Biochemical and Genetic Investigations on Patients with Congenital Disorders of Glycosylation

Biochemical and Genetic Investigations on

Patients with Congenital Disorders of

Glycosylation.

Faiqa Imtiaz

A thesis submitted for the degree of Doctor of Philosophy (Ph.D.) in the Faculty of Life Sciences of the University of London

Biochemistry, Endocrinology and Metabolism Unit

Institute of Child Health

University College London

March 2002 ProQuest Number: U643421

INFORMATION TO ALL USERS The quality of this reproduction is dependent upon the quality of the copy submitted.

In the unlikely event that the author did not send a complete manuscript and there are missing pages, these will be noted. Also, if material had to be removed, a note will indicate the deletion. uest.

ProQuest U643421

Published by ProQuest LLC(2016). Copyright of the Dissertation is held by the Author.

ProQuest LLC 789 East Eisenhower Parkway P.O. Box 1346 Ann Arbor, Ml 48106-1346 ABSTRACT

This study presents an overall review of the Congenital Disorders of Glycosylation (CDG) and describes genetic and enzymological investigations employed to identify and confirm the basic defect in 21 patients that were diagnosed as CDG-I on the basis of their clinical features and abnormal isoelectric focusing (lEF) pattern of serum transferrin. Fifteen patients from thirteen families were found to have CDG-Ia on the basis of markedly reduced phosphomannomutase (PMM) activity in fibroblasts in culture. Mutation analysis of the PMM2 gene demonstrated the presence of 8 missense mutations. All the patients were compound heterozygotes for these mutations. No correlation could be established between genotype and clinical/enzymological phenotypes in the CDG-Ia patients. Human PMM is encoded by two gene^ PMMl (22ql3) and PMM2 (16pl3), which are expressed in a tissue-specific manner. Patients with severe and milder forms of CDG-Ia were analysed for any possible mutations in PMMl. No mutations were detected. Detailed enzyme kinetics experiments were performed to investigate the inhibition of PMM using synthetic analogues.

One patient had reduced phosphomannose isomerase (PMI) activity in fibroblasts and genetic analysis of the MPI gene, encoding PMI showed a homozygous mutation, D131N, which confirmed the patient suffered from CDG-Ib. Another patient who had normal PMM and PMI activities in fibroblasts was found to have missense mutations in the hALG6 gene encoding al,3 glucosyltransferase and was classified as CDG-Ic.

Four patients, classified as CDG-Ix, who had normal PMM and PMI activities but defective protein iV-glycosylation as indicated by abnormal IFF patterns of serum transferrin, were investigated for plausible defects in the enzymes involved in the synthesis of precursor glucosyl donors for lipid-linked oligosaccharides, namely, GDP- mannose pyrophosphorylase, dolichol phosphate mannose synthase, and glutamine: fructose-6-phosphate amidotransferase, in fibroblasts. No significant difference was discernible in specific activities of these enzymes between control and patients’ fibroblasts. These four patients were also tested for a-glucosidase I activity in fibroblasts (a marker for CDG-IIb), but showed no significant difference compared with controls.

11 Preface

Part of the work presented in this thesis has been published

Papers

1. Martin A, Watterson M, Brown A, Imtiaz F, Winchester B. G, Watkin D J and Fleet G.WJ. (1999) 6R- and 6S-6C-Methylmannose and D-mannuronolactone. Inhibition of phosphoglucomutase: agents for the study of the primary metabolism of mannose. Tetrahedron Asymmetry 10: 355-366.

2. Imtiaz F, Worthington V, Champion M, Beesley C, Charlwood J, Clayton P, Keir G, Mian N, Winchester B. (2000) Genotypes and Phenotypes of patients in the UK with carbohydrate-deficient glycoprotein syndrome type I. J Inherit Metab Dis 23:162-174.

3. Schollen E, Borland L, de Koning T.J, Van Diggelen O P, Huijmans J.G.M, Marquardt T, Babovic-Vuksanovic D, Patterson M, Imtiaz F, Winchester B, Adamowicz M, Pronicka E, Freeze H and Matthijs G. (2000) Genomic Organization of the Human Phosphomannose Isomerase (MPI) Gene and Mutation Analysis in Patients with Congenital Disorders of Glycosylation Type Ib (CDG-Ib). Human Mutation 16: 247-252.

4. Matthijs G, Schollen E, Bjursell C, Erlandson A, Freeze H, Imtiaz F, Kjaergaard S, Martinsson T, Schwartz M, Seta N, Vuillaumier-Barrot S, Westphal V and Winchester B. (2000) Mutations in PMM2 That Cause Congenital Disorders of Glycosylation, Type la {CDG-\d).Human Mutation 16: 386-394.

5. Hendriksz CJ, McClean P, Henderson M J, Keir, Worthington V C, Imtiaz F, Schollen E, Matthijs G, Winchester B G. (2001) Successful treatment of carbohydrate deficient glycoprotein syndrome type lb with oral mannose.Arc/z Dis Child S5: 339-340

Abstracts

1. Imtiaz F, Worthington V, Champion M, Beesley C, Charlwood J, Clayton P, Keir G, Mian N, Winchester B. (1999) Genotypes and Phenotypes of patients in the UK with carbohydrate-deficient glycoprotein syndrome type I. J Inherit Metab Dis Supplement, Volume 22: July; Abstract.

Ill Poster Presentations

1. Title: Biochemical and genetic analysis of British CDGS type I patients Presented at: SSIEM 37* Annual Symposium, September 1999, Genoa, Italy Imtiaz F, Worthington V, Champion M, Beesley C, Charlwood J, Clayton P, Keir G, Winchester B.

2. Title: Successful treatment of carbohydrate deficient glycoprotein syndrome type lb with oral mannose Presented at: Society for Glycobiology, November 2000, Boston, USA Imtiaz F, Hendriksz CJ, McClean P, Henderson M J, Keir, Worthington V C, Winchester B.

IV Acknowledgements

I am extremely grateful to my principal supervisor Professor Bryan Winchester for his continued support, guidance and concern. I would like to thank Dr. Nasi Mian for his endless assistance, ideas and suggestions throughout this PhD. I would also like to thank Professor Peter Clayton, Dr. Geoff Keir and especially Dr. Clare Beesley for her role as a supervisor and friend.

I am indebted to The Enzyme Laboratory and would like to give a special thanks to

Elizabeth Young, Viki Worthington and Derek Burke for their assistance. I would also like to thank the clinicians who referred the patients and their families who allowed the further investigation of defects in their children.

I would really like to thank all my friends at the Institute of Child Health, especially

Philippa, Kevin, Tammy, Anna, Wendy, Hugh, Paulett, George and Simon for making the past four years so much fun.

I would like to give special thanks to Professor Pinar Ozand, King Faisal Specialist

Hospital, for taking me under his wing and introducing me to this field of science and to

Dr. Mohammed, Saudi Arabian Cultural Bureau, for looking after me for the past eight years.

Finally, I am eternally grateful to my wonderful parents for their unconditional love and support, my brothers and to my husband Shehzad for his unceasing patience, support and love. Table of Contents

Table of Contents

Abstract ii Preface iii Acknowledgements v Table of Contents vi List of Figures xiii List of Tables xvii List of Abbreviations xix

Chapter 1: Introduction 1 1.1 Preface 1 1.2 Protein Glycosylation 2 1.2.1 Protein 0-linked Glycosylation 3 1.2.1.1 0-P-GalNAc-linked glycosylation 3 1.2.1.2 0-P-GlcNAc-linked glycosylation 4

1.3 A-linked Glycosylation 4 1.3.1 Assembly of the lipid-linked oligosaccharide 5 1.3.1.1 Dolichol and dolichol phosphate 7 1.3.1.2 The synthesis of glycosyl substrates for the 9 assembly of the LLO 1.3.1.3 Biochemistry and enzymology of the synthesis 9 of nucleotide-activated sugars 1.3.1.4 Synthesis of dolichol phosphate mannose and 10 dolichol phosphate glucose 1.3.1.5 Glycosyltransferases involved in LLO assembly 12 1.3.1.5.1 Topography of the synthesis of the LLO 15 1.3.1.6 Self-regulatory aspects of LLO assembly 16 1.3.1.7 Bypass or salvage routes involved in LLO synthesis 17 under non-physiological conditions 1.3.2 The Oligosaccharyltransferase (OST) complex 18 1.3.2.1 Requirements and constraints of the oligosaccharyl- 20 transferase reaction with respect to the polypeptide as a substrate 1.3.2.1.1 Co-translational translocation of polypeptides 20 to the ER lumen 1.3.2.1.2 Influence of the nature of the JV-glycosylation 21 sequon and other polypeptide-structure based constraints on the ^-glycosylation reaction

VI Table of Contents

1.3.2.2 Effects of truncation of LLO on its transfer to the polypeptide 23 by OST and post-transfer processing in the ER 1.3.2.2.1 Influence of structural aspects of the LLO donor on 24 OST reaction efficiency 1.3.3 Processing of protein-bound oligosaccharides in the ER 25 1.3.4 Processing of protein N-linked oligosaccharides in Golgi apparatus 28

1.4 Congenital Disorders of Glycosylation 30

1.5 CDG-I syndromes 30 1.5.1 Protein Æ-glycosylation defect in serum transferrin in CDG-Ia 33 1.5.1.1 Genetic defect in CDG-Ia 34 1.5.2 Biochemical defect in CDG-Ib 34 1.5.2.1 Genetic defect in CDG-Ib 36 1.5.2.2 Mannose therapy as treatment for CDG-Ib 36 1.5.3 Biochemical defect in CDG-Ic 37 1.5.3.1 Genetic defect in CDG-Ic 39 1.5.4 CDG-Id 41 1.5.4.1 Biochemical defect in CDG-Id 41 1.5.4.2 Genetic defect in CDG-Id 42 1.5.5 Biochemical defect in CDG-Ie 42 1.5.5.1 Genetic defect in CDG-Ie 43 1.5.6 CDG-If 43

1.6 CDG-II syndromes 46 1.6.1 CDG-IIa-iV-acetylglucosaminyltransferase II deficiency 47 1.6.2 CDG-IIb-a-Glucosidase I deficiency 48 1.6.3 CDG-IIc-GDP-fucose deficiency 50

1.7 Other disorders of protein glycosylation 52

1.8 Aims of the thesis 53

Chapter 2: Materials and Methods 54

2.1 Cell Culture 54 2.1.1 Tissue Culture Media 54 2.1.1.1 Ham ’ s FIO growth medium 54 2.1.1.2 RPM I1640 growth medium 54 2.1.2 Cell culture conditions 55 2.1.2.1 Fibroblasts 55 2.1.2.2 Lymphoblastoid cells 56 2.1.2.3 Reconstitution of cells stored in liquid nitrogen 57 2.1.2.4 Detection of mycoplasma 57

2.2 Biochemical and enzymological assays 58 2.2.1 Preparation of samples 58 2.2.2 Protein Determination 59 2.2.3 Synthesis of mannose-1, 6-bisphosphate 59

v ii Table of Contents

2.2.4 Phosphomannomutase, phosphomannose isomerase and 60 phosphoglucomutase assays

2.3 Molecular biology 63 2.3.1 RNA Extraction 63 2.3.1.1 Harvesting of adherent cells 63 2.3.1.2 Lysis of cultured cells 64 2.3.1.3 RNA purification by centrifugation 64 2.3.1.4 Determination of RNA yield and purity 66 2.3.2 First-strand cDNA synthesis 66 2.3.3 Preparation and extraction of genomic DNA from fibroblasts 67 and whole blood samples 2.3.4 Measurement of concentration of DNA 68 2.3.5 Amplification of genomic DNA by the Polymerase Chain Reaction (PGR) 69 2.3.5.1 PGR conditions 69 2.3.5.2 Analysis of PGR products by agarose gel electrophoresis 70 2.3.6 Single Strand Conformation Polymorphism (SSGP) Analysis 71 2.3.6.1 Sample preparation 71 2.3.6.2 Preparation of polyacrylamide gels 72 2.3.6.3 Gel electrophoresis 72 2.3.6.4 Silver staining 73

2.4 Sequencing 74 2.4.1 Purification of PGR products 74 2.4.2 Direct automatic sequencing of PGR products 74 2.4.3 Dye primer sequencing using the M13 (-21) and M13 reverse 75 Dye primers 2.4.4 Big-Dye Primer Sequencing Chemistry 77 2.4.5 Dye-Terminator Sequencing Chemistry 77 2.4.5.1 Sequencing reactions using Dye-labeled Terminators 77 2.4.6 Big-Dye Terminator Sequencing Chemistry 78 2.4.6.1 Sequencing reactions using Big-Dye Terminators 78 2.4.7 Preparation of the sequencing gel 79 2.4.8 Sequencing gel electrophoresis 79

Chapter 3: Preliminary enzymatic analyses and segregation 81 of the patients into different subtypes of CDG

3.1 Introduction 81

3.2 Materials and Methods 82 3.2.1 Clinical Details of Patients 82

3.3 Results and Discussion 91

Vlll Table of Contents

Chapter 4: Genotype/phenotype correlation in U.K patients 94 with CDG-Ia

4.1 Introduction 94 4.1.1 Biochemical features 95 4.1.2 Biochemical basis of the CDG-Ia defect 96 4.1.3 Genetic basis of CDG-Ia 97 4.1.4 Structure of the human PMM2 gene 98 4.1.5 Diagnosis of CDG-Ia 99 4.1.6 Aims 100

4.2 Materials and Methods 101 4.2.1 Patient material 101 4.2.2 Amplification of genomic DNA by the Polymerase Chain 101 Reaction (PCR) 4.2.2.1 Design and synthesis of oligonucleotide primers 101 4.2.2.2 PCR conditions 102 4.2.3 Confirmation of sequence changes using restriction enzyme digestion 103 4.2.4 SSCP 104 4.2.5 Sequencing 104

4.3 Results 105 4.3.1 SSCP analysis of the PMM2 gene 105 4.3.2 Identification of sequence changes detected by SSCP 106 4.3.3 Detection of mutations by direct sequencing of amplified exons of 106 thePMM2 gene 4.3.3.1 Detection of R141H mutation 108 4.3.3.2 Detection of F119L mutation 110 4.3.3.3 Detection of D148N mutation 112 4.3.3.4 Detection of I132N mutation 114 4.3.3.5 Detection of F183S mutation 116 4.3.3.6 Detection of G208A mutation 118 4.3.3.7 Detection of V231M mutation 120 4.3.3.8 Detection of T237M mutation 122 4.3.3.9 Detection of 284delT mutation 124 4.3.4 Polymorphisms in intron 5 125

4.4 Discussion 126 4.4.1 Type, distribution and frequency of mutations 127 4.4.2 Effect of mutations on PMM enzyme 130 4.4.3 Genotype/phenotype correlation 133

Chapter 5: Molecular genetic and biochemical analysis of 134 CDG-Ib and CDG-Ic subtypes

5.1 Introduction 134

5.2 Aims 134

IX Table of Contents

5.3 CDG-Ib 135 5.3.1 Patient information and material 135 5.3.2 Analysis of cDNA 135 5.3.2.1 Preparation of cDNA 135 5.3.2.2 Amplification of cDNA for the MPI gene by PCR 137 5.3.2.3 Conditions of PCR 137 5.3.3 Amplification of genomic DNA for the MPI gene by PCR 138 5.3.3.1 Conditions of PCR 139 5.3.3.1.1 Results of sequencing exon 4 of MPI gene 139 5.3.3.2 Confirmatory test for the D131N mutation 141 5.3.4 Oral mannose therapy for the CDG-Ib patient 144

5.4 CDG-Ic 145 5.4.1 Patient information and material 145 5.4.2 Enzymic assays 145 5.4.3 Amplification of genomic DNA for the hALG6 gene by PCR 145 5.4.3.1 Conditions of PCR 146 5.4.4 Enzymic analysis of BB (CDG-Ic) 146 5.4.5 Mutation analysis of BB 147

5.5 Discussion 149 5.5.1 CDG-Ib patient, AH 149 5.5.2 CDG-Ic patient, BB 152

Chapter 6: Molecular genetic and enzymological 155 investigations on uncharacterised CDG-I patients (CDG-Ix)

6.1 Introduction 155 6.1.1 Other potential enzymic defects leading to CDG-I 155 6.1.2 GDP-mannose pyrophosphorylase 155 6.1.3 Dol-P-Man synthase (CDG-Ie) 159 6.1.4 Glutamine: fructose-6-phosphate amidotransferase (GFA) 159 6.1.5 a-glucosidase I deficiency (CDG-IIb) 163 6.1.6 Aims 164

6.2 Materials and Methods 165 6.2.1 Patient information and material 165 6.2.2 GDP-mannose pyrophosphorylase assay 165 6.2.3 Dolichol phosphate mannose synthase assay 168 6.2.4 Glutamine: fructose-6-phosphate amidotransferase assay 170 6.2.5 a-glucosidase I assay 172 6.2.6 Molecular biology 175 6.2.6.1 Dol-P-Man synthase gene (DPMI) 175 6.2.6.1.1 Amplification of genomic DNA for the DPMI gene 175 by PCR 6.2.6.1.2 Design and synthesis of oligonucleotide primers 175 6.2.6.1.3 Conditions of PCR 176 Table o f Contents

6.2.62 Amplification of exon 11 of the hALG6 gene by PCR for the 176 detection of the common mutation A333V 6.3 Results 177 6.3.1 GDPMP activity in fibroblasts from normal controls and CDG-I patients 177 6.3.2 Dol-P-Man synthase activities 180 6.3.2.1 Dol-P-Man synthase activity in fibroblasts from normal controls 181 and CDG-I patients 6.3.3 GFA activity in fibroblasts from normal controls and CDG-I patients 182 6.3.4 Mutation analysis of the hALG6 gene 184 6.3.5 a-glucosidase I activities 185 6.3.5.1 Inhibition of a-glucosidase I 185 6.3.3.2 a-glucosidase I activity in fibroblasts from normal controls 186 and CDG-I patients

6.4 Discussion 190 6.4.1 Case study of CDG-Ix patient NH 192 6.4.2 Case study of CDG-Ix patient KS 196 6.4.3 Case study of CDG-Ix patients RM and AU 200 6.4.4 Increased levels of glutamine: fructose 6-P amidotransferase (GFA) 200 levels in CDG-Ic patient (BB) 6.4.5 Concluding remarks 201

Chapter 7: Molecular analysis of PMMl 203

7.1 Introduction 203

7.2 Comparative analyses of the PMMl and PMM2 genes 204 7.2.1 Mouse orthologs of PMMl and PMM2 207 7.2.2 Enzymatic properties and tissular distribution of PMMl and PMM2 208

7.3 Aims 209

7.4 Materials and Methods 211 7.4.1 Amplification of genomic DNA for the PMMl gene by PCR 211 7.4.2 SSCP 212

7.5 Results 213 7.5.1 SSCP analysis of the PMMl gene 213 7.5.1.1 SSCP analysis of exon 1 of the PMMl gene 213 7.5.1.2 SSCP of exons 2-7 of the PMMl gene 214 7.5.1.3 SSCP of exon 8 of the PMMl gene 215

7.6 Discussion 216

XI Table of Contents

Chapter 8: Inhibitor studies on phosphomannomutase activity 217

8.1 Introduction 217

8.2 Enzyme assays and inhibition experiments 219 8.2.1 PMM, PMI and PGM enzyme assays 219 8.2.2 Phosphoglucose isomerase (PGI) assay 219 8.2.3 GIucose-6-phosphate dehydrogenase (G6PDH) assay 219

8.3 Results 220 8.3.1 Kinetics of PMM and PGM 220 8.3.2 Effects of 6R-6C and 65-6C-methylmannose 221 8.3.2.1 Preliminary experiments and effects on coupling enzymes 221

8.4 Discussion 226

Chapter 9: General Discussion 227

9.1 The lack of genotype/phenotype correlation in CDG-Ia 227 9.1.1 Diversity in the clinical phenotypes of CDG-Ia, Ib and Ic 230 9.1.2 CDG-Ix 232 9.1.3 Analysis of thePMMl gene 232

9.2 Predominance of missense mutations 232

9.3 Possible avenues of therapy in CDG 237

9.4 Identification of CDG defects 238

9.5 Concluding Remarks and Future Work 239

Appendix 241 References 243

XU ______List ofFisures ______

List of Figures

Chapter 1 Page Figure 1.1 The biosynthesis of the lipid-linked oligosaccharide 6 Figure 1.2 The synthesis of Dol-P from mevalonate 8 Figure 1.3 Schematic representation of stepwise synthesis (I to XIV) 13 of the LLO Figure 1.4 Co-operative stimulatory and inhibitory influences of initial reaction products in the biosynthesis of GlcNAc-PP-Dol 16 Figure 1.5 Schematic representation of the subunits of mammalian OST 20 Figure 1.6 Typical signal sequence of polypeptides 20 Figure 1.7 Biosynthetic pathway of a di-antennary V-glycan of a 26 glycoprotein Figure 1.8 Mannose processing in the ER and the production of 27 MangGlcNAc 2 isomers Figure 1.9 Schematic diagram showing the action of the Man9 28 mannosidase Figure 1.10 Schematic representation of the different types of 28 V-oligosaccharides Figure 1.11 Schematic presentation of CDG-I defects in LLO synthesis 32 Figure 1.12 Isoelectric focusing patterns of transferrin for CDG disorder 33 Figure 1.13 Normal oligosaccharide core glucosylation in the ER and 38 transfer of the oligosaccharide core to the N-glycosylation site of glycoproteins Figure 1.14 The processing defects in protein N-linked glycans in CDG-II 46 syndromes

Chapter 2 Figure 2.1 Schematic diagram of measurement of PMM, PMI and PGM 61 activities in fibroblasts

Chapter 4 Figure 4.1 Biochemical basis of CDG-Ia 96 Figure 4.2 SSCP analysis of exon 8 of the PMM2 gene 105 Figure 4.3 Sequencing of exon 5 of the PMM2 gene from a normal control 108 and patient TB Figure 4.4 Restriction enzyme digestion of ACRS products with B 5 /HKAI 109 to detect the R141H mutation Figure 4.5 Sequencing of exon 5 of the PMM2 gene from a normal control 110 and patient KF Figure 4.6 Restriction enzyme digestion of exon 5 PCR products with Tru9\ 111 to detect F119L mutation

Xlll List ofFisures

Figure 4.7 Sequencing of exon 5 of the PMM2 gene from a normal control 112 and patient LB Figure 4.8 Restriction enzyme digestion of exon 5 PCR products with Taq I 113 to detect D148N mutation Figure 4.9 Sequencing of exon 5 in the reverse direction of the PMM2 gene 114 from a normal control and patient JR Figure 4.10 Restriction enzyme digestion of ACRS products with Nla III 115 to detect the I132N mutation Figure 4.11 Sequencing of exon 7 of the PM M 2 gene from a normal control 116 and patient LB Figure 4.12 Restriction enzyme digestion of exon 7 PCR products with 117 BsmA I to detect F183S mutation Figure 4.13 Sequencing of exon 7 of the PMM2 gene from a normal control 118 and patient JB Figure 4.14 Restriction enzyme digestion of ACRS products with Pst I 119 to detect the G208A mutation Figure 4.15 Sequencing of exon 8 of the PMM2 gene from a normal control 120 and patient TB Figure 4.16 Restriction enzyme digestion of exon 8 PCR products with 121 TspAS I to detect V231M mutation Figure 4.17 Sequencing of exon 8 of the PMM2 gene from a normal control 122 and patient EW Figure 4.18 Restriction enzyme digestion of exon 8 PCR products with 123 Bst\J I to detect T237M mutation Figure 4.19 Sequencing of exon 4 of the PMM2 gene from a normal control 124 and patient MC Figure 4.20 Thermal stability of wild-type and mutants forms of PMM2 131

Chapter 5 Figure 5.1 cDNA of a normal control and AH amplified by HPRT specific 136 primers Figure 5.2 Amplification of MPI gene using normal control and AH cDNA 138 and varying concentrations of MgCL Figure 5.3 Sequencing of exon 4 of the MP7 gene from a normal control 140 and patient AH Figure 5.4 Sequencing of exon 4 of the MPI gene in the reverse direction 140 from a normal control and patient AH Figure 5.5 Sequencing of exon 4 of the MPI gene from a normal control and 141 AH family members Figure 5.6 Restriction enzyme digestion of MPI exon 4 PCR products to 143 detect D131N mutation Figure 5.7 Analysis of transferrin glycoforms of AH before and after 144 treatment with oral mannose Figure 5.8 Sequencing of exon 11 of the ALG6 gene from a normal control 147 and patient BB Figure 5.9 Restriction enzyme digestion of ALG6 exon 11 PCR products to 148 detect A333V mutation

XIV List ofFisures

Figure 5.10 Simplified diagram illustrating both the defect in CDG-Ib and 152 the method by which mannose is able to bypass this block in the metabolic pathway in the synthesis of N-linked glycoproteins

Chapter 6 Figure 6.1 Enzymic defects in the maimose pathway leading to CDG-I 156 Figure 6.2 Comparison of the 37 kDa-P-subunit sequences in pig liver 157 and yeast GDPMP Figure 6.3 GFA in the hexosamine metabolic pathway 161 Figure 6.4 TMR-labelled trisaccharide used in assaying a-glucosidase I 173 activity Figure 6.5 GDPMP activity in fibroblasts from CDG-Ix patients and normal 179 controls Figure 6.6 GDPMP activity in fibroblasts from CDG-Ia, Ib and Ic patients 179 and normal controls Figure 6.7 Inhibition of canine pancreatic Dol-P-Man synthase by 180 amphomycin Figure 6.8 Dol-P-Man synthase activity of CDG-I patients and the normal 182 control fibroblasts Figure 6.9 GFA activity in fibroblasts from CDG-I patients and normal 184 controls Figure 6.10 TLC analysis of separation of TMR-labelled standards 185 Figure 6.11 TLC analysis of the hydrolysis of TMR-labelled trisaccharide 186 by a-glucosidase I in the presence and absence of castanospermine Figure 6.12 TLC analysis of the fluorescently labelled trisaccharide by 187 extracts of fibroblasts from CDG-I patients Figure 6.13 TLC analysis of the fluorescently labelled trisaccharide by 188 extracts of fibroblasts from CDG-I patients Figure 6.14 The role of Lec35, ALG6, ALG8, ALGIO in the conversion of 193 MansGlcNAc 2 -PP-Dol intermediates to Glc 3 Man 9GlcNAc2 -PP-Dol Figure 6.15 Glucose utilisation in the protein ^-glycosylation pathway 195 Figure 6.16 Glucosylation of MansGlcNAc 2 -PP-Dol oligosaccharide 197 as a result of a defect in the ALG5 gene Chapter 7 Figure 7.1 Comparison of the genomic structure of the PMM2, PMMl and 205 PMM2cp genes Figure 7.2 Alignment of PMMl and PMM2 cDNA sequence 206 Figure 7.3 SSCP analysis of exon 1 of the PMMl gene 213 Figure 7.4 SSCP analysis of exons 2-7 of the PMMl gene for CDG-Ia 214 patients Figure 7.5 SSCP analysis of exons 2-7 of the PMMl gene for CDG-Ix 214 patients Figure 7.6 SSCP analysis of exon 8 of the PMMl gene for CDG-Ia and 215 Ix patients

XV ______List ofFisures ______

Chapter 8 Figure 8.1 Simplified diagram of pathway for synthesis of glycoproteins 217 Figure 8.2 Structures of analogues used for inhibitor studies 218 Figure 8.3 Lineweaver-Burk plot in determining the Km value for PMM 220 Figure 8.4 Lineweaver-Burk plot in determining the Km value for PGM 220 Figure 8.5 Effects of 6R- and 65-6C-methylmaimose on PMI activity 221 Figure 8.6 Effects of 6R- and 65-6C-methylmannose on PGI activity 222 Figure 8.7 Effects of 6R- and 6»S-6C-methylmarmose on G6PDH activity 222 Figure 8.8 Inhibition of PMM by 6S- and 6/?-6C-methylmannose 223 Figure 8.9 Inhibition of PMM by 6R-6C-methyImannose 223 Figure 8.10 Inhibition of PMM by 6S- 6C-methylmannose 224 Figure 8.11 Inhibition of PGM by 6/?-6C-methyImannose 224 Figure 8.12 Inhibition of PGM by 6R-6C-methylmannose (linear form) 225

Chapter 9

Figure 9.1 Relation between the clinical presentation and the extent of 231 underglycosylation in CDG-I patients Figure 9.2 The influence of cellular and other factors on the residual 235 protein function of mutant/variant proteins

XVI List of Tables

List of Tables

Chapter 1 Page Table 1.1 Glycosyltransferases involved in yeast protein#-glycosylation 14 Table 1.2 Comparison of OST complex from different organisms 19 Table 1.3 CDG-I: biochemical and molecular defects, number of patients 31 and year identified Table 1.4 CDG-II: biochemical and molecular defects, number of patients 46 and year identified

Chapter 2 Table 2.1 Experimental conditions for the assays of PMM, PMI and PGM 62

Chapter 3 Table 3.1 PMM, PMI and PGM activities of CDG-I patients 93

Chapter 4 Table 4.1 Sequence of oligonucleotide primers used to amplify the 8 exons 102 of the PMM2 gene Table 4.2 PCR conditions used for amplification of the PMM2 gene 102 Table 4.3 Restriction enzyme digestion for the confirmatory test for each 103 mutation, which alters a restriction site Table 4.4 Primers and PCR conditions for ACRS reactions 103 Table 4.5 Sequencing chemistries used in the screening of each exon of the 104 PMM2 gene Table 4.6 Genotypes of 15 UK CDG-Ia patients 107 Table 4.7 Summary of missense mutations found in PMM2 gene 127 Table 4.8 Genotypes of CDG-Ia patients 128

Chapter 5 Table 5.1 Primers and PCR conditions for ACRS reaction for detection of 142 D131N mutation Table 5.2 Principle of ACRS PCR on creation of Taql restriction site 142

Chapter 6 Table 6.1 Sequence of oligonucleotide primers used to amplify exons 3, 4 175 and 8 of the DPMI gene Table 6.2 GDPMP activity in fibroblasts 178 Table 6.3 Dol-P-Man synthase activities of canine pancreatic microsomes 180 with varying concentrations of amphomycin Table 6.4 Dol-P-Man synthase activity in fibroblasts 181 Table 6.5 GFA activity in fibroblasts 183 Table 6.6 Calculation of specific activities of a-glucosidase I in the CDG-I 188 patient fibroblasts and normal control fibroblasts

xvii ______List of Tables______

Table 6.7 Calculation of specific activities of a-glucosidase I in the CDG-I 189 patient fibroblasts and normal control fibroblasts Table 6.8 Specific activities of a-glucosidase I in the known and unknown 189 CDG-I patient fibroblasts

Chapter 7 Table 7.1 Sequence of the oligonucleotide primers used to amplify the 212 8 exons of the PMMl gene Table 7.2 PCR conditions used in the amplification of the PMMl gene 212

Appendix Table A.l Clinical, enzymatic and genetic details of CDG-Ia patients 241-2

XVlll List of Abbreviations

List of Abbreviations

ACRS Amplification created restriction site ADP Adenosine diphosphate Alg Asparagine-linked glycosylation Asn Asparagine Asp Aspartic acid ATP Adenosine triphosphate EGA Eicinchoninic acid ESA Eovine serum albumin CDG Congenital disorders of glycosylation CDGS Carbohydrate-deficient glycoprotein syndrome CHO Chinese hamster ovary CPM Canine pancreatic microsomes CNS Central nervous system CNX Calnexin CRT Calreticulin CSF Cerebral spinal fluid Da Daltons DADl Defender against apoptotic death DDD Disialotransferrin developmental delay syndrome DMSO Dimethylsulphoxide Dol-P Dolichol phosphate Dol-P-Glc Dolichol-phosphate-glucose Dol-P-Man Dolichol-phosphate-mannose DTT Dithiothreitol EDTA Ethylene diamine tetra acetic acid ER Endoplasmic reticulum ERMl Endoplasmic reticulum mannosidase 1 F-6-P Fructose-6-phosphate Gal Galactose GalNAc JV-acetylgalactosamine GDP Guanosine diphosphate GDPMP GDP-mannose pyrophosphorylase GFA Glutamine: fructose-6-phosphate amidotransferase Glc Glucose Glc-l-P Glucose-1 -phosphate GlcNAc AT-acetylglucosamine G6PDH Glucose-6-phosphate dehydrogenase GlsI a-glucosidase I Gls II a-glucosidase II Gin Glutamine GnT II jV-acetylglucosaminyltransferase GPI Glycosylphosphatidylinositol GRP Glucose-regulated protein GPT #-acetylglucosaminyl phosphate transferase Hepes 4-(2-hydroxyethyl)-l-piperazine propane sulphonic acid H Inhibitor concentration I50 Concentration of inhibitor required to produce 50% inhibition

XIX List of Abbreviations lEF Isoelectric focusing Ki Dissociation constant in the presence of inhibitor Km Michaelis constant LLO Lipid-linked oligosaccharide Lys Lysine Man Mannose Man-l-P Mannose-1 -phospahte Man-6-P Mannose-6-phosphate Man-1,6-P Mannose-1,6-bisphosphate MPI Phosphomannose isomerase gene on chromosome 15 mRNA Messenger ribonucleic acid MRI Magnetic resonance imaging NAD Nicotinamide adenine dinucleotide NADH Nicotinamide adenine dinucleotide (reduced form) NADP Nicotinamide adenine dinucleotide phosphate (oxidised form) NADPH Nicotinamide adenine dinucleotide phosphate (reduced form) NeuAc Sialic Acid OPCA Olivopontocerebellar atrophy ORF Open reading frame OST Oligosaccharyltransferase PBS Phosphate buffered saline PGI Phosphoglucose isomerase PGM Phosphoglucomutase pi Isoelectric point PLE Protein-losing enteropathy PMI Phosphomannose isomerase PMM Phosphomannomutase PMMl Phosphomannomutase gene on chromosome 22 PMM2 Phosphomannomutase gene on chromosome 16 Pro Proline R Arginine RI Ribophorin I RII Ribophorin II Ser Serine SDS Sodium dodecyl sulphate polyacrylamide gel electrophoresis SSCP Single-strand conformation polymorphism TBS Tris buffered saline TEMED N,N,N ’ ,N ’ -T etramethy lethylenediamine Thr Threonine TMR Tetra-methyl rhodamine Tris 2-Amiiio-2-hydroxymethyl propane-1,3-diol Trp Tryptophan Tyr Tyrosine UDP Uridine diphosphate UV Ultra-violet V Initial rate of reaction Val Valine Xaa Amino Acid

XX Chapter 1______Introduction

Chapter 1

1.1 Preface

A defect in the iV-glycosylation of human serum and cerebro-spinal fluid transferrin, first reported by Jaeken et al in 1980 led to the discovery of a number of human diseases collectively designated as the ‘Carbohydrate-deficient glycoprotein syndromes’

(CDGS). Since 1980, different variants of CDGS have been identified on the basis of extensive investigations of the biochemical and genetic aspects of the protein N- glycosylation pathway. At the First International Workshop on CDGS in 1999, a new classification and nomenclature of these syndromes was therefore adopted. As the acronym CDG had been in frequent use, it was re-defined as Congenital Disorders of

Glycosylation (CDG). CDG type I (CDG-I) now refers to all variants with a partial or complete lack of occupancy of Æ-glycosylation sites in the index glycoprotein (serum transferrin). It was recommended that within the CDG-I group, different variants should be designated alphabetically in the chronological order of their discovery. The other group of CDG syndromes, which comprises defects in the processing ofiV-linked oligosaccharides, should be termed CDG type II (CDG-II) and new variants be designated similarly by the alphabetical addition of letters in the chronological order of their discovery.

