DOCSLIB.ORG

Yersinia Ruckeri Strain SC09 Disrupts Proinflammatory Activation Via

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Yersinia Ruckeri Strain SC09 Disrupts Proinflammatory Activation Via Fish and Shellfish Immunology 99 (2020) 424–434 Contents lists available at ScienceDirect Fish and Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi Full length article Yersinia ruckeri strain SC09 disrupts proinflammatory activation via Toll/IL- 1 receptor-containing protein STIR-3 T ∗ Tao Liua,1, Liangyu Lib,1, Wenyan Weib,1, Kaiyu Wanga,c, , Qian Yangc, Erlong Wangc a Department of Basic Veterinary, Veterinary Medicine College, Sichuan Agricultural University, Chengdu, Sichuan, China b Institute of Fisheries of Chengdu Agriculture and Forestry Academy, Chengdu, China c Key Laboratory of Animal Disease and Human Health of Sichuan Province, Sichuan Agricultural University, Chengdu, Sichuan, China ARTICLE INFO ABSTRACT Keywords: Virulent pathogenic microorganisms often enhance their infectivity through immune evasion mechanisms. Our Yersinia ruckeri research on the integrative and conjugative element (ICE(r2)) of the virulent fish pathogen Yersinia ruckeri SC09 STIR-3 led to the identification of genes related to immune evasion (designated stir-1, stir-2, stir-3 and stir-4), among MyD88 which stir-1 and stir-2 were determined as the key contributors to bacterial toxicity and immune evasion. Here, Immune evasion we further examined the ability of stir-3 to mediate immune evasion based on detailed bioinformatic analysis of Secretion ICE(r2) from Y. ruckeri SC09. Interactions among the translated STIR-1, STIR-2, STIR-3 and STIR-4 proteins in the secretory process were additionally explored. STIR-3 was positively correlated with bacterial toxicity and inhibited host toll-like receptor (TLR) signaling by interacting with MyD88, thereby facilitating bacterial sur- vival in host cells. Importantly, our data showed co-secretion of STIR-1, STIR-2 and STIR-3 as a complex, with secretion failure occurring in the absence of any one of these proteins. While stir-1, stir-2, stir-3 and stir-4 genes werespecifictoY. ruckeri SC09, the ICE(r2) region where these genes were located is a mobile component widely distributed in bacteria. Therefore, the potential transmission risk of these immune evasion genes requires further research attention. 1. Introduction to a horizontal gene transfer (HGT) element [20], a powerful evolu- tionary adaptation of prokaryotic microorganisms [21] containing Yersinia ruckeri is an important pathogen in the aquaculture industry plasmids and phage in addition to ICEs [22] that significantly affects [1]. Previous studies on this pathogen have focused on clinical case their diversity and adaptability. Microorganisms containing these ele- reports (infection of multiple serotypes [2–8] and biotypes [9–11]) and ments can effectively transfer genes between strains over long phylo- individual virulence genes, such as cdsAB [12], flhDC [13], incAC [14], genetic distances, mediate mutations beneficial for niche adaptation of ZnuABC [15], and BarA-UvrY [16]. However, limited investigations to strains, and promote the formation of new species [22]. Notably, ICEs date have evaluated pathogenicity from a systemic perspective or differ significantly from plasmids and bacteriophages. On the one hand, clarified pathogen-host interactions. Earlier, we identified a large in- they have both plasmid and phage properties and are considered tegrative and conjugative element (ICEr2) containing the type IV se- plasmid-like prophages [23]. These elements can be inherited vertically cretion system in the Y. ruckeri SC09 genome [17,18] encompassing as part of a bacterial chromosome or horizontally via endogenously multiple immune