DOCSLIB.ORG

1 Supplement Evaluating the Quorum Quenching Potential of Bacteria Associated to Aurelia Aurita and Mnemiopsis Leidyi Daniela P

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
1 Supplement Evaluating the Quorum Quenching Potential of Bacteria Associated to Aurelia Aurita and Mnemiopsis Leidyi Daniela P 1 Supplement Evaluating the quorum quenching potential of bacteria associated to Aurelia aurita and Mnemiopsis leidyi Daniela Prasse1*, Nancy Weiland-Bräuer1*, Cornelia Jaspers2, Thorsten B.H. Reusch2, and Ruth A. Schmitz1 1Institute of General Microbiology, Christian-Albrechts University Kiel, Am Botanischen Garten 1- 9, 24118 Kiel, Germany 2GEOMAR Helmholtz Centre for Ocean Research Kiel, Marine Evolutionary Ecology, Kiel, Germany *Contributed equally to this work 2 Supplement Tab. S1: Primers used for QQ-ORF amplification and sequence analysis. Underlined parts are added restriction sites for directed cloning. Primer Sequence 5´ 3´ 91_5/E6_ORF1_for GAATTCATGAACTTTACAGACAAATCAATTAAGGC 91_5/E6_ORF1_rev TCTAGATTACAATACTAAGCTTACTTTATGGC 91_5/E6_ORF2_for GAATTCATGCGTGGTACCCTAAACATTGC 91_5/E6_ORF2_rev AAGCTTTTACAGACCTCCCTTGAGATACCGC 91_5/E6_ORF3_for GAATTCATGAGCAACAATAAAGACACAGTGC 91_5/E6_ORF3_rev AAGCTTTTAATGAGCAACAATAAAGACACAG 3 Supplement Tab. S2: Bacteria isolated from Aurelia aurita, Mnemiopsis leidyi and ambient seawater. Bacteria were isolated by classical enrichment on agar plates and taxonomically classified based on full length 16S rRNA gene sequences. QQ activities of isolates are stated in (-) no activity, (+) low, (++) mid, and (+++) high activity against acyl-homoserine lactone (AHL) and autoinducer-2 (AI-2). best homologue QQ taxonomic classification based on 16S full activity colony Isolate origin length rRNA gene morphology (Accession No., phylum class order family AHL AI-2 identity) A. aurita Pseudomonas stutzeri yellowish-white, 1 medusa Proteobacteria Gammaproteobacteria Pseudomonadales Pseudomonadaceae - - (JX177727.1, 99%) smeary Baltic Sea A. aurita Pseudomonas stutzeri 2 medusa Proteobacteria Gammaproteobacteria Pseudomonadales Pseudomonadaceae orange, round ++ - (JN228326.1, 99%) Baltic Sea A. aurita Pseudomonas segetis white, round, 3 medusa Proteobacteria Gammaproteobacteria Pseudomonadales Pseudomonadaceae - - (AY770691.2, 99%) smeary Baltic Sea A. aurita Pseudoalteromonas 4 medusa sp. 191Z-13 Proteobacteria Gammaproteobacteria Pseudomonadales Pseudomonadaceae white, smeary +++ - Baltic Sea (JX310231.1, 99%) A. aurita Uncultured bacterium white with orange 5 medusa clone ncd1928c11c1 n.a. n.a. n.a. n.a. +++ - spots, smeary Baltic Sea (JF165581.1, 93%) A. aurita Vibrio alginolyticus white with orange 6 medusa Proteobacteria Gammaproteobacteria Vibrionales Vibrionaceae - - (KP698605.1, 99%) spots, smeary Baltic Sea A. aurita Vibrio sp. S54CA 7 medusa Proteobacteria Gammaproteobacteria Vibrionales Vibrionaceae white, smeary - - (KF188533.1, 98%) Baltic Sea A. aurita Pseudomonas stutzeri 8 medusa Proteobacteria Gammaproteobacteria Pseudomonadales Pseudomonadaceae yellow, round ++ - (JN228326.1, 99%) Baltic Sea A. aurita Pseudomonas stutzeri 9 medusa Proteobacteria Gammaproteobacteria Pseudomonadales Pseudomonadaceae yellow, roundish + - (JX177727.1, 99%) Baltic Sea A. aurita Pseudomonas sp. 10 medusa BJGMM-B54 Proteobacteria Gammaproteobacteria Pseudomonadales Pseudomonadaceae yellow, roundish ++ - Baltic Sea (JQ716254.1, 99%) A. aurita Pseudomonas stutzeri 11 medusa Proteobacteria Gammaproteobacteria