This chapter describes i) different protein glycosylation pathways in brief, ii) protein#- glycosylation in detail and iii) the current information on defects in the JV-glycosylation of proteins and clinical manifestations in the CDG syndromes. This is followed by the aims and plans of the investigations presented in this thesis. Chapter 1______Introduction

1.2 Protein Glycosylation

Protein glycosylation is a highly conserved phenomenon in the evolution of prokaryotes and eukaryotes. It involves the covalent attachment of glycosidic residues to specific amino acids in the polypeptide chain. Although this modification of proteins is carried out during or after translation of the polypeptide, the actual site of glycosylation and polypeptide domain in the vicinity of the site as well as the cellular locale where glycosylation reaction(s) take place, play an important role in the process. Protein glycosylation can be divided into two main categories: O- and N- linked glycosylation.

0-linked glycosylation, in an evolutionary sense, is the older of the two and is prevalent among pro- and eukaryotes. #-linked glycosylation, on the other hand, is unique to eukaryotes and appears to have played a significant role in the evolution and diversity of multicellular organisms. Compared to O-linked glycosylation in prokaryotes, A^-linked glycosylation in eukaryotes appears to have evolved with the intracellular compartmentalisation of physiological reactions within the cell. A third type of protein glycosylation is C-glycosylation (for reviews see Komfeld and Komfeld, 1985;

Ferguson and Williams, 1988; Schachter, 1994). Glycosylation of lipids to produce glycolipids and glycophospholipids is also very important. The covalent attachment of carbohydrates to polypeptides also occurs via glycosylphosphatidylinositol (GPI)- anchored proteins. The function of a GPI anchor is to locate the protein at the plasma membrane (Ferguson and Williams, 1988). Like AT-linked glycans, GPI-anchored glycans are synthesised as precursors in the ER. The first step involves the addition of

A-acetylglucosamine (GlcNAc) to phosphatidylinositol, which is followed by deacetylation of GlcNAc to produce glucosamine phosphatidylinositol. Three mannose residues are subsequently added via dolichol-phosphate mannose. Finally, Chapter 1______Introduction phosphoethanolamine is added to complete the core structure (For reviews see Ferguson and Williams, 1988; Doering et al., 1990; Moss et al., 1999).

1.2.1 Protein 0-linked Glycosylation

1.2.1.1 O-P-GalNAc-linked glycosylation

The covalent linkage of an iV-acetylgalactosamine (GalNAc) moiety from (UDP-

GalNAc) as a donor to the hydroxyl group of serine (Ser) or threonine (Thr) constitutes and/or initiates the O-linked glycosylation process. A consensus sequence for O-linked glycosylation has not been identified, although a negative influence of adjacently charged residues and an enhanced frequency due to adjacent proline, serine and threonine residues have been reported (Hill et al., 1977; O’Connell et al, 1991, 1992;

Wilson et al, 1991; Wang et al, 1992, 1993; Elhammeret al, 1993; Nehrke et al,

1996). Whilst there is no evidence of #-linked glycosylation in prokaryotes, many glycoproteins may undergo both O- and W-linked glycosylation in eukaryotes. The O- linked glycosylation reactions take place in the Golgi apparatus. Elongation of the oligosaccharide structure on an O-linked GalNAc is carried out by the stepwise addition of glycosyl moieties from their activated sugar precursors by different membrane-bound glycosyltransferases located in different compartments of the Golgi network. The nucleoside diphosphate glycosides are transported to the Golgi network from the cytoplasm by specific activated sugar transporters (Jentoft, 1990). The oligosaccharide chain may contain 2 to 12 or more glycosidic residues comprising mannose, N- acetylgalactosamine, galactose, sialic acid and fucose. 0-glycans are linear or biantennary in structure (Jentoft, 1990). Chapter 1______Introduction

0-glycans are most commonly found in cell surface glycoproteins and mucin-type molecules. 0-glycans are also found in certain serum glycoproteins (e.g. erythropoietin), nuclear proteins (Jentoft, 1990) and the mammalian egg coat proteins

(zona pellucida) (Forstner, 1995).

1.2.1.2 0-p-GlcNAc-linked glycosylation

The other major type of O-linked glycosylation is the 0-P-GlcNAc (0-GlcNAc) linkage to polypeptides commonly found in all eukaryotes. This was first described by Gerald

Hart and his group (1984). It is a simple glycosylation modification comprising the addition of a single GlcNAc, O-linked to serine or threonine residues of nucleocytopiasmic proteins (Torres and Hart, 1984; Holt and Hart, 1986), such as RNA polymerase II and its transcription factors (Comer and Hart 2000), cytoskeletal proteins, nuclear pore proteins, oncogene products and tumour supressors (Haltiwanger et al,

1997; Hart, 1997). It is postulated that this 0-glycosylation, plays an important role in signalling (Wells et al, 2001), protein synthesis (Datta et al, 1989; Chakraborty et al,

1994) and transcription (Kelly et al, 1993; Roos et al, 1997).

1.3 A^-linked Glycosylation

Protein ^-glycosylation is a highly conserved, co-translational covalent modification of proteins throughout eukaryotes. It is carried out by a multi-subunit, endoplasmic

reticulum (ER)-membrane-bound enzyme complex, oligosaccharyltransferase (OST) in

the lumen of the ER. The OST transfers a mature oligosaccharide (Glc 3 Man 9GlcNAc2)

en bloc from its lipid carrier (Glc 3 Man 9GlcNAc2 -PP-Dol) (LLO) onto Asn residues in

A^-glycosylation sites (Asn-X-Ser/Thr) as the polypeptide translocates into the ER Chapter 1______Introduction lumen (Silberstein and Gilmore, 1996). The efficiency of the OST reaction is determined to a large extent by the nature of the AT-glycosylation site sequence and maturity of the LLO.

1.3.1 Assembly of the lipid-linked oligosaccharide

#-glycan synthesis in mammalian cells involves the assembly of a 14-saccharide "core" unit as a membrane -bound dolichol pyrophosphate precursor by enzymes located on both sides of the ER membrane (For reviews see, Komfeld and Komfeld, 1985; Burda and Aebi, 1999; Helenius and Aebi, 2001).

A schematic diagram of the stepwise assembly of the lipid-linked oligosaccharide precursor (LLO) in the synthesis of N-linked glycans is shown in Figure 1.1. Chapter 1 Introduction

Glucose ------► Glucose 6-P

\ cytoplasm ER lumen Fructose 6-P K 'VVi-n

ADP UDF F_ WX-n Mannose ► Mannose 6-P N

UDF FF—

\ Mannose 1-P F E - 'W V o

y FF_ T/VX-n GDF X 4

FF_'VVT- o

rv\f\r PP GDF X 4 F _rv\A -n : P _ 1/VT-n

rj\/\r -F-

rv\j\r FF UDF P _rVVXn

P « 'W X n

'V\AA_ FF

Figure 1.1 The biosynthesis of the lipid-linked oligosaccharide. dolichol, ■, N-acetylglucosamine; # , mannose; ♦ , glucose (adapted from Marquardt and Freeze, 2001) Chapter 1______Introduction

1.3.1.1 Dolichol and dolichol phosphate

Dolichol is a form of polyisoprenoid lipid where the isoprene unit of the polymer adjacent to the hydroxyl group is saturated (Krag, 1998). The early steps in dolichol synthesis are identical to those of sterols and ubiquinone (Hemming et al, 1983;

Chojnacki and Dallner, 1988). The chain length is perhaps determined by the action of ci5-isoprenyltransferase, which transfers isoprenyl units of isoprenyl pyrophosphate to t- famesyl pyrophosphate. The length of dolichol molecules is species-dependent but the mechanism determining the length is not known (Burda and Aebi, 1999). Dolichol is converted to dolichol phosphate (Dol-P) by a CTP-dependent kinase. In yeast, dolichol kinase is encoded by the SEC59 locus (Ferro-Novick et al, 1984; Bernstein et al, 1989;

Heller et al, 1992) and inactivation of the enzyme results in a block in the secretory pathway and rapid depletion of Dol-P, which leads to an immediate arrest of protein iV- glycosylation (Bernstein et al, 1989; Schenk et al, 2001a).

Organisms contain either polyprenyl or dolichyl derivatives. For instance, mammalian sources such a bovine, pig and human liver (Baynes et al, 1973) and Chinese hamster ovary (CHO) cells (Stoll et al, 1988; Rosenwald and Krag, 1990), Drosophila (Sagami and Lennarz, 1987), Trypanosoma (Low et al, 1991), S. cerevisiae (Adair and

Cafmeyer, 1987) and S. pombe (Quellhorst et al, 1997) all appear to contain dolichyl phosphate, while eubacteria contain polyprenyl phosphate (Higashi et al, 1967).

However, some glycosylation mutants of mammalian cells such as CHO Lec9 and B211 cells synthesise and utilise polyprenyl derivatives rather than dolichyl derivatives (Stoll et al., 1988; Rosenwald and Krag, 1990; Quellhorst et al, 1997; Kaiden et al, 1998). A schematic diagram of the synthesis of Dol-P from mevalonate is given in Figure 1.2. Chapter 1______Introduction

I mevalonatel

Y dimethylallyl ---- -— > isopentenyl diphosphate <------diphosphate

geranyl diphosphate

famesyl diphosphate T dehydrodolichyl diphosphate

dehydrodolichol I dolichol

P-dolichol

Figure 1.2 The synthesis of Dol-P from mevalonate (adapted from Ohkura et al,

1997).

Dol-P is the substrate for a number of enzymes in the glycosylation pathway and its availability is one of the rate-limiting factors in the synthesis of LLO in higher eukaryotic cells (Hubbard et al, 1980; Crick et al, 1991; Crick and Waechter, 1994;

Carlberg et al, 1996). Dol-P is produced by de novo synthesis, but is also regenerated from dolichol-phosphate-mannose (Dol-P-Man) and dolichol-phosphate-glucose (Dol-

P-Glc) in glycosyltransferase reactions. It can also be generated from Dol-PP, the lipid by-product of the OST reaction. This implies that all eight molecules of Dol-P utilised in the synthesis of a single Glc3 MangGlcNAc 2 -PP-Dol can be re-cycled into dolichol in the ER lumen. Chapter 1______Introduction

1.3.1.2 The synthesis of glycosyl substrates for the assembly of the LLO

For the synthesis of ER membrane-bound LLO, three nucleotide-activated sugars are required: UDP-GlcNAc, GDP-Man and UDP-Glc. During the initial assembly steps, which occur on the cytoplasmic face of the ER membrane, two UDP-GlcNAc and five

GDP-Man molecules are directly utilised. However, for the latter steps, which occur on the lumenal face of the ER membrane, four Dol-P-Man and three Dol-P-Glc molecules are required, which are themselves derived from GDP-Man and UDP-Glc, respectively.

The supply of these nucleotide-activated as well as dolichol phosphate- activated sugars plays a crucial role in the LLO synthesis. Therefore, mutations in genes involved in the biosynthesis of sugar donors have been shown to affect the viability in organisms such as yeast (Colussi et al, 1997).

1.3.1.3 Biochemistry and enzymology of the synthesis of nucleotide- activated sugars

All nucleoside diphosphate monosaccharides are synthesised by specific synthetases or pyrophosphorylases that catalyse the reaction between a-glycosyl phosphate at the C-1 position of the sugar molecule and nucleoside triphosphates with the elimination of pyrophosphate (Hughes, 1983). In vitro, these enzymes display a considerable “relaxed” specificity towards both sugar and nucleotide moieties of the participating substrates

(McLachlan and Krag, 1994). However, the availability of monosaccharide precursors in the form of monosaccharide-1-P is a primary requirement. Therefore, the cellular concentration of monosaccharide-1-P precursors plays a critical role in the synthesis of nucleotide-activated sugars. Chapter 1______Introduction

Glucose is both a central and primordial monosaccharide involved in carbohydrate metabolism. In theory, all different types and forms of cellular monosaccharides can be derived from glucose as a single exogenous source, which on its entry to the cell is converted to Glc-6-P by hexokinase (Martin et al, 1998). In the cell, the intermediary metabolism of carbohydrates generates fructose-6-phosphate (F-6-P) and the interconversion of glucose-6-phosphate (Glc-6-P) and F-6-P by phosphoglucose isomerase (PGI, EC. 5.3.1.9) plays a crucial regulatory role. Other monosaccharides such as galactose, glucosamine and mannose can also be utilised following their uptake by the cell. Under natural conditions, this alternative pathway does not offer any significant contribution. The major role of the exogenous glucose in the control of the protein glycosylation pathway (Martin cr al, 1998) and consequently in protein folding is clearly emphasised by the evolution of a family of chaperones, known as glucose- regulated proteins (GRPs) (Austen and Westwood, 1991).

1.3.1.4 Synthesis of dolichol phosphate mannose and dolichol phosphate glucose

Both Dol-P-Man and Dol-P-Glc are formed from their respective nucleoside- diphosphate sugar precursors as shown below:

Dol-P-Man synthase GDP-Man + Dol-P ------► Dol-P-Man + GDP

Dol-P-Glc synthase UDP-Glc + Dol-P ------► Dol-P-Glc + UDP

Dol-P-Man is synthesized on Dol-P anchored in the ER membrane by the enzyme Dol-

P-Man synthase (E.C 2.4.1.83), using GDP-Man as a sugar donor. Dol-P-Man synthase in mammalian cells comprises 3 subunits; Dpmlp, Dpm2p and Dpm3p, which form a

10 Chapter 1______Introduction functional complex, where Dpmlp is the catalytic subunit facing the cytoplasmic face of the ER membrane (Tomita et al., 1998; Kim et ai., 2000). Dpm2p is known to be essential for ER localization and also appears to have a role in Dol-P binding (Maeda et al., 1998). DpmSp has a direct function in stabilizing the complex by binding to both of the other known subunits (Tomita et al., 1998). The transfer of mannose residues from

GDP-Man to Dol-P is carried out on the cytoplasmic face of the ER membrane. Once constructed, Dol-P-Man is flipped into the lumenal side of the ER membrane by the

Lec35 gene product, flippase (Lehrman et al., 2001). Four molecules of Dol-P-Man are utilized to convert MangGlcNAci-PP-Dol into Man 9GlcNAc2 -PP-Dol by four different

ER membrane mannosyltransferases in the ER lumen in a highly ordered and sequential form. The Saccharomyces cerevisiae dpml mutant is defective in the synthesis of Dol-

P-Man and the gene encoding the enzyme, DPMi, was cloned by Orlean et al., (1988).

Dol-P-Man also serves as the donor of all three mannosyl residues used in the core of

GPI protein anchors (Menon et al., 1990; Orlean, 1990; Singh and Tartakoff, 1991).

The mouse Thy-1 negative thymoma mutant cells of complementation class E

(Trowbridge et al., 1978) are not able to synthesize Dol-P-Man (Chapman and

Hoffmann, 1980) and as a consequence cannot synthesize the GPI core resulting in the

defective surface expression of GPI-anchored proteins.

The Lee 15 mutants of CHO cells are another mammalian mutant cell-line defective in

Dol-P-Man synthesis and are unable to assemble a mature oligosaccharide precursor but

instead accumulate an intermediate consisting of five mannosyl residues (Chapman and

Hoffmann, 1980; Stoll et al., 1982). The incomplete intermediate oligosaccharides are

transferred to the proteins and are subsequently modified to complex type

11 Chapter 1______Introduction oligosaccharides by a process independent of the trimming reaction carried out by swainsonine-sensitive a-mannosidase II. As a result, these mutants are not sensitive to swainsonine treatment (Stoll et al., 1982; Beck et al., 1990). Transfection of yeast

DPMI DNA into Lecl5 mutant cells restored the assembly of mature oligosaccharide precursors and also their sensitivity to swainsonine treatment (Singh and Tartakoff,

1991). Similarly, ytast DPMI DNA complemented Class E mutants as transfection of yeastDPMI into these cells restored Dol-P-Man synthesis and the surface expression of

Thy-1 (DeGasperiet al., 1990).

In the case of Dol-P-Glc, the asparagine-linked glycosylation, ALG5 gene, in yeast, encodes Dol-P-Glc synthase (te Heesen et al., 1994), a 38-kDa transmembrane protein, which catalyses the formation of Dol-P-Glc from UDP-Glc, which serves as the sugar nucleotide donor in this reaction.

1.3.1.5 Glycosyltransferases involved in LLO assembly

A tetradeca-oligosaccharide is assembled on Dol-P, shown in Figure 1.3. The sequential addition of glycosyl moieties is shown by Roman numerals I to XIV.

12 Chapter 1 Introduction

(%-V ALGIO

ALG8

ALG6 IX XI VII a-1^ ALG9 a-1^ A L G ll VI X a-1^ ALG3 a-1,6 IV ALG12? V ALG2 a-1,6 III

II ALGl

ALG7

Dolichol

Figure 1.3: Schematic representation of stepwise synthesis (I to XIV) of the LLO. GlcNAc, V-acetylglucosamine; M, mannose; G, glucose (adapted from Burda and Aebi, 1999)

The formation of GlcNAc-PP-Dol is the first committed step both in the synthesis of

LLO and the V-glycosylation of proteins. The reaction is catalysed by an ER-membrane bound V-acetylglucosaminyl phosphate transferase (GPT, EC.2.7.8.17) utilizing UDP-

GlcNAc as the sugar donor and Dol-P as the acceptor as follows:

UDP-GlcNAc + Dol-P -► GlcNAc-PP-Dol + UMP

TheALG7 gene in yeast encodes this enzyme and homologues of the yeast gene have been characterised both in mammals and humans. Unlike Dol-P-Man and Glc-P-Dol synthesis, this reaction involves the formation of a pyrophosphate linkage by transfer of

GlcNAc-l-P from UDP-GlcNAc. Due to the pivotal role of GPT in protein N-

13 Chapter 1 Introduction

glycosylation, this gene has been shown to be implicitly involved in the regulation of a number of other integrated processes which control cell growth, cell division and also programmed cell death (Kukuruzinska and Lennon, 1998).

All glycosyltransferases involved in the subsequent sequential synthesis of

GlcsMangGlcNAci-PP-Dol on GlcNAc-PP-Dol utilise appropriate nucleoside

diphosphate glycosyl donors or dolichyl phosphate glycosides. Not all of these

enzymes and their encoding genes have been characterised, either in yeast or mammals.

The success in the identification of the genes encoding some of these

glycosyltransferases has been due to the selection of yeast or mammalian cell mutants

that exhibit an accumulation of truncated LLO structures, which predict a block in the

subsequent glycosylation step. The genetic and enzymological information available to

date on these glycosyltransferases is summarised in Table 1.1.

Gene Protein Product Size (kDa) Function/Location ALG7 Dol-PP-GlcNAc- 1 -P-transferase, Mr=33-50 essential N-GlcNActransferase/ER membrane

ALGl Dol-PP-GIcNAc2 -Man transferase, Mr=51.9 essential P-1,4- mannosyltransferase/ER membrane ALG2 Dol-PP-GlcNAczManz-Man transferase, Mr=55.8 essential a-1,3- mannosyltransferase/ER membrane

ALG3 Dol-PP-GlcNAc2 Man5 -Man transferase, Mr=52- a-1,3-mannosyltransferase/ER 64 membrane

ALG9 DoI-PP-GlcNAc2 Man6 -Man transferase, Mf=61.3 a-l,2-mannosyltransferase/ER membrane ALG5 Dol-P-Glc synthase, Mr=38.3 P -glucosy Itransferase/ER membrane

ALG6 Dol-PP-GlcNAc 2 Man9 -Glc transferase, Mr=62.8 a-l,3-glucosyltransferase/ER membrane

ALG8 Dol-PP-GlcNAc2 Man5 Glc-Glc transferase. a -1,3-glucosy Itransferase/ER Mr=63.5 membrane A L G ll ND, Mr=63.5 ND/ER membrane

Table 1.1: Glycosyltransferases involved in yeast protein A-glycosylation ND = not determined (adapted from Kukuruzinska and Lennon, 1998).

14 Chapter 1______Introduction

1.3.1.5.1 Topography of the synthesis of LLO

In terms of topology, LLO synthesis proceeds in two stages: Mai^GlcNAc 2 -PP-Dol is synthesised on the cytoplasmic face of the ER membrane with part of the dolichol being anchored within the ER membrane; MangGlcNAcz-PP-Dol is then translocated across the membrane into the lumen of the ER, where it undergoes elongation to the

Glc3 MansGlcNAc 2 -PP-Dol mature structure. The flippase or translocase responsible for this action has recently identified as the Per-15 gene in the yeast (Ng et a/.,2000) and the RFTl gene in humans (Helenius et al., 2002). The sugar donors for the addition of

4 marmosyl and 3 glucosy 1 residues are Dol-P-Man and Dol-P-Glc respectively. They are initially synthesised on the cytoplasmic face of the ER membrane and are also translocated across the membrane into the lumen of the ER. The Lec35 gene has been identified as the Dol-P-man flippase (Anand et al., 2001) and has also been shown to be able to translocate Dol-P-Glc (Helenius et al., 2002).

The division of reactions involved in the synthesis of LLO, between the cytoplasmic

and lumenal sides of the ER membrane, under normal physiological conditions

circumvents congestion on the lumenal side of the ER around protein translocation

chaimels and the site of OST action. This ensures that the ^-glycosylation

requirement(s) of a translocating polypeptide can be dealt with effectively. The

advantage of the this bi-phasic aspect of LLO synthesis involving lipid-linked substrates

as opposed to soluble ones has also been explained as a “trick” to overcome the barrier

of diffusion control. It also increases the efficiency of multi-molecular process at low

concentrations and allows the very rapid biosynthesis of the LLO (See Burda et ai,

1999). As the nascent polypeptide is translocated at the rate of approximately one amino

residue per 3-4 seconds into the ER lumen (Nilsson and von Heijne, 1993), an efficient

15 Chapter 1______Introduction supply of fully assembled LLOs is essential to accomplish the N-glycosylation of the translocating polypeptide.

1.3.1.6 Self-regulatory aspects of LLO assembly

While the availability of precursor sugars may have a direct effect on the LLO assembly, there is now increasing evidence that some components of the LLO itself may have a strong influence on its assembly. As the formation of GlcNAc-PP-Dol is the first committed step in LLO assembly, mechanisms influencing the supply and availability of Dol-P and formation of GlcNAc-PP-Dol have been investigated and reviewed in detail (Lehrman, 1991). The functioning of ALG7 gene in yeast is selectively regulated at two critical points in the G1 phase of the cell cycle and may influence other genes involved in LLO assembly (Lennon et ai, 1995). Dol-P-Man is shown to act as an allosteric activator of GPT-1 (Alg7p) (Chapman and Calhoun 1988,

Kean, 1982). It has been shown that there is mutual reciprocal stimulation of the synthesis of GlcNAc-PP-Dol and Dol-P-Man and that feedback inhibition of the synthesis of GlcNAc-PP-Dol by GlcNAc-PP-Dol and GlcNAcz-PP-Dol occurs (Kaushal and Elbein, 1985; Kean et al., 1999) as depicted in Figl .4.

GDP-Man ^ Dol-P-Man Dol-P TION ^ GlcNAc-PP-Dol - UDP-GlcNAc INHIBITION GlcNAc-GlcNAc-PP-Dol

Fig. 1.4 Co-operative stimulatory and inhibitory influences of initial reaction products in the biosynthesis of GlcN Ac-PP-Dol (based on Kean et al., 1999)

16 Chapter 1______Introduction

Another interesting aspect of self-regulation of LLO synthesis, even leading to the

correction of a metabolic genetic defect, is the algl mutant cell expressing PSAHVIG9

(Benton et al, 1996; Shimmaet al, 1997). Cells carrying PSA1/VIG9 on a multicopy

plasmid synthesise high levels of GDP-Man. ALGl encodes the GDP-mannose

dependent mannosyltransferase, which catalyses the addition of the first mannnose onto

G1c NA c 2-PP-D o1 during the early stage of LLO assembly on the cytoplasmic side of the

ER (Albright and Robbins, 1990). Therefore, the overproduction of GDP-Man

compensates for the reduced maimosyltransferase activity in algl cells.

1.3.1.7 Bypass or salvage routes involved in LLO synthesis under non-physiological

conditions

The multiphasic nature of the growth of the LLO and the branching and the elongation

of the chains suggest that a number of “check-points” exist in the pathway which

determine the fate of this macromolecular structure in case of metabolic break-down

and to accommodate bypass options. This strategy appears to have a significant role in

achieving the optimal structure of the LLO under adverse conditions, of either reduced

supply of appropriate glycosyl precursors or defective glycosyltransferases.

From studies on yeast and mammalian cell mutants, it is now becoming evident that the

early events involved in the assembly of the LLO on the cytoplasmic face of the ER

membrane are more or less essential, whereas those on the lumenal side are non-

essential for viability (Jakob et al, 1998; Burda and Aebi, 1999). The data from studies

using G1cNAc2-PP-Do1 as a donor and small hexapeptides as acceptors in vitro (Sharma

et a l, 1981) and from yeast and mammalian cell mutants, including pathological

conditions such as CDG, suggest that the translocation of incomplete LLO

17 Chapter 1______Introduction intermediates from the cytoplasmic side into the ER lumen, aberrant lumenal glycosylation and even transfer of truncated LLO to the polypeptide chain can take place (Sharmaet al., 1981; Aebi and Hennet, 2001; Helenius et a l, 2002).

1.3.2 The Oligosaccharyltransferase (OST) complex

The composition of the OST complex is still under investigation. To date, at least 9 non-identical subunits are known to comprise the OST complex in yeast (Table 1.2).

Mammalian OST was first isolated by the incubation of non-ionic detergents with rough microsomes extracted from dog pancreas with a high-salt concentration. The complex was purified further by sucrose density gradient and ion exchange chromatography

(Kelleher et al, 1992). These studies showed that the OST is an oligomeric complex composed of three integral membrane proteins of which ribophorin I (RI) (Hamik-Ort et al, 1987; Crimaudo et al, 1987) and the 48 kDa polypeptide, OST48 (Silberstein et al,

1992; Kelleheret al, 1992) are type I transmembrane proteins with a substantial length of polypeptide facing the lumen of the ER. Ribophorin II (RII), the third subunit of the complex, also has a large luminal domain, but the nature of its transmembrane and cytoplasmic domains is less defined (Fu et al, 1997). The OST complex has also been purified from other mammalian species, including humans (Kumar et al, 1995) and the structure comprising of RI, RII and OST48 polypeptides was shown to be highly conserved.

Homology studies between the yeast and mammalian OST proteins (Table 1.2) have shown that Ostlp is the homologue of mammalian RI, with a 58% similarity and 28% identity. Swplp in the yeast OST shows a 46% similarity and 24% identity to the C-

18 Chapter 1 Introduction terminal half of human RII (Kelleher and Gilmore, 1994; Knauer and Lehle, 1994).

DADl (defender gainst apoptotic death), another mammalian protein has been identified as a potential fourth subunit of the OST complex on the basis of its 40% sequence identity to the yeast Ost2 component. DADl was originally cloned by

Nakashima et al (1993) as a gene with a temperature-sensitive mutation that initiates apoptosis at its non-permissive temperature. It was postulated that loss of function of

DADl leads to apoptosis by disturbing cellular functions when A^-linked glycosylation is defective. Recently, DADl was identified as representing a fourth subunit of mammalian OST as it was shown to be present in equal amounts to that of RI, RII and

OST48, in addition to being able to be cross-linked to Ost48, the known homologue of yeast Wbplp (Kelleher and Gilmore, 1997). DADl is a small hydrophobic protein with a cytoplasmically located N-terminus and three transmembrane domains (Silberstein and Gilmore, 1996).

Yeast Mol. wt (k) Dog pancreas Hen oviduct Pig liver Human liver Ostlp 64/62 Ribophorin I (66) 65-1 66 65-1 Stt3p —60 --- - Wbplp 47 OST48 (48) 50 48 50 Ost3p 34 - - - - Ost6p 32 - - - - Swplp 30 Ribophorin II (63/64) 65-11 61/63 65-11 Ostlp 16 DADl (12) -- - OstSp 9.5 - -- - Ost4p 3.6 - ---

Table 1.2 Comparison of OST complex from different organisms (from Knauer and Lehle, 1999)

The structural organisation of the mammalian OST was elucidated by studying the interactions of the subunits comprising the OST complex by using the yeast-two hybrid system (Fu et al., 1997). A schematic representation of the structural composition of mammalian OST as proposed by Fu et al (1997) is shown in the following diagram:

19 Chapter 1 Introduction

RII

583

609

C ytop lasm 4 0 6 | 540

385 103 518

311 2 56 387

Figure 1.5 Schematic representation of the subunits of mammalian OST. Numbers of the amino acid sequences of the native proteins define boundaries of constructs tested for interactions in yeast two-hybrid system. Double arrows indicate interactions between domains of OST subunits (taken from Fu et al., 1997).

1.3.2.1 Requirements and constraints of the oligosaccharyltransferase reaction with respect to the polypeptide as a substrate

1.3.2.1.1 Co-translational translocation of polypeptides to the ER lumen

The foremost requirement for a polypeptide to undergo A^-glycosylation is its targeted translocation into the lumen of the ER. To ensure this, all polypeptides destined to be

A^-glycoproteins carry a signal sequence, generally 12-30 amino acid residues in length, as shown below;

MKWVTFLLLLFISGSAFS ^RGVF

Figure 1.6 Typical signal sequence of polypeptides. Hydrophobic residues are denoted in red and the symbol ^ marks the position of endopeptidase cleavage.