escape-related genes (stir-1, stir-2, stir-3, and stir-4). encoded conjugative elements. Structurally, ICEs include conservative We suggest that this ICE component and its “cargo” genes participate in modules that mediate integration, excision, binding, and regulation Y. ruckeri SC09-mediated evasion of the natural immune system of the [24]. During the conjugation process, ICEs are cyclized and transferred host, facilitating intracellular survival. to new species with retention of a copy in the original donor bacteria Due to significant developments in high-throughput sequencing [22]. On the other hand, plasmids and phages often carry only genes technology, genetic characteristics of bacteria are more comprehen- that are genetically related to themselves while ICEs carry “cargo” sively understood [19]. Integrative and conjugative elements (ICE) in Y. genes associated with niche adaptation of host strains [23], including ruckeri SC09 were recently identified by our group [17,18]. ICEs belong formation of biofilms, pathogenicity, antibiotic resistance and heavy ∗ Corresponding author. Department of Basic Veterinary, Veterinary Medicine College, Sichuan Agricultural University, Chengdu, China. E-mail address: [email protected] (K. Wang). 1 These authors contributed equally to this work. https://doi.org/10.1016/j.fsi.2020.02.035 Received 24 October 2019; Received in revised form 11 February 2020; Accepted 16 February 2020 Available online 19 February 2020 1050-4648/ © 2020 Published by Elsevier Ltd. T. Liu, et al. Fish and Shellfish Immunology 99 (2020) 424–434 metal resistance [25]. In addition, these cargo genes are not conserved in Jianyang, Sichuan Province of China, was routinely cultured on between strains and display significant differences in specificity and Luria-Bertani (LB) medium at 28 °C. A virulent Y. ruckeri SC10 strain genetic information, resulting in sizes ranging from 20 to 500 kb [24]. was isolated from the aquatic environment. The cargo genes, stir-1, stir-2, stir-3, and stir-4, associated with im- mune evasion were examined in this study. A common feature of these 2.3. Construction of Y. ruckeri Δstir-3 mutant and complementary strains genes is the presence of a Toll/interleukin-1 receptor domain within the encoded proteins. Our group previously investigated the pathogenicity Gene knockout was performed as described by Luo et al. [26]. The of stir-1 (originally designated tcpA and renamed stir-1 to distinguish it stir-3 gene sequence (gene accession number: NJ56_RS12440) of the Y. from similar genes found in other bacteria) and stir-2 in the Y. ruckeri ruckeri SC09 strain (gene accession number: NZ_CP025800) is available SC09 infection process [17,18] and established the immune evasion in GenBank. The left and right homology arm primer sequences of stir-3 functions of the corresponding translated proteins in vivo and in vitro were GGAATCTAGACCTTGAGTCGGTGAAAAATGAGGTGCCTTATGG/ [17,18]. The immune evasion mechanisms of stir-1 and stir-2 genes TATAACCTTCATCGAGCGTCCAGGCCATGAATCAACTCCTTTTG (up- were shown to be mainly achieved through direct interactions of the stream, A) and CAAAAGGAGTTGATTCATGGCCTGGACGCTCGATGAA encoded proteins with MyD88 in infected cells [17,18], which induced GGTTATA/ACAGCTAGCGACGATATGTCACACCAAGAGTCAAACACAC an inhibitory effect on the Toll-like receptor signaling pathway, even- CGA (downstream, B), respectively. Left and right homology arms (AB) tually reducing the ability of innate immunity to recognize bacterial of stir-3 were constructed and cloned into pLP12 (Guangzhou KnoGen infections. We propose that this pathway of immune evasion represents Biotech Co., Ltd.) to generate the pLP12-stir-3 construct, which was a universal mechanism. Here, we focused on the immune evasion transformed