Pseudomonadales Pseudomonadaceae yellow, roundish ++ - (JX177727.1, 99%) Baltic Sea A. aurita Alteromonas 12 medusa genoviensis Proteobacteria Gammaproteobacteria Alteromonadales Alteromonadaceae light yellow, round ++ - Baltic Sea (FJ040187.1, 99%) 4 Supplement A. aurita Bacillus subtilis 13 medusa Firmicutes Bacilli Bacillales Bacillaceae white, oval - - (JX188065.1, 98%) Baltic Sea A. aurita Microbacterium 14 medusa lacticum strain 2833 Actinobacteria Actinobacteria Actinomycetales Microbacteriaceae white, smeary - - Baltic Sea (EU714346.1, 99%) A. aurita Sulfitobacter sp. light orange in 15 medusa QD214-NF102 Proteobacteria Alphaproteobacteria Rhodobacterales Rhodobacteraceae +++ + centre, round Baltic Sea (KC689801.1, 99%) A. aurita Micrococcus sp. 3455 16 medusa Actinobacteria Actinobacteria Actinomycetales Micrococcaceae white, round - - (KP345948.1, 99%) Baltic Sea A. aurita Bacillus cereus 17 medusa Firmicutes Bacilli Bacillales Bacillaceae white, roundish - - (KF624695.1, 98%) Baltic Sea A. aurita Staphylococcus medusa yellow, roundish- 18 aureus Firmicutes Bacilli Bacillales Staphylococcaceae ++ + Baltic Sea smeary (CP011528.1, 99%) husbandry A. aurita medusa Bacillus cereus 19 Firmicutes Bacilli Bacillales Bacillaceae white, smeary - - Baltic Sea (DQ339684.1, 99%) husbandry A. aurita Phaeobacter medusa 20 gallaeciensis Proteobacteria Alphaproteobacteria Rhodobacterales Rhodobacteraceae white, smeary + - Baltic Sea (NR_027609.1, 82%) husbandry A. aurita medusa Cobetia amphilecti white-orange, 21 Proteobacteria Gammaproteobacteria Halomonadaceae Cobetia + - Baltic Sea (NR_113404.1, 99%) smeary husbandry A. aurita Pseudolateromonas medusa 22 sp. MACL07 Bacteroidetes Flavobacteriia Flavobacteriales Flavobacteriaceae orange, round ++ - Baltic Sea (EF198247.1, 99%) husbandry A. aurita medusa Sulfitobacter sp. S7-80 23 Proteobacteria Alphaproteobacteria Rhodobacterales Rhodobacteraceae white, round ++ - Baltic Sea (KU999998.1, 99%) husbandry A. aurita Pseudoalteromonas medusa 24 sp. MACL07 Proteobacteria Gammaproteobacteria Pseudomonadales Pseudomonadaceae light orange, round + - Baltic Sea (EF198247.1, 99%) husbandry A. aurita Pseudoalteromonas medusa 25 issachenkonii Proteobacteria Gammaproteobacteria Pseudomonadales Pseudomonadaceae white, round ++ - Baltic Sea (JQ799065.1, 99%) husbandry A. aurita Enterococcus white, roundish- 73 Firmicutes Bacilli Lactobacillales Enterococcaceae + - polyp casseliflavus smeary 5 Supplement Baltic Sea (KJ571214.1, 99%) husbandry A. aurita polyp Micrococcus sp. 3723 74 Actinobacteria Actinobacteria Actinomycetales Micrococcaceae light yellow, round - - Baltic Sea (KP345967.1, 99%) husbandry A. aurita Arthrobacter polyp 75 davidanieli Actinobacteria Actinobacteria Actinomycetales Micrococcaceae white, round - - Baltic Sea (AF099202.1, 99%) husbandry A. aurita polyp Bacillus mycoides 76 Firmicutes Bacilli Bacillales Bacillaceae white, irregular - - Baltic Sea (CP009692.1, 98%) husbandry A. aurita polyp Vibrio ordalii white-brownish, 77 Proteobacteria Gammaproteobacteria Vibrionales Vibrionaceae ++ - Baltic Sea (KC884626.1, 99%) smeary husbandry A. aurita Sulfitobacter sp. polyp 78 DG885 Proteobacteria Alphaproteobacteria Rhodobacterales Rhodobacteraceae white, smeary ++ - Baltic Sea (AY258079.1, 99%) husbandry A. aurita Olleya marilimosa polyp 79 strain KMM6714 Bacteroidetes Flavobacteriia Flavobacteriales Flavobacteriaceae orange, round +++ + Baltic Sea (KC247324.1, 99%) husbandry A. aurita polyp