20 Chapter 1______Introduction

These polypeptides are synthesised on polyribosomes bound to the ER membrane, near protein translocation chaimels. When a chain is long enough to emerge from the

ribosomes, the signal sequence is recognised by a ribonucleoprotein, the signal

recognition particle (SRP). The SRP binds tightly to the signal sequence and it then

docks on the SRP-receptor in the ER membrane. Binding to the SRP receptor releases

the signal sequence which results in translocation of nascent chain across the lumen and

de-arrest of translation (For a review see Austen and Westwood, 1991).

Signal sequences of translocated proteins are usually removed by a signal sequence

peptidase (SSP), which cleaves on the C-terminal side of a hydrophobic domain at

residues such as Gly or Ser, upon their arrival into the ER lumen (Figl.6). The active

site of SSP, a multi-subunit enzyme, is exposed to the lumen of the ER. Some signal

peptides are not cleaved but are retained in the mature protein.

1.3.2.1.2 Influence of the nature of the A-glycosylation sequon and other

polypeptide-structure based constraints on the A-glycosylation reaction

The OST complex recognises the Asn-X-Ser/Thr tripeptide sequence (sequon), where X

is any amino acid except proline (Kaplan et al, 1987). Studies on Æ-glycosylation

sequon recognition by OST have shown that approximately 10-30% of possible Asn-X-

Ser/Thr sequons are not efficiently glycosylated or not glycosylated at all (Mononen

and Karjalainen, 1984; Gavel and von Heijne, 1990). Studies by Imperiali and

Hendrickson (1995) have demonstrated that glycosylation requires the formation of an

Asx-tum motif (a loop conformation similar to a p-tum) at the sequon, which facilitates

the hydrogen bonding between the Asn residue, the hydroxyl residue (Ser/Thr) and the

peptide backbone.

21 Chapter 1______Introduction

The nature of the amino acids in the X and Y positions of the glycosylation sequon

(Asn-X-Ser/Thr-Y) and of the amino acids preceding the Asn affect the frequency of JV- glycosylation of protein molecules.

A number of experimental investigations have been conducted to discover the

importance of the types of amino acids in the X and the hydroxy position (Ser or Thr) of the sequon. Various techniques, including site-directed mutagenesis were employed to modify the sequons of recombinant proteins (Shakin-Eshleman, 1996). For example,

studies in vitro showed that peptides with the Asn-X-Thr sequons are approximately 40-

fold better substrates than those containing the Asn-X-Ser sequon (Bause, 1983). This

finding is comparable to the results reported in vivo, although the preference for Thr was shown to be reduced (Gavel and von Heijne, 1990; Kasturi, 1997).

Studies using site-directed mutagenesis and a cell-free translation/glycosylation system

have shown that the Y position in Asn-X-Ser/Thr-Y has an important influence on the

frequency of V-glycosylation (Mellquist et al, 1998). Variants have been designed with

each of the twenty common amino acids at the Y position, with either Ser or Thr at the

hydroxy (Ser/Thr) position.

The investigations carried out by a number of researchers (Bause, 1983; Gavel and von

Heijne, 1990; Mellquist et al, 1998) demonstrated that the presence of cysteine adjacent

to the A-glycosylation sequon also negatively influences the likelihood of N-

glycosylation. Nonetheless rare exceptions to the sequon structure have been described,

such as Asn-X-Cys (Titani et al, 1986; Miletich and Broze, 1990; Grinnell et al, 1991)

and Asn-Gly-Gly-Thr (Gavel and von Heijne, 1990).

22 Chapter 1______Introduction

Glycosylation of Asn-X-Ser/Thr can still occur even if the N- and C-termini of a protein are blocked (Hart et al, 1979) but there is evidence suggesting that sequons near to the

C-terminus of a protein are less likely to be glycosylated (Kanehisa, 1988; Gavel and von Heijne, 1990).

1.3.2.2 Effects of truncation of LLO on its transfer to the polypeptide by OST and post-transfer processing in the ER

1.3.2.2.1 Influence of structural aspects of the LLO donor on OST reaction efficiency

Full-length lipid-linked core oligosaccharide (GlcsMangGlcNAci-PP-Dol) is the preferred glycosyl donor in vitro and in vivo in all eukaryotes (Trimble et al, 1980;

Sharma et al, 1981; Runge et al, 1984; Verostek et al, 1993). However, this is not the case in trypanosomatid protozoa, which lack the Dol-P-Glc synthase gene (Bosch et al,

1988) and hence produce only Man 9GlcNAc2 -PP-Dol as the LLO (Parodi, 2000a). The presence of the three glucose residues on the LLO precursor in all other eukaryotes promotes more efficient transfer. The minimal structural requirement of the glycosyl donor in vitro is found to be GlcNAcz-PP-Dol, as no transfer could be demonstrated from GlcNAci-PP-Dol (Sharma et al, 1981). Alvarado and colleagues (1991) have postulated that the presence of glucose residues enhances transfer by providing a favourable conformation that contributes to oligosaccharide recognition by OST and by influencing the apparent binding affinity for the acceptor substrate (Sharma er al, 1981;

Breuer and Bause, 1995; Knauer and Lehle, 1999). Reaction kinetics revealed that Km values for the peptide acceptor substrate of the yeast OST were altered by the structural composition of the LLO. The Km for the same acceptor peptide was found to be 10- fold lower when GlcgMangGlcNAcz-PP-Dol was the donor substrate compared with

23 Chapter 1______Introduction

G1cNAc2-Do1PP as the donor (Sharma et al, 1981). The transfer of truncated oligosaccharides initially observed in vitro (Sharma et al, 1981) was also shown later to occur in vivo (Huffaker and Robbins, 1983). Studies using alg yeast mutants, with either a temperature sensitive block in LLO assembly or in alg null mutants that accumulate various oligosaccharides, provided the evidence that truncated oligosaccharide chains or fewer chains, depending on the protein, were being transferred onto the proteins, for example, Mani. 2 GlcNAc2 in alg2 (Jackson et a l, 1989,

1993).

The rate of transfer of truncated LLOs is not only inefficient by 20-30 fold, it requires a considerably longer time. As the rate of translation and translocation of nascent polypeptide is independent of co-translational modification such as ^-glycosylation

(Jackson, 1989), inefficient transfer of truncated LLO results in the lack of occupancy of A^-glycosylation sites. Thus, the relative concentrations of normal and truncated

LLOs could lead to non-glycosylation of a consensus sequon or its occupancy by an abnormal or truncated LLO. An altered pattern of glycosylation could affect the interaction of the glycoproteins with ER chaperones. Consequently this could have a profound effect on the folding of the protein and protein-protein interactions, which may determine its fate with respect to its intracellular degradation or exit from the ER to the Golgi apparatus for subsequent processing.

1.3.3 Processing of protein-bound oligosaccharides in the ER

Immediately after the transfer of Glc3 Man 9GlcNAc2 -oligosaccharide to the Asn-residue in the A^-glycosylation sequon, the terminal «-1,2-linked Glc residue is cleaved off by

ER membrane-bound a-glucosidase I (Gls I). The Gls I is considered to be located in

24 Chapter 1______Introduction juxtaposition to OST. This enzyme is highly specific for the terminal a-l,2-linked Glc residue and its action converts the protein-linked oligosaccharide to Glc 2 Man 9GlcNAc2 - structure. Using the ALG2 yeast strain, Jakob et al (1998) were unable to detect protein- bound Glc 3 Man 9GlcNAc2 . This reinforces the point that the removal of the terminal a-

1,2-linked Glc residue by Gls I is followed immediately by the OST transfer reaction.

The Gls I can thus be postulated to function as a “guardian” of transfer of oligosaccharide to the polypeptide. OST, like any other transferase can act as a hydrolase immediately after the transfer and catalyse the reverse reaction as follows:

OST as transferase GlcsMançGlcNAci-PP-Dol + Asn-polypeptide ------► OST as hydrolase GlcsMangGlcNAcz- Asn-polypeptide + Dohchol pyrophosphate + H 2O

Asn-polypeptide + GlcgMan^GlcNAcz-OH + Dolichol pyrophosphate

The immediate removal of the terminal Glc residue by Gls I, prevents this undesirable action by OST as a reverse transferase or hydrolase.

The analysis of the structure of protein-bound oligosaccharides as well as their temporal appearance also showed that the removal of the first a-l,3-linked Glc by a-glucosidase

II (Gls II) was a rapid process. Jakob et al (1998) further demonstrated that the mono- glucosylated GlciMan 9GlcNAc2 was converted to Man 9GIcNAc2 with a half-life of approximately 2 minutes and this occurred before processing by mannosidase I (ERMI), which was a relatively slow process (half-life of 10 minutes) (Jakob et al., 1998). In the

Agls2 yeast strain, the removal of two a-l,3-linked Glc residues was not a prerequisite for ERMI, because removal of the Mang residue (Fig. 1.8) occurred with approximately

25 Chapter I Introduction

the same kinetics in both Gls Il-deficient and Gls Il-proficient strains (Jakob et al.,

1998).

1 2 3 4 pi,4 Pl,4

Dol-PP Protein Protein Protein Protein

Protein Protein Protein Protein Protein Protein

Figure 1.7 Biosynthetic pathway of a bi-antennary N-glycan of a glycoprotein. The enzymatic steps involved are (1) OST transfers the precursor oligosaccharide from Dol-PP to nascent protein; (2) a-glucosidase I removes distal (al-2)-linked Glc, (3,4) a-glucosidase II removes distal (al-3)-linked Glc residues stepwise; (5) a-1,2- mannosidase I, Mang-mannosidase and a-mannosidase I remove the (al-2)-linked Man residues; (6) A^-acetylglucosaminyltransferase I adds the first GlcN Ac residue at a specific Man residue, (7) a-mannosidase II removes the two terminal Man residues, (8) A-acetylglucosaminyltransferase II adds a GlcN Ac residue to newly generated Man residue, (9) (5-1,4-galactosyltransferase adds a Gal residue on each GlcN Ac; (10) a-2,3- sialyltransferase terminates the glycan with an A-acetylneuraminic acid (NeuSAc) on each Gal residue. ■ = GlcNAc,o = Man, O = Glc, o = Gal, A = Neu5 Ac, A = ftjcose (may also be added during subsequent terminal glycosylation).

The protein-bound oligosaccharide undergoes further processing in the ER, which

involves the removal of some of the Man residues. A number of a-mannosidases have

been identified, localized specifically in the ER or Golgi and cytoplasm (Daniel et a i,

1994; Gonzalez et a i, 1999; Zuber et al., 2000). The ER contains two a-mannosidases.

26 Chapter 1 Introduction

ERMI and ERMII, of which ERMI is more abundant (Moreman et al, 1994). They both produce MangGlcNAcz isomers as shown in Figure 1.8.

M s My Mg

I I I M4 M e Mg

Mz ' ^ u /

I Gnz I Gni

ERMI I ERMII Asn

M s Mg M s My

I I I I M4 M e Mg M4 Me M g

I M 2 \/ Mz M/ Ml I I Ghz Gnz I I Gni Gni

I I Asn Asn Man 8C isomer Man 8B isomer

Figure 1.8 Mannose processing in the ER and the production of MangGlcNAci isomers.

Another ER a-mannosidase, described as Mang-mannosidase, which processes

Man 9GlcNAc2 to MangGlcNAcz (Fig 1.9) has been reported by Bause et al, (1992).

27 Chapter 1 Introduction

Ms M7 M9 Mz I 1 1 I M4 Mé Ms

1 Mz / Ml \ Ms

\ M,' / Figurel.9 I 1 Schematic diagram Gnz Gnz showing the action 1 of the Man9 Gni (Jni mannosidase I Asn -\sn

1.3.4 Processing of protein A^-linked oligosaccharides in Golgi apparatus

Normal A^-glycoproteins enter the Golgi apparatus bearing Mang.gGlcNAci structures, although, through alternative pathways, A-glycoproteins with completely unprocessed oligosaccharides like Glc 3 Man 9GlcNAc2 -structures or truncated oligosaccharides do enter the Golgi apparatus. The oligosaccharide processing machinery in lower eukaryotes is simple, whereas in higher eukaryotes like mammals, it is highly complex.

The lower eukaryotes do not contain the repertoire of glycosyltransferases required for complex glycan formation. This gives rise to the appearance of different types of N- oligosaccharides as shown in Fig 1.10.

High Hybrid Complex mannose hi- tri- tetra-antennary

A s n

Figure 1.10 Schematic representation of the different types of A-oIigosaccharides. Symbols; ■ , GlcN Ac, O , Man, Glc, O, Sialic Acid; A , Fucose (adapted from Durand and Seta, 2000)

2 8 Chapter 1______Introduction

In higher eukaryotes, the Golgi apparatus can be sub-divided into three main compartments; cis-, median and trans-Go\g\. The formation of complex oligosaccharide structures involves co-ordinated and sequential enzyme reactions, which remove and add sugar residues. These enzymes, glycosidases and glycosyltransferases are located in different compartments of the Golgi apparatus. Similarly, the transporters for donor substrates i.e., nucleotide activated sugar precursors are also located in different compartments according to their requirement (Schachter, 1999). The reaction product of one enzyme becomes the substrate for the subsequent enzymatic step and the glycoprotein undergoing such modifications is carried from one compartment to the next by a vesicular transport system. When present, sialic acid residues are always at the terminal non-reducing ends of the oligosaccharide. The high-mannose and hybrid oligosaccharides are formed by the primary pathway. The complex type in the mature form of iV-linked oligosaccharides may be bi-, tri and tetra-antennary structures, again depending on the action of specific glycosyltransferases.

29 Chapter 1______Introduction

1.4 Congenital Disorders of Glycosylation

The Congenital Disorders of Glycosylation (CDG) are a group of multi-system disorders, characterised by the aberrant glycosylation of glycoproteins. They are divided into two main groups, CDG-I and CDG-II. CDG-I comprises disorders in the synthesis and transfer of the lipid-linked oligosaccharide. To date, six subtypes of CDG-I (la-f) have been reported. CDG-Ia, Ib, le and If are due to the defects in the supply of mannosyl precursors or mannosylated lipid-linked intermediates for the synthesis of mature LLOs and one subtype (CDG-Id) to a defect in the incorporation of mannosyl residues in the assembly of the LLO. One subtype (CDG-Ic) results from a defect in the incorporation of glucosyl residues in the assembly of the LLO.

CDG-II comprises defects in the processing of protein-linked oligosaccharides and it is subdivided into three subtypes (Ila, lib and lie). The defects of CDG-II are given in

Section 1.6 of this chapter and are summarised in Table 1.4.

1.5 CDG-I syndromes

The information on the enzyme deficiency and/or inactive protein as well as the genes responsible for these defects is summarised in Table 1.3. Different CDG-I defects in the LLO synthesis pathway starting from fructose-6-phosphate to the formation of

GlcgMangGlcNAcz-PP-Dol are depicted in Figure 1.11.

30 Chapter 1 Introduction

CDG-I Enzymatic or protein defect Gene Patients Year la Phosphomannomutase 2 PMM2 -300 1995 Ib Phosphomannose Isomerase MPI -20 1998 Ic Dol-P-Glc: MangGlcNAcz- alpha 1,3- HALG6 -30 1999 glucosyltransferase Id Dol-P-Man: Man 5 GlcNAc2 - HALG3 1 1999 mannosyltransferase le Dol-P-Man Synthase 1 DPMI 4 2000 If Dol-P-Man utilisation defect 1; MPDUl 4 2001 SL15, supressor of Lecl5 and Lec35

Table 1.3: CDG-I: biochemical and molecular defects, number of patients and year identified

31 Chapter I Introduction

Glucose -► Glucose 6-P

cytoplasm ER lumen Fructose 6-P CDG-Ib : Mannose ^ Mannose 6-P CDG-Ia X \ Mannose 1-P

r\r\f\r GDP CDG-Ie CDG-Id

CDG-If rvy/V"

CDG-Ic r v \r \r

''^r\T\r\

rvwn

Figure 1.11 Schematic presentation of CDG-I defects in LLO synthesis dolichol, ■, N-acetylglucosamine; # , mannose; ♦ , glucose

32 Chapter 1 Introduction

1.5.1 Protein A^-glycosylation defect in serum transferrin in CDG-Ia

CDG-Ia, initially designated as CDGS, was described as an inherited, multisystemic disorder with severe neurological involvement and developmental delay and a characteristic phenotypical presentation (For reviews see Jaeken et al., 2001; Schachter,

2001). The characteristic biochemical abnormality of this syndrome was discovered serendipitously as an abnormal isoelectric focusing pattern of serum transferrin (Jaeken et at., 1984; Stibler and Jaeken, 1990; Horslen et al., 1991), a test used to screen for alcohol abuse in normal adults (Stibler et ai, 1978). The disorder was initially called the “Disialotransferrin Developmental Deficiency (DDD) Syndrome (Stibler and

Jaeken, 1990), because of the consistent presence of serum transferrin isoforms with a higher pi, due to a decrease in the terminal sialic acid residues in the glycans attached to proteins. Human serum transferrin is a 79 kDa glycoprotein, in which Asn 413 and Asn

611 are normally A-glycosylated with tri- or bi-antennary complex glycans with terminal sialic acid residues. Tetrasialotransferrin is the predominant form in normal serum, but in CDG-Ia, the proportion of tetrasialotransferrin is considerably decreased with the appearance of di- and asialo transferrin as shown in Figure 1.12.

////

Tetraskilo-

— Oisioio- Transferrin

— Askito-

Figure 1.12 Isoelectric focusing patterns of transferrin for CDG disorders (taken from Marquardt and Freeze, 2001)

33 Chapter 1______Introduction

Analysis of the composition and tryptic digests of transferrin from CDG-Ia have shown a random non-occupancy of the Asn 413 or Asn 611 iV-glycosylation sites or complete non-occupancy of both sites by mature glycans (Yamashita et al., 1993; Wada et al,

1992, 1994). The biochemical basis of underglycosylation of serum transferrin and other glycoproteins was not known until van Schaftingen and Jaeken (1995) first reported a deficiency of phosphomannomutase in fibroblasts in culture from CDG-I patients. The deficiency of phosphomannomutase leads to a decrease in the synthesis of

GDP-mannose and hence of the Dol-PP oligosaccharides and consequent underglycosylation of proteins (see Figure 1.11).

1.5.1.1 Genetic defect in CDG-Ia

CDG-Ia is inherited in an autosomal recessive manner and the gene (PMM2) has been localised to chromosome 16pl3 by linkage analysis (Martinsson et al., 1994; Matthijset al., 1996). Fine mapping of the disease locus was obtained by haplotype and linkage disequilibrium analysis in Scandinavian families (Bjursell et al., 1997). The identification of mutations in the PMM2 gene in CDG-I patients with a known PMM deficiency provided the evidence that PMM2 is the disease-causing locus (Matthijs et al., 1997a; Schollen et al., 1998; Matthijs et al., 1999; Carchon et al., 1999). Further details on the PMM2 gene, on the mutations found worldwide and in UK patients and the genotype correlation with residual PMM activity and clinical severity of the disease are given in Chapter 4.

1.5.2 Biochemical defect in CDG-Ib

CDG-Ib was first described in 1998 by Niehues et al., and was also independently discovered by two other groups in the same year (de Koning et al., 1998; Jaeken et al..

34 Chapter 1______Introduction

1998). Initial observations on these patients, prior to the discovery of the basic enzymological defect indicated that the isoelectric focusing pattern of serum transferrin of these patients was identical to that observed in patients with CDG-Ia, suggesting hypoglycosylation of transferrin with a predominance of disialo- and tetrasialotransferrin.

However, a diagnosis of CDG-Ia was unlikely as the clinical symptoms presented by these patients were clearly different from the CDG-Ia (PMM-deficient) patients. The patients under investigation did not have the neurological signs or mental retardation common in CDG-Ia, but were described with a gastrointestinal disorder with protein- losing enteropathy. Other clinical symptoms, including coagulopathy, cyclic vomiting

(de Koning et al., 1998; Babovic-Vuksanovic et al., 1999), hypoglycaemia and hepatic fibrosis were observed in many of the patients (Jaeken et al., 1998; Babovic-

Vuksanovic et al., 1999).

The enzymatic investigations showed that whereas the PMM activity was normal in fibroblasts of these patients there was a marked decrease in the activity of phosphomannose isomerase (PMI, E.C 5.3.18). This led to the conclusion that PMI deficiency was the basic enzyme defect in these patients ^iehues et al., 1998; de

Koning et al., 1998; Jaeken et al., 1998). PMI catalyses the interconversion of fructose-

6-phosphate (F-6-P) and mannose-6-phosphate (Man-6-P) and a deficiency of this enzyme leads to the decreased formation of GDP-marmose and hence results in hypoglycosylation of glycoproteins (See Fig. 1.11).

35 Chapter 1______Introduction

1.5.2.1 Genetic defect in CDG-Ib

The PMI gene (MPT) has been used as a marker for somatic cell genetics and has been assigned to chromosome 15 (van Heyningen et al., 1975). The human phosphomannose isomerase was purified to greater than 98% purity and the full-length cDNA was isolated from a human testes Xgtll library (Proudfoot et al., 1994). TheMPI gene was shown to be conserved between different species and at the protein level, there is 84% identity between human and mouse and 39% between human and Candida albicans.

PMI mRNA was found to be highly expressed in heart, brain and skeletal muscle

(Proudfoot et al., 1994; Jaeken et al., 1996).

Molecular analysis of cDNA and genomic DNA sequences of the MPI gene in these patients have shown the presence of mutations, therefore confirming that MPI is the disease-causing locus in this type of CDG (Niehues et al., 1998; Jaeken et al., 1998; de

Lonlay et al., 1999; Schollen et al., 2000).

To date, 12 different mutations have been found in CDG-Ib patients, with 10 of the 12 being missense mutations and the majority affecting amino acids conserved between human, mouse and Candida albicans (Schollen et al., 2000).

1.5.2.2 Mannose therapy as treatment for CDG-Ib

Man-6-P as a precursor is utilised for nine mannosylation steps in the synthesis of the lipid-linked oligosaccharide precursor required for protein ^-glycosylation, for the synthesis of GPI-anchors and as a precursor in GDP-fucose synthesis (Niehues et al.,

1998). PMI deficiency leads to reduced synthesis of Man-6-P from fructose-6- phosphate. The exogenous mannose from the diet or mannose produced from

36 Chapter 1______Introduction glycoconjugate hydrolysis products in the body can be converted to Man-6-P by mannose kinase. The mammalian cells are known to have mannose specific transporters and are reported to operate at approximately half of their optimal rate (Etchison and

Freeze, 1997). Therefore, it was suggested that an increase in the extracellular mannose concentration might elevate the amount of Man-6-P in the cells (Niehues et al., 1998).

With the administration of oral mannose therapy in certain cases, (Niehues et al., 1998; de Lonlay et al., 1999; Hendriksz et al., 2001) the clinical phenotype and biochemical abnormalities have been shown to be almost completely corrected.

Oral mannose therapy has also been carried out as a possible treatment for patients with

CDG-Ia, but has not been successful (Marquardt and Freeze, 2001).

As PMI deficiency is the only treatable CDG disorder so far, a rapid and reliable diagnosis is paramount in order to try and minimise the levels of diarrhoea, protein loss from the gut and bleeding/clotting problems. Details of the biochemical and genetic investigations of a patient with CDG-Ib are given in Chapter 5.

1.5.3 Biochemical defect in CDG-Ic

CDG-Ic (previously known as CDGS Ic or CDGS type V) was initially identified in a group of patients who had normal levels of PMM and PMI, presented with milder clinical symptoms and far less neurological involvement as compared to typical CDG-Ia patients (Burda et a l, 1998; Kômer et al., 1998; Imbach et al., 1999). The characteristic features observed in CDG-Ia, for example, inverted nipples and fat pads were also absent in these patients. However, the isoelectric focusing pattern of serum transferrin was comparable to that seen in CDG-Ia and Ib with regard to the disialo- and tetra-sialo

37 Chapter 1 Introduction forms being the most abundant glycoforms, which suggests a reduced efficiency of N- linked glycosylation of proteins in the ER (Yamashita et a i, 1993). Further investigations on the analysis of lipid-linked oligosaccharides in patient fibroblasts, showed an accumulation of MangGlcNAcz-PP-Dol, lacking the three terminal glucose residues. The accumulation of the non-glucosylated Man 9GlcNAc2 -PP-Dol, is caused by the deficiency of the ER located a - 1,3 glucosyltransferase enzyme (See Fig. 1.11)

(Burda et a l, 1998; Kôrner et a l, 1998; Imbach et a l, 1999). The addition of the 3 glucose residues in the synthesis of the LLO is critical for the optimal substrate recognition by the oligosaccharyltransferase complex and is therefore necessary in ensuring efficient transfer of the oligosaccharide core to nascent glycoproteins. Hence, in CDG-Ic, the incomplete oligosaccharide structure is inefficiently transferred to the nascent protein by the oligosaccharyltransferase complex (Murphy and Spiro, 1981;

Burda and Aebi, 1998)

AAA

4L 66

MangGlcNAc2-PP4)ol

OTase complex

Figure 1.13: Normal oligosaccharide core glucosylation in the ER and transfer of the oligosaccharide core to the A-glycosylation sites of glycoproteins Mannose (A) and glucose (■) are both added to GlcNAc](##)-PP-Dol to form the nascent oligosaccharide core, OTase, (oligosaccharyltransferase) (taken from Imbach et a l, 2 0 0 0 )

38 Chapter 1______Introduction

1.5.3.1 Genetic defect in CDG-Ic

The accumulation of MaugGlcNAci-PP-Dol observed in CDG-Ic is analogous to the biochemical phenotype described in the algS and alg6 Saccharomyces cerevisiae mutant strains (Runge et a l, 1984; te Heesen et a l, 1994). Subsequently, by using BLAST searching of databases and PGR amplification, Imbach et al., (1999) cloned the human orthologs to the ALG5 and ALG6 genes that coded for the dolichyl phosphate glucosyltransferase and the Man 9GlcNAc2 -PP-Dol-a-l , 3 glucosyltransferase enzymes, respectively. In the case of the human ALG5 (hALG5) gene, several human EST fragments similar to yeast ALG5 were retrieved and a putative open-reading frame

(ORE) of 644 bp was constructed and by using this fragment as a probe, a full-length

ALG5 cDNA from a human T-lymphocyte cDNA library was isolated. The 1,126 bp hALG5 cDNA included an ORE of 729 bp encoding a polypeptide of 242 amino acids.

The hALG5 gene showed 37% identity and 58% similarity to the 5. cerevisiae ortholog.

However, a similar EST database search using the yeast ALG 6 gene as query failed because only EST fragments that were similar to the closely related yeast ALG5 gene

(Stagljar et at., 1994) emerged at the time the search was carried out. An alternative approach was undertaken by designing a series of degenerate oligonucleotide primers within regions of the yeast ALG6 sequences that were different to the yeast ALG8 sequences. Using PGR amplification on human T-cell cDNA using two of the sequence primers yielded a 908 bp fragment that was similar to the yeast ALG6 as shown by sequencing. The 908 bp fragment allowed the isolation of a complete human cDNA, which contained a 1,524 bp long ORE coding for a protein of 507 amino acids. The human Alg 6 protein showed several conserved regions with its S. cerevisiae ortholog and the overall identity and similarity between the two orthologs was 32% and 51%,

39 Chapter 1______Introduction respectively. Results of Northern blotting showed that the hALG5 and \\ALG6 genes were expressed in all the tissues that were examined, including heart, brain, lung and skeletal muscle.

Mutation analysis using direct sequencing was carried out on the ALG5 and ALG6 cDNA in patients diagnosed with CDG-Ic. No anomalies were found in the ALG5 gene.

However, a C to T substitution of nucleotide 998 was detected in the ALG6 cDNA in all of the patients investigated by Imbach et al, (1999). This transition results in an amino acid substitution from alanine (GCG) to valine (GTG) at codon 333 (A333V).

Further investigations by Imbach and colleagues (2000) confirmed the presence of this mutation at the genomic level, in exon 11 of the ALG6 gene, using intron- and exon- specific primers. Using the genomic organization of the hALG6 gene, which they determined to be comprised of 14 exons, spread over 55 kb, three mutations (2 missense mutations and one frameshift) in addition to the A333V missense mutation have been found in other CDG-Ic patients. Using complementation analysis in S. cerevisiae, they confirmed that the presence of the three missense mutations causes a detrimental effect on ALG 6 activity. Complementation analysis was not carried out on the frameshift mutation as it leads to a large deletion in the ALG6 protein by causing the loss of exon

The combined results of the mutation analysis on these and previously reported CDG-Ic patients (Burda et al., 1998; Kômer et al., 1998; Imbach et al., 1999) showed a high frequency for the A333V mutation and haplotype analysis of these patients revealed a founder effect for the ALG 6 allele bearing this mutation (Imbach et al., 2000).

40 Chapter 1______Introduction

To date, 30 cases of CDG-Ic have been described (Burda et al., 1998; Kômer et al.,

1998; Imbach et al., 1999, 2000; Grünewald et al., 2000; Westphal et al., 2000a,

2000b). Approximately the same number of CDG-Ib cases have been identified but it is more difficult to characterise CDG-Ic on a clinical basis. Therefore it is possible that the

ALG6 deficiency is the second most frequent type of CDG after CDG-Ia Çmbach et al.,

2000). Details of the biochemical and genetic investigations of a patient with CDG-Ic are given in Chapter 5.

1.5.4 CDG-Id

CDG-Id (previously known as CDGS Type IV) is characterised by the neonatal onset of severe epilepsy, skeletal abnormalities and microcephaly with minimal psychomotor development (Kômer et al, 1999). The isoelectric focusing pattem of semm transferrin in CDG-Id demonstrates a partial deficiency of sialic acid residues, which is less pronounced than those seen in CDG-Ia patients.

1.5.4.1 Biochemical defect in CDG-Id

The underlying biochemical defect in CDG-Id is the deficiency of dolichyl-P-Man:

Man 5 GlcNAc2 -PP dolichyl mannosyltransferase, which transfers mannose from Dol-P-

Man onto MansGlcNAc 2 -PP-Dol intermediate (Figure 1.11). This defect causes an accumulation of the LLO intermediate and results in glycoproteins with fewer but normal oligosaccharides (Kômer et al, 1999).

41 Chapter 1______Introduction

1.5.4.2 Genetic defect in CDG-Id

Aebi and colleagues (1996) demonstrated that the ALG3 gene in Saccharomyces cerevisiae is required for the activity of Dol-P-Man: MangGlcNAcz-PP-Dol mannosyltransferase. Kôrner et al, (1999) carried out mutation analysis on the cDNA sequence of the human Not (neighbour of tid) 56-like protein which has a 30% homology with AlgSp. Sequence analysis of the Not 56-like protein cDNA of the patient resulted in the detection of a missense mutation as the only anomaly, causing the substitution of a G to A of nucleotide 353. This results in the replacement of Gly 118 with aspartic acid. Further sequencing analysis was carried out at the genomic level, which revealed that the patient was homozygous for G353A and that the parents of the index case were heterozygous for the mutation.

1.5.5 Biochemical defect in CDG-Ie

A deficiency of the Dol-P-Man synthase in humans is the underlying biochemical defect in CDG-Ie (Figure 1.11). Simultaneous reports by two separate groups (Kim et al.,

2000; Imbach et al., 2000) described patients suffering from severe seizures, muscular hypotonia, profound developmental retardation and dysmorphic features such as dysplastic nails and knee contractures. The isoelectric focusing patterns of the patients’ serum transferrin were abnormal, with increased amounts of disialotransferrin and varying levels of asialotransferrin. PMM and PMI activities were normal when assayed in the patient fibroblasts and subsequent LLO analysis revealed the accumulation of the

MangGlcNAcz-PP-Dol intermediate in all of the patients in comparison to known standards, where control cells showed Glc 3 Man 9GlcNAc2 accumulation. This finding suggested the possibility of a reduced level of Dol-P-Man. The hypothesis was confirmed by measuring Dol-P-Man synthase activity in fibroblasts of the patients,

42 Chapter 1______Introduction which showed that they had less than 5-6% of normal control activity when assayed under standard conditions.

1.5.5.1 Genetic defect in CDG-Ie

The humanDPMI gene, encoding for the catalytic subunit of Dol-P-Man synthase, has been cloned. The human Dpml protein consists of 260 amino acids with 30% identity with the yeast Dpml protein but lacks a hydrophobic transmembrane domain, which is found in the yeast synthase. The humanDPMI gene, which is located on chromosome

20ql3, comprises 9 exons spanning 23.3kbp (Tomita et al., 1998). Mutation analysis of this gene in 3 patients reported with a deficiency of Dol-P-Man synthase has revealed a common point mutation, C274G, in all of the patients, causing a change from arginine to glycine at amino acid residue 92. Two different sized deletions in the DPMI gene have been found in patients; Imbach et al (2000) detected a 628delC in their two patients (siblings) and Kim et al (2000) found a 13bp deletion in their patient.