into the competent E. coli strain β2163 (Guangzhou property of stir-3 and its associations with stir-1, stir-2 and stir-4 in KnoGen Biotech Co., Ltd.) via electroporation. A positive strain re- addition to the collective effects of all four genes on immune evasion. sistant to chloramphenicol, designated pLP12-stir-3-β2163, was subse- quently isolated. Co-culture of β2163 cells containing pLP12-stir-3-po- 2. Materials and methods sitive clones with Y. ruckeri SC09 resulted in conjugation and allowed screening for the first homologous recombinants of the mutant SC09 2.1. Bioinformatics analysis of ICE(r2) in genomes strain on LB plates (20 μg/mL CM + 0.3% D-glucose). SC09 strains with the insertion were screened on LB plates (0.4% L-arabinose) to obtain a ICE(r2) homologous regions in other bacterial genomes were de- Δstir-3 strain with a second homologous recombination. As described tected using MegaBlast (https://blast.ncbi.nlm.nih.gov/Blast.cgi). previously [26], SC09 and SC10 strains were re-transformed with the Individual hits were retrieved and manually searched for ICE(r2) hall- stir-3-pBAD33cm-rp4 vector [27] and expression of stir-3 induced with mark genes in close proximity, such as integrase and tRNA, located near arabinose. the other end of ICEs. Putative ICE regions were isolated in silico from the host genome and pairwise compared with ICE(r2) using WebACT 2.4. Fish infection model (http://www.webact.org/WebACT/home). Regions with > 79% nu- cleotide sequence similarity were exported and displayed on the local At the logarithmic growth phase, wild-type Y. ruckeri SC09 and gene map using DNAPlotter. TIR domain analysis of STIR-1, 2, 3, and 4 recombinant SC09Δstir-3 were inoculated intraperitoneally in SC09 was performed using BlastX (https://blast.ncbi.nlm.nih.gov/ (5 × 107 CFU) into 15 random rainbow trout (60–100 g), and mortality Blast.cgi). in fish assessed. Rainbow trout survival curve analysis and mapping were performed using GraphPad Prism software version 8.0. The 2.2. Bacterial strains growth curves of Y. ruckeri SC09 and SC09Δstir-3 were compared to eliminate the potential effect of differences in growth ability of the The strains and plasmids used in this study are listed in Table 1. knockout strain in the infection model. To investigate infection and Wild-type Y. ruckeri SC09 isolated from diseased fish in a reservoir farm histological differences in immune organs post-infection, liver, spleen, Table 1 Strains and plasmids used in this study. Strain or plasmid Description Reference Strains Y. ruckeri SC09 GenBank (CP025800.1) with ICE (r2) Liu et al. [19] Y. ruckeri SC10 Does not carry ICE (r2) Liu et al. [19] − – + – E. coli DH5α F endA1 glnV44 thi-1 recA1 relA1 gyrA96 deoR nupG purB20 ϕ80dlacZΔM15 Δ(lacZYA-argF)U169, hsdR17 (rK mK ), λ Clontech β2163 (F−) RP4-2-Tc::Mu ΔdapA::(erm-pir) KnoGen Biotech SC09 Δstir-1 stir-1 deletion Liu et al.
Load more

Recommended publications
  • Effects of Sirna Silencing on the Susceptibility of the Fish
    bioRxiv preprint doi: https://doi.org/10.1101/626812; this version posted May 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 Effects of siRNA silencing on the susceptibility of the 2 fish cell line CHSE-214 to Yersinia ruckeri 3 4 Running page head: siRNA silencing vs Y. ruckeri 5 1# 1 6 Authors: Simon Menanteau-Ledouble , Oskar Schachner , Mark L. 2 1 7 Lawrence , Mansour El-Matbouli 1 8 Clinical Division of Fish Medicine, University of Veterinary Medicine, Vienna, 9 Austria 2 10 College of Veterinary Medicine, Mississippi State University, Mississippi State, 11 Mississippi, USA 12 13 Postal addresses: Clinical Division of Fish Medicine, University of Veterinary 14 Medicine, Veterinärplatz 1, 1210 Vienna, Austria # 15 Corresponding Author: Dr. Simon Menanteau-Ledouble 16 Email Address: [email protected] 17 Tel. No.: +431250775151 18 Fax No.: +431250775192 19 20 Additional email addresses: 21 M. El-Matbouli: [email protected] 22 M. L. Lawrence: [email protected] 23 O. Schachner : [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/626812; this version posted May 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