Vibrio anguillarum white-brown, 80 Proteobacteria Gammaproteobacteria Vibrionales Vibrionaceae +++ - Baltic Sea (JX966409.1, 99%) smeary husbandry A. aurita polyp Vibrio anguillarum 81 Proteobacteria Gammaproteobacteria Vibrionales Vibrionaceae yellow, round +++ ++ Baltic Sea (JX966409.1, 99%) husbandry A. aurita Arthrobacter sp. polyp 82 MB182 Actinobacteria Actinobacteria Actinomycetales Micrococcaceae white, round + - Baltic Sea (JF706644.1, 99%) husbandry A. aurita polyp Gordonia terrae 83 Actinobacteria Actinobacteria Actinomycetales Nocardiaceae light orange, round - - Baltic Sea (KM113032.1, 97%) husbandry A. aurita Arthrobacter sp. polyp 84 MB182 Actinobacteria Actinobacteria Actinomycetales Micrococcaceae white, round (tiny) ++ - Baltic Sea (JF706644.1, 100%) husbandry A. aurita Staphylococcus polyp 85 warneri Firmicutes Bacilli Bacillales Staphylococcaceae white-yellow, round + - Baltic Sea (LC035464.1, 99%) husbandry 6 Supplement A. aurita Alpha proteobacterium polyp 86 C45 Proteobacteria Alphaproteobacteria n.a. n.a. white, smeary - - Baltic Sea (AB302365.1, 96%) husbandry A. aurita Staphylococcus sp. polyp 87 C34 Firmicutes Bacilli Bacillales Staphylococcaceae brownish, round + + Baltic Sea (JX482523.1, 99%) husbandry A. aurita polyp Paracoccus sp. UBF- 88 Proteobacteria Alphaproteobacteria Rhodobacterales Rhodobacteraceae white, smeary - - Baltic Sea P7 (JX239761.1, 99%) husbandry A. aurita Alpha proteobacterium polyp 89 C45 Proteobacteria Alphaproteobacteria n.a. n.a. white, round - - Baltic Sea (AB302365.1, 99%) husbandry A. aurita polyp Pseudomonas putida 90 Proteobacteria Gammaproteobacteria Pseudomonadales Pseudomonadaceae white-yellow, round ++ ++ Baltic Sea (FJ577648.1, 96%) husbandry A. aurita Pseudoalteromonas polyp white-brownish, 91 issachenkonii Proteobacteria Gammaproteobacteria Pseudomonadales Pseudomonadaceae +++ + Baltic Sea smeary (JQ799065.1, 98%) husbandry A. aurita polyp Pseudomonas putida 92 Proteobacteria Gammaproteobacteria Pseudomonadales Pseudomonadaceae white, round ++ - Baltic Sea (GU191929.1, 99%) husbandry A. aurita Pseudomonas sp. polyp white, round with 93 GA87 Proteobacteria Gammaproteobacteria Pseudomonadales Pseudomonadaceae ++ - Baltic Sea dent (AB934380.1, 99%) husbandry A. aurita Pseudomonas polyp 94 monteilii Proteobacteria Gammaproteobacteria Pseudomonadales Pseudomonadaceae orange, roundish ++ - Baltic Sea (KP056325.1, 99%) husbandry A. aurita polyp Streptococcus infantis 95 Firmicutes Bacilli Lactobacillales Streptococcaceae white, round - - North Sea (GU561389.1, 98%) husbandry A. aurita Enterococcus polyp 96 casseliflavus Firmicutes Bacilli Lactobacillales Enterococcaceae white, round + - North Sea (KJ571214.1, 99%) husbandry A. aurita Shewanella sp. W3- polyp 97 18-1 Proteobacteria Betaproteobacteria Alteromonadales Oxalobacteraceae yellowish, smeary + + North Sea (CP000503.1, 99%) husbandry 7 Supplement A. aurita
Load more

Recommended publications
  • The 2014 Golden Gate National Parks Bioblitz - Data Management and the Event Species List Achieving a Quality Dataset from a Large Scale Event