This defect in Dol-P-Man synthesis leads to the formation of truncated LLO precursor, which subsequently leads to underglycosylation ofA^-glycoproteins.

1.5.6 CDG-If

Recently, three unrelated patients with a novel type of CDG-I (CDG-If, Figure 1.11) were reported by Schenk et al (2000, 2001b), who presented a typical CDG-I serum transferrin pattern but normal PMM and PMI activities. Cultured fibroblasts from the patients showed an accumulation of truncated Dol-PP-oligosaccharides (mainly

MangGlcNAcz and Man 9GlcNAc2 with a small amount of the glucosylated form of these

43 Chapter 1______Introduction oligosaccharides). Genetic analysis of the MPDUl gene in the three patients revealed the presence of mutations in this gene.

Lecl5 and Lec35 are recessive CHO cell glycosylation mutants that are characterised, respectively, by defects in the synthesis and utilisation of Dol-P-Man. Lec35 mutant cells, due to their inability to utilise Dol-P-Man accumulate Man 5 GlcNAc2 -PP-Dol. Lec

15 mutant cells, which lack DPM2, one of the subunits of Dol-P-Man synthase, however express a functional Lec35 gene. They also accumulate Mar^GlcNAc 2 -PP-Dol, but can utilise Dol-P-Glc in order to add glucose residues to the terminal Man-al,2 residue of the LLO (Anand et al., 2001). The Lec35 gene is hence required for both

Dol-P-Man and Dol-P-Glc utilisation as Lec35 mutant cells are defective largely in the translocation of Dol-P-Man into the ER lumen and partially in the translocation of Dol-

P-Glc, in the C-linked mannosylation of tryptophan and in the synthesis of glycosylphosphatidylinositols (Camp et al., 1993; Doerrler and Lehrman, 2000;

Schachter, 2001).

A novel supressor of Lecl5 and Lec35 mutations (named SL15 for Supressor of Lecl5) was cloned from a CHO cDNA library by the functional expression in Lec35 cells by using phytohaemagglutinin/swainsonine selection. SL15 has two potential membrane spanning regions, has a predicted molecular weight of 26,693Da and a likely C-terminal

ER retention signal (Lys-Lys-Glu-Gln). Lecl5 mutant cells transfected with SL15 were shown to have normal levels of Dol-P-Man synthase activity in vitro and converted

MansGlcNAc 2 -PP-Dol to Man 9GlcNAc2 -PP-Dol in vivo. Interestingly, SL15 also corrected the defective mannosylation and glucosylation in Lec35 cells but showed a preference for Dol-P-Man over Dol-P-Glc. The SL15 protein, which did not have any

44 Chapter 1______Introduction apparent similarity to S. cerevisiae Dol-P-Man synthase (DPMI protein), was shown not to be an inhibitor of mannosyltransferases (Doerrler and Lehrman, 2000) and as yet, its function remains unknown.

The human Lec35 gene has been shown to encode the SL15 cDNA and has been mapped to chromosome 17pl2-pl3.1 (Anand et al., 2001). It has been designated as

MPDUl (Man-P-Dol utilisation defect 1) and its DNA sequence has been determined

(Anand et at., 2001).

45 Chapter 1 Introduction

1.6 CDG-II syndromes

CDG-II syndromes are characterised by a type-II isoelectric focusing pattem of serum transferrin (see Figure 1.12), in that in addition to increased di- and asialotransferrin there is also an increase in tri- and/or monosialotransferrin. CDG-II disorders are caused by defects in the processing of protein /V-linked glycans in the Golgi apparatus.

The processing defects identified to date are listed in Table 1.4:

CDG-II Enzymatic or protein defect Gene Patients Year

Ila UDP-GlcNAc:a-6 -D-mannoside p- MGAT2 2 1994 1,2-N-acetylglucosaminyltransferase II (GnT II) Ilb a-l,2-glucosidase I 1 2 0 0 0

lie GDP-fucose transporter - 4 2 0 0 1 (LAD II) (cytosol-Golgi)

Table 1.4: CDG-II: biochemical and molecular defects, number of patients and year identified

Dol-PP Protein CDG-IIb Protein Protein Protein

Protein Protein Protein CDG-IIa CDG-lIc """"

Figure 1.14 The processing defects in protein TV-linked glycans in CDG-II syndromes.

* = GlcNAc, Man, O = Glc, O = Gal, Neu5Ac, fucose

46 Chapter 1______Introduction

1.6.1 CDG-IIa- A^-acetylglucosaminyltransferase II deficiency

Two patients have been reported, an Iranian girl (Ramaekers et al., 1991) and a Belgian boy (Jaeken et al., 1993; Jaeken et al., 1994). The patients presented with facial dysmorphy (high forehead, low set ears, beaked nose), widely spaced nipples and both had a distinct stereotypic behaviour (tongue thrusting and hand-washing movements).

Psychomotor development was severely retarded, for example, the boy could only take a few steps at 7 years of age and his speech was limited to a few monotonous sounds at

1 0 years old.

Isoelectric focusing of serum transferrin showed an abnormal pattern that was different from that of CDG-I, in that tetrasialotransferrin was almost absent. There were low amounts of monosialotransferrin, only a moderate amount of trisialotransferrin and a large amount of disialotransferrin (Jaeken et al., 1994; Coddeville et al., 1998).

Carbohydrate analysis and high-resolution proton nuclear magnetic resonance (NMR) of glycans from the boy’s serum transferrin (Coddeville et al., 1998) showed that the major glycan was a truncated bi-antennary glycan, missing the terminal trisaccharide on one antenna (Coddeville et al., 1998). The structural analysis of protein JV-linked glycans suggested that the CDG-IIa patients had a deficiency of the Golgi-localised #- acetyl glucosaminyltransferase (GnT II) (see Figure 1.14). GnT II is a medial Golgi- type II transmembrane glycoprotein which catalyses the incorporation of a GlcNAc residue in P-1,2 linkage to the Man-a-1,6 arm of the iV-glycan core. The reaction catalysed by GnT II is an essential step in the formation of complex jV-glycans

(Komfeld and Komfeld, 1985; Schachter, 2001; Jaeken et al., 2001) and therefore, a deficiency of the enzyme prevents the formation of complex glycans and leads to the formation of truncated glycans with a single sialic acid.

47 Chapter 1______Introduction

As predicted, the GnT II activities in cultured fibroblasts from the two patients were reduced by over 98% (Jaeken et al., 1994) and there was no detectable GnT II activity in mononuclear cell extracts from the male patient (Charuk et al., 1995). The gene encoding human GnT II (MGAT2) has been cloned and localised to chromosome 14q21

(Tan et al., 1995). Both patients were found to be homozygous for different point mutations in the MGAT2 gene (Tan et al., 1996).

1.6.2 CDG Ilb-a-Glucosidase I deficiency a-Glucosidase I, is responsible for the removal of the terminal (al-2)-linked glucose residue from the protein A^-linked GlcsMangGlcNAci, immediately after the transfer of the oligosaccharide from its lipid-linked carrier to the nascent translocating polypeptide chain (Figure 1.14). The removal of this glucose residue is a highly specific processing step that cannot be performed by the other ER-resident a-glucosidase II. The deficiency of a-glucosidase I thus prevents any further processing interaction of the nascent gly copolypeptide with lectin-type chaperones such as calnexin and calreticulin and any further processing by a-glucosidase II and the a-mannosidases present in the ER.

To date, only one patient, a female bom to consanguineous parents (second cousins) has been identified to have a-glucosidase I deficiency (De Praeter et al., 2000). The patient presented with dysmorphic features, such as broad nose, high arched palate, overlapping fingers and hypoplastic genitalia and lung edema. She developed seizures at 3 weeks of age and artificial ventilation was necessary at 4 weeks of age. Her liver became increasingly large and subsequent morphological evaluation of the liver revealed fibrosis, fat accumulation and proliferation and dilation of bile ducts. Her seizures became more frequent and at 2.5 months of age, ten minutes after artificial ventilation

48 Chapter 1______Introduction was stopped, the patient died. This disorder has been classified as CDG-IIb since it involves a defect in a post-oligosaccharide transfer step (Jaeken et al., 2001; Marquardt and Freeze, 2001).

Initially, the finding of a normal isoelectric focusing pattem of semm sialotransferrin and P-trace protein in CSF made a diagnosis of CDG seem unlikely. Thin-layer chromatography (TLC) of the patient’s urine however, revealed a prominent abnormal carbohydrate-positive band that was not detected in controls. This compound was purified and analysis allowed the identification of the #-glycan fragment Glc(al-2)-

Glc(al-3)-Glc(al-3) Man, of glycoproteins (GlcgMan). The presence of this compound in the urine of the patient suggested a deficiency of a-glucosidase I. In this case,

GlcgMangGlcNAcz is not processed in the ER and therefore, the generation of the

GlcgMan tetrasaccharide must result from the endo-al,2 mannosidase activity in the

Golgi (De Praeter et al., 2000).

This hypothesis was confirmed using homogenates from liver tissue and cultured skin fibroblasts of the patient, which were shown to be unable to degrade either synthetic tetra-methyl-rhodamine (TMR)-labeled Glc(al-2 )-Glc(al-3 )-Glc(al-0 )-(CH2)s

COOCH3 (Figure 6.3) or the natural a-glucosidase I substrate [^"^C] Glc 3 Mau 5 GlcNAc2 , concluding that a-glucosidase I was deficient. a-Glucosidase I activity of the patient was reported to be <3% of the control value and cultured fibroblasts of the parents of the index case exhibited a phenotype that expressed approximately 50% of the enzyme activities compared to controls, indicating heterozygosity for this defect.

49 Chapter 1______Introduction a-Glucosidase I has been purified from various sources (Hettkamp et al., 1984; Bause et al., 1989; Schweden et al., 1986; Shailubhai et al., 1987) and the sequence of the full- length human a-glucosidase I cDNA comprises 288Ibp, encoding a polypeptide of 834 amino acids, corresponding to a protein with a molecular mass of ~92 kDa (Kalz-Fiiller et al., 1995). The a-glucosidase I gene has been localized to chromosome 2pl2-13

(Kalz-Füller et al., 1996). Molecular analysis of the full-length a-glucosidase I cDNA sequence isolated from fibroblasts showed that the patient was a compound heterozygote for a G ^ C transition resulting in the substitution of Arg at position 486 by

Thr (R486T) and for a T->C transition which resulted in the substitution of Phe by Leu at position 652 (F652L). The mother of the index case was found to be heterozygous for the R486T mutation and the father was shown to be heterozygous for the F652L mutation. All of these changes were also confirmed at the genomic level.

1.6.3 CDG IIc-GDP-fucose deficiency

Lübke et al (1999) reported a patient with a clinical phenotype resembling that of leukocyte adhesion deficiency type II (LAD II), which has previously been reported in five patients (Etzioni et al., 1995; Etzioni and Tonetti, 2000). All of the LAD II patients were reported with severe mental and growth retardation, dysmorphic features and recurrent infections with a high leukocyte count and without the formation of pus

(Etzioni et al., 1992; Frydman et al., 1992; Marquardt et al., 1999a). The immune defect in the patients was due to the absence of sialyl-Lewis X, a fucose-containing carbohydrate ligand for the selectin family of cell adhesion molecules required for the normal recruitment of neutrophils to sites of inflammation (Etzioni et al., 1995). Other fucose-containing carbohydrate sequences, for example A, B, O and Lewis A blood

50 Chapter 1______Introduction groups were also absent. LAD II was reported to be caused by the failure to convert

GDP-mannose to GDP-fucose, which resulted in the general deficiency of GDP-fucose, due to the inactivity of GDP-D-mannose-4,6-dehydratase (Sturla et al., 1998),

The investigations on the patient reported by Lübke et al (1999), revealed that although the clinical phenotype of the patient was similar to that seen in LAD II, the synthesis of

GDP-fucose was normal. The defect in this patient, designated as CDG lie, was found to be caused by the decreased import of GDP-fucose into Golgi-enriched vesicles, resulting in decreased fucosylation of glycoproteins (see Figure 1.14). Addition of L- fucose to the medium in which the patient’s fibroblasts were growing restored the fucosylation of glycoproteins and the defect was corrected. Oral fucose therapy was attempted on this patient (Marquardt et al., 1999b). Therapy resulted in a rapid improvement of fucosylation of the selectin ligands and other glycoproteins, in addition to an overall improvement in clinical condition, for example, fever and infections disappeared. Although oral fucose supplements were an effective treatment for this patient, it was ineffective in another patient with the same defect in the transport of

GDP-fucose (Sturla et al., 2001). Recently, Lübke et al (2001) and Luhn et al (2001) cloned the GDP-fucose transporter gene and identified the presence of mutations in patients with impaired import of GDP-fucose into Golgi vesicles.

51 Chapter 1______Introduction

1.7 Other disorders of protein glycosylation

The altered glycosylation of glycoproteins is not unique to the CDG syndromes and

LAD II. It has been reported in a number of other diseases, including hereditary erythroblastic multinuclearity with a positive acidified-serum lysis test; congenital dyserythropoietic anaemia type II (HEMPAS), hereditary fructose intolerance, galactosaemia and chronic alcoholism (Fukuda et al., 1999; Gitzelmann et al., 1989;

Van Pelt et al., 1996; Landberg et al., 1995). The liver is one of the organs most affected in all of the mentioned disorders including CDG. This is probably due to the fact that the liver is the major organ in the synthesis and degradation of serum glycoproteins.

52 Chapter 1______Introduction

1.8 Aims of the thesis

The overall aim of this thesis was to identify the biochemical and genetic basis of the disease in 21 patients from 19 families, who have clinical symptoms and the characteristic aberrant isoelectric focusing pattem for serum transferrin of CDG type I.

This involved:

1) The assay of phosphomarmomutase (PMM) and phosphomannose isomerase (PMI)

activities in fibroblasts from the patients to identify those with a deficiency of PMM

(CDG-Ia) and PMI (CDG-Ib).

2) Confirmation of the basis of the deficiency of PMM in the CDG-Ia patients by

mutation analysis of the PMM2 gene and investigation of any correlation between

the clinical severity of the disease with residual enzyme activity and genotype.

3) Confirmation of the basis of a deficiency of PMI in a CDG-Ib patient by mutation

analysis of the MPI gene.

4) Confirmation of the molecular basis of a CDG-Ic patient by mutation analysis of the

hALG6 gene.

5) Investigation of defects in other enzymes involved in LLO synthesis, including

GDP-mannose pyrophosphorylase, dolichol phosphate mannose synthase, and

glutamine: fructose- 6 -phosphate amidotransferase, or processing of glycoproteins

(a-glucosidase I) to identify the plausible basic biochemical defects in CDG-Ix

patients.

6 ) Investigation of the possibility of mutations in the PMMl gene in CDG-Ia and Ix

patients to delineate the basis of the neuro-degenerative effects.

7) Establishment of a reversible chemically induced phenocopy of CDG-I by the

characterisation of inhibitors of PMM.

53 Chapter 2______Materials & Methods ______General

Chapter 2

Materials and Methods

2.1 Cell culture

All procedures were carried out under sterile conditions. Cell culture reagents and disposable, sterile plastic-ware, were obtained from Gibco-BRL™ and Falcon, respectively, unless otherwise stated.

2.1.1 Tissue Culture Media

2.1.1.1 Ham’s FIO growth medium

Ham’s FIO medium (500 ml) containing 146 mg/L of L-glutamine was supplemented with 50 ml of fetal calf serum (FCS, Imperial Laboratories) and 5 ml of penicillin/streptomycin (1 mg/ml). This growth medium was used for the routine nourishment of fibroblast cell cultures. Once prepared, the medium was stored for up to one month at 4°C.

2.1.1.2 RPM I1640 growth medium

RPM I1640 growth medium (500 ml) was supplemented with 73 mg of L-glutamine, 50 ml of fetal calf serum (FCS, Imperial Laboratories) and 5 ml of penicillin/streptomycin

(1 mg/ml). This growth medium was used for the routine growth of lymphoblastoid cell cultures. Once prepared, the medium was stored for up to one month at 4°C.

54 Chapter 2______Materials & Methods ______General

2.1.2 Cell culture conditions

2.1.2.1 Fibroblasts

Fibroblast cell lines were obtained in the form of ampoules of cells in liquid nitrogen or as a growing cell culture, which had been established from a skin biopsy by the Enzyme

Laboratory at Great Ormond Street Hospital.

Fibroblasts were grown as monolayers in tissue culture flasks, which had a surface area of 25, 75 or 175 cm^ and contained 4, 10 or 30 ml of Ham’s FIO growth medium, respectively. Flasks were incubated at 37 °C with a 5% (v/v) CO 2 atmosphere in an incubator. The growth medium was replaced twice a week and the cells in each flask were sub-cultured, harvested or stored in liquid nitrogen, depending on their confluency, validated by phase contrast microscopy.

To sub-culture, harvest or store in liquid nitrogen, the fibroblasts were removed by trypsinisation. This was carried out by initially removing the spent medium and washing the cell monolayer with 5-10ml of phosphate buffered saline (PBS). The PBS was removed and the cells were incubated with 2 ml of sterile trypsin solution (Porcine,

0.5 g trypsin and 0.2 g EDTA per litre) for 5-10 min at 37°C. The cells were detached by gently tapping the sides of the flask. For sub-culturing, the detached cells were divided into two new flasks and 4, 10 or 30 ml of growth medium were added, depending on the size of the flask. For harvesting or storage in liquid nitrogen, 5 ml of growth medium were added to the flask containing the detached cells, which was then transferred to a sterile 15 ml Falcon tube. The tube was centrifuged at 2000 x g for 5 min. The medium was removed and the resultant cell pellet washed twice with 2ml of

PBS. To harvest the cells, 50 pil of water was added and the cells were either used

55 Chapter 2______Materials & Methods ______General immediately or the tube containing the ceils was shock-frozen in liquid nitrogen and stored at -70°C for subsequent analysis. Cells for storage in liquid nitrogen were carefully resuspended in 1 ml of ice-cold growth medium containing 1 0 % (v/v) dimethylsulphoxide (DMSO). The suspension was divided into two sterile plastic ampoules (Nalgene Nunc International), which were then immediately placed into a

Nalgene Cryo 1°C freezing container, which was stored at -70°C overnight. This method allowed the cells to be frozen slowly, which helps to prevent cell damage.

Finally, the ampoules were immersed in liquid nitrogen for storage.

2.1.2.2 Lymphoblastoid cells

Lymphoblastoid cells, which had been established previously by Paul Rutland at the

Institute of Child Health, were grown in suspension using 10 ml of RPMI 1640 growth medium in 75 cm^ flasks. Flasks were incubated at 37°C with a 5% (v/v) CO 2 atmosphere. The growth medium was changed twice a week.

For sub-culturing, half of the lymphoblastoid cells from one tissue culture flask were transferred to a new flask with 10 ml of fresh growth medium added to each flask. For harvesting and storage in liquid nitrogen, the cells were transferred into a sterile 15 ml

Falcon tube and centrifuged at 2000 x g for 10 min. The medium was removed and the cell pellet was washed twice with 2 ml of PBS. To harvest the cells, 50 pi of water was added and the cells were either used immediately or the tube containing the cells was shock-frozen in liquid nitrogen and stored at -70°C for subsequent analysis. Cells for storage in liquid nitrogen were carefully resuspended in 1ml of RPMI 1640 growth medium containing 10% (v/v) DMSO at 0°C. The suspension was divided into two sterile plastic ampoules (Nalgene Nunc International), which were then immediately

56 Chapter 2______Materials & Methods ______General placed into a Nalgene Cryo 1°C freezing container, which was stored at -70°C overnight. Finally, the ampoules were immersed in liquid nitrogen for storage.

2.1.2.3 Reconstitution of cells stored in liquid nitrogen

Fibroblast and lymphoblastoid cells stored in ampoules were removed from liquid nitrogen and were thawed quickly in a 37°C water bath. The cells were immediately transferred to a 25 cm^ flask containing 5ml of respective growth medium and were incubated at 37°C in an incubator for one hour. After one hour, 5 ml of new medium was added to the flask and the cells were grown as described previously.

2.1.2.4 Detection of mycoplasma

Fibroblast cells were routinely screened for mycoplasma contamination. The cells were grown for 5 days on a glass coverslip in a cell culture dish (25 cm^) containing 5 ml of cell culture medium. The cells were fixed using 5 ml of methanol: acetic acid (1:3) for 2 min. This solution was removed and 5 ml of fresh methanol: acetic acid (1:3) was added for 5 min. This step was repeated again twice and the cells were allowed to air-dry. The cells were stained with 4’, 6-diamidino-2-phentindole (DAPI, 50 fxg/ml) in PBS for 30 min. The cells were then rinsed twice with water and mounted on a microscope slide.

Mycoplasma contamination was detected using a fluorescent microscope with a 53/44- barrier filter and a BG-3 exciter filter. Flasks affected by mycoplasma contamination gave a punctate fluorescence. Contamination was treated by including Mycoplasma

Removal Agent (ICN, 1% (v/v)) in the growth medium until the fluorescence disappeared.

57 Chapter 2______Materials & Methods ______General

2.2 Biochemical and enzymological assays

The enzyme assays described in this section were used for the diagnosis of CDG-Ia and

Ib patients. They were also used for the inhibitor studies described in Chapter 8 .

All the chemicals and enzymes were obtained from Sigma, apart from phosphoglucomutase (Boehringer) and mannose- 1,6-bisphosphate, which was synthesised as described in section 2.2.3. The assays were carried out using a Perkin

Elmer LS 50 fluorimeter with four quartz cuvettes, which were thermostatically controlled at 30°C by a circulating water bath. The fluorimeter was calibrated each day using a freshly prepared standard solution of NADH, the concentration of which was determined by measuring the absorbance at 340 run using a CECIL CE2021 spectrophotometer.

2.2.1 Preparation of samples

Cultured fibroblasts or lymphoblastoid cells were harvested by trypsinization and sonicated in 50|xl of water for 10 s at an amplitude of 6 microns in an MSE-Soniprep

150. The sonicated cells were centrifuged for 5 min at 10,000 x g and the supernatants diluted to the appropriate concentration of protein, which was determined using the method described in section 2 .2 . 2 before being used for the enzyme assays.

58 Chapter 2______Materials & Methods ______General

2.2.2 Protein Determination

The protein concentration was determined according to the method described by Smith et al (1985). The protein concentration of the cell supernatants prepared as described in section 2.2.1, was determined by constructing a standard curve using 5-50 pg bovine serum albumin (BSA) in 50 pi of distilled water (0.1-1 mg/ml). Samples containing 5 or

10 pi of cell supernatants in 50 pi of distilled water were assayed in parallel with the standards by the initial addition of 1 ml of bicinchoninic acid (BCA, Sigma). All assays were incubated at 37°C for 10 min in order to solubilise the protein. 20 pi of 4% (w/v)

CUSO4 .5 H2 O was added to the reactions, which were incubated for a further 20-25 min at 37°C. The absorbance of each assay mixture was measured at 562 nm using a CECIL

CE2021 spectrophotometer. The protein concentration of the cell extracts was calculated from the standard curve and expressed as mg/ml.

For the measurement of protein concentration below this range, the BSA standard curve was constructed over the range of 0.01-0.1 mg/ml. This method was carried out as before but the incubation at 60°C was prolonged for 45 min.

2.2.3 Synthesis of mannose-1, 6-bisphosphate

Mannose-1, 6-bisphosphate was prepared as described by Van Schaftingen and Jaeken

(1995). The reaction mixture mix was prepared using (final concentration) 0.3 mM mannose 1-phosphate with 0.2 mM glucose-1, 6 bisphosphate, 5 pg/ml glucose-6- phosphate dehydrogenase (Boehringer), 0.25 mM NADP (Boehringer), 1 mM dithiothreitol (DTT) and 5 mM MgCli in 50 mM Hepes buffer (pH 7.1). The total reaction volume was 1 ml. The mixture was incubated at 30°C for 1 hour and the

59 Chapter 2______Materials & Methods ______General reaction was stopped by placing the sample tube in a boiling water bath for 5 min. The initial (pre-incubation) and final (post-incubation) absorbance of the mixture was measured at 340 nm on a CECIL CE2021 spectrophotometer. This was carried out to estimate the final concentration, with a change in absorbance of 0 .6 , corresponding approximately to a concentration of 1 0 0 pM of mannose- 1 , 6 -bisphosphate synthesised.

2.2.4 Phosphomannomutase, phosphomannose isomerase and phosphoglucomutase assays

22 patients from 20 U.K families were investigated in total. The specific activities of phosphomannomutase (PMM, EC 5.4.2.28) and phosphomannose isomerase (PMI, EC

5.3.1.8) were measured for the identification of CDG-Ia andlb sub-types, respectively.

Cultured fibroblasts or lymphoblastoid cells were prepared as described in section 2.3.1 for the assay of PMM, PMI and phosphoglucomutase (PGM, EC 5.4.2.2.) activities. The

PGM, PMM and PMI assays are all enzyme-coupled reactions with the glucose- 6 - phosphate dehydrogenase/NADPH system as the final step. They were assayed as described by Van Schaftingen and Jaeken (1995), except that the rate of production of

NADPH was measured fluorimetrically using an excitation wavelength of 340 nm and emission wavelength of 460 nm (Charlwood et al., 1997; Charlwood et al., 1998). The incubation temperature for each assay was 30°C and the assays were carried out in a total reaction volume of 500 pi. PMM and PMI activities were measured diagnostically by the Enzyme Laboratory at Great Ormond Street Hospital.

60 Chapter 2______Materials & Methods ______General

PMM Mannose-l-P ^ Mannose-6-P

mannose- 1 ,6 - A bisphosphate PMI

1 Fructose-6-P A glucose- 1 ,6 - PGI bisphosphate Glucose-6-P

NADP+ Glucose-6-phosphate dehydrogenase NADPH V 6-Phosphogluconate

Figure 2.1 Schematic diagram of measurement of PMM and PMI activities in fibroblasts

Solutions

The following stock solutions were freshly prepared in Hepes buffer, pH 7.1:

Hepes Buffer, pH 7.1 50 mM Hepes, 5 mM MgCli, pH 7.1 Mannose-l-phosphate (Man-l-P) 2 mM Glucose-1 -phosphate (Glc-l-P) 5 mM NADP 2.5 mM Phosphoglucose isomerase (PGI) 100 ng/ml Phosphomannose isomerase (PMI) 35 pg/ml Glucose-6-phosphate dehydrogenase 100 pg/ml (20 pg/ml for PMI assay) Mannose-1, 6-bisphosphate (M-1-6-P) 100 pM Glucose-1, 6 bisphosphate (Glc-1, 6-P) 10 pM

A reagent mix of a total volume of 2500 pi containing the appropriate components (see

Table 2.1) for each enzyme assay was prepared and 250 pi was added to each reaction

61 Chapter 2 Materials & Methods General tube. For the PMM and FMI assays, 25 fxl of cell extract was added to the reaction tube, prior to the addition of the substrate. The total reaction volume was made up to 500 pi with 50 mM Hepes buffer (pH 7.1) and the mixture was pre-incubated for 20 min at

30°C. This pre-incubation stage was required in order to remove any endogenous substrates from the reactions. The assays were started by the addition of the appropriate substrate. The PGM assay was pre-incubated for 10 min and started by the addition of 5 pi of cell extract. All assays were carried out in the presence and absence of substrate and a reagent blank was also measured. The rate of reaction was measured by reading the fluorescence at 2, 5 or 10 min intervals over specific time periods and by plotting a graph of net fluorescence over time. The change in fluorescence over time was calculated using the linear section of the plotted line. All of the conditions for each enzyme assay described are summarised in Table 2.1.

Enzyme Assay PMM FMI PGM (final concentration) (final concentration) (final concentration) Substrate (+/-) O.lmM (+/-) 0.5 mM (+/-) 0.5 mM Man-l-P Man- 6 -P Glc-l-P Co-factor 2 pM mannose 1,6 none 1 pM glucose 1,6 bisphosphate bisphosphate phosphoglucose 1 0 pg/ml 1 0 pg/ml - isomerase

phosphomannose 3.5 pg/ml - - isomerase NADP 0.25 mM 0.25 mM 0.25 mM MgCh 5 mM 5 mM 5 mM glucose-6- 1 0 pg/ml 2 pg/ml 1 0 pg/ml phosphate dehydrogenase Cell extract 25 pi 25 pi 25 pi Pre-incubation 2 0 min 2 0 min 1 0 min Reaction time 60 min 2 0 min 15-20 min

Table 2.1: Experimental conditions for the assays of PMM, PMI and PGM

62 Chapter 2______Materials & Methods ______General

2.3 Molecular biology

2.3.1 RNA Extraction

The SV Total RNA Isolation System (Promega) was used for the preparation of purified and intact RNA from cultured fibroblasts. To isolate RNA efficiently, four essential steps are required; the effective disruption of cells or tissue, dénaturation of nucleoprotein complexes, inactivation of endogenous ribonuclease (RNase) activity and finally, the removal of contaminating DNA and proteins.

2.3.1.1 Harvesting of adherent cells

Solutions

PBS buffer, IX 11.5 g Na 2 HP0 4 , 2g KH2PO4, 80g NaCl, 2g KCl (in 11 of sterile de-onised water) Trypsin-EDTA solution trypsin (0.05%, w/v) in 1 X PBS containing 0.53 mM EDTA

The cultured fibroblasts were washed with ice-cold sterile IX PBS and after the removal of the PBS, 2 ml of trypsin solution was added to the 75 cm^ flask to cover the cell monolayer. The flask was incubated at 37°C until the cells just began to detach (1-2 min), after which the trypsin solution was removed and the bottom and the sides of the flask were struck to dislodge the remaining adherent cells. 5ml of Ham’s FIO culture media (Gibco-BRL™) were added to the flask and the cell suspension was transferred to a sterile 50 ml Falcon tube, which was centrifuged for 10 min at 500 x g. The supernatant was removed and 5 ml of ice-cold sterile PBS was added to resuspend the pellet. To ensure that 1.5x10^-5x10^ cells were collected from the harvesting procedure, which is the amount of cells required for the RNA extraction, the number of cells

63 Chapter 2______Materials & Methods ______General present in the cell suspension was estimated. 100 pil of Tryphan Blue was added to 200 pi of the cell suspension and the number of cells counted using a haemocytometer.

2.3.1.2 Lysis of cultured cells

Solutions SV RNA Lysis Buffer 4M guanidine thiocyanate (GTC), O.OIM Tris (pH 7.5) containing P- mercaptoethanol (0.97%, v/v)

The cell suspension (Section 2.3.1.1) was resuspended in 20 ml of ice-cold 1 X PBS and centrifuged at 500 x g for 5 min to collect the cells. The supernatant was discarded and

175 pi of SV RNA Lysis Buffer (with (3-mercaptoethanol added) were added to the washed cells and the tube was mixed by vortexing. GTC and P-mercaptoethanol were present to inactivate the ribonucleases present in the cell extract. The cells were then passed through a 20-gauge needle (5 times) to shear the genomic DNA and then the lysate was placed into a fresh 1.5 ml microfuge tube. 350 pi of SV RNA Dilution

Buffer were added to the lysate, which was mixed by inverting the tube 3-4 times. The tube was incubated at 70°C for 3 min and centrifuged at 12,000 x g for 10 min at room temperature.

2.3.1.3 RNA purification by centrifugation

Solutions SV RNA Wash Solution 60mM potassium acetate, lOmM Tris-HCl (pH 7.5 at 25°C), ethanol (60%, v/v) SV DNAse Stop Solution 2M guanidine isothiocyanate, 4mM Tris- HCl (pH 7.5), ethanol (57%, v/v)

64 Chapter 2______Materials & Methods ______General

Yellow Core Buffer 0.0225M Tris (pH 7.5), 1.125M NaCl, yellow dye (0.0025%, w/v)

The clear lysate solution was transferred to a fresh microfuge tube by pipetting to avoid disturbing the pelleted debris. 200 pi of 95% ethanol were added to the lysate to selectively precipitate the RNA The solution was mixed by aspirating 3-4 times and transferred to the Spin Column Assembly (Promega), containing a Spin Basket, and centrifuged at 12,000 x g for 1 min. During centrifugation, the precipitated RNA binds to the silica surface of the glass fibers found in the spin basket. After centrifugation, the

Spin Basket was removed from the Spin Column Assembly and the liquid in the

Collection Tube was discarded. The Spin Basket was placed back into the Collection

Tube and 600 pi of SV RNA Wash Solution were added to the Spin Column Assembly and centrifuged at 12,000 x g for 1 min. The Collection Tube was emptied as before.

For each RNA isolation performed, a DNase incubation mix was prepared by combining (in this order) 40 pi of Yellow Core Buffer, 5 pi of 0.09 M MnCh and 5 pi of DNase 1 enzyme per sample in a sterile tube and was mixed gently by pipetting.