    [Show full text]
  • Table S4. Phylogenetic Distribution of Bacterial and Archaea Genomes in Groups A, B, C, D, and X
    Table S4. Phylogenetic distribution of bacterial and archaea genomes in groups A, B, C, D, and X. Group A a: Total number of genomes in the taxon b: Number of group A genomes in the taxon c: Percentage of group A genomes in the taxon a b c cellular organisms 5007 2974 59.4 |__ Bacteria 4769 2935 61.5 | |__ Proteobacteria 1854 1570 84.7 | | |__ Gammaproteobacteria 711 631 88.7 | | | |__ Enterobacterales 112 97 86.6 | | | | |__ Enterobacteriaceae 41 32 78.0 | | | | | |__ unclassified Enterobacteriaceae 13 7 53.8 | | | | |__ Erwiniaceae 30 28 93.3 | | | | | |__ Erwinia 10 10 100.0 | | | | | |__ Buchnera 8 8 100.0 | | | | | | |__ Buchnera aphidicola 8 8 100.0 | | | | | |__ Pantoea 8 8 100.0 | | | | |__ Yersiniaceae 14 14 100.0 | | | | | |__ Serratia 8 8 100.0 | | | | |__ Morganellaceae 13 10 76.9 | | | | |__ Pectobacteriaceae 8 8 100.0 | | | |__ Alteromonadales 94 94 100.0 | | | | |__ Alteromonadaceae 34 34 100.0 | | | | | |__ Marinobacter 12 12 100.0 | | | | |__ Shewanellaceae 17 17 100.0 | | | | | |__ Shewanella 17 17 100.0 | | | | |__ Pseudoalteromonadaceae 16 16 100.0 | | | | | |__ Pseudoalteromonas 15 15 100.0 | | | | |__ Idiomarinaceae 9 9 100.0 | | | | | |__ Idiomarina 9 9 100.0 | | | | |__ Colwelliaceae 6 6 100.0 | | | |__ Pseudomonadales 81 81 100.0 | | | | |__ Moraxellaceae 41 41 100.0 | | | | | |__ Acinetobacter 25 25 100.0 | | | | | |__ Psychrobacter 8 8 100.0 | | | | | |__ Moraxella 6 6 100.0 | | | | |__ Pseudomonadaceae 40 40 100.0 | | | | | |__ Pseudomonas 38 38 100.0 | | | |__ Oceanospirillales 73 72 98.6 | | | | |__ Oceanospirillaceae
    [Show full text]
  • Olfactory-Immuno Pathway of Infectious Hematopoietic
    OLFACTORY-IMMUNO PATHWAY OF INFECTIOUS HEMATOPOIETIC NECROSIS VIRUS AND YERSINIA RUCKERI IN RAINBOW TROUT by Fabiola Mancha, B.S. A thesis submitted to the Graduate Council of Texas State University in partial fulfillment of the requirements for the degree of Master of Science with a Major in Aquatic Resources August 2021 Committee Members: Mar Huertas, Chair Dana M. García Kelly Woytek COPYRIGHT by Fabiola Mancha 2021 FAIR USE AND AUTHOR’S PERMISSION STATEMENT Fair Use This work is protected by the Copyright Laws of the United States (Public Law 94-553, section 107). Consistent with fair use as defined in the Copyright Laws, brief quotations from this material are allowed with proper acknowledgement. Use of this material for financial gain without the author’s express written permission is not allowed. Duplication Permission As the copyright holder of this work I, Fabiola Mancha, authorize duplication of this work, in whole or in part, for educational or scholarly purposes only. ACKNOWLEDGEMENTS First and foremost, I’d like to thank Dr. Mar Huertas for her patience, guidance and encouragement throughout this experience. Her love and passion for science, teaching, and uplifting Hispanic women in STEM is inspiring, and I am forever appreciative for everything I have learned during my time in her lab. Thank you, Dr. Huertas, so much for challenging me and helping me evolve as a writer and scientist. I would also like to thank my committee, Dr. Dana García, and Dr. Kelly Woytek, for taking their time to help me with this project and for introducing and nurturing my love of neurobiology and immunology.