    National Park Service U.S. Department of the Interior Natural Resource Stewardship and Science The 2014 Golden Gate National Parks BioBlitz - Data Management and the Event Species List Achieving a Quality Dataset from a Large Scale Event Natural Resource Report NPS/GOGA/NRR—2016/1147 ON THIS PAGE Photograph of BioBlitz participants conducting data entry into iNaturalist. Photograph courtesy of the National Park Service. ON THE COVER Photograph of BioBlitz participants collecting aquatic species data in the Presidio of San Francisco. Photograph courtesy of National Park Service. The 2014 Golden Gate National Parks BioBlitz - Data Management and the Event Species List Achieving a Quality Dataset from a Large Scale Event Natural Resource Report NPS/GOGA/NRR—2016/1147 Elizabeth Edson1, Michelle O’Herron1, Alison Forrestel2, Daniel George3 1Golden Gate Parks Conservancy Building 201 Fort Mason San Francisco, CA 94129 2National Park Service. Golden Gate National Recreation Area Fort Cronkhite, Bldg. 1061 Sausalito, CA 94965 3National Park Service. San Francisco Bay Area Network Inventory & Monitoring Program Manager Fort Cronkhite, Bldg. 1063 Sausalito, CA 94965 March 2016 U.S. Department of the Interior National Park Service Natural Resource Stewardship and Science Fort Collins, Colorado The National Park Service, Natural Resource Stewardship and Science office in Fort Collins, Colorado, publishes a range of reports that address natural resource topics. These reports are of interest and applicability to a broad audience in the National Park Service and others in natural resource management, including scientists, conservation and environmental constituencies, and the public. The Natural Resource Report Series is used to disseminate comprehensive information and analysis about natural resources and related topics concerning lands managed by the National Park Service.
    [Show full text]
  • The Hydrocarbondegrading Marine Bacterium Cobetia Sp. Strain
    bs_bs_banner The hydrocarbon-degrading marine bacterium Cobetia sp. strain MM1IDA2H-1 produces a biosurfactant that interferes with quorum sensing of fish pathogens by signal hijacking C. Ibacache-Quiroga,1 J. Ojeda,1 G. quorum sensing signals. Using biosensors for Espinoza-Vergara,1 P. Olivero,3 M. Cuellar2 and quorum sensing based on Chromobacterium viol- M. A. Dinamarca1* aceum and Vibrio anguillarum, we showed that when 1Laboratorio de Biotecnología Microbiana and the purified biosurfactant was mixed with N-acyl 2Departamento de Ciencias Químicas y Recursos homoserine lactones produced by A. salmonicida, Naturales, Facultad de Farmacia, Universidad de quorum sensing was inhibited, although bacterial Valparaíso, Gran Bretaña 1093, 2360102, Valparaíso, growth was not affected. In addition, the transcrip- Chile. tional activities of A. salmonicida virulence genes 3Centro de Investigaciones Biomédicas, Facultad de that are controlled by quorum sensing were Medicina, Universidad de Valparaíso, Hontaneda 2653, repressed by both the purified biosurfactant and the 2341369, Valparaíso, Chile. growth in the presence of Cobetia sp. MM1IDA2H-1. We propose that the biosurfactant, or the lipid struc- tures interact with the N-acyl homoserine lactones, Summary inhibiting their function. This could be used as a strat- Biosurfactants are produced by hydrocarbon- egy to interfere with the quorum sensing systems of degrading marine bacteria in response to the pres- bacterial fish pathogens, which represents an attrac- ence of water-insoluble hydrocarbons. This is tive alternative to classical antimicrobial therapies in believed to facilitate the uptake of hydrocarbons fish aquaculture. by bacteria. However, these diffusible amphiphilic surface-active molecules are involved in several Introduction other biological functions such as microbial compe- tition and intra- or inter-species communication.