50 pi of the freshly prepared DNase incubation mix were applied directly to the membrane inside the Spin Basket, ensuring that the solution was thoroughly covering the membrane. The Spin Column Assembly was incubated at 20-25°C for 15 min.

After incubation, 200 pi of SV DNase Stop Solution was added to the Spin Basket, which was then centrifuged at 12,000 x g for 1 min. 600 pi of SV RNA Wash Solution was added and the Spin Column Assembly was centrifuged again at 12,000 x g for 1 min. The Collection Tube was emptied and 250 pi of SV RNA Wash Solution was

added and centrifuged at high speed for 2 min. The cap was removed from the Spin

Basket, which was then transferred to a separate, labeled Elution Tube (Promega) to

65 Chapter 2______Materials & Methods ______General which 100 pil of Nuclease-Free water was added to the membrane. The Spin Basket

Assembly was centrifuged at 12,000 x g for 1 min to elute the purified RNA from the

Spin Basket. The eluted solution of RNA was stored at -70°C until analysis.

2.3.1.4 Determination of RNA yield and purity

The yield and purity of the total RNA obtained were determined spectrophotometrically from the relative absorbances (A) at 230, 260 and 280 nm. Pure RNA usually exhibits an A 26 0 /2 8 0 ratio of around 2.0 and using the SV Total RNA Isolation System the expected range of A 2 6 0 /2 8 0 ratios for RNA is 1.7-2.1 when there is little contaminating protein. A 2 6 0 /2 3 0 ratios were also used to estimate the RNA yield, as RNA usually exhibits a ratio of 1.8-2.2.

The concentrations of the prepared RNA solutions were determined using a 1 in 100 dilution of the RNA in distilled water by measuring the absorbances at 260 nm/280 nm and 260 nm/230 nm using a GeneQuant spectrophotometer (Pharmacia).

2.3.2 First-strand cDNA synthesis

First-strand cDNA was synthesized from RNA isolated as described in Section 2.3.1, the addition of 100 pmol/pl of random 9mer primer (degenerate sequence) to 12.5 pi of

RNA in a 0.5 pi Eppendorf tube, which was incubated at 70°C for 10 min and then immediately placed on ice. 4 pi of 5X strand buffer (250 mM Tris-HCl-pH 8.3, 375 mM KCl, 15 mM MgCli), 2 pi of 0.1 mM DTT and 0.5 pi of 20 mM dNTPs were added to the reaction mix, which was incubated at 42°C for 2 min. 1 pi of Superscript II

Rnase Reverse Transcriptase (RT, Life Technologies) was added and the reaction mix was incubated at 42°C for 50 min and for a further 15 min at 70°C, in order to inactivate

6 6 Chapter 2______Materials & Methods ______General the reverse transcriptase. To ensure that there was no contaminating DNA, a similar reaction without the addition of RT was also carried out for each RNA sample. A negative control was also performed using 12.5 \i\ of water instead of RNA. All of the reactions were stored at -20°C until further use.

2.3.3 Preparation and extraction of genomic DNA from fibroblasts and whole blood samples.

Genomic DNA was extracted from fibroblasts and whole blood using a method, which involves the salting out of cellular proteins, by dehydration and precipitation using saturated ammonium acetate (Miller et al., 1988).

Solutions Nuclei lysis buffer 10 mM Tris-HCl, 400 mM NaCl, 2 mM Nai- EDTA (stored at 4°C) Proteinase K solution 2 mg/ml of fungal proteinase K (BDH) in 2 mM

Na2 -EDTA, 1% (w/v) SDS (stored at 4°C)

Saturated ammonium acetate 148 g of ammonium acetate in 100 ml of H 2O

Whole blood samples were collected in EDTA-coated tubes and stored at -70°C.

Uncapped EDTA-coated tubes, which contained approximately 10 ml of frozen blood, were inverted over 50 ml Falcon tubes. The blood was allowed to defrost at room temperature for approximately 45 min. The red blood cells were lysed by adding ice- cold water to the tubes to give a final volume of 50 ml. The tube was shaken and centrifuged at 2300 rpm for 20 min at 4°C in an lEC CENTRA-7R centrifuge. The supernatant was decanted and the nuclear pellet washed with 25 ml of 0.1% (v/v)

Nonidet P40 (NP40, Sigma) to disrupt the cell membrane. The pellet was vortexed until

67 Chapter 2______Materials & Methods ______General completely resuspended and centrifuged for 20 min at 4°C. The supernatant was discarded and the intact nuclear pellet was lysed with 3 ml of nuclei lysis buffer by resuspending with a sterile plastic pipette. 200 |^1 of 10% (w/v) SDS and 600 \i\ of

Proteinase K solution were added to the resuspended pellet and then vortexed. The sample was incubated in a water bath for 1-2 h at 60 °C or overnight at 37 °C. 1 ml of saturated ammonium acetate was added to precipitate the proteins and the tube was vortexed for 15 s and allowed to stand at room temperature for 10-15 min before centrifugation at 2300 rpm for 20 min at room temperature. The supernatant was transferred into a separate tube and the DNA was precipitated by the addition of 2 volumes (approximately 10 ml) of absolute ethanol. The contents of the tube were mixed gently by inversion and the DNA threads were spooled out on the tip of a sealed glass Pasteur pipette. The DNA was transferred to a 1.5 ml Eppendorf tube containing 1 ml of distilled water and placed on a rotor overnight to dissolve the DNA. The DNA was stored at -20°C.

Genomic DNA was also extracted from frozen fibroblast cell pellets using the same method as described for whole blood but beginning at the stage of addition of nuclei lysis buffer and the volumes of the solutions used were scaled down to one-tenth of those used in the extraction from blood. The spooled DNA was dissolved in 200-500 \i\ of distilled water and stored at -20°C.

2.3.4 Measurement of concentration of DNA

The concentrations of the prepared DNA solutions were determined using a 1 in 100 dilution of the DNA in distilled water by measuring the absorbance at 260 nm using a

GeneQuant spectrophotometer (Pharmacia). One absorbance unit is considered to be

68 Chapter 2______Materials & Methods ______General equivalent to 50 ng/jxl of double stranded DNA or 37 ng/pil of single stranded DNA.

This calculation is based on the assumption that DNA contains approximately equal amounts of purine and pyrimidine bases (Sambrook et al., 1989). The purity of the

DNA was estimated by determining the ratio of absorbance at 260 and 280 nm, where a ratio of between 1.8 and 2 indicated a pure preparation of DNA, with little contaminating protein.

2.3.5 Amplification of genomic DNA by the Polymerase Chain

Reaction (PGR)

2.3.5.1 PCR conditions

(template), 25 pmol of each of the sense and antisense primers, 1-1.5 mmol/1 of MgC^,

0.2 mmol/1 dATP, dCTP, dGTP and dTTP, 1 x ammonium reaction buffer (160 mM

(NH4 )2 SO4 , 0.67 M Tris-HCl (pH 8.8), 0.1 % (v/v) Tween-20, 50 mM MgCli) and 0.5 pi (2.5 units) of BioPro DNA Polymerase (Bioline). Each reaction was overlaid with 30 pi of mineral oil to minimise evaporation. Amplification was carried out on a Biometra

TRIO-Thermoblock. A reaction containing all of the components of the reaction mix but without DNA template was prepared as a control to check for possible contamination.

69 Chapter 2______Materials & Methods ______General

Typical cycling conditions were 10 min at 9^C, with the Taq DNA polymerase added after a “hot start”, followed by 32-35 cycles of amplification in 3 stages: 1) dénaturation of the double-stranded DNA template for one min at 96°C; 2) annealing of the primers to the complementary DNA strands at a temperature, depending on their composition

(Table 4.2), one min at 58 - 68°C; 3) extension of the DNA template copy by the 5’ to

3’ activity of the Taq DNA polymerase for one min at ITC and a final extension at

72°C for 10 min, to ensure that elongation was complete.

2.3.5.2 Analysis of PCR products by agarose gel electrophoresis

Solutions

1 X Tris Borate EDTA (TBE) buffer 45 mM Tris-HCl, 45 mM boric acid, 10 mM Naz-EDTA, pH 8.0 Loading dye 2.5 ml dHzO, 2.5 ml glycerol, 0.1 M EDTA, Sigma orange dye

The PCR products were analysed by agarose gel electrophoresis to determine the specificity of amplification and size of the product. A 1.5% (w/v) agarose gel was prepared in 100 ml of TBE containing Img/ml ethidium bromide. The gel was poured into a 8x10 cm minigel system tray (GNA-100, Pharmacia) containing combs and allowed to set at room temperature for 1-2 h. The agarose gel tray was placed in an electrophoresis tank (Pharmacia) containing 1 X TBE buffer.

5 p,l of the PCR product was mixed with 2 pi of the loading dye and loaded into the wells of the agarose gel. A 100 bp ladder (Gibco-BRL) was loaded in the first lane as a molecular weight marker. Electrophoresis was carried out at 100 V for 30 min to 1 h.

70 Chapter 2______Materials & Methods ______General depending on the size of the PCR product. After electrophoresis, the bands on the gel were visualised on an ultra-violet (UV) transilluminator and photographed using a

Mitsubishi videocopy processor.

The bands from each PCR product were analysed and if a clear distinct band for each

DNA template was not produced, the reaction conditions were altered to optimize the

PCR reaction. Alterations of conditions included; 1) increasing the annealing temperature of the reaction, 2) varying the concentration of MgCb and 3) increasing or diluting the concentration of the DNA template in the reaction mixture.

2.3.6 Single Strand Conformation Polymorphism (SSCP) Analysis

SSCP analysis (Orita et al., 1989; Hayashi et al., 1991) was carried out to detect sequence changes in DNA amplified for specific genes by PCR. Such changes may alter the mobility of single-stranded DNA compared to wild type during electrophoresis through a non-denaturing polyacrylamide gel. Primary sequence differences alter the intramolecular interactions that generate a three-dimensional folded structure.

2.3.6.1 Sample preparation

Solutions

Denaturing solution 95% (w/v) deionised formamide, 0.05% (w/v) bromophenol blue, 0.05% (w/v) xylene cyanol and 20 mM EDTA

Genomic DNA of patients was amplified by PCR as described in section 2.3.5.1 and prior to electrophoresis, 5 fxl of PCR product was mixed with 2 pi of denaturing

71 Chapter 2______Materials & Methods ______General solution. The samples were denatured for 4 min at 94°C and immediately placed on ice before loading onto the gel.

2.3.6 2 Preparation of polyacrylamide gels

Two glass plates (44 x 33 cm and 39 x 33 cm) were carefully washed with Alconox™ detergent, rinsed with tap water and wiped with 70%(v/v) ethanol and twice with absolute ethanol to dry the plates. One side of the smaller plate was coated with

Sigmacote® siliconising fluid (Sigma) in the fume hood where it was allowed to dry for approximately 10 min. Silinisation ensured that the gel remained bound to the larger plate during plate separation after electrophoresis. The glass plates were assembled by placing them together with 0.4 mm spacers were inserted between the sides of the plates to separate them. The plates were placed horizontally on a flat surface and clamped with bulldog binder clips to secure them.

A non-denaturing polyacrylamide gel was prepared by mixing 30 ml of MDE™ Gel

Solution (FMC Bioproducts), 6 ml of 5x TBE and 24 ml of dH20. 300 pi of 10% (w/v)

ammonium persulphate and 30 pi of TEMED (N,N,N’,N’-tetramethylethylenediamine) were added to the mixture to induce polymerisation. The gel was poured immediately between the two horizontal plates. The straight edge of a shark’s toothcomb was

inserted at the top of the gel and clamped into position. The gel was allowed to polymerise for 1-2 h.

2.3.6 3 Gel electrophoresis

Electrophoresis was carried out in a model S2 Sequencing Gel System (Gibco-BRL).

500 ml of 0.5 X TBE was poured into the bottom reservoir of the apparatus and the

72 Chapter 2______Materials & Methods ______General bulldog clips were removed from the plates. The plates were clamped vertically to the gel tank and the upper reservoir was filled with 500 ml of 0.5 x TBE. The comb was removed and the top of the plate was washed in order to remove any unpolymerised acrylamide. The shark’s toothcomb was inserted to form wells and each well was washed with 0.5 x TBE. 3\i\ of sample was loaded in a well and electrophoresis was carried out overnight at 4°C at 15W.

2.3.6 4 Silver staining

This procedure was carried out as described by Bassam et al (1991). After electrophoresis, the plates were separated and the gel was transferred onto 3MM

Whatman paper and then immersed in a tray containing 10% (v/v) ethanol for 5 min to fix the DNA. The gel was rinsed with dHiO and then oxidised for 3 min with 1% (v/v) nitric acid. The gel was rinsed with dH20 before being impregnated with 0.012 M silver nitrate for 20 min. The gel was rinsed thoroughly with dH%0 and developed with 0.28

M sodium carbonate, 0.019% (v/v) formaldehyde until the bands appeared.

Development was stopped, when the bands were dark enough, by the addition of 10%

(v/v) acetic acid for 2 min. The gel was rinsed again with dH20 and was shrunk by treatment with 50% ethanol for 15-30 min. The gel was transferred to 3MM Whatman paper, covered with cling film and dried under a vacuum at 80°C for 1-2 h.

73 Chapter 2______Materials & Methods ______General

2.4 Sequencing

2.4.1 Purification of PCR products

DNA from the PCR reactions was purified by spin-column chromatography before sequencing to remove enzyme and buffer components, dNTPs and excess primers. For each sample to be purified, 15 jxl of PCR product and 450 \û of double-distilled water

(ddH20) were mixed and pipetted onto a separate MICROCON™-100 column

(Amicon), which was inserted into a sample reservoir. The column was sealed and centrifuged at 2500 rpm for 20 min in a Sigma 113 microfuge. The eluant was discarded and the column was washed with 400 pil of ddHzO and centrifuged again at 2500 rpm for 20 min or until all of the ddHzO had passed through the colunrn. Purified DNA was obtained by inverting the column into a new collection tube, which was centrifuged at

3500 rpm for 4 min. The eluted, purified DNA solution was made up to a total volume of 10 pi using dH20. 1 pi of the purified DNA was mixed with 4 pi dH20 and 2 pi of loading dye and subjected to electrophoresis at 100 V for 30 min in a 1.5% agarose gel

(see section 2.3.3.2) to quantify the concentration of the purified DNA, which was stored at -20°C until use.

2.4.2 Direct automatic sequencing of PCR-products

DNA sequencing of the purified PCR samples was carried out using cycle sequencing.

Cycle sequencing is a method, which comprises successive rounds of dénaturation, annealing and extension in a thermal cycler, which results in the linear amplification of extension products. The fluorescence of four different dyes attached to the target sequence are used to identify the A, G, C and T extension reactions. Each dye emits

74 Chapter 2______Materials & Methods ______General light at a different wavelength when excited by laser light. All four colours and hence all four extension reactions can be detected and analyzed in a single gel lane, using the

ABI 377 Automated DNA Sequencer (Applied Biosystems). The peaks corresponding to the bases in the sequence of the patient samples were compared to the data for the normal control sequence, for each exon, to detect base alterations, indicating the presence of possible mutations. In dye primer labeling, primers are tagged with four different fluorescent dyes and the extension products are generated in four separate base-specific reactions. The products of these four reactions are combined after cycle sequencing and are loaded into a single lane on a polyacrylamide gel.

With Dye-Terminator labeling (Perkin-Elmer Applied Biosystems), each of the four- dideoxy terminators (ddNTPs) is tagged with a fluorescent dye. Thus, the growing chain is simultaneously terminated and labeled with the dye that corresponds to that base. There are a number of advantages of using dye-labeled terminators, for example, an unlabeled primer can be used and the four sequencing reactions are performed simultaneously in one tube. As with dye-labeled primer reactions, the four coloured dye-labeled reactions are loaded in a single gel lane.

2.4.3 Dye primer sequencing using the M13 (-21) and M13 reverse dye primers

Exons synthesised with the M13 (-21) and M13 Reverse dye primers were sequenced using the Perkin-Elmer Applied Biosystems Dye Primer Sequencing Kit. All of the four

Ready Reaction mixes for this method contained dNTPs, Tris-HCl (pH 9.0 at 25°C),

MgClz, thermally stable pyrophosphatase, AmpliTaq DNA Polymerase and a differently labeled dye primer, either M13 (-21) (forward) or M13Rev (reverse). In addition, the

75 Chapter 2______Materials & Methods ______General reaction mixes contained ddATP along with JOE dye label (green), ddCTP along with

FAM dye label (blue), ddCTP along with TAMRA dye label (black) or ddTTP along with ROX dye label (red). JOE, FAM, ROX and TAMRA dye labels are fluorescent amidate matrix standards used in detection.

1-6 ^1 of DNA template from each patient was made up to a total volume of 6 \i\ with ddH%0 according to prior quantification of the approximate concentration of the purified PCR sample established using the purification method (Section 2.4.1). Four

0.5|li1 microfuge tubes were labeled A, C, G and T, respectively and placed on ice. For the A- and C- terminating reactions, Ijxl of diluted DNA and 4 pi of the Ready Reaction

Premix were used, whereas 2pl of diluted DNA and 8 pi of the Ready Reaction Premix were used for the G- and T- terminating reactions. The thermal cycler (Hybaid Omn-E) with a heated lid was pre-heated to 95°C and the reactions were taken through the cycling reaction program of 15 cycles at 95°C for 30 s, 52°C for 30 s, 70°C for 1 min;

15 cycles of 95°C for 30 s, 70°C for 1 min and finally, 35°C for 30 min.

After cycle sequencing, the products of each sample were combined and precipitated.

4.5 pi of 2M sodium acetate (pH 4.5) and 90 pi of 100% ethanol were aliquoted into clean microfuge tubes. For each patient sample, all of the four extension reactions were pipetted into the ethanol mixture and the tubes were mixed by vortexing. The tubes were incubated at 4°C for 30 min in order to precipitate the extension reactions. The samples were centrifuged at 13000 r.p.m for 20 min in a Sigma 113 benchtop microfuge. The supernatants were removed and the pellets were washed with 150 pi of

70 % (v/v) ethanol, air dried and stored at -20°C until analysis.

76 Chapter 2______Materials & Methods ______General

2.4.4 Big-Dye Primer Sequencing Chemistry

During the course of this project, Perkin-Elmer Applied Biosystems introduced the Big-

Dye™ Primer Cycle Sequencing technology to replace the original Dye-Primer sequencing chemistry. This new technology was used because the Big-Dye primers are

2-3 times more sensitive than the standard dye primers and allow the sequencing of larger templates with only half of the amount of the ready reaction pre-mix. The method for the preparation of samples for cycle sequencing is the same as that carried out for

Dye-Primer sequencing (Section 2.4.3) with the exception that in this case, all of the A,

C, G and T reactions were carried out in a ratio, i.e. Ipl of the purified, diluted template and 4pi of the Ready Reaction Premix were used in a total volume of 5pi for each cycling reaction.

2.4.5 Dye-Terminator Sequencing Chemistry

2.4.5.1 Sequencing reactions using Dye-labeled Terminators

Sequencing reactions were carried out using the Dye-Terminator-Cycle Sequencing

Ready Reaction Kit (Perkin-Elmer Applied Biosystems). The Ready Reaction Premix contained MgCli, Tris-HCl (pH 9.0), AmpliTaq DNA polymerase FS with thermally stable pyrophosphatase, dNTPs containing dITP instead of dGTP and fluorescently labeled ddNTPs; ddATP was labeled with dichloro[R6G], ddCTP with dichloro[ROX], ddGTP with dichloro[R110] and dTTP with dichloro[TAMRA]. The cycle sequencing reactions consisted of 1 pi of the purified exon PCR product, 4 pi of Ready Reaction

Premix, 4 pi of ddH 2Ü and 3.2 pmol of exon 8 (only) of the PMM2 gene forward or reverse primer, giving a total volume of 10 pi. Before cycle sequencing, approximately

20 pi of mineral oil was overlaid on the reaction mix to prevent evaporation.

77 Chapter 2______Materials & Methods ______General

The cycle sequencing programme was as follows: 25 cycles at 96°C for 30 s, 55°C for

15 s, 60°C for 4 min and was then held at 30°C. After cycle sequencing, the reaction mixes were separated from the mineral oil and were precipitated in 2 pil of 3M sodium acetate and 50 ^ of 100% ethanol by incubation on ice for 15 min followed by centrifugation at 13000 r.p.m in a Sigma 113 benchtop microfuge for 30 min. The supernatants were aspirated and discarded and the pellets were washed with 70% (v/v) ethanol air-dried and stored at -20°C until analysis.

2.4.6 Big Dye-Terminator Sequencing Chemistry

As with the advance in the Dye Primer sequencing chemistry, Perkin-Elmer Applied

Biosystems developed a set of dye terminators, named as Big-Dye™ Terminators labeled with novel, high-sensitivity dyes to replace the original dye-terminators. The dye structures contain a fluorescein donor dye, e.g., 6-carboxyfluorescein (6-FAM), linked to a dichlororhodamine (dRhodamine) acceptor dye. The Big-Dye Terminators are 2-3 times more sensitive than the standard dye terminators making the sequencing of larger templates possible.

2.4.6.1 Sequencing reactions using Big-Dye Terminators

The Big-Dye Terminator cycle sequencing reactions were the same as for the original

Dye-Terminator reactions (See Section 2.4.5.1) except that after cycle sequencing and separation from the mineral oil, the reaction mixtures were placed in microfuge tubes containing 26 p,l of ddH20 and 64 pil of 100% ethanol, mixed by vortexing and incubated at room temperature in the dark for approximately 20 min. This was followed by centrifugation at 13000 r.p.m in a Sigma 113 benchtop microfuge for 30 min. The

78 Chapter 2______Materials & Methods ______General supernatants were aspirated and discarded and the pellets were washed with 150 pi of

70 % ethanol (v/v), air-dried and stored at -20°C until analysis.

2.4.7 Preparation of the sequencing gel

Two glass ABI Prism™ plates were washed thoroughly with Alconox™ detergent, rinsed with MilliQ water and allowed to dry in air. The sequencing apparatus was assembled by placing the outside of one of the plates face down onto a clean cassette with 0.2 mm spacers arranged at the sides of plate, to separate the second plate. The plates were then clamped into position and covered until the gel was ready to be poured.

To prepare a gel with a final concentration of 4.1% (w/v) polyacrylamide, 5.2 ml of acrylamide: bisacrylamide (19:1, Amresco) was mixed with 18 g of urea, 0.5 g

Amberlite (Sigma) and 25 ml of water. The mixture was stirred until dissolved and then filtered through a 0.2 pM cellulose nitrate filter, which initially had 5 ml of lOX TBE buffer poured onto the filter base. The filtered solution was made up to a final volume of 50 ml using MilliQ water. 250 pi of ammonium persulphate (10%, w/v) and 35 pi of

TEMED were added to initiate polymerization. The solution was mixed and poured between the gel plates. The straight edge of a shark’s toothcomb was inserted at the top of the gel and clamped into position. The gel was allowed to polymerize for a minimum of 2 h before use.

2.4.8 Sequencing gel electrophoresis

The gel apparatus was placed in the ABI Prism™ 377 DNA Sequencer (Perkin Elmer

Applied Biosystems) and pre-run to ensure that the level of background fluorescence in the gel was at a minimum. The comb was taken out from the gel, washed with IXTBE and reinserted to form wells. The buffer trays were attached and the buffer was first

79 Chapter 2______Materials & Methods ______General poured into the top chamber to check for any leakage. If there was no leakage, buffer was added to the lower chamber and the cooling plate was fixed to the front of the gel plate. The wells were washed with IX TBE and the system was pre-run at 0.97 V until the temperature reached 51°C. Meanwhile, the loading dye mixture was prepared by combining 100 p,l of deionised formamide and 20 \i\ Blue Dextran (50 mg/ml), of which

4 pi was added to each sequencing sample to be analysed. The samples were denatured at 91 °C and immediately placed on ice. The wells were washed again with IX TBE and

2.5 pi of each sample was loaded onto the gel, which was run at 1.6 kV for 7 h overnight.

Sample files of sequence data were generated by Sequencing Analysis™, version 3.4.1.

Comparison of patient sequences and the normal sequence was carried out using

Sequence Navigator™, version 1.01.

80 Chapter 3 ______Preliminary enzymatic analyses

Chapter 3

Preliminary enzymatic analyses and segregation of the

patients into different subtypes of CDG

3.1 Introduction

In 1988, Harding et al, first described two siblings in the U.K with an unusual form of olivopontocerebellar atrophy, which is now known to have been CDG. Since then, 20 patients from 18 British families and 1 patient from a family from the United Arab

Emirates have been referred to Great Ormond Street Hospital, London, as possible cases of CDG on the basis of their clinical features and abnormal isoelectric focusing patterns of serum transferrin. Some of the patients investigated have been reported elsewhere;

BE (Westphal et al., 2000); CB (Clayton et al., 1993); JB (Hutchesson et al., 1995); DC

(Clayton et al., 1992); NH (Charlwood et al., 1997) and siblings JS and TS (Horslen et a l, 1991).

Prior to the discovery of a deficiency of PMM as the cause of CDG-Ia (Van Schaftingen and Jaeken, 1995), the diagnosis of this disease was based on clinical presentation and an abnormal isoelectric focusing pattern for serum transferrin. Since 1995, the activities of PMM, PMI and PGM have been routinely measured in leukocytes, cultured fibroblast and lymphoblastoid cells to confirm the diagnosis of CDG-Ia or Ib and to classify the patients.

This chapter gives the details on enzymatic analyses carried out in cultured fibroblast and lymphoblastoid cells derived from 21 patients diagnosed as CDG I patients on the

81 Chapter 3 ______Preliminary enzymatic analyses basis of their clinical presentation and abnormal isoelectric focusing patterns of serum transferrin. The measurement of PMM and FMI activities formulated the basis for the assignment of these patients into different subgroups of CDG-I.

3.2 Materials and Methods

3.2.1 Clinical Details of Patients

The clinical details of the 21 patients are given in this section. Each family was assigned a serial number and classified on the basis of the results of the preliminary enzymatic analysis (See Table 3.1).

Family 1

Patient 1: CB

CB was a female patient, who was delivered at 35 weeks gestation by caesarean section because of a deceleration in foetal heart rate. She required resuscitation and was hypotonic in addition to having roving eye movements, restricted movements at the hips and knees, diarrhoea and failure to thrive. She had dysmorphic features, such as long fingers and toes, fat pads above the buttocks and lipoatrophy affecting the thighs. She died within the first year of life. This patient has been described elsewhere (Clayton et al., 1993) and was the sibling of the patients described in Harding et al, (1988).

Family 2

Patient 2: JB

JB is a male, who presented at 3 weeks of age with failure to thrive. He was noticed to be dysmorphic at 8 weeks old with loose skin folds and inverted nipples. He was developmentally delayed, hypotonic and had skeletal dysplasia. He developed left

82 Chapter 3 ______Preliminary enzymatic analyses ventricular failure with pericardial effusion and died from respiratory failure aged 106 days. This patient has been described elsewhere (Hutchesson et al., 1995).

Family 3

Patient 3: LB

A female bom as a breech presentation. She was diagnosed with CDG-I at 12 months of age when investigated for global developmental delay, ataxia and hypotonia. Neuro imaging results demonstrated brainstem and cerebellar atrophy. She has some dysmorphic features including long fingers and toes and fat pads. She is currently 5 years old.

Family 4

Patient 4.1: TB

A male who presented at birth with hypotonia and dysmorphic features including inverted nipples and fat pads. He had failure to thrive and roving eye movements. He was developmentally delayed and was sitting unaided at 2.5 years, pulling to stand at

5.5 years and walking with the aid of a rolator by 10 years. He said his first words at 3 years of age and was constmcting short sentences by 10 years. He is currently 14 years old and is able to attend a mainstream school with the aid of a special needs tutor.

Family 4

Patient 4.2: VB

She is the younger sister of TB and like her brother was bom as a breech presentation.

She had severe global developmental delay with ataxia and seizures at 3 years.

Subsequent susceptibility to recurrent infections has progressed to pneumonia on

83 Chapter 3 ______Preliminary enzymatic analyses occasion. She is currently 13 years old. The father of TB and VB has inverted nipples in isolation.

Family 5

Patient 5: DC

DC, the first child of healthy parents, was bom at 37 weeks gestation by caesarean section due to the failure to progress in labour. Two minutes after birth he was noticed to be gmnting and was making poor respiratory effort. He had dysmorphic features, including inverted nipples and fat pads. At the age of 3 weeks, echocardiogram results showed ventricular hypertrophy and at 4 weeks showed negligible weight gain due to poor feeding and vomiting. At 6 weeks he was visually inattentive and hypotonic. At 9 weeks he appeared breathless and a systolic murmur was noted. He was found to have a cardiomyopathy. A diagnosis of CDG-I was confirmed by an abnormal isoelectric focusing pattern for serum transferrin. DC died at the age of 11 weeks after severe vomiting and longer periods of apnoea. This patient has been described elsewhere

(Clayton et al., 1992).

Family 6

Patient 6: MC

A female, bom after an uneventful pregnancy with three previous term siblings who are alive and well. At 1 day old, she was breathless with poor feeding and sweating. Her blood pressure was stable but she was pale with poor peripheral perfusion. At 16 days of age, an EGG revealed a bright myocardium with a small pericardial effusion. She was initially treated with antibiotics but these were discontinued when all cultures remained negative. She continued with feed intolerance, poor weight gain and chronic

84 Chapter 3 ______Preliminary enzymatic anahses diarrhoea. On examination she had inverted nipples, arachnodactyly and abnormal fat distribution. A diagnosis of CDG-I was confirmed by an abnormal isoelectric focusing pattern for serum transferrin. The patient’s condition continued to deteriorate and she became more oedematous due to cardiac and renal failure. She died at 7 weeks of age.

Family 7

Patient 7: JD

JD, a male was bom following a normal delivery but was admitted at one month of age with colic and feeding difficulties. At two months, he presented with diarrhoea, was pale and oedematous (excessive accumulation of watery fluid in cells, tissues and blood cavities). Intermittent liver dysfunction with raised enzymes and hypoalbuminaemia were noted and his diet was changed to a Soya formula. He had dysmorphic features

(inverted nipples and fat pads) and was developmentally delayed. He is currently 2.2 years of age.

Family 8

Patient 8: KF

KF is a female investigated at 10 weeks for failure to thrive and vomiting. Magnetic

Resonance Imaging (MRI) showed delayed myelination with cerebellar atrophy. She

developed a right-sided hemiplegia secondary to venous sinus thrombosis. She was

developmentally globally delayed and was unable to sit at 4 years of age. She is

currently 7 years old.

85 Chapter 3 ______Preliminary enzymatic analyses

Family 9

Patient 9: LM

LM was a male who originally presented at 2 months of age with poor feeding and failure to thrive. He had dysmorphic features including long fingers and toes, inverted nipples and fat pads. He had hypotonia and results of MRI showed cerebellar atrophy and delayed myelination. He was developmentally delayed and by 4 months was becoming increasingly breathless as a result of poor ventricular function and associated pericardial effusion, compounded by hypoalbuminaemia. He died at 6 months of age.

Family 10

Patient 10: JR

She was diagnosed at birth with dysmorphic features comprising of long fingers and toes, inverted nipples and fat pads. She had oedema and was hypotonic. In addition, she presented with roving eye movements and poor muscle bulk. She failed to thrive before her death.

Family 11

Patient 11.1: TS

A boy, the third child of unrelated Caucasian parents was bom at 37 weeks gestation after presenting in a double footling position. He failed to thrive and was admitted at 3 months of age with increasing oedema and abdominal swelling. On examination, he had a large head, high forehead, roving eye movements and hypotonia. An abdominal ultrasound revealed the presence of ascites and hepatomegaly. Biochemical investigations showed that semm albumin and total protein concentration were abnormally low. Following an episode of diarrhoea, he suddenly became restless with

8 6 Chapter 3 ______Preliminary enzymatic analyses an irregular breathing pattern and died soon afterwards at 15 weeks of age. This patient has been described elsewhere (Horslen et al., 1991).

Family 11

Patient 11.2: JS

A boy, the brother of TS, was bom just over 2 years later. At 4 weeks of age he was admitted because of failure to thrive, vomiting and abnormal eye movements.

Biochemical examination of semm showed a low albumin concentration although less severe than that of his brother. Ultrasound examinations showed a small cerebellum and a small quantity of ascites. He died at home of pneumonia at the age of 17 weeks.

This patient has been described elsewhere (Horslen et al., 1991).

Family 12

Patient 12: KT

KT is a female, who was growth retarded at birth with subsequent failure to thrive and poor feeding. She presented with the typical CDG-Ia dysmorphic features.