    [Show full text]
  • A Genome-Scale Antibiotic Screen in Serratia Marcescens Identifies Ydgh As a Conserved Modifier of Cephalosporin and Detergent S
    bioRxiv preprint doi: https://doi.org/10.1101/2021.04.16.440252; this version posted April 17, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 A genome-scale antibiotic screen in Serratia marcescens identifies YdgH as a conserved 2 modifier of cephalosporin and detergent susceptibility 3 Jacob E. Lazarus1,2,3,#, Alyson R. Warr2,3, Kathleen A. Westervelt2,3, David C. Hooper1,2, Matthew 4 K. Waldor2,3,4 5 1 Department of Medicine, Division of Infectious Diseases, Massachusetts General Hospital, Harvard 6 Medical School, Boston, MA, USA 7 2 Department of Microbiology, Harvard Medical School, Boston, MA, USA 8 3 Department of Medicine, Division of Infectious Diseases, Brigham and Women’s Hospital, Harvard 9 Medical School, Boston, MA, USA 10 4 Howard Hughes Medical Institute, Boston, MA, USA 11 * Correspondence to [email protected] 12 13 Running Title: Antibiotic whole-genome screen in Serratia marcescens 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.16.440252; this version posted April 17, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 14 Abstract: 15 Serratia marcescens, a member of the order Enterobacterales, is adept at colonizing healthcare 16 environments and an important cause of invasive infections. Antibiotic resistance is a daunting 17 problem in S. marcescens because in addition to plasmid-mediated mechanisms, most isolates 18 have considerable intrinsic resistance to multiple antibiotic classes.
    [Show full text]
  • Diversity of Culturable Gut Bacteria of Diamondback Moth, Plutella Xylostella (Linnaeus) (Lepidoptera: Yponomeutidae) Collected
    Diversity of Culturable Gut Bacteria of Diamondback Moth, Plutella Xylostella (Linnaeus) (Lepidoptera: Yponomeutidae) Collected From Different Geographical Regions of India Mandeep Kaur ( [email protected] ) Dr Yashwant Singh Parmar University of Horticulture and Forestry https://orcid.org/0000-0002-6118- 9447 Meena Thakur Dr Yashwant Singh Parmar University of Horticulture and Forestry Vinay Sagar ICAR-CPRI: Central Potato Research Institute Ranjna Sharma Dr Yashwant Singh Parmar University of Horticulture and Forestry Research Article Keywords: Plutella xylostella, Bacteria, DNA, Phylogeny Posted Date: May 25th, 2021 DOI: https://doi.org/10.21203/rs.3.rs-510613/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/15 Abstract Diamondback moth, Plutella xylostella is one of the important pests of cole crops, the larvae of which cause damage to leaves from seedling stage to the harvest thus reducing the quality and quantity of the yield. The insect gut posses a large variety of microbial communities among which, the association of bacteria is the most spread and common. Due to variations in various agro-climatic factors, the insect often assumes the status of major pest. These geographical variations in insects inuence various biological parameters including insecticide resistance due to diversity of microbes/bacteria. The diverse role of gut bacteria in insect tness traits has now gained perspectives for biotechnological exploration. The present study was aimed to determine the diversity of larval gut bacteria of diamondback moth collected from ve different geographical regions of India. The gut bacteria of this pest were found to be inuenced by different geographical regions.
    [Show full text]
  • Challenges in Detection and Sub Typing of Yersinia Enterocolitica by Conventional Culture Methods
    SL Gastroenterology Special Issue Article “Yersiniosis” Short Review Challenges in Detection and Sub typing of Yersinia Enterocolitica by Conventional Culture Methods Stefanos Petsios* Department of Microbiology, Faculty of Medicine, University of Ioannina, Ioannina ARTICLE INFO ABSTRACT Yersinia enterocolitica is an important food borne pathogen, but the incidence of Received Date: January 13, 2020 Accepted Date: February 11, 2020 infected people is underestimated since clinical samples are not routinely tested for Published Date: February 13, 2020 Yersinia. Problems emerge also from the similarities with other Enterobacteriaceae and KEYWORDS Y. enterocolitica-like species and the heterogeneity of Y. enterocolitica as it comprises both pathogenic and non-pathogenic isolates. This review focuses on the methods for Yersinia Enterocolitica Y. enterocolitica detection and sub typing by culture methods as well as the difficulties Food LPS that are met. INTRODUCTION Copyright: © 2020 Stefanos Petsios. Yersinia enterocolitica is a Gram negative bacterium that belongs to the order SL Gastroenterology. This is an open Enterobacteriales and the family Yersiniaceae [1]. It is highly heterogonous species access article distributed under the Creative Commons Attribution License, which according to biochemical activity and Lipopolysaccharide (LPS) O antigens is which permits unrestricted use, divided into six biotypes and in about 70 O-serotypes, respectively. Biotypes distribution, and reproduction in any includethe non-pathogenic 1A and the pathogenic biotypes 1B, 2, 3, 4 and medium, provided the original work is properly cited. 5.Additionally, the Presence Of The Virulence Plasmid (pYV) is a strong indication of pathogenicity that is essential for the bacterium to survive and multiple in lymphoid Citation for this article: Stefanos tissues 2,3].
