growth assays overexpressing group compared with the control group after further showed that knockdown of SLPI inhibited soft agar colony castration. Ki-67 staining showed more proliferative cells in SLPI- formation of C42B cells suggesting a tumorigenic role of SLPI in overexpressing tumors. These results suggested that SLPI is PCa (Figure 3d). Reduction of SLPI in C4-2B cells significantly required for CRPC growth, and functions as a survival and inhibited cell invasion in a transwell assay consistent with the proliferation factor in vivo after ADT. Our results showed that notion that SLPI overexpression is associated with more aggres- overexpression of SLPI in LNCaP cells provides a growth sive tumors (Figure 3e). advantage in vivo but not in vitro, indicating an important role

Figure 3. SLPI is required for C4-2B cell proliferation and invasion in vitro.(a) Western blot showing SLPI protein levels in parental C4-2B, green ﬂuorescent protein knockdown (shGFP) and two SLPI knockdown (shSLPI-1 and shSLPI-2) C4-2B stable cell lines. (b) Proliferation of SLPI knockdown C4-2B cells vs control cells was examined using CCK8 assay. Cells were cultured in phenol-red-free RPMI 1640 media with 5% CSS in the presence or absence of 10 nM DHT. (c) Cell lines as indicated were grown in phenol-red-free RPMI 1640 media containing 5% CSS for 5 days. Cell apoptosis was determined by caspase 3 and 7 activities. (d) Anchorage-independent growth of SLPI knockdown C4-2B cells vs control cells was examined using soft agar assay. Values are means ± s.d. from three wells. (e) Invasion of SLPI knockdown C4-2B cells vs control cells was examined using transwell assay. Values are means ± s.d. from three observed ﬁelds. *Po0.05; **Po0.001.

of microenvironment for SLPI to be functional in promoting PCa wound healing, a complex process requiring cell proliferation, cell survival and growth under androgen-deprived conditions. migration and differentiation. A similar mechanism was reported to enhance the ovarian cancer survival and growth.23,24 SLPI interacts with the growth factor PGRN and maintains PGRN at To examine whether SLPI interacts with PGRN in PCa cells, we a high level in CRPC patients transfected HA-tagged SLPI and FLAG-tagged PGRN expression Next, we sought to determine the mechanism of SLPI in plasmids into LNCaP cells. Co-immunoprecipitation demonstrated promoting CRPC growth. As an acid-stable protease inhibitor, a that SLPI physically interacts with PGRN (Figure 5a). This major physiological role of SLPI is to protect epithelial tissues from interaction was also detected in cell culture supernatant indicating serine proteases. Progranulin (PGRN) is an evolutionarily con- their functions in PCa local microenvironment. We also measured served epithelial growth factor. It is well known that SLPI interacts PGRN protein levels in serum samples from the mCRPC-1 cohort with PGRN and protect it from elastase-mediated degradation.29 using ELISA. We found that PGRN levels are signiﬁcantly correlated This is the underlying mechanism for the protective role of SLPI in with SLPI levels in CRPC patients (Pearson correlation with

Oncogene (2016) 4807 – 4815 © 2016 Macmillan Publishers Limited, part of Springer Nature. SLPI promotes prostate cancer progression D Zheng et al 4811 intracellular pathways regulated by SLPI, we performed RNA-seq analysis in C4-2B cells in the absence of androgen after SLPI knockdown. We identified 232 upregulated and 448 downregulated genes after SLPI siRNA transfection (Figure 6a and full list in Supplementary Table S1). The pathway analysis of upregulated and downregulated genes using DAVID (Database for Annotation, Visualization and Integrated Discovery30) identified p53 signaling (P = 4.08 × 10 − 6) and apoptosis (P = 1.15 × 10 − 4)as the top significantly over-represented pathway, respectively (Figure 6b). We selected 10 genes from these two pathways and validated their mRNA expression levels by RT–qPCR after SLPI knockdown (Supplementary Figure S3). The upregulated genes in p53 signaling pathway include genes regulating apoptosis, such as CDKN1A and TP53, whereas the downregulated genes in apoptosis pathway are primarily anti-apoptosis genes such as XIAP, BIRC2 and BIRC3 (Supplementary Table S2). These results indicate protective role of SLPI from the pro-apoptotic process and in so doing promotes cell survival. Tumor necrosis factor α (TNFα), a proinflammatory cytokine, is a potent apoptosis inducer in LNCaP cells, but less effective in C4-2B cells.31–33 TNFα is also required for castration-induced prostate regression.34 To test whether SLPI increases protective capacity of CRPC cells in TNFα-induced apoptosis, we performed apoptosis assays in LNCaP and C4-2B cells after overexpression and knockdown of SLPI, respectively. As expected, TNFα induced LNCaP apoptosis with over 5-fold induction based on caspase 3 and 7 activities (Figure 6c). C4-2B cells showed less sensitivity to TNFα treatment compared with LNCaP cells (P = 0.0107). Overexpression of SLPI rendered LNCaP cells to be more resistant to TNFα-induced apoptosis (P = 0.0084 and P = 0.0007). Conversely, knockdown of SLPI significantly increased TNFα-induced apoptosis in CRPC C4-2B cells (P = 0.0138 and 0.0255).