    [Show full text]
  • Evolution Toward Maximum Transport Capacity of the Ttg2 ABC System In
    bioRxiv preprint doi: https://doi.org/10.1101/834812; this version posted November 8, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Evolution toward maximum transport capacity of the Ttg2 ABC system in 2 Pseudomonas aeruginosa 3 4 Daniel Yero,1,2 Lionel Costenaro,1# Oscar Conchillo-Solé,1 Mireia Díaz-Lobo,3 Adrià 5 Mayo,1 Mario Ferrer-Navarro,1# Marta Vilaseca,3 Isidre Gibert,1,2* Xavier Daura1,4* 6 7 1Institut de Biotecnologia i de Biomedicina (IBB), Universitat Autònoma de Barcelona 8 (UAB), Barcelona, Spain; 9 2Departament de Genètica i de Microbiologia, UAB, Barcelona, Spain; 10 3Institute for Research in Biomedicine (IRB Barcelona), The Barcelona Institute of 11 Science and Technology, Barcelona, Spain; 12 4Catalan Institution for Research and Advanced Studies (ICREA), Barcelona, Spain. 13 14 *Corresponding Authors: Xavier Daura, Tel: (+34)935868940 Email: 15 [email protected]. Isidre Gibert, Tel: (+34)935862050 Email: 16 [email protected]. 17 18 #Present address: Lionel Costenaro, Institut de Biologia Molecular de Barcelona 19 (CSIC), Barcelona, Spain. Mario Ferrer-Navarro, Teknokroma Analítica SA, 20 Barcelona, Spain. 21 1 bioRxiv preprint doi: https://doi.org/10.1101/834812; this version posted November 8, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 22 Abstract 23 In Pseudomonas aeruginosa, Ttg2D is the soluble periplasmic phospholipid-binding 24 component of an ABC transport system thought to be involved in maintaining the 25 asymmetry of the outer membrane.
    [Show full text]
  • Response of Heterotrophic Stream Biofilm Communities to a Gradient of Resources
    The following supplement accompanies the article Response of heterotrophic stream biofilm communities to a gradient of resources D. J. Van Horn1,*, R. L. Sinsabaugh1, C. D. Takacs-Vesbach1, K. R. Mitchell1,2, C. N. Dahm1 1Department of Biology, University of New Mexico, Albuquerque, New Mexico 87131, USA 2Present address: Department of Microbiology & Immunology, University of British Columbia Life Sciences Centre, Vancouver BC V6T 1Z3, Canada *Email: [email protected] Aquatic Microbial Ecology 64:149–161 (2011) Table S1. Representative sequences for each OTU, associated GenBank accession numbers, and taxonomic classifications with bootstrap values (in parentheses), generated in mothur using 14956 reference sequences from the SILVA data base Treatment Accession Sequence name SILVA taxonomy classification number Control JF695047 BF8FCONT18Fa04.b1 Bacteria(100);Proteobacteria(100);Gammaproteobacteria(100);Pseudomonadales(100);Pseudomonadaceae(100);Cellvibrio(100);unclassified; Control JF695049 BF8FCONT18Fa12.b1 Bacteria(100);Proteobacteria(100);Alphaproteobacteria(100);Rhizobiales(100);Methylocystaceae(100);uncultured(100);unclassified; Control JF695054 BF8FCONT18Fc01.b1 Bacteria(100);Planctomycetes(100);Planctomycetacia(100);Planctomycetales(100);Planctomycetaceae(100);Isosphaera(50);unclassified; Control JF695056 BF8FCONT18Fc04.b1 Bacteria(100);Proteobacteria(100);Gammaproteobacteria(100);Xanthomonadales(100);Xanthomonadaceae(100);uncultured(64);unclassified; Control JF695057 BF8FCONT18Fc06.b1 Bacteria(100);Proteobacteria(100);Betaproteobacteria(100);Burkholderiales(100);Comamonadaceae(100);Ideonella(54);unclassified;
    [Show full text]
  • The Oral and Conjunctival Microbiotas in Cats with and Without Feline
    The oral and conjunctival microbiotas in cats with and without feline immunodeficiency virus infection Scott J Weese, Jamieson Nichols, Mohammad Jalali, Annette Litster To cite this version: Scott J Weese, Jamieson Nichols, Mohammad Jalali, Annette Litster. The oral and conjunctival microbiotas in cats with and without feline immunodeficiency virus infection. Veterinary Research, BioMed Central, 2015, 46 (1), pp.21. 10.1186/s13567-014-0140-5. hal-01290670 HAL Id: hal-01290670 https://hal.archives-ouvertes.fr/hal-01290670 Submitted on 18 Mar 2016 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Weese et al. Veterinary Research (2015) 46:21 DOI 10.1186/s13567-014-0140-5 VETERINARY RESEARCH RESEARCH Open Access The oral and conjunctival microbiotas in cats with and without feline immunodeficiency virus infection Scott J Weese1*, Jamieson Nichols2, Mohammad Jalali1 and Annette Litster2 Abstract The oral and conjunctival microbiotas likely play important roles in protection from opportunistic infections, while also being the source of potential pathogens. Yet, there has been limited investigation in cats, and the impact of comorbidities such as feline immunodeficiency virus (FIV) infection has not been reported. Oral and conjunctival swabs were collected from cats with FIV infection and FIV-uninfected controls, and subjected to 16S rRNA gene (V4) PCR and next generation sequencing.