    [Show full text]
  • Diversity and Evolution of Surface Polysaccharide Synthesis Loci in Enterobacteriales
    bioRxiv preprint doi: https://doi.org/10.1101/709832; this version posted January 28, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. 1 Diversity and evolution of surface polysaccharide synthesis loci 2 in Enterobacteriales 1,2 3 1 1 3,4 Kathryn E. Holt , Florent Lassalle , Kelly L. Wyres , Ryan Wick and Rafa l J. Mostowy † 4 1) Department of Infectious Diseases, Central Clinical School, Monash University, Melbourne, Australia 2) London School of Hygiene and Tropical Medicine, London, UK 6 3) Department of Infectious Disease Epidemiology, School of Public Health, Imperial College London, UK 4) Malopolska Centre of Biotechnology, Jagiellonian University, Krakow, Poland 8 Correspondence: [email protected] † Bacterial capsules and lipopolysaccharides are diverse surface polysaccharides (SPs) that serve 10 as the frontline for interactions with the outside world. While SPs can evolve rapidly, their di- versity and evolutionary dynamics across di↵erent taxonomic scales has not been investigated in 12 detail. Here, we focused on the bacterial order Enterobacteriales (including the medically-relevant Enterobacteriaceae), to carry out comparative genomics of two SP locus synthesis regions, cps and 14 kps,using27,334genomesfrom45genera.Weidentifiedhigh-qualitycps loci in 22 genera and kps in 11 genera, around 4% of which were detected in multiple species. We found SP loci to 16 be highly dynamic genetic entities: their evolution was driven by high rates of horizontal gene transfer (HGT), both of whole loci and component genes, and relaxed purifying selection, yielding 18 large repertoires of SP diversity.
    [Show full text]
  • International Journal of Systematic and Evolutionary Microbiology (2016), 66, 5575–5599 DOI 10.1099/Ijsem.0.001485
    International Journal of Systematic and Evolutionary Microbiology (2016), 66, 5575–5599 DOI 10.1099/ijsem.0.001485 Genome-based phylogeny and taxonomy of the ‘Enterobacteriales’: proposal for Enterobacterales ord. nov. divided into the families Enterobacteriaceae, Erwiniaceae fam. nov., Pectobacteriaceae fam. nov., Yersiniaceae fam. nov., Hafniaceae fam. nov., Morganellaceae fam. nov., and Budviciaceae fam. nov. Mobolaji Adeolu,† Seema Alnajar,† Sohail Naushad and Radhey S. Gupta Correspondence Department of Biochemistry and Biomedical Sciences, McMaster University, Hamilton, Ontario, Radhey S. Gupta L8N 3Z5, Canada [email protected] Understanding of the phylogeny and interrelationships of the genera within the order ‘Enterobacteriales’ has proven difficult using the 16S rRNA gene and other single-gene or limited multi-gene approaches. In this work, we have completed comprehensive comparative genomic analyses of the members of the order ‘Enterobacteriales’ which includes phylogenetic reconstructions based on 1548 core proteins, 53 ribosomal proteins and four multilocus sequence analysis proteins, as well as examining the overall genome similarity amongst the members of this order. The results of these analyses all support the existence of seven distinct monophyletic groups of genera within the order ‘Enterobacteriales’. In parallel, our analyses of protein sequences from the ‘Enterobacteriales’ genomes have identified numerous molecular characteristics in the forms of conserved signature insertions/deletions, which are specifically shared by the members of the identified clades and independently support their monophyly and distinctness. Many of these groupings, either in part or in whole, have been recognized in previous evolutionary studies, but have not been consistently resolved as monophyletic entities in 16S rRNA gene trees. The work presented here represents the first comprehensive, genome- scale taxonomic analysis of the entirety of the order ‘Enterobacteriales’.