DISCUSSION Although the mechanisms of aberrant AR activation in CRPC have been extensively studied, the critical downstream AR target genes controlling CRPC cell survival and growth under androgen- deprived conditions remain largely unknown. Elucidating the roles of these genes in CRPC progression after ADT may help predict anti-androgen resistance and develop new therapeutic strategies. Here we report that a serine protease inhibitor, SLPI, is highly overexpressed in some mCRPC patients, and SLPI supports CRPC cell growth and invasion under androgen-deprived conditions. Overexpression of SLPI in PCa cells provides a proliferation advantage after castration likely through its anti-protease and anti-apoptotic activity (Figure 7). Figure 4. SLPI promotes PCa survival and growth in vivo after SLPI was considered as a biomarker in lung and ovarian cancer. castration. (a) Western blot showing SLPI protein levels in SLPI- It was reported that SLPI serum levels are high in primary lung overexpressing stable LNCaP cells (LNCaP-SLPI) vs control cells cancer patients and further increased in patients with advanced b (LNCaP-HA). ( ) Xenograft tumor growth was monitored by the lung cancer.35 Serum SLPI has also been used to differentiate bioluminescence imaging system. The end point P-value between benign ovarian cysts from ovarian cancer.36 Our present data have two groups was determined using two-sided Student’s t-test. (c) The concentration of serum SLPI was measured by ELISA in LNCaP-HA shown that upregulation of SLPI in CRPC C4-2B and PC-3 cell and LNCaP-SLPI mice. (d) After sacrifice, tumors were weighted. models is either androgen-independent or AR-independent. (e) The Ki-67 protein was examined by immunohistochemistry in Therefore, it is tempting to speculate that patients with elevated SLPI-overexpressing tumors (n = 5) vs controls (n = 7). Ki-67-positive serum SLPI may not benefit from the new-generation anti- cells were counted. Values are means ± s.d. Representative images androgen treatments (enzalutamide and abiraterone). Biomarkers are shown. with a predictive value for anti-androgen resistance are of special interest for physicians to identify patients that are likely to r = 0.55487, P = 5.1023e-6; Figure 5b). This evidence supports the develop castration-resistant state in the course of disease and notion that SLPI may promote CRPC growth through regulating therefore should be followed or treated respect to this knowledge. PGRN levels in patients. Because the multi-focal and heterogeneous nature of PCa makes tissue sampling difficult, serum SLPI seems as an attractive predictive biomarker. A prospective study is necessary to examine SLPI suppresses apoptosis pathways in PCa cells the correlation between the serum SLPI level and responsiveness Although SLPI is a serine protease inhibitor, the biological to abiraterone and enzalutamide. functions of SLPI in tumor development and progression are Serine protease inhibitors have a complex role in carcino- not limited to its anti-protease activity.16 To identify potential genesis. Tumor progression is generally associated with extensive

© 2016 Macmillan Publishers Limited, part of Springer Nature. Oncogene (2016) 4807 – 4815 SLPI promotes prostate cancer progression D Zheng et al 4812 tissue remodeling in order to provide a favorable environment for because of their ability to activate and release cytokines and tumor growth, invasion and metastasis.37 Proteases expressed by growth factors, and to cleave components of the extracellular cancer and/or stromal cells have the key role in this process matrix, which creates optimal conditions for both cancer cell

Figure 5. SLPI interacts and correlates with PGRN. (a) Co-immunoprecipitation (IP) was preformed to assess interaction between SLPI and PGRN. Protein binding was detected by western blot (WB) with antibodies as indicated. (b) SLPI and PGRN levels from 60 serum samples were measured by ELISA. All serum samples are from the Gelb Center of Dana-Farber Cancer Institute, including 44 mCRPC patients plus 8 with matched samples collected before and after ADT.