    [Show full text]
  • Effects of Sirna Silencing on the Susceptibility of the Fish
    bioRxiv preprint doi: https://doi.org/10.1101/626812; this version posted May 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 Effects of siRNA silencing on the susceptibility of the 2 fish cell line CHSE-214 to Yersinia ruckeri 3 4 Running page head: siRNA silencing vs Y. ruckeri 5 1# 1 6 Authors: Simon Menanteau-Ledouble , Oskar Schachner , Mark L. 2 1 7 Lawrence , Mansour El-Matbouli 1 8 Clinical Division of Fish Medicine, University of Veterinary Medicine, Vienna, 9 Austria 2 10 College of Veterinary Medicine, Mississippi State University, Mississippi State, 11 Mississippi, USA 12 13 Postal addresses: Clinical Division of Fish Medicine, University of Veterinary 14 Medicine, Veterinärplatz 1, 1210 Vienna, Austria # 15 Corresponding Author: Dr. Simon Menanteau-Ledouble 16 Email Address: [email protected] 17 Tel. No.: +431250775151 18 Fax No.: +431250775192 19 20 Additional email addresses: 21 M. El-Matbouli: [email protected] 22 M. L. Lawrence: [email protected] 23 O. Schachner : [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/626812; this version posted May 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
    [Show full text]
  • Biodegradability of Woody Film Produced by Solvent Volatilisation Of
    www.nature.com/scientificreports OPEN Biodegradability of woody flm produced by solvent volatilisation of Japanese Beech solution Yuri Nishiwaki-Akine1*, Sui Kanazawa2, Norihisa Matsuura3 & Ryoko Yamamoto-Ikemoto3 To address the problem of marine pollution from discarded plastics, we developed a highly biodegradable woody flm, with almost the same components as wood, from the formic acid solution of ball-milled wood. We found that the woody flm was not easily degraded by cultured solution of hand bacteria (phylum Proteobacteria was dominant). However, the flm was easily biodegraded when in cultured solution of soil (Firmicutes, especially class Bacilli, was dominant) for 4 weeks at 37 °C, or when buried in the soil itself, both under aerobic conditions (Acidobacteria and Proteobacteria were dominant) for 40 days at room temperature and under anaerobic conditions (Firmicutes, especially family Ruminococcaceae, was dominant) for 5 weeks at 37 °C. Moreover, when flm was buried in the soil, more carbon dioxide was generated than from soil alone. Therefore, the flm was not only brittle but formed of decomposable organic matter. We showed that the flm does not decompose at the time of use when touched by the hand, but it decomposes easily when buried in the soil after use. We suggest that this biodegradable woody flm can be used as a sustainable raw material in the future. In recent years, plastics dumped as garbage afer use have ofen been released into the sea, leading to frequent ingestion of microplastics by marine organisms. Terefore, the low biodegradability of plastics has become a major social problem. Development of materials with high biodegradability is an important approach to help solve this problem.
    [Show full text]
  • Comparative Proteomic Profiling of Newly Acquired, Virulent And
    www.nature.com/scientificreports OPEN Comparative proteomic profling of newly acquired, virulent and attenuated Neoparamoeba perurans proteins associated with amoebic gill disease Kerrie Ní Dhufaigh1*, Eugene Dillon2, Natasha Botwright3, Anita Talbot1, Ian O’Connor1, Eugene MacCarthy1 & Orla Slattery4 The causative agent of amoebic gill disease, Neoparamoeba perurans is reported to lose virulence during prolonged in vitro maintenance. In this study, the impact of prolonged culture on N. perurans virulence and its proteome was investigated. Two isolates, attenuated and virulent, had their virulence assessed in an experimental trial using Atlantic salmon smolts and their bacterial community composition was evaluated by 16S rRNA Illumina MiSeq sequencing. Soluble proteins were isolated from three isolates: a newly acquired, virulent and attenuated N. perurans culture. Proteins were analysed using two-dimensional electrophoresis coupled with liquid chromatography tandem mass spectrometry (LC–MS/MS). The challenge trial using naïve smolts confrmed a loss in virulence in the attenuated N. perurans culture. A greater diversity of bacterial communities was found in the microbiome of the virulent isolate in contrast to a reduction in microbial community richness in the attenuated microbiome. A collated proteome database of N. perurans, Amoebozoa and four bacterial genera resulted in 24 proteins diferentially expressed between the three cultures. The present LC–MS/ MS results indicate protein synthesis, oxidative stress and immunomodulation are upregulated in a newly acquired N. perurans culture and future studies may exploit these protein identifcations for therapeutic purposes in infected farmed fsh. Neoparamoeba perurans is an ectoparasitic protozoan responsible for the hyperplastic gill infection of marine cultured fnfsh referred to as amoebic gill disease (AGD)1.