    [Show full text]
  • Description of Two Serratia Marcescens Associated Mastitis Outbreaks in Finnish Dairy Farms and a Review of Literature
    Friman et al. Acta Vet Scand (2019) 61:54 https://doi.org/10.1186/s13028-019-0488-7 Acta Veterinaria Scandinavica RESEARCH Open Access Description of two Serratia marcescens associated mastitis outbreaks in Finnish dairy farms and a review of literature Mari Johanna Friman1* , Marjut Hannele Eklund2, Anna Helena Pitkälä2, Päivi Johanna Rajala‑Schultz1 and Merja Hilma Johanna Rantala2 Abstract Background: Infection with Serratia spp. have been associated with mastitis outbreaks in dairy cattle herds. Environ‑ mental contamination or a point source, like a teat dip product, have often been observed to be potential sources of such outbreaks. We describe two Serratia marcescens associated mastitis outbreaks associated with a contaminated teat dip containing a tertiary alkyl amine, n,n‑bis (3‑aminopropyl) dodecylamine in two dairy cattle farms in Finland. S. marcescens strains isolated from milk and environmental samples were identifed by the MALDI‑TOF method. Results: Six specimens (n 19) on Herd 1 and all specimens (n 9) on Herd 2 were positive for S. marcescens. Positive specimens were from mastitis= milk and teat dip liquid and equipment.= Bacteria were not isolated from the unopened teat dip canister. The same clone of S. marcescens was isolated from milk samples and teat dip samples within the farms. Pulsed feld gel electrophoresis results to the S. marcescens isolates from these two diferent herds were tested with unweighted pair‑group method using arithmetic average clustering analysis. The isolates were not same clone in both herds, because similarity in that test was only 75% when cut‑of value to similarity is 85%. Conclusions: Our investigation showed that the post milking teat dip and/or temporary containers were contami‑ nated with S.
    [Show full text]
  • Asaia (Rhodospirillales: Acetobacteraceae)
    Revista Brasileira de Entomologia 64(2):e20190010, 2020 www.rbentomologia.com Asaia (Rhodospirillales: Acetobacteraceae) and Serratia (Enterobacterales: Yersiniaceae) associated with Nyssorhynchus braziliensis and Nyssorhynchus darlingi (Diptera: Culicidae) Tatiane M. P. Oliveira1* , Sabri S. Sanabani2, Maria Anice M. Sallum1 1Universidade de São Paulo, Faculdade de Saúde Pública, Departamento de Epidemiologia, São Paulo, SP, Brasil. 2Universidade de São Paulo, Faculdade de Medicina da São Paulo (FMUSP), Hospital das Clínicas (HCFMUSP), Brasil. ARTICLE INFO ABSTRACT Article history: Midgut transgenic bacteria can be used to express and deliver anti-parasite molecules in malaria vector mosquitoes Received 24 October 2019 to reduce transmission. Hence, it is necessary to know the symbiotic bacteria of the microbiota of the midgut Accepted 23 April 2020 to identify those that can be used to interfering in the vector competence of a target mosquito population. Available online 08 June 2020 The bacterial communities associated with the abdomen of Nyssorhynchus braziliensis (Chagas) (Diptera: Associate Editor: Mário Navarro-Silva Culicidae) and Nyssorhynchus darlingi (Root) (Diptera: Culicidae) were identified using Illumina NGS sequencing of the V4 region of the 16S rRNA gene. Wild females were collected in rural and periurban communities in the Brazilian Amazon. Proteobacteria was the most abundant group identified in both species. Asaia (Rhodospirillales: Keywords: Acetobacteraceae) and Serratia (Enterobacterales: Yersiniaceae) were detected in Ny. braziliensis for the first time Vectors and its presence was confirmed in Ny. darlingi. Malaria Amazon Although the malaria burden has decreased worldwide, the disease bites by the use of insecticide-treated bed nets, and insecticide indoor still imposes enormous suffering for human populations in the majority residual spraying (Baird, 2017; Shretta et al., 2017; WHO, 2018).