Figure 6. Overexpression of SLPI prevents CRPC cells from apoptosis. (a) Volcano plots of RNA-seq analysis showing differentially expressed genes after SLPI knockdown. (b) Pathway analysis of 232 upregulated genes and 448 downregulated genes after SLPI knockdown. (c) Cell lines as indicated were grown in phenol-red-free RPMI 1640 media containing 5% CSS for 2 days followed by TNFα (50 ng/ml) treatment for 16 h before apoptosis assays. Cell apoptosis was determined by caspase 3 and 7 activities using the Caspase-Glo 3/7 assay kit.

Oncogene (2016) 4807 – 4815 © 2016 Macmillan Publishers Limited, part of Springer Nature. SLPI promotes prostate cancer progression D Zheng et al 4813 related to inﬂammation and tumor-forming capacity.55 In this study, we found that SLPI may prevent PCa cells from TNFα- induced apoptosis through inhibiting the p53 pathway and enhancing anti-apoptosis capacity. In conclusion, SLPI, a newly identiﬁed ligand-independent AR- regulated gene, is highly overexpressed in mCRPC patients. Overexpression of SLPI yields a proliferation advantage for PCa to suvive and grow after ADT. A humanized neutralizing monoclonal antibody against SLPI has been tested for chemo- resistant ovarian cancer treatment in a preclinical study.24 Targeting SLPI thus is a viable therapeutic option for CRPC with anti-androgen resistance.

MATERIALS AND METHODS Cell culture Human PCa LNCaP, C4-2B, PC-3, 22RV1 and LAPC4 cells were cultured as Figure 7. A model for mechanisms of SLPI-mediated CRPC growth. 56,57 Overexpression of SLPI protects the growth factor PGRN from previously described. DU145 and VCaP cells, obtained from the degradation and inhibits CRPC cells from undergoing apoptosis. American Type Culture Collection (ATCC; Manassas, VA, USA), were maintained in RPMI 1640 and Dulbecco's modified eagle's medium, respectively, supplemented with 10% (v/v) fetal bovine serum. C4-2 cells, proliferation and angiogenesis. In theory, expression of corre- obtained from ViroMed Laboratories (Minneapolis, MN, USA), were sponding protease inhibitors in tumoral environment will control maintained in RPMI 1640 supplemented with 5% fetal bovine serum. the activity of these enzymes and protease inhibitors are therefore 38 thought to counteract tumor progression and metastasis. Human serum specimens However, serine protease inhibitors are often overexpressed in The study protocol was approved by the Human Research Protection different tumor types, suggesting that overexpression of these Office of Washington University School of Medicine and the Gelb Center of inhibitors might favor tumor progression through a variety of 39–43 Dana-Farber Cancer Institute. Serum samples from 20 cancer-free males mechanisms. For example, SPINK1, a serine protease inhibitor, and 20 localized PCa patients were obtained from the Tissue Procurement can act as an autocrine growth factor, and promotes PCa growth Core of Washington University Siteman Cancer Center. Serum samples and invasion. SPINK1 is overexpressed in PCa and associated with from 20 metastatic hormone naive patients and 52 mCRPC patients were poor prognosis.44,45 A recent study demonstrated that SLPI along obtained from the Gelb Center of Dana-Farber Cancer Institute. Eight of 52 with another serine protease inhibitor SERPINE2 are the drivers of mCRPC patients had a matched sample collected before ADT. We obtained metastatic progression in breast cancer by promoting the additional 15 mCRPC serum samples from BioreclamationIVT (New York, formation of extravascular networks and acting as NY, USA) for validation. anticoagulants.46 Interestingly, we previously validated SLPI and SERPINH1 (a member of the SERPIN superfamily of serine protease Stable PCa cell lines with SLPI knockdown or overexpression inhibitors) as AR-regulated genes in C4-2B cells using chromo- For stable SLPI knockdown, C4-2B cells were infected with lentiviruses 8 some conformation capture assay. Similar to SLPI, SERPINH1 is encoding shRNA against human SLPI or green fluorescent protein control overexpressed in CRPC cells and required for CRPC cell prolifera- for 24 h, and selected with puromycin (1.5 