Neurologically at 5 weeks, she had marked hypotonia and presented with a squint and roving eye movement. Results of her electroencephalogram (EEG), which records the electric potential of the brain, showed excessively slow activity for her age. She died at

2 months of age.

Family 13

Patient 13: EW

In the first hours of her life, EW was noticed to have a period of cyanosis (bluish colouration of the skin and mucous membranes due to deficient oxygenation of the

87 Chapter 3 ______Preliminary enzymatic analyses blood). She was admitted at 13 weeks of age following an intercurrent infection and dehydration. She was also noted to have a degree of eye rolling. In her first year, hypotonia became increasingly apparent and she developed ataxia. At 3.3 years old, she was referred for investigation and the diagnosis of CDG-I was confirmed. She had subtle dysmorphic features but was severely hypotonic and was unable to stand. She is currently 9 years old and is mobile with the aid of a walker. Her speech remains difficult but language comprehension is appropriate for her age.

Family 14

Patient 14: AH

AH, a female of non-consanguineous parents, presented at 6 months of age with poor feeding, failure to thrive and mild developmental delay. At 9 months, her liver was enlarged and liver function tests were transiently deranged. A liver biopsy showed congenital hepatic fibrosis. She had severe episodes of diarrhoea and vomiting but had no proteinuria. An MRI scan of her brain was normal, but she presented with fat pads on her chin and thighs in addition to having inverted nipples.

Family 15

Patient 15: BB

BB, a male was seen at 3 months for profound protein-losing enteropathy (PLE) after gastro-enteritis. A colonoscopy was normal and proteinuria was absent. The PLE normalized within a month, but during the next year, BB had several episodes of life- threatening PLE after acute gastro-enteritis and required large amounts of intravenous- infused albumin. At 14 months of age, he had the first of several fits. Isoelectric focusing patterns of serum transferrin showed an abnormal pattern typical of CDG-I.

88 Chapter 3 ______Preliminary enzymatic analyses

He continues to show marked developmental delay, hypotonia and occasional convulsions occur.

Family 16

Patient 16: NH

A male, the first child of unrelated patients was delivered by caesarean section at 35 weeks after reduced foetal movements were noted and a scan showed intrauterine growth retardation. He was difficult to feed and failed to gain weight during the first 4 weeks after birth and at 4 weeks developed diarrhoea and vomiting. Physical examination revealed a high forehead and long fingers and toes. An echocardiogram showed a small pericardial effusion and an abdominal ultrasound showed massive ascites. A chest radiograph revealed lung consolidation, particularly in the right and upper middle zones and blood gases with the baby in air revealed hypoxia. Despite treatment for the various abnormalities, he died at age 3 months.

Family 17

Patient 17: RM

A male, was referred from the United Arab Emirates for investigation on the basis of a clinical diagnosis. Clinical notes were not provided and efforts to try and locate the patient’s medical notes have not been successful. RM was characterised as CDG-I by transferrin analysis and was therefore included in this group of patients.

89 Chapter 3 ______Preliminary enzymatic analyses

Family 18

Patient 18: KS

KS is the first child of unrelated parents. She was bom at 34 weeks, weighing 1.6kg.

She was difficult to feed due to incoordinate sucking and continued to fail to thrive with weight below the 3^^ centile. At 3 weeks of age she developed myoclonic jerks and had roving eye movements. She had dysmorphic features that were characteristic of CDG-I and subsequent agarose gel electrophoresis of transferrin showed a type I pattern. At 7 months of age she aspirated feed. She recovered underwent a Nissan’s fundoplication and insertion of a gastrostomy. Her seizures were managed with vigabatrin and phenobarbitone. She died at the 3.5 years of age.

Family 19

Patient 21: AU

A male, who was referred from The Children’s Hospital, Birmingham for investigation on the basis of a clinical diagnosis, which was characteristic of CDG-I. Subsequent agarose gel electrophoresis of transferrin showed a type I pattern.

90 Chapter 3 ______Preliminary enzymatic analyses

3.3 Results and Discussion

The activities of PMM and PMI were measured for diagnostic purposes, whereas the

PGM activity was measured as an internal control. The data on all of the 21 patients are given in Table 3.1. The results for families 1-15 were obtained by the Enzyme

Laboratory, Great Ormond Street Hospital, before the onset of this project. Enzyme analyses were not carried out on patients JS and TS because they had died before the enzymic basis of CDG was discovered and cultures of fibroblasts were not established.

These patients were, however, confirmed to be PMM deficient by subsequent mutational analysis of the PMM2 gene (described in Chapter 4).

The specific activity of PMM was less than 10% of the minimal value of the normal control range for patients from families 1-10, 12-15. The residual PMM activity ranged from 3% to 6% of the mean control values. The PMI and PGM activities of these patients were within the normal range. The PMM-deficiency together with abnormal isoelectric focusing patterns of serum transferrin and the clinical features justified the diagnosis of CDG-la in these patients. CDG-la represents the largest group of CDG patients (Stibler and Jaeken, 1990; Jaeken et al., 1997a; Jaeken et al., 1997b). The disease has a worldwide occurrence, where European ancestry is most common.

Patients have been identified from Australia, Ecuador, Japan, Peru and an increasing number has been found in North America (For Reviews, See Jaeken et al., 2001;

Schachteret al., 2001). The proportion of CDG-1 families found to be CDG-la in this study, 13/19 or 68% is very similar to that found in other Caucasian populations.

The remaining 6 patients had PMM activities within the normal control range, but one patient (AH) had decreased activity of PMI. A deficiency of PMI as a result of

91 Chapter 3 ______Preliminary enzymatic analyses mutations in the MPI gene is consistent with the diagnosis of CDG-Ib. Further investigation of this patient is described in Chapter 5. There are about 20 patients that have been reported, so far, with this CDG-I subtype (de Koning et al., 1998; Jaeken et al., 1998; Niehues et al., 1998; Babovic-Vuksanovic et al., 1999; Schollen et al., 2000;

Hendriksz et al., 2001).

At the same stage of the project, the other 5 patients (families 15-19) were considered to have unknown defects leading to the CDG-1 syndrome, CDG-lx. However, subsequent advances in the understanding of CDG revealed that a defect in the enzyme a-1,3 glucosyltransferase, encoded by theMLGb gene (See Figure 1.14) is another cause of the disease. This enzymic defect is now defined as CDG-lc. Collaboration with Dr.

Hudson Freeze of the Burnham Institute, La Jolla, California showed that patient BB had a deficiency of a-1,3 glucosyltransferase. The biochemical and mutational analysis of patient BB described in Chapter 5 confirmed the diagnosis of CDG-lc. The basic biochemical and genetic defects in the four remaining patients, NH, RM, KS and AU,

are still unknown and hence they remain classified as CDG-lx. This proportion of patients (4 out of 23, 17%) is similar to the published reports on this subtype, where

approximately 20% of patients with a CDG-1 isoelectric focusing patterns of serum transferrin, do not show PMM deficiency (Freeze and Aebi, 1999; Schachter, 2001).

It is important to point out that the rapid enzymic assay of PMM and PMI will confirm

and fully define the diagnosis of CDG for approximately 75% of patients with

characteristic abnormal isoelectric focusing patterns of serum transferrin.

92 Chapter 3 Preliminary enzymatic analyses

Family Patient PMM Activity PMI Activity PGM Activity (nmol/min/mg of (nmol/min/mg of (nmol/min/mg of protein) protein) protein) normal control: normal control: normal control: (n=30, mean=2.7+/- (n=22, mean=23 (n=23,mean=95.6 +/- 0.7; range: 1.9-3.8) +/- 9; range: 14-37) 19.7; range: 80-126) 1 CB 0.18 N.A N.A 2 JB 0.05 N.AN.A 3 LB 0.05 15 76 4 1 TB 0.24 N.AN.A 2 VB 0.02 N.AN.A 5 DC 0.13 N.A N.A 6 MC 0.07 21 132 7 JD 0.00 15 N.A 8 KF 0.1 18 63 9 LM 0.25 25 108 10 JR 0.23 26 94.1 11 1. JS N D N.D N.D

2 TS N D N D N D 12 KT 0.13 N.A N.A

13 EW 0.05 N.A N.A

14 AH 6.3 6.12 113

15 BB 2.95 27 118

16 NH 6.5 20 109 17 RM 4.1 14 154

18 KS 5.9 25 89 19 AU 3.6 19 132

Table 3.1: PMM, FMI and PGM activities of CDG-I patients. (N.D) denotes that the enzyme assay was not performed due to lack of patient sample; (N.A) denotes that values were not available. Text in red denotes deficiency.

93 Chapter 4 ______Introduction ______CDG-Ia

Chapter 4

Genotype/phenotype correlation in U K patients with CDG-Ia

4.1 Introduction

CDG-Ia has a worldwide occurrence and is the most common type of CDG with more than 300 patients reported to date and is known to affect both sexes equally (Winchester et al., 1995; Freeze, 1998; Carchon et al., 1999; Jaeken et al., 2001). The majority of patients have been diagnosed in Europe but a number of patients have also been reported in Japan, South America, the Middle East and the United States (For Reviews

See Jaeken et al., 2001; Schachteret al., 2001). The clinical presentation of CDG-Ia is characterised by the presence of three main features: moderate to severe neurological involvement, dysmorphic features and variable multi-system defects (Jaeken et al.,

1997; Carchon and Jaeken, 1999; de Lonlay et al., 2001; Leonard et al., 2001). The diagnosis can generally be made by an experienced clinician within the first weeks of life when patients have inverted nipples, long fingers and toes, severe failure to thrive, abnormal adipose tissue distribution (fat pads) “orange peel skin”, and hypotonia.

Between early and late infancy, the patients suffer from psychomotor delay, ataxia and roving eye movements. By childhood, all patients are moderately to severely retarded and a number have epilepsy, seizures, joint contractures and stroke-like episodes. A minority of infants have severe organ problems, such as liver failure, cardiac insufficiency or multi-organ failure (Clayton et al., 1992; Jaeken and Carchon, 1993;

Hutchesson et al., 1995). Patients that survive to adolescence have skeletal abnormalities, for example deformities of the thorax and most are unable to walk without support. Premature ageing is also evident in some patients (Stibler et al., 1994) but most patients have an extrovert and cheerful personality. Although the above

94 Chapter 4 ______Introduction ______CDG-Ia account describes the majority of patients, there is, however, an emerging group of patients, who have mild to moderate clinical symptoms and do not present with the characteristic features useful in the diagnosis of CDG-Ia (Di Rocco et al., 2000; van

Ommen et at., 2000; Grünewald et al., 2001). For example, typical symptoms such as abnormal fat pad distribution, inverted nipples and failure to thrive are not observed in patients with “milder” symptoms. These patients do however present with psychomotor retardation in a variable degree, strabismus and hypotonia. In addition, these patients had higher residual PMM activities in fibroblasts compared with patients with moderate or severe cases and approximately half the PMM activity compared to normal control fibroblasts. Nonetheless, patients with the “milder” phenotype have been confirmed to have CDG-Ia by the presence of mutations in the PMM2 gene.

4.1.1 Biochemical features

Abnormal glycosylation of a number of glycoproteins in CDG-Ia patients has previously been reported (Wada et a l, 1994; Yuasa et al., 1995; Seta et al., 1996;

Heyne et al., 1997). In serum, data have been published on various transport proteins

(Jaeken et al., 1980; Jaeken et al., 1984; Yuasa et al., 1995; Stibler et al, 1998; Van

Geet et al., 1993), lysosomal and other enzymes (Jaeken et al., 1980; Jaeken et al.,

1991; Barone et al, 1998). The total concentrations of most glycoproteins or their enzyme activities in serum are decreased but an increase in the serum levels of several lysosomal enzymes has also been reported (Barone et al, 1998; Carchon et a l, 1999).

The protein V-glycosylation defect in CDG-Ia can be defined as non- or under occupancy of V-glycosylation sites (Asn-X-Ser/Thr sequences) by iV-linked glycans.

For instance in the case of serum transferrin, which is one of the best-studied

95 Chapter 4 ______Introduction ______CDG-Ia glycoproteins in CDG-I, the serum transferrin is a mixture of molecules representing hi-, mono- or non-glycosylated forms. The A^-glycans on these transferrin molecules are however normal complex hi- or tri-antennary structures (Imtiaz et al., 2000; Mills et al.,

2001).

4.1.2 Biochemical basis of the CDG-Ia defect

A deficiency of phosphomannomutase (PMM) activity was first reported by Van

Schaftingen and Jaeken (1995) and has been confirmed by all of the other groups working on this disorder including those in the U.K (Charlwood et al., 1997; Imtiaz et al., 2000). Deficiency in PMM activity diminishes the conversion of mannose-6- phosphate (Man-6-P) to mannose-1-phosphate (Man-l-P), as shown in Figure 4.1. In consequence, this decreases the production of GDP-mannose, which is an essential mannosyl precursor in the synthesis of the lipid-linked oligosaccharides (LLOs) required for V-glycosylation of proteins. It has been reported that 80% of CDG-1 patients have a deficiency of PMM (van Schaftingen and Jaeken, 1995, Jaeken et al.,

1997a, 1997b, Carchon et ai, 1999, Imtiaz et al., 2000).

GDP-fticose PMM2_ î Fructose-6-P Mannose-6-P — Mannose-1-P GDP-mannose LLO

Dol-P-Mannose

Figure 4.1: Biochemical basis of CDG-Ia

96 Chapter 4 ______Introduction ______CDG-Ia

The majority of patients with CDG-Ia are found to have very low activity of PMM

(<5% of the normal activity) in liver, leukocytes, fibroblasts or lymphoblasts. However, it has been reported that in some patients, the PMM activities in fibroblasts or lymphocytes were about 25% higher than in leukocytes girard et al, 1999b) and up to

35%-70% of the mean control value in fibroblasts (Grünewald et al., 2001). In addition to these findings, the PMM activity in fibroblasts of some patients that are clinically and genetically characterised with CDG-la is reported to be within the normal control range

(Grünewald et at., 2001).

4.1.3 Genetic basis of CDG-Ia

CDG-la has an autosomal recessive mode of inheritance and the CDG locus was first localised to human chromosome 16pl3 by using DNA samples from 25 families for linkage analysis (Martinsson et al., 1994). In order to further localise the CDG-la locus, recombination and linkage disequilibrium analyses were performed. Recombination events in six of the families indicated that the gene was localised in a 13 cM interval between microsatellite markers D16S406 and D16S500. The linkage to this region between D16S406 and D16S500 was later confirmed in 10 out of 11 families investigated (Matthijs et al., 1996). The subsequent discovery of PMM-deficiency in

1995, as the biochemical basis of the disease intensified the search for the disease- causing gene. The yeast PMM gene, SEC53, had been previously characterised by

Kepes and Schekman (1988). A human homologue of SEC53 was cloned by Matthijs et al, (1997a) and named as PMMl. The protein encoded by the human PMM7 gene and expressed in E.coli had phosphomannomutase activity (Matthijs et a l, 1997a).

However, subsequent mapping studies localised the PMMl gene to human chromosome

97 Chapter 4 ______Introduction ______CDG-Ia

22ql3 (Matthijs et a l, 1997a; Wada et al., 1997). The discrepancy between the genetic loci of the predicted CDG-Ia locus (chromosome 16pl3) and the PMMl gene

(chromosome 22ql3) discredited the status of PMMl as the disease-causing gene. Fine mapping of the chromosome 16pl3, the CDG-Ia disease locus, was carried out using haplotypes, linkage disequilibrium analysis and geographical distribution in 44 CDG-Ia families (Bjursell et al., 1997). The identification of mutations in the PMM2 gene

(Matthijs et al., 1997b) gave conclusive support to the biochemical finding that PMM- deficiency is the basis for CDG-Ia and that PMM2 is the disease-causing locus of this disorder (Matthijs et al., 1997b; Schollen et al., 1998; Matthijs et al., 1999; Carchon et al., 1999). Matthijs and colleagues (2000) published a collaborative report on the mutations found in the PMM2 gene of 249 CDG-Ia patients from 23 countries. In total,

58 different mutations were documented from 6 centres involved in screening CDG-Ia patients. The research concluded that there is a plethora of missense mutations (53 of

58) in the PMM2 gene causing CDG-Ia, where R141H is the most common mutation

(found in 186 patients).

4.1.4 Structure of the human PMM2 gene

Both human PMMl and PMM2 genes were identified on the basis of the sequence similarity of a number of expressed sequence tags (ESTs) with the yeast PMM gene,

SEC53. The cDNA of PMM2 has an open reading frame of 738 base pairs (bp), which encodes a protein of 246 amino acids. The PMM2 gene has 58% identity with SEC53 whereas thePMMl gene shows about 54% identity. At the cDNA level, (coding sequence only), the identity is 52% and 32% respectively forPMM2 and PMMl. Thus, the degree of identity with yeast SEC53 is higher for PMM2 than PMMl (Matthijs et al., 1997a; 1997b). The PMM2 gene consists of 8 exons, which span approximately 20

98 Chapter 4 ______Introduction ______CDG-Ia kilobases (kb) of genomic DNA (Matthijs et al., 1997b; Schollen et at., 1998). The size of the coding exons ranges from 66 to 116 bp. Matthijs et al (1997b) have described the alignment of PMMl and PMM2 and it was reported that there are 78 differences at the amino acid level between the two genes, excluding the 4 mutational events that have led to a difference in length of the proteins (the identity is 65% at the nucleotide and

66% at the amino acid level).

4.1.5 Diagnosis of CDG-Ia

CDG-Ia should be considered in any child or adult with unexplained psychomotor retardation, especially if this is associated with clinical features such as abnormal subcutaneous fat distributions, inverted nipples and feeding problems with failure to thrive. Generally, the diagnosis of CDG-Ia can be facilitated by isoelectric focusing and immunofixation of serum transferrin (Jaeken et al, 1984; Stibler and Jaeken, 1990) or transferrin obtained from dry blood spots (Stibler and Cederberg, 1993). Normal serum transferrin is composed of tetrasialotransferrin with small amounts of mono-, di-, tri-, penta-, and hexasialotransferrin (Stibler et al, 1979). The partial deficiency of sialic acid residues owing to the absence of #-linked glycans in patients with a PMM deficiency causes a cathodal shift that results in a marked increase of both asialo- and disialotransferrin and a decrease of tetra-, penta- and hexasialotransferrin. Isoelectric focusing of another serum glycoprotein, like ai-antitrypsin and p-hexosaminidase, can be carried out to eliminate protein-specific variation (Jaeken et al, 1992; Mills et al,

2001). Confirmation of the diagnosis of CDG-Ia is obtained by assaying PMM activity in leukocytes or fibroblasts (Jaeken and Carchon, 1996; van Schaftingen and Jaeken,

1995; Carchon et a l, 1999). In all cases, a full diagnosis of CDG-Ia should be

99 Chapter 4 ______Introduction ______CDG-Ia accomplished by mutation analysis of the PMM2 gene. As R141H is the most frequent mutation in CDG la, an obvious approach should be to search for this mutation first.

4.1.6 AJms

The main aims of the work described in this chapter are to carry out mutation analysis of the PMM2 gene in patients diagnosed clinically and biochemically as CDG-Ia and to determine if there is any correlation between clinical symptoms, residual PMM activity and genotype of patients.

1 0 0 Chapter 4 ______Materials & Methods ______CDG-Ia

4.2 Materials and Methods

4.2.1 Patient Material

DNA was extracted from whole blood or cultured fibroblasts (Section 2.3.3, Chapter 2) from the 15 patients (13 families) who had been diagnosed as CDG-Ia on the basis of a deficiency of PMM or clinical features and transferrin electrophoresis (JS and TS).

4.2.2 Amplification of genomic DNA by the Polymerase Chain

Reaction (PGR)

4.2.2.1 Design and synthesis of oligonucleotide primers

The eight exons of the PMM2 gene were amplified using intronic primer sequences kindly made available to us by Dr. Gert Matthijs prior to publication (Matthijs et al.,

1998a). New sequences were designed for amplification of exon 5 (Table 4.1). The sense primer of each pair, apart from exon 8, was tagged at the 5'-end with the M13 (-

21) forward primer sequence (5 -TGTAAAACGACGGCCAGT-3') and each of the antisense primers was tagged at the 5'-end with the M13 reverse primer sequence (5'-

CAGGAAACAGCTATGACC-3'). The primers were synthesised by Sigma-Genosys.

1 0 1 Chapter 4 Materials & Methods CDG-Ia

Target Primer Sequence (5’ -> 3’) Sequence Exon 1 PMM2exl+ M13 (-21)-AGCGGCCGAACCCGGAAGTTC PMM2exl- M13 rev-AGCAGCCGCCGGCCGCCAC Exon 2 PMM2ex2+ M13 (-21)-GGTCTCCTGATTATTGTGTGGC PMM2ex2- M13 rev-GGCAGCCTATGATACTTG Exon 3 PMM2ex3+ M13 (-21)-GATTCnTGCATTCGAAGTG PMM2ex3- M13 rev-TCCTAGAGGCATTCATTGTG Exon 4 PMM2ex4+ M13 (-21)-CTGGGTTTGCrATGAAGCTG PMM2ex4- M13 rev-ACCATGTGACACTACGCTATG Exon 5 PMM2ex5+ M13 (-21)-ATGTTGCCCAAATGAATAACG PMM2ex5- M13 rev-CATAAACCCAGCCATTCACC Exon 6 PMM2ex6+ M13 (-21)-CCAGTAGTTAAAACTGTGCr PMM2ex6- M13 rev-CCAAGTTTGGAACACAGGCA Exon 7 PMM2ex7+ M13 (-21)-TCAGTGACATATCATTAGCC PMM2ex7- M13 rev-CCATCAAGCGCAAATGC Exon 8 PMM2ex8+ TCCAGGGTCACATCAGCAATGG PMM2ex8- GGAGAACAGCAGTTCACAG

Table 4.1 Sequence of oligonucleotide primers used to amplify the 8 exons of the PMM2 gene. (+) = forward, (-) = reverse

42.1.2 PCR conditions

PCR was carried out as described in Chapter 2, Section 2.3.5. The PCR conditions used to amplify the 8 exons of the PMM2 gene are shown in Table 4.2.

Exon PCR Mg CI2 Annealing product Concentration temperature °C size (bp) (mmol/1) 1 201 1.5 60 2 283 1.5 62 3 232 1.5 62 4 257 1.0 64 5 241 1.5 68 6 214 1.0 64 7 269 1.0 62 8 192 1.0 58

Table 4.2: PCR conditions used for amplification of the PMM2 gene.

1 0 2 Chapter 4 Materials & Methods CDG-Ia

4.2.3 Confirmation of sequence changes using restriction enzyme digestion

Any sequence changes detected in the analysis of the patient samples were confirmed in an independent genomic DNA sample amplified by PCR for the specific exon where the base change had been found. Confirmation was carried out by a specific restriction enzyme digestion (determined in this study), if the sequence change altered a restriction site (Table 4.3) or by novel ACRS (amplification created restriction site) PCR if the sequence change did not alter a restriction enzyme digestion site (Table 4.4).

Mutation Restriction Enzyme Product Size Restriction enzyme (bp) fragment sizes (bp) F119L + Tru 91 241 87 + 24 + 130 D148N - Taq I 241 171 + 70 F183S + BsmA I 269 108 + 161 V231M - Tsp45 I 192 130 + 62 T237M - BstV I 192 148 + 44

Table 4.3: Restriction enzyme digestion for the confirmatory test for each mutation, which alters a restriction site (+) denotes creation of restriction site in presence of mutation, (-) denotes loss of restriction site in presence of mutation

Mutation Sense Primer Anti Product Annealing MgCb Restriction 5 ’->3’ sense Size temp cone enzyme Primer (bp) CC) (mmol/1) (fragment sizes) (bp) I132N TCCGAAATGGGATG PMM2 144 64 1.5 + Ma III TTAAACGTGTCCCCTC ex5(-) 32 + 112 R141H CTATTGGAAGAAGCTG PMM2 117 62 1.5 + BsiHKA I CAGCCAAGAAGAGC ex5(-) 29 + 88 G208A ATGACGGTTATAAGAC PMM2 115 62 1.5 + Pstl CATTTATTTCrCTG ex7(-) 31 + 84

Table 4.4: Primers and PCR conditions for ACRS reactions (+) denotes creation of restriction site in presence of mutation, (-) denotes loss of restriction site in presence of mutation

103 Chapter 4 Materials & Methods CDG-Ia

4.2.4 SSCP

SSCP was carried out for exons 4,5, 6 and 8 of the PMM2 gene, as described in Section

2.3.6 (Chapter 2).

4.2.5 Sequencing

Four different fluorescent sequencing chemistries from Applied Biosystems were used in the screening of the PMM2 gene: 1) Dye Primer 2) Big-Dye Primer 3) Dye

Terminator and 4) Big-Dye Terminator.

Sequencing Exon Exon Exon Exon Exon Exon Exon Exon chemistry 1 2 3 4 5 6 7 8 Dye-Primer / y y y y y y

Big-Dye / y y y y y y Primer Dye- y Terminator Big-Dye y Terminator

Table 4.5: Sequencing chemistries used in the screening of each exon of the PMM2 gene (y ) denotes type of sequencing chemistry used

The various sequencing reactions prepared were run on sequencing gels and compared to the normal sequence to try and detect any sequence changes (See Section 2.4,

Chapter 2).

104 Chapter 4 Results CDG-Ia

4.3 Results

4.3.1 SSCP analysis of the PMM2 gene

SSCP was carried out on the PCR products for exons 4, 5, 6 and 8 for seven patients out of the 15 diagnosed as having CDG-Ia. Only exons 4, 5, 6 and 8 were analysed initially because mutations had been reported previously in these exons in British patients with

CDG-Ia (Matthijs et al., 1997b). SSCP analysis of exon 5 was inconclusive and therefore this exon was sequenced directly in all patients. In the later stages of the project, all exons were sequenced directly and SSCP analysis was discontinued. Shifts in the pattern of bands, indicative of sequence changes, were only observed in exon 8 of patients TB, KT, CB and DC (Figure 4.2). The change in the pattern appeared to be the same for all the samples, suggesting that the patients have a common mutation.

1 2 3456789 Figure 4.2: SSCP analysis of exon 8 of the PMM2 gene. Lane 1, TB Lane 2, KS Lane 3, KT. Lane 4, JB Lane 5, EW. Lane 6, CB, Lane 7, DC.Lane 8, KF. Lane 9, Normal Control.

105 Chapter 4 ______Results ______CDG-Ia

4.3.2 Identification of sequence changes detected by SSCP

The patients (CB, TB, DC, and KT) that were found to have shifts in the band patterns demonstrated by SSCP were sequenced as described in Section 4.4. All of the four patients were shown to be heterozygous for the V231M mutation, which is caused by a

G to A transition of nucleotide 691 in exon 8 of the PMM2 gene (See Section 4.3.S.7)

4.3.3 Detection of mutations by direct sequencing of amplified exons of the PMM2 gene

Initially, exons 5 and 8 of the PMM2 gene were sequenced because most of the previously reported mutations had been found in these exons including the two most common mutations, R141H and F119L in exon 5 (For review see Matthijs et al., 2000).

Further, our preliminary SSCP analysis had shown that the mutation V231M was relatively abundant in British patients. If these three mutations (R141H, F119L and

V231M) were not found in these two exons then exon 7 was sequenced as this is the third most popular exon (Matthijs et al., 2000). Both mutations were found in exon 5, 7 or 8 for 10 out of 13 of the CDG-Ia families (Table 4.6). Only one mutation was found in these exons for two patients, DC and JR and therefore the whole of the gene was sequenced in search of the second mutation for these two patients. However, no other mutations were detected in the exons and their flanking regions.

Only DNA was available from the father of family 11 (patients JS and TS). The detection of the common null allele, R141H in the father provided strong evidence that the patients had CDG-Ia. All sequence changes were detected in the heterozygous state.

106 Chapter 4 Results CDG-Ia

Family Patient Genotype Mutation 1 Mutation 2 1 CB R141H V231M 2 JB R141H G208A 3 LB D148N F183S 4.1 TB R141H V231M 4.2 VB R141H V231M

5 DC - V231M 6 MC 284 del T G208A 7 JD R141H F119L 8 KF R141H F119L 9 LM R141H F119L

10 JR I132N - 11.1 JS R141H N.D 11.2 TS R141H N.D 12 KT R141H V231M 13 EW R141H T237M

Table 4.6: Genotypes of 15 UK CDG-Ia patients. (N.D) denotes that mutation analysis could not be carried out due to lack of patient material (only father’s DNA available for analysis)

In the following sections, 4.3.3.1-4.3.3.9 the detection of each mutation by direct sequencing and the specific confirmatory test are described.

107 Chapter 4 Results CDG-Ia

4.3.3.1 Detection of R141H mutation

R141H results from a transition of G to A at nucleotide 422, in exon 5 of the PMM2 gene. This causes the conservative substitution at codon 141, of arginine (CGC) by histidine (CAG), which are both basic amino acids.

AAGAACGCATTGA

Normal

Patient TB

Figure 4.3: Sequencing of exon 5 of the PMM2 gene from a normal control and patient TB. (*) denotes the heterozygous G->A transition causing R141H

Patients from 9 of the 13 CDG-Ia families were heterozygous for R141H (Table 4.6) and it was the most frequent mutation observed in this study. R141H was confirmed by an ACRS PCR, which was designed to create a Bj/HKAI restriction site (Table 4.4).

108 Chapter 4 Results CDG-Ia

117 bp 88 bp

2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12.

Figure 4.4: Restriction enzyme digestion of ACRS PCR products with RsiHKA I to detect the R141H mutation. Lane 1, 100 bp ladder. Lane 2, Father of TB. Lane 3, Mother of TB. Lane 4, TB. Lane 5, JB. Lane 6, LB Lane 7, DC. Lane 8, CB. Lane 9, KF. Lane 10, LM. Lane 11, EW. Lane 12, Normal Control.

Genomic DNA from the patients and normal controls was amplified with the R141H

ACRS primer (Table 4.4) as the sense primer and with PMM2 exon5(-) as the anti sense primer (Table 4.1), which generated a /Jav HKA I restriction site in the presence of the mutation Therefore, as shown in Figure 4.4, digestion of PCR samples from patients heterozygous for R141H and digested with ^5/HKA I, resulted in the production of two bands, 88 bp and 29 bp (not seen), in addition to the normal undigested allele.

Digestion of the PCR product from normal controls and patients who were not heterozygous for R141 FI resulted in the production of only one band of 117 bp

(undigested).

The R141H mutation was also confirmed by this test in a patient JD (7), who was a heterozygote, and in the fathers of KF, JD, TS and JS (data not shown).

109 Chapter 4 Results CDG-Ia

4.3.3.2 Detection of F119L mutation

FI 19L results from a transversion of C to A at nucleotide 357 in exon 5 of the PMM2 gene. This change results in a conservative substitution at codon 119, of TTC

(phenylalanine) to TTA (leucine), which are both neutral and hydrophobic amino acids.

Normal

Patient KF

Figure 4.5: Sequencing of exon 5 of the PMM2 gene from a normal control and patient KF. (*) denotes the C ^ A transversion causing FI 19L

Three patients (JD, KF and LM) were heterozygous for FI 19L. This mutation creates a restriction site for the enzyme Tru 91, permitting confirmation of the presence of the mutation and carrier detection.

110 Chapter 4 Results CDG-Ia

< — 241 bp

< — 130 bp < — 111 bp < — 87 bp

1. 2 . 3. 4. 5. 6 .

Figure 4.6: Restriction enzyme digestion of exon 5 PCR products with Tru 91 to detect F119L mutation. Lanel, 100 bp ladder. Lane 2, LM. Lane 3, KF. Lane 4, Mother of KF. Lane 5, Normal Control. Lane 6, Uncut PCR product.

Exon 5 was amplified from genomic DNA from the patients and a normal control using

PMM2 exon5(+) and PMM2 exon5(-) primers (Table 4.1). Digestion with Tru 91 of

PCR products from normal individuals results in 2 bands of 130 bp and 111 bp (Lane 5,

Figure 4.6). When the mutation is present, the 130 bp band is cleaved to produce 2 bands of 87 bp and 24 bp (not seen). Tru 91 digestion of PCR products from patients heterozygous for FI 19L (Figure 4.6) shows 4 bands of 130 bp. 111 bp, 87 bp and 24 bp

(not seen). The mutation was also detected in the mother of patient KF (lane 4) and in the mother of patient JD (not shown).

I ll Chapter 4 Results CDG-Ia

4.3.3.3 Detection of D148N mutation

The D148N mutation is caused by a G to A transition at nucleotide 442 in exon 5 of the

PMM2 gene. This causes the non-conservative substitution at codon 148, of aspartic acid (GAT), an acidic amino acid, by asparagine (AAT), which is a neutral and polar amino acid.