    [Show full text]
  • Taxonomic Hierarchy of the Phylum Proteobacteria and Korean Indigenous Novel Proteobacteria Species
    Journal of Species Research 8(2):197-214, 2019 Taxonomic hierarchy of the phylum Proteobacteria and Korean indigenous novel Proteobacteria species Chi Nam Seong1,*, Mi Sun Kim1, Joo Won Kang1 and Hee-Moon Park2 1Department of Biology, College of Life Science and Natural Resources, Sunchon National University, Suncheon 57922, Republic of Korea 2Department of Microbiology & Molecular Biology, College of Bioscience and Biotechnology, Chungnam National University, Daejeon 34134, Republic of Korea *Correspondent: [email protected] The taxonomic hierarchy of the phylum Proteobacteria was assessed, after which the isolation and classification state of Proteobacteria species with valid names for Korean indigenous isolates were studied. The hierarchical taxonomic system of the phylum Proteobacteria began in 1809 when the genus Polyangium was first reported and has been generally adopted from 2001 based on the road map of Bergey’s Manual of Systematic Bacteriology. Until February 2018, the phylum Proteobacteria consisted of eight classes, 44 orders, 120 families, and more than 1,000 genera. Proteobacteria species isolated from various environments in Korea have been reported since 1999, and 644 species have been approved as of February 2018. In this study, all novel Proteobacteria species from Korean environments were affiliated with four classes, 25 orders, 65 families, and 261 genera. A total of 304 species belonged to the class Alphaproteobacteria, 257 species to the class Gammaproteobacteria, 82 species to the class Betaproteobacteria, and one species to the class Epsilonproteobacteria. The predominant orders were Rhodobacterales, Sphingomonadales, Burkholderiales, Lysobacterales and Alteromonadales. The most diverse and greatest number of novel Proteobacteria species were isolated from marine environments. Proteobacteria species were isolated from the whole territory of Korea, with especially large numbers from the regions of Chungnam/Daejeon, Gyeonggi/Seoul/Incheon, and Jeonnam/Gwangju.
    [Show full text]
  • OXA-48 Carbapenemase-Producing Enterobacterales in Spanish Hospitals: an Updated Comprehensive Review on a Rising Antimicrobial Resistance
    antibiotics Review OXA-48 Carbapenemase-Producing Enterobacterales in Spanish Hospitals: An Updated Comprehensive Review on a Rising Antimicrobial Resistance Mario Rivera-Izquierdo 1,2,3,* , Antonio Jesús Láinez-Ramos-Bossini 4 , Carlos Rivera-Izquierdo 1,5, Jairo López-Gómez 6, Nicolás Francisco Fernández-Martínez 7,8 , Pablo Redruello-Guerrero 9 , Luis Miguel Martín-delosReyes 1, Virginia Martínez-Ruiz 1,3,10 , Elena Moreno-Roldán 1,3 and Eladio Jiménez-Mejías 1,3,10,11 1 Department of Preventive Medicine and Public Health, University of Granada, 18016 Granada, Spain; [email protected] (C.R.-I.); [email protected] (L.M.M.-d.); [email protected] (V.M.-R.); [email protected] (E.M.-R.); [email protected] (E.J.-M.) 2 Service of Preventive Medicine and Public Health, Hospital Clínico San Cecilio, 18016 Granada, Spain 3 Biosanitary Institute of Granada, ibs.GRANADA, 18012 Granada, Spain 4 Department of Radiology, University of Granada, 18016 Granada, Spain; [email protected] 5 Service of Ginecology and Obstetrics, Hospital Universitario Virgen de las Nieves, 18014 Granada, Spain 6 Service of Internal Medicine, San Cecilio University Hospital, 18016 Granada, Spain; [email protected] 7 Department of Preventive Medicine and Public Health, Reina Sofía University Hospital, 14004 Córdoba, Spain; [email protected] 8 Maimonides Biomedical Research Institute of Córdoba (IMIBIC), 14001 Córdoba, Spain Citation: Rivera-Izquierdo, M.; 9 School of Medicine, University of Granada,
    [Show full text]