ug/ml). Pooled populations tion under androgen-deprived conditions (Supplementary Figure were maintained in RPMI 1640 containing 5% fetal bovine serum and S4). These results underscore the oncogenic role of serine puromycin. The shRNA lentiviral vectors were obtained from the RNAi Core protease inhibitors in CRPC progression. at Washington University School of Medicine. The shRNA sequences are: The mechanism of SLPI in promoting CRPC growth remains shSLPI-1, GCGTGACTTGAAGTGTTGCAT; shSLPI-2, GAGTCTGTCCTCCTAAGA unclear. We have demonstrated that SLPI interacts with growth AAT; and shGFP, CCACATGAAGCAGCACGACTT. For stable SLPI overexpression, LNCaP cells were transfected with pcDNA3.1-SLPI-HA plasmid factor PGRN, which may enhance CRPC cell proliferation through 24 protecting PGRN from cleavage by neutrophil elastase. PGRN is a obtained from Dr Elise C Kohn or empty vector using Lipofectamine LTX wound-related glycoprotein growth factor and regulates cell (Life Technologies, Carlsbad, CA,USA), and selected with G418 (400 ug/ml). Monoclonal cells were picked up and grown in RPMI 1640 containing 5% division and migration through activating MAPK and PI3K 47 fetal bovine serum and G418. The expression of SLPI in stable cell lines was pathways. PGRN is over-produced in many tumor types, examined by western blot. including breast, ovarian, prostate, bladder, renal and liver.48–53 It promotes tumor growth, migration, invasion and angiogenesis, and confers an aggressive phenotype. PGRN has been shown to Western blot 57 enhance PCa cell proliferation and migration through activation of Western blot was performed as previously described. Antibodies were MAPK and AKT pathways, two common pathways activated by anti-SLPI (#PRS4249, Sigma-Aldrich, St Louis, MO, USA), anti-PSA β classic growth factors such as IGF, EGF and PDGF. In this study, we (#K92110R, Meridian Life Science, Memphis, TN, USA) and anti- -tubulin showed that PGRN levels are significantly correlated with SLPI (SC-80011, Santa Cruz Technology, Santa Cruz, CA, USA). levels in CRPC patients, supporting the regulatory role of SLPI in maintaining growth factor-enriched microenvironment in CRPC. RT–qPCR Although SLPI is a serine protease inhibitor, the biological RT–qPCR was performed as previously described.8 Primers were listed in functions of SLPI in tumor development and progression are not Supplementary Figure S3. limited to its anti-protease activity as originally defined. For example, SLPI can enter the nucleus and regulate transcription by Cell proliferation assay 54 interacting with transcription factor binding site directly. The LNCaP (1 × 104 cells per well) and C4-2B (5 × 103 cells per well) stable cells oncogenic role of SLPI has been studied in lung, ovarian and were seeded in 96-well plates. Cells were maintained in phenol-red-free breast cancers. It was reported that urethane-induced carcinogen- RPMI 1640 containing 5% charcoal-stripped serum (CSS) with ethanol or esis in the lung is suppressed in the SLPI knockout mouse through 10 nM DHT for 2, 4 or 6 days. The number of viable cells were analyzed inhibition of the NF-κB pathway, indicating complex SLPI functions using the CCK-8 kit (Dojindo Molecular Technologies, Kumamoto, Japan).

© 2016 Macmillan Publishers Limited, part of Springer Nature. Oncogene (2016) 4807 – 4815 SLPI promotes prostate cancer progression D Zheng et al 4814 Soft agar colony formation assay Lipofectamine RNAiMAX Transfection Reagent (Life Technologies, Carlsbad, SLPI knockdown stable C4-2B cells or control cells were seeded in 24-well CA, USA) according to the manufacturer’s instruction. RNA extraction was plate (2000 cells per well). Cells were suspended in phenol-red-free RPMI conducted 3 days after siRNA transfection. RNA-seq was performed and 8 1640 containing 10% CSS and 0.5% agar, and overlaid onto a solid layer of analyzed as previously described. Differentially expressed genes were ﬁ the same media containing 1.0% agar. After 2-week incubation, colonies de ned using a 2-fold change cutoff, dispersion at 0.1 and minimum were counted and photographed at × 40 magniﬁcation. counts per million at 25.