    [Show full text]
  • Supplementary Information for Microbial Electrochemical Systems Outperform Fixed-Bed Biofilters for Cleaning-Up Urban Wastewater
    Electronic Supplementary Material (ESI) for Environmental Science: Water Research & Technology. This journal is © The Royal Society of Chemistry 2016 Supplementary information for Microbial Electrochemical Systems outperform fixed-bed biofilters for cleaning-up urban wastewater AUTHORS: Arantxa Aguirre-Sierraa, Tristano Bacchetti De Gregorisb, Antonio Berná, Juan José Salasc, Carlos Aragónc, Abraham Esteve-Núñezab* Fig.1S Total nitrogen (A), ammonia (B) and nitrate (C) influent and effluent average values of the coke and the gravel biofilters. Error bars represent 95% confidence interval. Fig. 2S Influent and effluent COD (A) and BOD5 (B) average values of the hybrid biofilter and the hybrid polarized biofilter. Error bars represent 95% confidence interval. Fig. 3S Redox potential measured in the coke and the gravel biofilters Fig. 4S Rarefaction curves calculated for each sample based on the OTU computations. Fig. 5S Correspondence analysis biplot of classes’ distribution from pyrosequencing analysis. Fig. 6S. Relative abundance of classes of the category ‘other’ at class level. Table 1S Influent pre-treated wastewater and effluents characteristics. Averages ± SD HRT (d) 4.0 3.4 1.7 0.8 0.5 Influent COD (mg L-1) 246 ± 114 330 ± 107 457 ± 92 318 ± 143 393 ± 101 -1 BOD5 (mg L ) 136 ± 86 235 ± 36 268 ± 81 176 ± 127 213 ± 112 TN (mg L-1) 45.0 ± 17.4 60.6 ± 7.5 57.7 ± 3.9 43.7 ± 16.5 54.8 ± 10.1 -1 NH4-N (mg L ) 32.7 ± 18.7 51.6 ± 6.5 49.0 ± 2.3 36.6 ± 15.9 47.0 ± 8.8 -1 NO3-N (mg L ) 2.3 ± 3.6 1.0 ± 1.6 0.8 ± 0.6 1.5 ± 2.0 0.9 ± 0.6 TP (mg
    [Show full text]
  • Table S4. Phylogenetic Distribution of Bacterial and Archaea Genomes in Groups A, B, C, D, and X
    Table S4. Phylogenetic distribution of bacterial and archaea genomes in groups A, B, C, D, and X. Group A a: Total number of genomes in the taxon b: Number of group A genomes in the taxon c: Percentage of group A genomes in the taxon a b c cellular organisms 5007 2974 59.4 |__ Bacteria 4769 2935 61.5 | |__ Proteobacteria 1854 1570 84.7 | | |__ Gammaproteobacteria 711 631 88.7 | | | |__ Enterobacterales 112 97 86.6 | | | | |__ Enterobacteriaceae 41 32 78.0 | | | | | |__ unclassified Enterobacteriaceae 13 7 53.8 | | | | |__ Erwiniaceae 30 28 93.3 | | | | | |__ Erwinia 10 10 100.0 | | | | | |__ Buchnera 8 8 100.0 | | | | | | |__ Buchnera aphidicola 8 8 100.0 | | | | | |__ Pantoea 8 8 100.0 | | | | |__ Yersiniaceae 14 14 100.0 | | | | | |__ Serratia 8 8 100.0 | | | | |__ Morganellaceae 13 10 76.9 | | | | |__ Pectobacteriaceae 8 8 100.0 | | | |__ Alteromonadales 94 94 100.0 | | | | |__ Alteromonadaceae 34 34 100.0 | | | | | |__ Marinobacter 12 12 100.0 | | | | |__ Shewanellaceae 17 17 100.0 | | | | | |__ Shewanella 17 17 100.0 | | | | |__ Pseudoalteromonadaceae 16 16 100.0 | | | | | |__ Pseudoalteromonas 15 15 100.0 | | | | |__ Idiomarinaceae 9 9 100.0 | | | | | |__ Idiomarina 9 9 100.0 | | | | |__ Colwelliaceae 6 6 100.0 | | | |__ Pseudomonadales 81 81 100.0 | | | | |__ Moraxellaceae 41 41 100.0 | | | | | |__ Acinetobacter 25 25 100.0 | | | | | |__ Psychrobacter 8 8 100.0 | | | | | |__ Moraxella 6 6 100.0 | | | | |__ Pseudomonadaceae 40 40 100.0 | | | | | |__ Pseudomonas 38 38 100.0 | | | |__ Oceanospirillales 73 72 98.6 | | | | |__ Oceanospirillaceae
    [Show full text]
  • D 3111 Suppl