GAACTCG AT

Normal

Patient LB

Figure 4.7: Sequencing of exon 5 of the PMM2 gene from a normal control and patient LB. (*) denotes the G-^A transition causing D148N

One patient (LB) was heterozygous for this mutation, which was subsequently reported as a novel mutation (Imtiaz et al., 2000).

112 Chapter 4 Results CDG-Ia

1. 2. 3. 4.

Figure 4.8: Restriction enzyme digestion of exon 5 PCR products with Taq I to detect D148N mutation. Lane 1, 100 bp ladder. Lane 2, LB. Lane 3, Normal. Lane 4, Normal Control.

D148N abolishes a Taq I restriction enzyme site and this was used as the basis of the confirmatory test for this mutation in the patient. Exon 5 of the PMM2 gene was amplified from genomic DNA of LB and normal controls were amplified for exon 5 of the PMM2 gene using PMM2 exon5(+) and PMM2 exon5(-) primers (Table 4.1).

Digestion of this product from normal controls with the Taq I restriction enzyme resulted in the production of two bands of 171 bp and 70 bp (Figure 4.8). Digestion of the PCR product from LB, who was shown to be heterozygous for D148N by sequencing analysis, resulted in the production of the two bands observed in the normal controls and in addition a band of 241 bp, corresponding to undigested material. This confirmed the presence of the mutation, D148N.

Using the same method, the mutation, D148N, was detected in the father but not the mother of LB.

113 Chapter 4 Results CDG-Ia

4.3.3 4 Detection of I132N mutation

I132N results from the transversion of T to A at nucleotide 395 in exon 5 of the PMM2 gene. This causes the non-conservative substitution at codon 148, of isoleucine (ATT), a neutral and hydrophobic amino acid, by asparagine (AAT), which is a neutral and polar amino acid.

Normal (reverse sequence)

I132N (reverse sequence)

Figure 4.9: Sequencing of exon 5 in the reverse direction of the PMM2 gene from a normal control and patient JR. (*) denotes the T ^A (A->T in the reverse sequence) transversion causing I132N

One patient (JR) in this study was heterozygous for this mutation, which was subsequently reported as a novel mutation (Imtiaz et a/., 2000). I132N was confirmed in the patient using an ACRS PCR method (Section 4.5.3), which was designed to create a Nla III restriction site.

114 Chapter 4 Results CDG-Ia

144 bp 112 bp

1. 2. 3.

Figure 4.10: Restriction enzyme digestion of ACRS PCR products with Nla III to detect I132N mutation. Lane 1, 100 bp ladder. Lane 2, JR. Lane 3, Normal Control.

Genomic DNA of JR and a normal control was amplified with the I132N ACRS primer

(Table 4.4) as the sense primer and PMM2 exon5(-) as the antisense primer (Table 4.1), which generated a Nla III restriction site in the presence of the mutation. Digestion of the PCR product from the patient resulted in the production of two bands of 112 bp and

32 bp (not seen), whereas digestion of the PCR product from the normal control resulted in the production of only one band of 144 bp (uncut).

115 Chapter 4 Results CDG-Ia

4.3.3.S Detection of F183S mutation

The F183S mutation is caused by a T to C transition at nucleotide 548 in exon 7 of the

PMM2 gene. This causes the non-conservative substitution at codon 183, of phenylalanine (TTT), a neutral and hydrophobic amino acid, by serine (TCT), which is a neutral and polar amino acid.

Normal

Figure 4.11: Sequencing of exon 7 of the PMM2 gene from a normal control and LB. (*) denotes the T-^C transition causing F1838

One patient (LB) was heterozygous for this mutation, which was subsequently reported as a novel mutation (Imtiaz et al., 2000). F I838 creates a BsmK I restriction enzyme site, which was used as the basis of the confirmatory test for this mutation in the patient.

116 Chapter 4 Results CDG-Ia

Undigested PCR product 180 bp 110 bp 90 bp 70 bp

1. 2. 3.

Figure 4.12: Restriction enzyme digestion of exon 7 PCR product with BsmA I to detect F183S mutation. Lanel, 100 bp ladder. Lane 2, LB. Lane 3, Normal control

Exon 7 of the PMM2 gene was amplified from genomic DNA of LB and a normal control using PMM2 exon7(+) and PMM2 exon7(-) primers (Table 4.1). Digestion of this product from normal controls with the BsmA I restriction enzyme resulted in the production of two specific bands of 180 bp and 90 bp (Figure 4.12). Digestion of the

PCR product from LB, who was shown to be heterozygous for F183S by sequencing analysis, resulted in the production of the two bands observed in the normal controls and two additional bands of 110 bp and 70 bp, which were produced by digestion of the

180 bp band, confirming the presence of the mutation.

117 Chapter 4 Results CDG-la

4.3.3 6 Detection of G208A mutation

G208A results from a transversion of G to C at nucleotide 623 in exon 7 of the PMM2 gene. This causes the non-conservative substitution at codon 208, of glycine (GGA), a neutral and polar amino acid, by alanine (GCA), a neutral and hydrophobic amino acid.

Normal

C T T-TG NAG ACAA

Patient JB

Figure 4.13: Sequencing of exon 7 of the PMM2 gene from a normal control and patient JB. (*) denotes the G ^ C transversion causing G208A

Two of the patients (JB and MC) were heterozygous for the mutation G208A. The mutation was confirmed in these patients using an ACRS PCR method (See Section

4.2.3), which was designed to create a Pst I restriction site.

118 Chapter 4 Results CDG-Ia

115 bp 84 bp

1. 2. 3. 4.

Figure 4.14: Restriction enzyme digestion of ACRS PCR products with Pst I to detect G208A mutation. Lane 1, 100 bp ladder. Lane 2, JB. Lane 3, Normal Control. Lane 4, Uncut PCR Product.

Genomic DNA from JB and a normal control was amplified with the G208A ACRS primer (Table 4.4) in the forward direction and the PMM2 exon7(-) primer in the reverse direction (Table 4.1), which generates a Pst I restriction site in the presence of the G208A mutation. As shown in Figure 4.14, digestion of PCR sample from the patient, JB who was heterozygous for G208A, resulted in the production of two bands of 115 bp (uncut-normal allele), 84 bp and 31 bp (mutant allele-not seen). In contrast, digestion of the PCR product from the normal control resulted in the production of only one uncut band of 115 bp.

The same restriction enzyme digestion ACRS assay was carried out on DNA from patient MC. This confirmed the presence of the mutation G208A in the heterozygous state, which had been detected by sequencing (results not shown).

119 Chapter 4 Resîdlts CDG-Ia

4.3.3.7 Detection of V231M mutation

The V23IM mutation is caused by a G to A transition of nucleotide 691 in exon 8 of the

PMM2 gene. This causes the conservative substitution at codon 231, of valine (GTG) by methionine (ATG), which are both neutral and hydrophobic amino acids

Normal

C T A C T C C ATG

Patient TB

Figure 4.15: Sequencing of exon 8 of the PMM2 gene from a normal control and patient TB. (*) denotes the G->A transition causing V231M

Five patients (CB, TB, VB, DC and KT) from four CDG-Ia families were shown by sequencing analysis to be heterozygous for the V231M mutation, which abolishes a

75/745 I restriction site.

120 Chapter 4 Results CDG-Ia

< — 174 bp 126 bp

< — - 48 bp

1. 2. 3. 4. 5.

Figure 4.16: Restriction enzyme digestion of exon 8 PCR products with Tsp4S I to detect V231M mutation. Lane 1, 100 bp ladder. Lane 2, Normal Control. Lane 3,EW. Lane 4, KT. Lane 5, TB.

Exon 8 of the PMM2 gene was amplified from genomic DNA of the patients using

PMM2 exonS(+) and PMM2 exonS(-) primers (Table 4.1). Digestion of this product from the normal control and the patient who did not have V231M (Lane 3) with the

TspAS I restriction enzyme resulted in the production of two bands of 126 bp and 48 bp

(Figure 4.16). Digestion of the PCR product from patients heterozygous for the V231M mutation resulted in an additional band of 174 bp, corresponding to the undigested product, confirming the presence of the mutation in this allele.

V231M was also confirmed in the mother but not in the father of TB and VB using the same method (data not shown).

1 2 1 Chapter 4 Results CDG-Ia

4.3.3.S Detection of T237M mutation

T237M results from a transition of C to T at nucleotide 710 in exon 8 of the PMM2 gene. This causes the non-conservative substitution at codon 237, of threonine (ACG), a neutral and polar amino acid, by methionine (ATG), which is a neutral and hydrophobic amino acid.

Normal

Patient EW

Figure 4.17: Sequencing of exon 8 of the PMM2 gene from a normal control and patient EW. * denotes the C ^T transition causing T237M

One patient (EW) was heterozygous for T237M, which abolishes a BstC I restriction site and was used as the basis of the confirmatory test for this mutation.

122 Chapter 4 Results CDG-Ia

174 bp 148 bp

1. 2. 3.

Figure 4.18: Restriction enzyme digestion of exon 8 PCR products with I to detect T237M mutation. Lane 1, 100 bp ladder. Lane 2, EW. Lane 3, Normal Control.

Exon 8 of the PMM2 gene was amplified from genomic DNA of EW and a normal control using PMM2 exon8(+) and PMM2 exon8(-) primers (Table 4.1). Digestion of this product from the normal control with the BstV I restriction enzyme resulted in the production of 2 bands of 148 bp and 26 bp (not seen)(Figure 4.18). Digestion of the

PCR product from the patient heterozygous for T237M, resulted in the production of the

148 bp and 26 bp bands observed in the normal control and an additional band of 174 bp, corresponding to the undigested material. This confirmed the presence of the mutation, since T237M abolishes the BstlJ I restriction enzyme site.

123 Chapter 4 Results CDG-Ia

4.3 3.9 Detection of 284delT mutation

A novel single base deletion, 284delT was found in codon 95 in exon 4 of the PMM2 gene in patient MC.

/\ Normal

\y Patient MC

Figure 4.19: Sequencing of exon 4 of the PMM2 gene from a normal control and patient MC. * denotes the deletion of T

One patient (MC) was heterozygous for this mutation, which causes the deletion of a T in the codon sequence CTA, which codes for leucine. This mutation causes a frameshift, which results in a premature stop after codon 98 in exon 4 and therefore must result in a truncated protein. This mutation was confirmed by sequencing exon 4 of the PMM2 gene in the reverse direction, using genomic DNA of MC (data not shown).

124 Chapter 4 ______Results ______CDG-Ia

4.3.4 Polymorphisms in intron 5

In addition to the mutations found in the PMM2 gene, two different polymorphisms were also detected in a number of patients, in the intron sequence following exon 5

(IVS5). The polymorphism, IVS5+19 C/T was detected in 20 of 30 chromosomes analysed whereas, IVS5+22 T/A was detected in 11 of 30 chromosomes analysed. Both are common polymorphisms and have been reported elsewhere (Bjursell et al., 2000;

Matthijs et al., 2000).

The presence of these two intronic polymorphisms initially interfered with the PCR amplification of exon 5. As mentioned in Section 4.2.2.1, new primer sequences were designed, in particular, for the antisense primer, using the sequence downstream of the intronic polymorphisms.

125 Chapter 4 ______Discussion ______CDG-Ia

4.4 Discussion

The identification of the genetic basis of CDG-Ia, by the localisation of the PM M 2 gene encoding an active PMM on chromosome 16 and the identification of mutations in this gene, has given conclusive support to the biochemical evidence that a deficiency of

PMM is the basis of CDG-Ia. In conjunction with clinical features, the diagnosis of

CDG-I can usually be made by the identification of aberrant serum transferrin patterns by isoelectric focusing. Definitive diagnosis of CDG-Ia is then based upon demonstrating a deficiency of PMM in fibroblasts or leukocytes. As the residual PMM activity in cultured fibroblasts of CDG-Ia patients may be up to 30% of the control value, it has been recently suggested that the enzyme assay should be performed on leukocytes, as the enzyme deficiency is more pronounced in these cells ^atthijs et al.,

1999). CDG-Ia patients have been identified with a partial deficiency (30-50%) of

PMM activity in leukocytes and mutation analysis has shown that the majority of this particular group of patients are heterozygous for a ‘milder’ mutation C241S (Jaeken et al., 1997b; Matthijs et al., 1998; Grünewald et al. 2001).

The residual PMM activity in the CDG-Ia patients in this study ranged from 0.0 to 0.25 nmol/min per mg of protein, corresponding to 0.7-9.0% of the mean of the normal controls (2.8 nmol/h per mg of protein, range 1.9-3.6). Thus, the problem of high residual PMM activity in fibroblasts and lymphoblastoid cells that has been reported by other groups was not seen. It was not possible to make an enzymic diagnosis in two patients (JS and TS, family 11) because no cellular material was available but mutation analysis confirmed the diagnosis of CDG-Ia.

126 Chapter 4 Discussion CDG-Ia

4.4.1 Type, distribution and frequency of mutations

Mutation analysis of the PMM2 gene was carried out on all of the patients with CDG-Ia by various methods, including SSCP analysis, direct sequencing and restriction enzyme digestion. Nine different mutations were found in the CDG-Ia patients, 8 of which were missense mutations. One novel deletion, 284delT in exon 4 of the PMM2 gene was the only other change found. Therefore, the detection of mutations in the CDG-Ia patients in our study confirms the enzymic diagnosis. A summary of the missense mutations found is shown in Table 4.7:

Exon cDNA Mutation Codon Amino Acid Number of nucleotide Change Change Occurrences number 5 357 CÂ TTC-^TTA F119L 3 5 395 T-Â ATTÂAT I132N* 1 5 422 GÂ CGC^CAC R141H 11 5 442 GÂ CGA^CAA D148N* 1 7 548 T-^C TTT—TCT F183S* 1 7 623 G-^C GGA^GCA G208A 2 8 691 GÂ GTG-ÂTG V231M 5 8 710 C^T ACGÂTG T237M 1

Table 4.7: Summary of missense mutations found in PMM2 gene (*) denotes novel mutation

All of the patients were compound heterozygotes. Two mutations were found in 11 of the 14 CDG-Ia families (Table 4.7), but only one mutation was found in two patients

DC, JR and in the siblings JS and TS, where DNA only from the father was available.

In the cases of DC and JR, all of the complete coding sequence and intron/exon boundaries of the PMM2 gene were sequenced in the forward and reverse directions.

The detection of the normal sequence ruled out the complete deletion of the gene in the other chromosome. This suggests that the other mutation may be located in the non-

127 Chapter 4 Discussion CDG-Ia coding regions of the PMM2 gene, which may affect normal splicing, or in the promoter region, which would affect transcription. In order to verify these possibilities, further investigation using mRNA analysis of the PMM2 gene would need to be carried out.

Patient Genotype PMM activity Clinical Mutation 1 Mutation 2 (nmol/min per mg of phenotype protein) normal (survival control: mean=2,7±0.7; <2yrs=severe; range: 1.9-3.8 >2yrs=mild) CB R141H V231M 0.18 severe JB R141H G208A 0.05 severe LB D148N F183S 0.05 mild TB R141H V231M 0.24 mild VB R141H V231M 0.02 mild DC - V231M 0.13 severe MC 284 del T G208A 0.07 severe JD R141H F119L 0.00 mild KF R141H F119L 0.10 mild LM R141H F119L 0.25 severe JR I132N - 0.23 severe JS R141H - N.D severe TS R141H - N.D severe KT R141H V231M 0.13 severe EW R141H T237M 0.05 mild

Table 4.8: Genotypes of CDG-Ia patients (N.D) denotes that the enzyme assay was not performed due to lack of patient sample Clinical phenotype was classified as either ‘severe’, where the patient died before the age of 2 years, or ‘mild’ if the patient survived over 2 years of age. (For a detailed clinical description of patients see Appendix Table A.1)

All of the missense mutations were found in exons 5, 7 and 8 of the PMM2 gene. These exons contain regions that are highly conserved in human PMM2, human PMMl, yeast

PMM (SEC53) and Candida albicans PMM genes (Matthijs et al, 19997b; Schollen et al, 1998; Imtiaz et al., 2000). All of the mutations caused an alteration to a conserved

or semi-conserved arnino acid, therefore supporting the idea that they are disease-

causing. Furthermore, none of novel mutations was found in 100 normal chromosomes

128 Chapter 4 ______Discussion ______CDG-Ia screened by SSCP analysis (Matthijs et al., 2000), indicating that they are not polymorphisms.

The R141H mutation was the most common mutation found (35% of alleles) where 9 of the 13 CDG-Ia families were heterozygous for this mutation. A high incidence of

R141H has been observed worldwide and it accounts for 37% of all reported mutant chromosomes (Matthijs et al., 2000). R141H has an incidence of approximately 1 in 80 in the normal Western European population (Matthijs et al., 1998b), but as yet, has not been found in the homozygous state (Matthijs et al., 1997a; 1998b; Schollen et al.,

1998; Carchon et al., 1999; Imtiaz et al., 2000; Matthijs et al., 2000). The residual activity of the R141H recombinant protein when expressed in vitro is almost zero

(Pirard et ai, 1999). This finding supports the hypothesis by Matthijs and colleagues

(1998a) that R141H is deleterious in the homozygous state, leading to fetal wastage, miscarriage or early death. Homozygosity for R141H may also give rise to a different phenotype. However, in view of the fundamental role of PMM2 in the normal functioning of the cell, it was hypothesized that the R141H/R141H genotype is lethal soon after conception. R141H is associated with a specific haplotype and it has been suggested that the mutation is the result of a single mutational event (Schollen et al.,

1998). R141H is caused by a CGC to CAC transition at a CpG dinucleotide, a hotspot for mutations.

The second most common mutation was V231M, found in 5 patients. V231M has been reported as the most common mutation found in exon 8 of the PMM2 gene and its presence has been reported worldwide (For review, see Matthijs et al., 2000).

129 Chapter 4 ______Discussion ______CDG-Ia

The third most common mutation was F119L, found in 3 patients. F119L has been reported to be the second most common CDG-Ia mutation found worldwide (Matthijs et al., 2000), accounting for 16% of all mutant chromosomes. Bjursell et al, (1997; 1998) have documented a clear founder effect for F119L in the Southern Scandinavian population, as in Denmark where the mutation accounts for 48% of the disease alleles

(Matthijs et al., 1999a; 2000). The proportion gradually decreases from north to south and the incidence varies between 17% in the Netherlands and 11% in Germany but has not yet been reported in Spain, Portugal or Italy. A patient homozygous for F119L has been reported (Matthijs et al., 1998; 2000) which is in accordance with the Hardy-

Weinburg equilibrium, whereas the lack of a patient homozygous for R141H is not. As the F119L/R141H genotype has been found in this and other investigations (Matthijs et al., 1998; 2000), it can therefore be concluded that the combination of the two most frequent disease mutations is not lethal.

4.4.2 Effect of mutations on PMM enzyme

Studies have been carried out to try to elucidate the effects of some of the mutations found in this investigation on the PMM activity. Pirard and colleagues (1999) generated seven mutant forms of PMM2 by site-directed mutagenesis and expressed the recombinant proteins in Escherichia coli. After purification, the activity of PMM was assayed in each of the mutant proteins. Kinetically, five of the mutations, F119L,

V129M, V231M, R162W and D65Y decreased the Vmax of PMM2 by 2- to 5-fold. In

F119L, this change was also accompanied by a marked decrease in the affinity for the substrate, Man-l-P and for the co-factor maimose 1,6-bisphosphate, whereas in other mutants, these effects were either absent (V129M, V231M) or modest (R162W). The

D65Y mutation showed a 1.7 fold increase in the affinity for the substrate. The two

130 Chapter 4 Discussion CDG-Ia remaining mutations D188G and R141H had a marked effect on the Vmax, which decreased to about 2 and 0.4% respectively of the control value. In the case of the

D188G mutant, this decrease was partially compensated for by a 3.5-fold increase in the affinity for the substrate, whereas for the R141H mutant, the decrease in Vmax was accompanied by approximately a 10-fold decrease in the affinity for mannose 1,6- bisphosphate.

The thermal stability of the mutant and wild-type recombinant PMM2 enzymes was also investigated at different temperatures. The mutant proteins were significantly less stable than the wild-type enzyme, with the V231M mutant, being the least stable (Figure

4.20). The R141H and F119L mutant enzymes were also very unstable.

WT 100

>• 80 > o < 01SBG S 60 s R162W 0.

5 i 20 R141H, V2$1 D«5Y

0 1 0 20 3 0 T im e (m ln )

Figure 4.20: Thermal stability of wild-type and mutant forms of PMM2 Enzymes were incubated for the indicated times at 40°C (from Pirard et al., 1999)

Overall, R141H was the mutation shown to affect most the Vmax of PMM and its affinity for Man-l-P and mannose 1,6-bisphosphate. The R141H mutation destabilises the enzyme, therefore Pirard and colleagues concluded that it must lead to a virtually inactive protein in vivo. This probably explains why this has never been observed in the

131 Chapter 4 ______Discussion ______CDG-Ia

homozygous state, whereas patients have been found, who are homozygous for other mutations (D65Y, F119L) (Matthijs et al., 1998; Bjursell et al., 1998). Similar

investigations have also reported that the activity of the R141H mutant protein to be

undetectable compared to the activity of the normal enzyme when expressed in vitro

(Kjaergaard et al., 1999; Vuillaumier-Barot et al., 2000; Westphal et al., 2001).

The existence of patients with the F119L/R141H genotype, including three in this study,

is interesting because the R141H mutant protein is almost inactive and the F119L

mutant protein has one of the lowest PMM activities. This suggests that the small

amount of residual activity associated with the F119L allele is sufficient to prevent fetal

death. The existence of FI 19L/F119L homozygotes supports this conclusion.

The D148N mutation, found in one patient in this investigation (LB) has been expressed

using PMM-deficient S. cerevisae and its activity was measured in the extracts

(Westphal et al., 2001). It was reported to be a severe mutation and the activity of the

D148N mutant protein was approximately 10% of the normal enzyme. The genotype of

patient LB is D148N/F183S and the residual activity the patient’s fibroblasts was shown

to be 0.05 nmol/min per mg of protein. The clinical phenotype of LB is mild, as she has

survived beyond 2 years of age, which suggests that the F183S must be a mild mutation

which is paired to the severe D148N mutation, giving rise, in this case to a less severe

phenotype.

In this investigation, the most common genotype observed was V231M/R141H, which

was found in 3 families.

132 Chapter 4 ______Discussion ______CDG-Ia

4.4.3 Genotype/phenotype correlation

A strong correlation between residual PMM activity, clinical severity and genotype was not evident for our patients (Table 4.8). For our patients, for instance, siblings TB and

VB both have the V231M/R141H genotype, have both survived to over the age of 11

years but have markedly different residual PMM activities (0.24 and 0.02 nmol/min per mg of protein, respectively). In contrast, KT and CB, who had the same genotype, had

PMM residual activities of 0.18 and 0.13 nmol/min per mg of protein, respectively, were diagnosed clinically with the severe form of the disease and died before the age of

2 years. This was also seen in a patient (KF) with the V231M/R141H genotype, who

has a mild phenotype and is still alive, whereas LM, another patient with the same

genotype had a severe phenotype and died at 6 months of age. Interestingly, KF has a

lower residual PMM activity when compared to that of LM.

In conclusion, these findings suggest that the severity of the disease cannot be solely

determined by the PMM2 mutant alleles, but that other genes together with

environmental factors may modulate the effect of the PMM2 mutations and the clinical

diversity in some way. As a result, the PMM2 genotype is of little use in prognosis.

However, mutational analysis is a very useful method for confirming the diagnosis of

CDG-Ia, including prenatal diagnosis and is invaluable for carrier testing.

133 Chapter 5______Introduction ______CDG-Ib and Ic

Chapter 5

Molecular genetic and biochemical analysis of CDG-Ib and

CDG-Ic subtypes

5.1 Introduction

Two U.K patients, AH and BB, who presented with various clinical symptoms (Section

3.2.1, Chapter 3) had abnormal isoelectric focusing patterns for serum transferrin and were also shown to have normal PMM activities (Table 3.1, Chapter 3) were diagnosed on the basis of enzymic analysis with CDG-Ib and Ic, respectively.

BB presented with episodic severe protein-losing enteropathy, which is characteristic of patients with CDG-Ib, in addition to having milder CDG-I clinical symptoms compared with typical CDG-Ia patients. This patient was investigated further in collaboration with Professor Hudson Freeze, The Burnham Institute, California.

Analysis of the lipid-linked oligosaccharide indicated the accumulation of

MangGlcNAcz-PP-Dol and a deficiency of a -1,3 glucosyltransferase was found in cultured fibroblasts of this patient. The patient was diagnosed with CDG Ic.

5.2 Aims

The main aim of the work described in this chapter was to perform mutation analysis of

AH and BB, for the specific disease-causing genes to each patient using various molecular genetic techniques.

134 Chapter 5______Results ______CDG-Ib and Ic

5.3 CDG-Ib

5.3.1 Patient information and material

The patient described (AH) was referred from St. James’s University Hospital, Leeds, for biochemical and genetic investigation, detailed in this section, following a clinical diagnosis and transferrin isoelectric focusing suggesting CDG (see Chapter 3, Section

3.2.1). The patient samples used were either obtained from whole blood or fibroblasts.

Part of this work has been published (Schollen et al., 2000; Hendriksz et al., 2001).

5.3.2 Analysis of cDNA

5.3.2.1 Preparation of cDNA cDNA was synthesised from mRNA from AH and a normal control as described in

Section 2.3.2 (Chapter 2). Its quality was assessed by performing RT-PCR on each sample using primers designed to amplify the hypoxanthine phosphoribosyltransferase gene (HPRT), which encodes a purine salvage enzyme that catalyses the conversion of hypoxanthine and guanine to their respective nucleotides (Mai et al., 1998). HPRT is known as a “housekeeping” gene due to its ubiquitous nature and can therefore be used as an internal control in the quantification of the synthesised cDNA.

The primers used for amplification of the HPRT gene were HPRT(+) (5’-

CCACGAAAGTGTTGGATATAAGC-3’) in the forward direction and HPRT(-) (5’-

GGCGATGTCAATAGGACTCCAGATG-3 ’) in the reverse direction. The primers were synthesised and purified by MWG-Biotech.

135 Chapter 5 Results CDG-Ib and Ic

A standard reaction was carried out in a total volume of 25 ^1 in 0.5 ml Eppendorf tubes and each reaction contained 2.5 pi of cDNA, 2.5 pi of 10 pmol of each of the HPRT sense and antisense primer, 1.5 mmol/1 of MgClz, 0.2 mmol/1 dATP, dCTP, dGTP and dTTP, 1 X ammonium reaction buffer (160 mM (NH 4 )2 SO4 , 0.67 M Tris-HCl (pH 8.8),

0.1 % (v/v) Tween-20, 50 mM MgCb) and 0.5 pi (2.5 units) of BioPro DNA

Polymerase (Bioline). Each reaction was overlaid with 30 pi of mineral oil to minimize evaporation. Amplification was carried out on a Biometra TRIO-Thermoblock. A reaction containing all of the components of the reaction mix but without cDNA template was prepared as a control to check for possible contamination.

The cycling conditions were 5 min at 95°C, with the Taq DNA polymerase added after a

“hot start”, followed by 30 cycles of amplification of 30 s at 95°C; 30 s at 56°C; one min at 72°C and a final extension at 72°C for 10 min.

The products were analysed by electrophoresis in an agarose gel (1.5% w/v) as described in Section 2.3.5.2. Detection of a band of approximately 205 bp, size of the

HPRT gene product, indicated that the integrity of the cDNA was sufficient to carry out amplification of the MPI gene in the patient and normal control samples.

205 bp

1 . 2. 3. 4.

Figure 5.1: cDNA of a normal control and AH amplified by HPRT specific primers Lane 1, 100 bp ladder. Lane 2, Normal Control. Lane 3, negative control for normal control RT-PCR. Lane 4, AH. Lane 5, negative control for AH RT-PCR.

136 Chapter 5______Results ______CDG-Ib and Ic

S.3.2.2 Amplification of cDNA for the MPI gene by PCR cDNA was produced from RNA extracted from cultured fibroblasts from patient AH for the analysis of theMPI gene. The nearly full-length MPI coding region was amplified using the synthesised cDNA (Section 2.3.2) and primers described by Niehues et ai,

(1998). The primers used for amplification of the MPI gene were PMI-8F (5’-

CTCCGCGAGTATTCCCACTT; positions 8-27) in the forward direction and PMI-

1321R ( 5 -CCCGAGGAGGTGAGGTTG; positions 1321-1338) in the reverse direction. The primers were synthesised by Sigma-Genosys.

5.3 2.3 Conditions of PCR

All of the reagents and reactions were prepared and carried out under sterile conditions within a designated area of the laboratory. A standard PCR reaction was carried out typically in a total volume of 25 pi in 0.5 ml Eppendorf tubes according to the method described by Saiki et al (1985). Each reaction contained 2.5 pi of cDNA, 2.5 pi of 10 pmol of each of the sense and antisense primers, 1-1.5 mmol/1 of MgCh, 0.2 mmol/1 dATP, dCTP, dGTP and dTTP, 1 x ammonium reaction buffer (160 mM (NH 4 ) 2 SO4 ,

0.67 M Tris-HCl (pH 8.8), 0.1 % (v/v) Tween-20, 50 mM MgClz) and 0.5 pi (2.5 units) of BioPro DNA Polyiherase (Bioline). Each reaction was overlaid with 30 pi of mineral oil to minimise evaporation. Amplification was carried out on a Biometra TRIO-

Thermoblock. A reaction containing all of the components of the reaction mix but without cDNA template was prepared as a control to check for possible contamination.

Typical cycling conditions were 5 min at 94°C, with the Taq DNA polymerase added after a “hot start”, followed by 35 cycles of amplification of one min at 94°C; one min at 57 - 62°C; one min at 72°C and a final extension at 72°C for 10 min.

137 Chapter 5 Results CDG-Ib and Ic

The PCR products were analysed by electrophoresis in an agarose gel (1.5% w/v) as described in Section 2.3.5.2.

1. 2. 3. 4. 5. 6.

Figure 5.2 Amplification of MPI gene using normal control and AH cDNA and varying concentrations of MgCh

Lane 1, 1 Kb ladder. Lane 2, Normal control-1.0 mM MgCb. Lane 3, Normal control-1.5 mM MgCb. Lane 4, AH-1.0 mM MgCb. Lane 5, AH-1.5 mM MgCb. Lane 6, negative control.

The results of this work were inconclusive because non-specific bands were produced after PCR. This was a recurring result even after a number of different PCR experimental conditions were applied, including changes in temperature and MgCb concentration. Due to the failure of cDNA analysis of the MPI gene, genomic DNA

analysis was performed.

5.3.3 Amplification of genomic DNA for the MPI gene by PCR

Genomic DNA was extracted from whole blood as described in Section 2.3.3.

Exon 4 of the MPI gene was amplified using intronic primer sequences kindly made

available to us by Dr. Gert Matthijs prior to publication (Schollen et ai, 2000). The

138 Chapter 5______Results ______CDG-Ib and Ic primers used for amplification of exon 4 were PMI-4F

(TGGCACTGGTGTACCTGCTA) in the forward direction and PMI-4R

(CTGTGACATGTGACCCGTTC) in the reverse direction. The primers were synthesised by Sigma-Genosys.

5.3.3.1 Conditions of PCR

PCR reactions were carried out a described in Section 2.3.5.1 using 1.5 mmol/1 of

MgCli The cycling conditions were 10 min at 96°C, with the Taq DNA polymerase added after a “hot start”, followed by 35 cycles of amplification of one min at 9^C; one min at 68°C; one min at 72°C and a final extension at 72°C for 10 min. The PCR products were analysed and sequenced using the Big-Dye™ Terminator sequencing chemistry as described in Section 2.5.

5.3.3.1.1 Results of sequencing exon 4 of the MPI gene

AH was shown to be homozygous for the mutation, D131N, which is caused by a G to

A transition at nucleotide 391 in exon 4 of the MPI gene. This mutation results in a substitution of aspartic acid (GAT) by asparagine (AAT) at codon 131.

139 Chapter 5 Results CDG-Ib and Ic

N G C C ■■ C

GAT

¥i Normal

■ G C Cm -C

AAT

D131N Homozygous

Figure 5.3: Sequencing of exon 4 of the MPI gene from a normal control and patient AH. (*) denotes the homozygous G ^ A transition causing D13 IN

The presence of the D131N mutation was confirmed by sequencing in the reverse direction.