Transwell invasion assay Statistical analysis – Cell suspension (2 × 105 cells per 200 μl) was prepared in serum-free RPMI For patient samples, the Mann Whitney U-test was used to compare the 1640 media, and then transferred into the upper chamber in a 24-well differences of serum SLPI levels between two groups. Assuming two plate. The lower chamber contained 500 μl of RPMI 1640 media containing samples with n = 20 (mHN) and n = 15 (mCRPC-2), respectively (the smallest two groups for comparison), there was a 80% power (two sided, significant 10% CSS. Matrigel invasion chambers were obtained from Corning level of 0.05) to detect a difference of 1 × s.d. of SLPI expression levels. (Tewksbury, MA, USA). Following incubation at 37 °C, 5% CO for 24 h, 2 The Wilcoxon signed-rank test was used for comparison between matched the cells that had migrated through the membrane were stained with samples. Correlation between SLPI and PGRN serum levels was assessed by crystal violet and counted. the Pearson correlation coefficient. We removed one extreme point and applied winsorising to the PGRN dimension at a 90% level. Thus, points Apoptosis assay more extreme than the 95th percentile on both sides were set to the 95th Cells were grown in phenol-red-free RPMI 1640 containing 5% CSS alone or percentile. ’ treated with 50 ng/ml TNFα (Life Technologies, Carlsbad, CA, USA) as For in vivo and in vitro experiments, two-sided Student s t-test was used indicated. Cell apoptosis was determined by caspase 3 and 7 activities to compare the diferences between two groups. In animal studies, we used using the Caspase-Glo 3/7 assay kit (Promega, Madison, WI, USA) according seven mice in each of the two groups, which allow a 80% power at 0.05 fi to the manufacturer’s instruction. signi cance level (two-sided t-test) to detect a minimum difference of 1.5 × s.d. of tumor volume. All values represent means ± s.d. of three measurements or as indicated in all graphs. As the research was mostly ELISA assay hypothesis generation, no multiple comparison adjustments were Amounts of SLPI and PGRN in serum were determined with the SLPI implemented. All statistical tests were two sided and P-valueo0.05 was and PGRN ELISA kit (R&D Systems, Minneapolis, MN, USA), respectively, considered to be statistically significant. according to the manufacturer’s instruction. CONFLICT OF INTEREST Animal studies The authors declare no conflict of interest. The animal protocol was approved by the Animal Studies Committee of Washington University School of Medicine. SLPI-overexpressing LNCaP cells and control cells were stably infected with lentiviruses expressing a ACKNOWLEDGEMENTS luciferase reporter obtained from the Molecular Imaging Center of This work was supported by Anthony DiNovi Fund. Ilker Tinay was partially supported Washington University School of Medicine. Tumor xenografts were by the ‘Turkiye Kanserle Savas Vakfi’ Scholarship Program. established by subcuteneous injection of 1 × 106 cancer cells mixed with Matrigel (Corning; 1:1, v/v) into 6-week-old male NOD/SCID mice (Taconic, Germantown, NY, USA). Seven mices in each group were injected REFERENCES with LNCaP-HA or LNCaP-SLPI cells. Mice were scanned at 1-week intervals for bioluminescence signals using the IVIS Imaging System. Data were 1 American Cancer Society. Cancer Facts & Figures 2015. American Cancer Society: normalized by plotting as fold enhancement on a given imaging day over Atlanta, GA, USA, 2015. bioluminescence on the first day. Mice were castrated 4 weeks after 2 Bernard B, Sweeney CJ. Management of metastatic hormone-sensitive 16 implantation, and then monitored for another 5 weeks. After sacrifice, the prostate cancer. Curr Urol Rep 2015; : 14. tumors were weighted and fixed for immunohistochemistry staining using 3 Shen MM, Abate-Shen C. Molecular genetics of prostate cancer: new prospects for 24 – anti-Ki-67 (Santa Cruz Technology, Santa Cruz, CA, USA). Percentage of Ki- old challenges. Genes Dev 2010; : 1967 2000. 67-positive cells were counted. 