    The following supplement accompanies the article Fine-scale transition to lower bacterial diversity and altered community composition precedes shell disease in laboratory-reared juvenile American lobster Sarah G. Feinman, Andrea Unzueta Martínez, Jennifer L. Bowen, Michael F. Tlusty* *Corresponding author: [email protected] Diseases of Aquatic Organisms 124: 41–54 (2017) Figure S1. Principal coordinates analysis of bacterial communities on lobster shell samples taken on different days. Principal coordinates analysis of the weighted UniFrac metric comparing bacterial community composition of diseased lobster shell on different days of sampling. Diseased lobster shell includes samples collected from the site of disease (square), as well as 0.5 cm (circle), 1 cm (triangle), and 1.5 cm (diamond) away from the site of the disease, while colors depict different days of sampling. Note that by day four, two of the lobsters had molted, hence there are fewer red symbols 1 Figure S2. Rank relative abundance curve for the 200+ most abundant OTUs for each shell condition. The number of OTUs, their abundance, and their order varies for each bar graph based on the relative abundance of each OTU in that shell condition. Please note the difference in scale along the y-axis for each bar graph. Bars appear in color if the OTU is a part of the core microbiome of that shell condition or appear in black if the OTU is not a part of the core microbiome of that shell condition. Dotted lines indicate OTUs that are part of the “abundant microbiome,” i.e. those whose cumulative total is ~50%, as well as OTUs that are a part of the “rare microbiome,” i.e.
    [Show full text]
  • The Gut Microbiome of the Sea Urchin, Lytechinus Variegatus, from Its Natural Habitat Demonstrates Selective Attributes of Micro
    FEMS Microbiology Ecology, 92, 2016, fiw146 doi: 10.1093/femsec/fiw146 Advance Access Publication Date: 1 July 2016 Research Article RESEARCH ARTICLE The gut microbiome of the sea urchin, Lytechinus variegatus, from its natural habitat demonstrates selective attributes of microbial taxa and predictive metabolic profiles Joseph A. Hakim1,†, Hyunmin Koo1,†, Ranjit Kumar2, Elliot J. Lefkowitz2,3, Casey D. Morrow4, Mickie L. Powell1, Stephen A. Watts1,∗ and Asim K. Bej1,∗ 1Department of Biology, University of Alabama at Birmingham, 1300 University Blvd, Birmingham, AL 35294, USA, 2Center for Clinical and Translational Sciences, University of Alabama at Birmingham, Birmingham, AL 35294, USA, 3Department of Microbiology, University of Alabama at Birmingham, Birmingham, AL 35294, USA and 4Department of Cell, Developmental and Integrative Biology, University of Alabama at Birmingham, 1918 University Blvd., Birmingham, AL 35294, USA ∗Corresponding authors: Department of Biology, University of Alabama at Birmingham, 1300 University Blvd, CH464, Birmingham, AL 35294-1170, USA. Tel: +1-(205)-934-8308; Fax: +1-(205)-975-6097; E-mail: [email protected]; [email protected] †These authors contributed equally to this work. One sentence summary: This study describes the distribution of microbiota, and their predicted functional attributes, in the gut ecosystem of sea urchin, Lytechinus variegatus, from its natural habitat of Gulf of Mexico. Editor: Julian Marchesi ABSTRACT In this paper, we describe the microbial composition and their predictive metabolic profile in the sea urchin Lytechinus variegatus gut ecosystem along with samples from its habitat by using NextGen amplicon sequencing and downstream bioinformatics analyses. The microbial communities of the gut tissue revealed a near-exclusive abundance of Campylobacteraceae, whereas the pharynx tissue consisted of Tenericutes, followed by Gamma-, Alpha- and Epsilonproteobacteria at approximately equal capacities.
    [Show full text]