4 Karantanos T, Corn PG, Thompson TC. Prostate cancer progression after androgen deprivation therapy: mechanisms of castrate resistance and novel therapeutic approaches. Oncogene 2013; 32: 5501–5511. Co-immunoprecipitation 5 de Bono JS, Logothetis CJ, Molina A, Fizazi K, North S, Chu L et al. Abiraterone and LNCaP cells were transfected with HA-tagged SLPI and FLAG-tagged PGRN increased survival in metastatic prostate cancer. N Engl J Med 2011; 364: plasmids. The FLAG-tagged PGRN plasmid was obtained from Dr Stephen 1995–2005. M Strittmatter.58 The media were changed to serum-free RPMI 1640 36 h 6 Scher HI, Fizazi K, Saad F, Taplin ME, Sternberg CN, Miller K et al. Increased survival after transfection and collected 12 h later. The cells were resuspended in with enzalutamide in prostate cancer after chemotherapy. N Engl J Med 2012; 367 – 1 ml lysis buffer (20 mM Tris, pH 7.5, 150 mM NaCl, 1.0% Triton X-100, 1 mM : 1187 1197. EDTA and protease inhibitor cocktail). Collected cell cultured media (1 ml) 7 Ryan CJ, Smith MR, de Bono JS, Molina A, Logothetis CJ, de Souza P et al. or whole-cell lysate (2 mg) were immunoprecipitated with anti-FLAG Abiraterone in metastatic prostate cancer without previous chemotherapy. N Engl (Sigma-Aldrich, St Louis, MO, USA) or anti-HA (Santa Cruz Technology, J Med 2013; 368: 138–148. Santa Cruz, CA, USA) antibodies and protein G beads (Roche, Indianapolis, 8 Decker KF, Zheng D, He Y, Bowman T, Edwards JR, Jia L. Persistent androgen IN, USA) at 4 °C overnight. Protein binding was detected by western blot receptor-mediated transcription in castration-resistant prostate cancer under 40 – with antibodies as indicated. androgen-deprived conditions. Nucleic Acids Res 2012; : 10765 10779. 9 Bouchard D, Morisset D, Bourbonnais Y, Tremblay GM. Proteins with whey-acidic- protein motifs and cancer. Lancet Oncol 2006; 7: 167–174. Microarray data analysis 10 Tanner MM, Grenman S, Koul A, Johannsson O, Meltzer P, Pejovic T et al. Frequent SLPI expression data from clinical PCa tumors were obtained from the NCBI amplification of chromosomal region 20q12-q13 in ovarian cancer. Clin Cancer Res GEO database GSE 691928 and GSE 3325,27 and analyzed using limma.59 2000; 6: 1833–1839. 11 Nukiwa T, Suzuki T, Fukuhara T, Kikuchi T. Secretory leukocyte peptidase inhibitor and lung cancer. Cancer Sci 2008; 99: 849–855. RNA-seq 12 Cheng WL, Wang CS, Huang YH, Liang Y, Lin PY, Hsueh C et al. Overexpression of C4-2B cells were grown in phenol-red-free RPMI 1640 containing 5% CSS a secretory leukocyte protease inhibitor in human gastric cancer. Int J Cancer for 2 days and transfected with siRNA against SLPI. A pre-designed pool of 2008; 123: 1787–1796. four siRNA duplexes against SLPI and a non-specific pool of four siRNA 13 Hoskins E, Rodriguez-Canales J, Hewitt SM, Elmasri W, Han J, Han S et al. Paracrine duplexes (siNS) were purchased as previously described.8 Cells were SLPI secretion upregulates MMP-9 transcription and secretion in ovarian transfected with siRNA at a final concentration of 15 nM using cancer cells. Gynecol Oncol 2011; 122: 656–662.

Oncogene (2016) 4807 – 4815 © 2016 Macmillan Publishers Limited, part of Springer Nature. SLPI promotes prostate cancer progression D Zheng et al 4815 14 Kluger HM, Chelouche Lev D, Kluger Y, McCarthy MM, Kiriakova G, Camp RL et al. 36 Tsukishiro S, Suzumori N, Nishikawa H, Arakawa A, Suzumori K. Use of serum Using a xenograft model of human breast cancer metastasis to find genes secretory leukocyte protease inhibitor levels in patients to improve specificity of associated with clinically aggressive disease. Cancer Res 2005; 65: 5578–5587. ovarian cancer diagnosis. Gynecol Oncol 2005; 96: 516–519. 15 Lowe AW, Olsen M, Hao Y, Lee SP, Taek Lee K, Chen X et al. Gene expression 37 Johnsen M, Lund LR, Romer J, Almholt K, Dano K. Cancer invasion and tissue patterns in pancreatic tumors, cells and tissues. PLoS ONE 2007; 2: e323. remodeling: common themes in proteolytic matrix degradation. Curr Opin Cell Biol 16 Devoogdt N, Rasool N, Hoskins E, Simpkins F, Tchabo N, Kohn EC. Overexpression 1998; 10: 667–671. of protease inhibitor-dead secretory leukocyte protease inhibitor causes 38 Liotta LA, Kohn EC. The microenvironment of the tumour-host interface. Nature more aggressive ovarian cancer in vitro and in vivo. Cancer Sci 2009; 100: 2001; 411: 375–379. 434–440. 39 Higashiyama M, Doi O, Yokouchi H, Kodama K, Nakamori S, Tateishi R. 17 Devoogdt N, Hassanzadeh Ghassabeh G, Zhang J, Brys L, De Baetselier P, Alpha-1-antichymotrypsin expression in lung adenocarcinoma and its possible Revets H. Secretory leukocyte protease inhibitor promotes the tumorigenic association with tumor progression. Cancer 1995; 76: 1368–1376. and metastatic potential of cancer cells. Proc Natl Acad Sci USA 2003; 100: 40 Grondahl-Hansen J, Christensen IJ, Rosenquist C, Brunner N, Mouridsen HT, 5778–5782. Dano K et al. High levels of urokinase-type plasminogen activator and its 18 Kluger HM, Kluger Y, Gilmore-Hebert M, DiVito K, Chang JT, Rodov S et al. cDNA inhibitor PAI-1 in cytosolic extracts of breast carcinomas are associated with poor microarray analysis of invasive and tumorigenic phenotypes in a breast prognosis. Cancer Res 1993; 53: 2513–2521. cancer model. Lab Invest 2004; 84: 320–331. 41 Hough CD, Sherman-Baust CA, Pizer ES, Montz FJ, Im DD, Rosenshein NB et al. 19 McElvaney NG, Nakamura H, Birrer P, Hebert CA, Wong WL, Alphonso M et al. Large-scale serial analysis of gene expression reveals genes differentially Modulation of airway inflammation in cystic fibrosis. In vivo suppression of expressed in ovarian cancer. Cancer Res 2000; 60: 6281–6287. interleukin-8 levels on the respiratory epithelial surface by aerosolization 42 Zelvyte I, Wallmark A, Piitulainen E, Westin U, Janciauskiene S. Increased plasma of recombinant secretory leukoprotease inhibitor. J Clin Invest 1992; 90: levels of serine proteinase inhibitors in lung cancer patients. Anticancer Res 2004; 1296–1301. 24: 241–247. 20 Song X, Zeng L, Jin W, Thompson J, Mizel DE, Lei K et al. Secretory leukocyte 43 Kataoka H, Itoh H, Koono M. Emerging multifunctional aspects of cellular serine protease inhibitor suppresses the inflammation and joint damage of bacterial cell proteinase inhibitors in tumor progression and tissue regeneration. Pathol Int wall-induced arthritis. J Exp Med 1999; 190: 535–542. 2002; 52:89–102. 21 Lentsch AB, Yoshidome H, Warner RL, Ward PA, Edwards MJ. Secretory leukocyte 44 Tomlins SA, Rhodes DR, Yu J, Varambally S, Mehra R, Perner S et al. The role of protease inhibitor in mice regulates local and remote organ inflammatory injury SPINK1 in ETS rearrangement-negative prostate cancers. Cancer Cell 2008; 13: induced by hepatic ischemia/reperfusion. Gastroenterology 1999; 117: 953–961. 519–528. 22 Gipson TS, Bless NM, Shanley TP, Crouch LD, Bleavins MR, Younkin EM et al. 45 Flavin R, Pettersson A, Hendrickson WK, Fiorentino M, Finn S, Kunz L et al. SPINK1 Regulatory effects of endogenous protease inhibitors in acute lung protein expression and prostate cancer progression. Clin Cancer Res 2014; 20: inflammatory injury. J Immunol 1999; 162: 3653–3662. 4904–4911. 23 Simpkins FA, Devoogdt NM, Rasool N, Tchabo NE, Alejandro EU, Kamrava MM 46 Wagenblast E, Soto M, Gutierrez-Angel S, Hartl CA, Gable AL, Maceli AR et al. et al. The alarm anti-protease, secretory leukocyte protease inhibitor, is a A model of breast cancer heterogeneity reveals vascular mimicry as a driver of proliferation and survival factor for ovarian cancer cells. Carcinogenesis 2008; 29: metastasis. Nature 2015; 520: 358–362. 466–472. 47 He Z, Ong CH, Halper J, Bateman A. Progranulin is a mediator of the wound 24 Rasool N, LaRochelle W, Zhong H, Ara G, Cohen J, Kohn EC. Secretory leukocyte response. Nat Med 2003; 9: 225–229. protease inhibitor antagonizes paclitaxel in ovarian cancer cells. Clin Cancer Res 48 He Z, Bateman A. Progranulin (granulin-epithelin precursor, PC-cell-derived 2010; 16: 600–609. growth factor, acrogranin) mediates tissue repair and tumorigenesis. J Mol Med 25 Thompson M, Lapointe J, Choi YL, Ong DE, Higgins JP, Brooks JD et al. (Berl) 2003; 81: 600–612. Identification of candidate prostate cancer genes through comparative 49 Monami G, Emiliozzi V, Bitto A, Lovat F, Xu SQ, Goldoni S et al. Proepithelin expression-profiling of seminal vesicle. Prostate 2008; 68: 1248–1256. regulates prostate cancer cell biology by promoting cell growth, migration, and 26 Thalmann GN, Anezinis PE, Chang SM, Zhau HE, Kim EE, Hopwood VL et al. anchorage-independent growth. Am J Pathol 2009; 174: 1037–1047. Androgen-independent cancer progression and bone metastasis in the LNCaP 50 Pan CX, Kinch MS, Kiener PA, Langermann S, Serrero G, Sun L et al. PC cell-derived model of human prostate cancer. Cancer Res 1994; 54: 2577–2581. growth factor expression in prostatic intraepithelial neoplasia and prostatic 27 Varambally S, Yu J, Laxman B, Rhodes DR, Mehra R, Tomlins SA et al. Integrative adenocarcinoma. Clin Cancer Res 2004; 10: 1333–1337. genomic and proteomic analysis of prostate cancer reveals signatures of meta- 51 Tangkeangsirisin W, Hayashi J, Serrero G. PC cell-derived growth factor mediates static progression. Cancer Cell 2005; 8: 393–406. tamoxifen resistance and promotes tumor growth of human breast cancer cells. 28 Chandran UR, Ma C, Dhir R, Bisceglia M, Lyons-Weiler M, Liang W et al. Gene Cancer Res 2004; 64: 1737–1743. expression profiles of prostate cancer reveal involvement of multiple molecular 52 Lovat F, Bitto A, Xu SQ, Fassan M, Goldoni S, Metalli D et al. Proepithelin is an pathways in the metastatic process. BMC Cancer 2007; 7: 64. autocrine growth factor for bladder cancer. Carcinogenesis 2009; 30: 861–868. 29 Zhu J, Nathan C, Jin W, Sim D, Ashcroft GS, Wahl SM et al. Conversion of 53 Ho JC, Ip YC, Cheung ST, Lee YT, Chan KF, Wong SY et al. Granulin-epithelin proepithelin to epithelins: roles of SLPI and elastase in host defense and precursor as a therapeutic target for hepatocellular carcinoma. Hepatology 2008; wound repair. Cell 2002; 111: 867–878. 47: 1524–1532. 30 Huang, da W, Sherman BT, Lempicki RA. Systematic and integrative analysis of 54 Taggart CC, Cryan SA, Weldon S, Gibbons A, Greene CM, Kelly E et al. Secretory large gene lists using DAVID bioinformatics resources. Nat Protoc 2009; 4:44–57. leucoprotease inhibitor binds to NF-kappaB binding sites in monocytes and 31 Lee EC, Zhan P, Schallhom R, Packman K, Tenniswood M. Antiandrogen-induced inhibits p65 binding. J Exp Med 2005; 202: 1659–1668. cell death in LNCaP human prostate cancer cells. Cell Death Differ 2003; 10: 55 Jan Treda C, Fukuhara T, Suzuki T, Nakamura A, Zaini J, Kikuchi T et al. Secretory 761–771. leukocyte protease inhibitor modulates urethane-induced lung carcinogenesis. 32 Chopra DP, Menard RE, Januszewski J, Mattingly RR. TNF-alpha-mediated Carcinogenesis 2014; 35: 896–904. apoptosis in normal human prostate epithelial cells and tumor cell lines. Cancer 56 Jia L, Shen HC, Wantroba M, Khalid O, Liang G, Wang Q et al. Locus-wide Lett 2004; 203: 145–154. chromatin remodeling and enhanced androgen receptor-mediated transcription 33 Wang D, Montgomery RB, Schmidt LJ, Mostaghel EA, Huang H, Nelson PS et al. in recurrent prostate tumor cells. Mol Cell Biol 2006; 26: 7331–7341. Reduced tumor necrosis factor receptor-associated death domain expression is 57 Zheng D, Decker KF, Zhou T, Chen J, Qi Z, Jacobs K et al. Role of WNT7B-induced associated with prostate cancer progression. Cancer Res 2009; 69: 9448–9456. noncanonical pathway in advanced prostate cancer. Mol Cancer Res 2013; 11: 34 Davis JS, Nastiuk KL, Krolewski JJ. TNF is necessary for castration-induced prostate 482–493. regression, whereas TRAIL and FasL are dispensable. Mol Endocrinol 2011; 25: 58 Hu F, Padukkavidana T, Vaegter CB, Brady OA, Zheng Y, Mackenzie IR et al. 611–620. Sortilin-mediated endocytosis determines levels of the frontotemporal dementia 35 Ameshima S, Ishizaki T, Demura Y, Imamura Y, Miyamori I, Mitsuhashi H. Increased protein, progranulin. Neuron 2010; 68: 654–667. secretory leukoprotease inhibitor in patients with nonsmall cell lung carcinoma. 59 Smyth GK. Linear models and empirical bayes methods for assessing differential Cancer 2000; 89: 1448–1456. expression in microarray experiments. Stat Appl Genet Mol Biol 2004; 3:1–25.

Supplementary Information accompanies this paper on the Oncogene website (http://www.nature.com/onc)