Normal (reverse)

G C A G G G

D131N (reverse)

Figure 5.4: Sequencing of exon 4 of the MPI gene in the reverse direction from a normal control and patient AH. (*) denotes the homozygous C-^T (G->A in the forward sequence) transition causing D131N

140 Chapter 5 Results CDG-Ib and Ic

Carrier testing was performed on the parents of AH and subsequently on the twin siblings bom after AH was diagnosed with CDG-Ib. The parents and the twin siblings of AH were all shown to be heterozygous for D131N, by sequencing of exon 4 of the

MPI gene (Figure 5.5).

GAT

Normal

G-AI G C C A A C

AAT

D131N (heterozygous)

Figure 5.5: Sequencing of exon 4 of the MPI gene from a normal control and AH family members. (*) denotes the heterozygous G ^ A transition causing D13 IN

5.3.3.2 Confirmatory test for the D131N mutation

The results of the mutation analysis by automated sequencing of exon 4 of the MPI gene of AH and family were confirmed using a restriction digestion method specific for the

013 IN mutation. As the sequence change detected in the patient sample did not alter or create a restriction enzyme digestion site, ACRS PCR was used. The sense primer was designed to introduce a base change in the codon where the mutation was found, in order to abolish a Taq I restriction site (Table 5.1). The ACRS primer was synthesised and purified by Genosys

141 Chapter 5 Results CDG-Ib andic

Mutation Sense Primer Anti Product Annealing MgCb Restriction sense Size temp cone enzyme Primer (bp) CO (mmol/1) (fragment sizes in presence of D131N)(bp) D131N CTGCACCTCCAGGC PMI- 230 64 1.5 -Taq I TCCGCAGCACTACC 4R 200 + 30 TC (normal = 230)

Table 5.1: Primers and PCR conditions for ACRS reaction for detection of D131N mutation T = base change in the codon specific for ACRS primer

The ACRS primer was designed specifically to create a Taq I restriction site (TiCGA) in the normal sequence and in the presence of the mutation, this site was abolished due to the transition of G to A:

Normal sequence ACCCCGAT ACRS Primer ACCTCGAT Normal sequence ACCTCGAT (when amplified with ACRS primer) D131N sequence ACCTCA AT (when amplified with ACRS primer)

Table 5.2: Principle of D131N ACRS PCR on creation of Taq I restriction site T= base change in the codon specific for ACRS primer, underlined text = Taq I restriction site, A= base transition causing D131N mutation

The ACRS PCR products were incubated with Taq I restriction enzyme at 65°C for 2 h and then analysed by electrophoresis on a 4% (3% Nusieve™ and 1% agarose w/v) gel.

Since the expected fragments only had a difference in size of 30 bp, a higher density gel was required to ensure adequate separation of the bands after Taq I digestion.

142 Chapter 5 Results CDG-Ib andIc

230bp 2 0 0 bp

1. 2. 3. 4. 5. 6. 7. 8.

Figure 5.6: Restriction enzyme digestion of MPI exon 4 PCR products to detect D131N mutation. Lanel, 100 bp ladder. Lane 2: AH - D131N homozygote. Lane 3; Mother of AH - D131N heterozygote. Lane 4; Father of AH - D131N heterozygote. Lane 5: Sibling 1 of AH - D131N heterozygote. Lane 6: Sibling 2 of AH - D131N heterozygote. Lane 7: Normal Control. Lane 8; Uncut PCR Product.

Genomic DNA from AH, her family and a normal control were amplified with the

D131N ACRS primer (Table 5.1) in the forward direction and by MPI exon4R (-) in the reverse direction and digested with Taq I (Figure 5.6). Digestion of the PCR product from AH, who is homozygous for D131N, resulted in the production of a band of 230 bp (Lane 2), similar to the undigested PCR product (Lane 8). Digestion of the PCR product from the normal control resulted in the production of a band of 200 bp and 30 bp (not seen) (Lane 7). Digestion of the PCR products from the four family members of

AH, mother, father and two siblings, who were heterozygous for D131N, resulted in three bands, a digested band of 200 bp, an undigested band of 230 bp and one band of

30 bp (not seen). This confirmed that they were heterozygous for the D131N mutation.

The D131N mutation was not found in genomic DNA of 50 normal individuals screened by SSCP analysis (Schollen et a i, 2000).

143 Chapter 5______Remits______CDG-Ib andic

5.3.4 Oral mannose therapy for the CDG-Ib patient

Oral mannose therapy of AH was carried out at St. James’s University Hospital, Leeds.

It was started at lOOmg/kg/dose of oral mannose (SHS International Ltd.) five times daily when the patient was 1.5 years old and increased to 150mg/kg/dose daily after 7 days with no ill effect. The patient’s episodes of diarrhoea and vomiting became less severe (Hendriksz et al., 2001). AH did not become hypoglycaemic and could be managed at home with oral electrolyte solutions and mannose. Her thrombotic tendency screen returned to normal within 10 days of starting the mannose therapy and over the next 5 months her transferrin pattern was also shown to improve. Her growth and development are progressing normally now at 5 years old. Her transferrin pattern improved over time with oral mannose treatment as shown in Figure 5.7. This work was carried out by Dr. Geoff Keir (National Hospital for Neurology and Neurosugery), who kindly allowed it to be reproduced in this thesis.

1 2 3 4 5 6 7 8

" # m

Senim CSF Father Mother 6/98 11/98 4/99 11/99 Serum I CSF Father Mother 6/98 11/98 4/99 11/99 Proband I Proband

Native transferrin electrophoresis Post-neuraminidase

Figure 5.7: Analysis of transferrin glycoforms of AH before and after treatment with oral mannose.

Lane 1: Normal serum; Lane 2; Normal cerebrospinal fluid; Lane 3: Serum of father-carrier; Lane 4; Serum of mother-carrier. Lane 5; Proband- (6/98) first serum sample suggesting CDG Ib; Lane 6; Proband- (11/98) second sample confirming hypoglycosylation (arrow indicating band of asialotransferrin becoming less apparent with treatment with oral mannose); Lane 7: Proband- (4/99) after 5 months of treatment; Lane 8: Proband-after one year of treatment.

144 Chapter 5______Results ______CDG-Ib and Ic

Treatment of samples with neuraminidase proved that the charge heterogeneity observed before treatment was not due to differences in the primary sequence of the amino acids in the protein.

5.4 CDG-Ic

5.4.1 Patient information and material

The clinical details of BB are presented in Section 3.2.1 and the biochemical and genetic study of this patient carried out during this project have been published

(Westphal et al., 2000a). Fibroblasts and serum were available.

5.4.2 Enzymic assays

PMI, PMM and PGM were assayed in the cultured fibroblasts of the patient are described in Section 2.3. Four additional enzyme activities; GDP-mannose- pyrophosphorylase, dolichol-phosphate-mannose-synthase, a-glucosidase I and glutamine-fructose-6-phosphate-amidotransferase were assayed in the cultured fibroblasts of this patient in the course of trying to identify the enymic defect of this patient. The results of this work are presented in Chapter 6.

5.4.3 Amplification of genomic DNA for the hALG6 gene by PCR

Genomic DNA was extracted from fibroblasts as described in Section 2.3.3.

A common mutation, A333V, in exon 11 of the hALG6 gene was discovered in CDG-Ic patients during the course of this project. Therefore, exon 11 of the ALG6 gene was amplified using intronic primer sequences kindly made available to us by Professor

145 Chapter 5______Results ______CDG-Ib and Ic

Hudson Freeze. The primers used for amplification of exon 11 were ALG6-11(+) (5’-

GCTTTAATAAACTTTCAACTTTCATTTG) in the forward direction and ALG6-11(-)

(S’-CATTTGTGTAGTTTTGTTTTGCATTC) in the reverse direction. The primers were synthesised by Sigma-Genosys.

5.4.3.1 Conditions of PCR

PCR reactions were carried out a described in Section 2.4.3 using 1.5 mmol/1 of MgCli

The cycling conditions were 10 min at 96°C, with the Taq DNA polymerase added after a “hot start”, followed by 35 cycles of amplification of one min at 9^C; one min at

66°C; one min at 72°C and a final extension at 72°C for 10 min. The PCR products were analysed and sequenced using the Big-Dye™ Terminator sequencing chemistry as described in, Section 2.5.

5.4.4 Enzymic analysis of BB (CDG-Ic)

The patient BB, was also being studied in parallel by the laboratory of Professor

Hudson Freeze. Cultured fibroblasts of BB were assayed for PMM, PMI and PGM activities (see Table 3.1, Chapter 3). The activities of cultured fibroblasts for PMM,

PMI and PGM activities in fibroblasts from patient BB were all within the normal control range. Concurrently, the laboratory of Professor Hudson Freeze reported that

BB had a deficiency of the Dol-PP-Man^GlcNAc 2 -a-1,3 glucosyltransferase enzyme, indicating a diagnosis of CDG-Ic. Further genetic analysis was subsequently carried out on the hALG6 gene, which codes for this enzyme, for confirmation of this diagnosis.

146 Chapter 5 Results CDG-Ib andic

5.4.5 Mutation Analysis of BB

BB was shown to be heterozygous for the mutation A333 V, which is caused by a C to T transition at nucleotide 998 in exon 11 of the hALG6 gene. This mutation causes the conservative substitution at codon 333, of alanine (GCG) by valine (GTG), which are both neutral and hydrophobic amino acids.

Normal

G G C 6 C T A

A333V

Figure 5.8: Sequencing of exon 11 of the ALG6 gene from a normal control and patient BB. (*) denotes the heterozygous C ^ T transition causing A333 V

The mutation A333V abolishes a Hha I restriction enzyme site and this was used as the basis of the confirmatory test for this mutation in the patient and subsequently in the mother of BB, who was shown to be heterozygous for A333V by sequencing (data not shown).

147 Chapter 5 Results CDG-Ib andic

270 bp

164 bp 106 bp

1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11.

Figure 5.9: Restriction enzyme digestion of ALG6 exon 11 PCR products to detect A333V mutation. Lane 1, 100 bp ladder. Lane 2: KS - normal. Lane 3: Mother of KS - normal. Lane 4: Father of KS - normal. Lane 5: NH - normal. Lane 6: RM - normal. Lane 7: AU - normal. Lane 8: BB - A333V heterozygote. Lane 9; Normal Control. Lane 10; Uncut PCR Product. Lane 11: 100 bp ladder

Exon 11 of the hALG6 gene was amplified from genomic DNA of BB, various other patients and a normal control using ALG6 exonll(+) and ALG6 exonll(-) primers

(Section 5.4.3). Digestion of the PCR product from the normal control and patients without the A333V mutation with the Hha I restriction enzyme resulted in the production of two bands of 164 bp and 106 bp (Lanes 2-7, Fig. 5.9). Digestion of the

PCR product from BB (Lane 8), who was shown to have A333V by sequencing analysis, resulted in the production of the two visible bands, one of 164 bp, in addition to a band of 270 bp corresponding to the undigested material. This confirmed that BB was heterozygous for the A333V mutation, which abolishes the Hha I restriction enzyme site.

During the course of my project, BB was also shown to have two other mutations in the

ALG6 gene, Y131H and S308R that were inherited paternally (Westphal et at., 2000).

148 Chapter 5______Discussion ______CDG-Ib and Ic

5.5 Discussion

The two patients with CDG-I isoelectric patterns of serum transferrin, similar to those

seen in CDG-Ia (PMM-deficient) patients were referred and investigated using various biochemical and genetic methods.

5.5.1 CDG-Ib patient, AH

The first patient, AH, had physical characteristics that were typically seen in patients

with CDG-Ia (PMM-deficient), for example, inverted nipples and fat pads. She also

presented with clinical symptoms that have been reported in patients with CDG-Ib, such

as hypoglycaemia, protein-losing enteropathy, diarrhoea, cyclic vomiting, liver

dysfunction and hepatic fibrosis (de Koning et al., 1998; Niehues et al., 1998; Jaeken et

al., 1998; de Lonlay et al., 1999). As with other CDG-Ib patients, AH did not present

with mental retardation, neuropathy or ataxia, which are characteristic of patients with

CDG-Ia. Enzyme analysis of the patient’s cultured fibroblasts demonstrated only 30%

of phosphomaimose isomerase activity (6.12 nmol/min/mg of protein) of normal control

fibroblasts (23 nmol/min/mg of protein). This residual activity in AH is higher

compared to other patients with CDG-Ib, but this does not indicate that she would

therefore present with a milder phenotype in comparison to other CDG-Ib patients with

lower residual activities of PMI. For example, the oldest reported patient with CDG-Ib

is 34 years old and presented with fever, vomiting and diarrhoea at 2.5 years of age, but

recovered completely with anticoagulation therapy. This patient has about 17% PMI

activity in cultured fibroblasts compared with normal controls and has normal

psychomotor development. Currently she has no health problems, eats a normal diet

and has delivered three healthy children after uneventful pregnancies.

149 Chapter 5______Discussion ______CDG-Ib and Ic

Initially in AH, a diagnosis of CDG-Ib was made on the enzymology and was confirmed using genetic analysis of the MPI gene, which encodes phosphomannose isomerase. Mutation analysis by direct sequencing of the MPI gene showed that the patient was homozygous for the novel mutation, D131N, which was confirmed by a specific restriction digestion experiment. D131N is a missense mutation and affects an amino acid that is conserved between human, mouse and Candida albicans. The

D131N mutation results in the substitution of aspartic acid (GAT) by asparagine (AAT) in codon 131 of exon 4 of the MPI gene. Aspartic acid is acidic and asparagine is a neutral and polar amino acid, therefore D131N may affect the overall ionic bonding of the protein. However, this mutation does not result in the generation of a new glycosylation site. The X-ray crystal structure of PMI iiomCandida albicans has been characterised and it shows that the enzyme has three distinct domains. The active site lies in the central domain, contains a single zinc atom and forms a deep, open cavity of suitable dimensions to contain mannose-6-phosphate or fructose-6-phosphate (Cleasby et al., 1996). The x-ray structure of mammalian or human PMI has not yet been determined. To date, 13 different mutations have been found in ten patients with CDG-

Ib (Schollen et al., 2000; Westphal et al., 2001), where 11 of the 13 mutations are missense mutations and the remaining two are a splice mutation (IVS4-1G>C) and one insertion (c.l66-167insC). Expression studies to try and elucidate the effect of these mutations on PMI activity have not yet been carried out.

The combined enzymatic and genetic results confirmed the diagnosis of CDG-Ib.

Subsequent mutation analysis showed that the parents of AH were carriers of D131N as well as the patient’s twin siblings who were bom after the index case and were therefore not affected.

150 Chapter 5______Discussion ______CDG-Ib and Ic

AH was successfully treated using oral mannose therapy and was shown to respond to mannose supplementation within 10 days of the initial onset of treatment (Hendriksz et al, 2001) with clinical improvement in addition to the normalization of anti-thrombin

III and protein C levels. As shown in Figure 5.7, serial electrophoretic analysis of the patient’s serum transferrin showed a gradual improvement to a nearly normal pattern after 5 months of the treatment. Niehues et al (1998) were the first to successfully treat a patient with CDG-Ib using oral mannose therapy and the normalisation of the serum transferrin patterns of AH after treatment has provided further evidence that oral mannose therapy improves the clinical and biochemical abnormalities seen in patients with CDG-Ib. Several reports have indicated that other patients, especially young ones, have also responded well to mannose therapy (Babovic-Vuksanovic et al., 1999; de

Lonlay et al., 1999). On the other hand, patients that are closer to adult age have not required (or complied with) mannose therapy and yet seem to do relatively well (de

Koning et al., 2000; Westphal et al., 2001). This finding suggests that the stress of growth in childhood rnay be overwhelming to the glycosylation pathway.

As described previously, in PMI-deficient (CDG-Ib) patients, the conversion of fructose-6-phosphate into mannose-6-phosphate is severely impaired. However, hexokinase provides an alternative pathway for mannose-6-phosphate formation from mannose. As the dietary intake of mannose is not substantial enough for normal glycosylation to occur, oral mannose supplementation provides intracellular mannose and mannose-6-phosphate by bypassing the defect catalysed by PMI.

151 Chapter 5______Discussion ______CDG-Ib and Ic

Glucose ------► Glucose-6-P ^ Fructose-6-P

^ PMI hexokinase Mannose ------► Mannose-6-P I PMM

Mannose-1-P i A^-linked glycosylation of proteins

Figure 5.10: Simplified diagram illustrating both the defect in CDG-Ib and the method by which added mannose is able to bypass this block in the metabolic pathway in the synthesis of TV-linked glycoproteins

Mannose treatment has not been successful in CDG-Ia (PMM-deficient patients), which is due to the fact that the supplemented mannose cannot enter the metabolic pathway without the conversion of Man-6-P to Man-l-P (Figure 5.10).

5.5.2 CDG-Ic patient, BB

Enzymic analysis of cultured fibroblasts were also carried out on the second patient,

BB, who had a CDG-I isoelectric pattern of serum transferrin comparable to those seen in patients with CDG-Ia and Ib. Activities of PMM, PGM and PMI were all shown to be within the normal control range (Table 3.1). BB was reported to have a milder clinical phenotype than patients described with CDG-Ia, in that he was mentally retarded and had seizures but did not present with cerebellar hypoplasia and the typical dysmorphic features. This clinical presentation is similar to other patients that have been reported with CDG-Ic. However, BB did present with profound protein-losing enteropathy, which is a characteristic clinical symptom seen regularly in patients with

CDG-Ib. BB was being studied in parallel by another group and was subsequently confirmed by Professor Hudson Freeze, to have a deficiency of the Dol-PP-

152 Chapter 5______Discussion ______CDG-Ib and Ic

MançGlcNAcz-a-1,3-glucosyltransferase enzyme, indicating a diagnosis of CDG-Ic. A deficiency of this enzyme, located in the endoplasmic reticulum, causes the accumulation of non-glucosylated Dol-PP-Man 9GlcNAc2 , that lacks the three terminal glucose residues required for optimal recognition and is therefore inefficiently transferred to the nascent protein by the oligosaccharyltransferase complex. To date,

about 20 patients have been characterised with a deficiency of a-1,3-glucosyltransferase

and eight mutations have been found in the human ALG6 gene that encodes the a-1,3-

glucosyltransferase enzyme (For reviews see Schachter, 2001; Freeze, 2001). Mutation

analysis of this gene indicated that BB was heterozygous for the A333V missense

mutation found in exon 11, which results in an amino acid substitution of alanine

(GCG) to valine (GTG). In collaboration with the laboratory of Professor Hudson

Freeze, BB was also found to have two mutations, Y131H and S308R on the paternal

allele (Westphal et al, 2000a). Both of these mutations result in the substitution of

neutral and polar amino acids (tyrosine and serine) to amino acids that are basic

(histidine and arginine).

Patients with CDG-Ic have been reported that are homozygous for the A333V mutation

(Imbach et al., 2000; Grünewald et al., 2000) and complementation analysis in S.

cerevisiae àalgô and alg6wbpl-2 mutant strains (Runge et al., 1984; Reiss et al., 1996)

was carried out to investigate the impact of A333V on ALG6 function (Imbach et al.,

2000). These two yeast strains were transformed with yeast expression plasmids

harbouring the human wildtype and mutant ALG6 cDNA. Two phenotypes were

assessed; the glycosylation of the vacuolar protein carboxypeptidase complex (CPY)

and the growth capacity of alg6wbpl-2 double mutant yeasts. The CPY normally has

153 Chapter 5______Discussion ______CDG-Ib and Ic four AT-linked oligosaccharide chains and alg6 strains produce stable CPY species lacking one or two chains and the wbpl-2 mutation affects a subunit of the oligosaccharyltransferase complex (te Heesen et al., 1992). Neither mutation is lethal, but they are conditionally lethal when combined. Using various human genes to rescue the conditional lethality provides a sensitive growth-based assay, which can be accurately measured based on the degree of CPY glycosylation Çmbach et al., 1999;

2000; Westphal et al., 2000a, b). Previous investigations have shown that the human

ALG6 gene was able to partially complement the hypoglycosylation of CPY observed in

Aalg6 yeasts. However, the cDNA with the A333V substitution failed to restore the glycosylation defect, confirming that the mutation severely impairs ALG6 protein function. A333V is a commonly found mutation in patients with CDG-Ic and the high frequency may be attributed to the fact that it is found in a CpG dinucleotide, a hotspot for mutations. The detrimental effect of A333V on ALG6 function is interesting as the mutation causes the conservative substitution of alanine for valine, both of which are neutral and hydrophobic.

It would seem impertinent to suggest any genotype-phenotype correlations as there are

still too few published cases of CDG-Ic and the proportion of abnormal, non-

glucosylated precursor oligosaccharides can vary from 2 0 % to 1 0 0 % in patients with

characterised mutations in the hALG6 gene. In conclusion, the combined enzymatic and

genetic results confirmed the diagnosis of CDG-Ic in the patient, BB.

154 Chapter 6______Introduction ______CDG-Ix

Chapter 6

Molecular genetic and enzymological investigations on

uncharacterised CDG-I patients (CDG-Ix)

6.1 Introduction

6.1.1 Other potential enzymic defects leading to CDG-I

Patients from 13 families have been shown to have CDG-Ia (Chapter 4) and a further two were diagnosed with CDG-Ib and CDG-Ic, respectively (Chapter 5). The biochemical and genetic basis of CDG-I in the remaining four patients has not been established. From the analysis of serum transferrin, it is likely that the glycoproteins in these cases are underglycosylated, which suggests that the basic defect may be in the synthesis of mature LLOs (Figure 1.11). Therefore other potential enzymic defects in this pathway were investigated by developing assays for specific enzymic steps.

6.1.2 GDP-Man pyrophosphorylase

Every mature LLO requires 9 mannosyl residues for its synthesis, five of which are supplied directly by GDP-Man as a precursor and the other four after the transfer of mannose from GDP-Man to Dol-P-Man (Figure 1.11). Five out of the six known causes of CDG-I are defects either in the supply of GDP-Man and Dol-P-Man or in the transfer of mannosyl residues to the growing LLO. The mannose pathway plays an important role in LLO synthesis and in the pathogenesis of CDG-I (Figure 6.1).

155 Chapter 6______Introduction ______CDG-Ix

CDG-Ib CDG-Ia CDG-Ie ? F-6 -P-----■ — ^ Man- 6 -P Man-l-P ------^ GDP-Man — ^ Dol-P-Man GDP-Man MPI PMM2 pyrophosphorylase DPM/

Figure 6.1: Enzymic defects in the mannose pathway leading to CDG-I

Since the conversion of Man-I-P into GDP-man is catalysed by GDP-Man pyrophosphorylase, it was considered pertinent to check the levels of this enzyme in cultured fibroblasts from the four patients with CDG-Ix, because a deficiency of this enzyme would also decrease the overall pool of GDP-Man and Dol-P-Man in the cell.

The enzyme GDP-mannose pyrophosphorylase (GDPMP, EC 2.7.7.13) catalyses the synthesis of GDP-Man from Man-I-P and GTP as precursors (Szumilo et a i, 1993).

GDPMP can be assayed either in the forward direction using GTP and Man-l-P as substrates, or in the reverse direction using GDP-Man and inorganic pyrophosphate

(Szumilo et al., 1993; Ning and Elbein, 2000). GDPMP has been purified from various organisms and tissues, including Pseudomonas aeruginosa (Shinabarger et ai, 1991) and pig liver (Szumilo et ai, 1993). The cloning and analysis of VIG9 (vanadate- resistant and immature glycosylation), the structural gene for GDPMP in yeast, was carried out by Hashimoto and colleagues in 1997. The gene was shown to encode a polypeptide consisting of 361 amino acids, with a predicted molecular mass of 39,565

Da and pi of 5.93. The predicted gene product showed a significant amino acid sequence homology with several bacterial proteins that catalyse the synthesis of (deoxy) ribonucleotide diphosphate sugars from sugar phosphates and (deoxy) ribonucleotide

156 Chapter 6______Introduction ______CDG-Ix triphosphate (Zhou et al, 1991; Kessler et ai, 1982; Distler et al., 1987). VIG9 is identical to the PSAl gene cloned by Benton et al (1996) and it is postulated that PSAl is either the same gene (VIG9) or an identical gene involved in sugar nucleotide metabolism. Pig liver GDPMP has been purified about 5,000-fold to apparent homogeneity (Szumilo et al., 1993). The native enzyme appeared as a single band of about 450 kDa after non-denaturing gel electrophoresis with two subunits of 43 kDa (a- subunit) and 37 kDa (^-subunit) after SDS-PAGE. The partial amino acid sequence of the p-subunit had only a single methionine at its amino terminus followed by a 23 amino acid hydrophobic sequence (top line) in Figure 6.2:

MK A ULVGGYGTRLRPLTL SI PK Pig liver MK G LILVGGYGTRLRPLTL TV PK Yeast VIG9

Figure 6.2: Comparison of the 37 kDa-p-subunit sequences in pig liver and yeast GDPMP

This amino terminal region of the p-subunit of the pig liver enzyme (top line) shows approximately 87% identity (shown in the boxed areas of the two sequences in Figure

6.2) to the corresponding region of the yeast VIG9 enzyme protein. A significant homology, although based on a relatively short stretch of the two polypeptides along with a similarity in the predicted molecular mass of the VIG9 yeast protein (about 39.5 kDa) and the 37 kDa-p-subunit of the pig liver enzyme suggest that the pig 37 kDa-P- subunit is a homologue of yeast VIG9 and that the two proteins have evolved from a common ancestral gene. The a-subunit of the pig liver GDPMP (43 kDa polypeptide) was found to be blocked at the amino terminus, but a 29 kDa CN-Br-cleaved fragment had the following sequence: Leu-Asp-Ala-His-Arg-His-Arg-Pro-His-Pro-Phe-Leu-Leu.

157 Chapter 6______Introduction ______CDG-Ix

The sequence information based on a stretch of internal amino acids in a polypeptide does not make the task of screening cDNA libraries easier. A search of the data however revealed that similar domains are present in large numbers of protein families.

Hence it is not surprising that the a-subunit (43 kDa polypeptide) of the mammalian enzyme, unlike the -p-subunit, has not been cloned so far. GDPMP from yeast only utilises GDP-Man as a substrate in the reverse direction and is not active with other

Man or Glc nucleotides. On the other hand, the purified pig GDPMP catalyses the

synthesis of GDP-Glc (from Glc-l-P and GTP) and GDP-Man (from Man-l-P and

GTP) and has a higher affinity for the formation of GDP-Glc (100%) than for the

synthesis of GDP-Man (61%) (Szumilo et al, 1993). Therefore, pig liver GDPMP

appears to be quite different from the yeast enzyme with regards to substrate specificity, perhaps due to different roles of its constituent subunits. To investigate these findings,

Ning and Elbein (2000) cloned the gene encoding the 37 kDa-P-subunit protein. A full- length cDNA encoding the p-subunit was isolated from a porcine cDNA library and the predicted gene product showed a high sequence homology to GDPMP from other

species. The pig liver enzyme was expressed mE.coli cells and a 37 kDa protein was

overproduced in the cells and the gene product was shown to react strongly with

antibody raised against the native p-subunit of pig GDPMP. The recombinant protein was assayed for GDPMP activity in both the forward and reverse directions and was

found to be active in both directions. The 37 kDa protein was active without the

presence of the 43 kDa protein. Comparison of the enzymatic activity of the

recombinant 37 kDa protein showed that it had a small amount of GDP-Glc

synthesising activity utilising Glc-l-P as a substrate and that the activity of Man-l-P $.e

formation of GDP-Man) was at least six times higher at optimal substrate

158 Chapter 6______Introduction ______CDG-Ix concentrations. The substrate specificity of the recombinant 37 kDa protein is significantly different from that of the native pig liver enzyme (Ning and Elbein 2000).

6.13 Dol-P-Man synthase (CDG-Ie)

During the course of this project (October 1997-October 2000), a defect in the synthesis of Dol-P-Man from GDP-Man due to mutations in the Dol-P-Man synthase (DPMI) gene was discovered by Kim et al (2000) and Imbach et at (2000). Therefore, an assay for the determination of Dol-P-Man synthase activity was developed to analyse levels of this enzymic activity in the uncharacterised CDG-I patients. The review of the literature on the genetic aspects of Dol-P-Man synthase is given in Chapter 1 (Section 1.5.5).

6.1.4 Glutamine: fructose-6-phosphate amidotransferase (GFA)

Glutamine: fructose- 6 -phosphate amidotransferase (GFA, E.C 2.6.1.1.16) is the first and rate-limiting enzyme in the hexosamine synthetic pathway ^ubay, 1988). This enzyme diverts 2-5% of the fructose- 6 -phosphate (F-6 -P) derived from glucose to glucosamine-

6 -phosphate (GlcN-6 -P), using the amide group from L-glutamine (Hassell et al., 1986) as shown in the following reaction:

GFA Fructose- 6 -phosphate + glutamine------^ Glucosamine- 6 -P + glutamate

GlcN-6 -P is an essential precursor of hexosamines required for the glycosylation of proteins and lipids (Marshall et al., 1991; Oki et al., 1999) and is subsequently metabolised to uridine diphosphate #-acetylglucosamine (UDP-GlcNAc), which serves as a donor substrate in protein #-linked glycosylation (Figure 6.3). Cultured fibroblasts from the 4 uncharacterised CDG-I patients were analysed for GFA activity, because a

159 Chapter 6______Introduction ______CDG-Ix diminished supply of UDP-GlcNAc would drastically reduce the production of mature as well as truncated LLOs.

Recent investigations have shown that the hexosamine biosynthetic pathway regulates a diverse set of cellular events, including glycogen synthase activity (Crook er uL, 1993), pyruvate kinase activity (Traxinger and Marshall, 1992), glucose-induced desensitisation to insulin in adipocytes (Marshall et al., 1991) and glucose-induced growth factor expression in vascular smooth muscle cells (McClain et al., 1992; Roos et al., 1996; Sayeski and Kudlow, 1996). Such studies have shown that glucosamine can mimic the effects of glucose. It has also been suggested that glucosamine induces glucose toxicity and insulin resistance, where alterations of GFA expression could occur in preclinical or manifest diabetes. For example, an increased level of GFA activity in the skeletal muscle of patients with type II diabetes has been observed (Yki-Jarvinen et al, 1996).

160 Chapter 6 Introduction CDG-Ix

Fructose- 6 -phosphate Glutamine GFA Glutamate UTP PPi ATP ADP I: Glucosamine-^y^^ Glucosamine Glucosamine- ^ UDP-glucosamine A 6 -phosphate 1 -phosphate acetyl CoA o ATP ADP Acetyl-CoA

N-Acetyl N-Acetyi-glucosamine Glycosaminoglycans e g heparin N-Acetyl- glucosamine 1 -phosphate glucosamine 6 -phosphate A -UTP -PPi

UDP-N-acetylglucosamine Glycosaminoglycans N-Acetyl A (hyaluronic acid), mannosamine glycoproteins NAD^ 6 -phosphate Phosphoenol > - pyruvate UDP-N-acetylgalactosamine

N-Acetyl-neuraminic acid 9-phosphate Glycosaminoglycans (chondroitins), glycoproteins Sialic acid, gangliosides, glycoproteins G Inhibiting allosteric effect

Figure 6.3: GFA in the hexosamine metabolic pathway

Thus, the intracellular concentration of glucosamine is likely to be tightly regulated.

The regulation of glucosamine synthesis, is mediated by inhibition of GFA by its

downstream products UDP-GlcNAc and A-acetylglucosamine- 6 -phosphate (Komfeld,

1967; McKnight et a l, 1992). Overexpression of GFA under the control of a

heterologous promoter in cultured cells results in an increase in the intracellular

161 Chapter 6______Introduction ______CDG-Ix concentration of glucosamine (Daniels et al., 1993). The endogenous GFA promoter also appears to regulate the expression of this enzyme. In yeast, GFA gene transcription can be regulated by a-pheromone (Watzele and Tanner, 1989) and in human cells, GFA gene transcription can be regulated by epidermal growth factor (EGF), glucose and glucosamine (Paterson and Kudlow, 1995). The fact that the regulation of this GFA gene promoter could potentially result in changes in glucosamine synthesis with possible consequences in protein glycosylation and cellular metabolism led Sayeski et al (1997) to clone molecularly and identify the mouse GFA promoter. Initial characterisation of the promoter showed that it was located 149 bp upstream of the translational start site and 8 8 bp downstream of the transcriptional start site.

Interestingly, the mouse GFA promoter lacked a TATA box, which is a typical characteristic of most genes encoding ‘housekeeping’ enzymes. The promoter also had several GC boxes within a highly GC-rich region. Detailed analysis of the proximal element of the promoter by DNase I footprinting, electrophoretic mobility shift assays and site-directed mutagenesis indicated that the transcription factor Spl binds to three elements in the proximal promoter segments that play a vital role in the regulation of the basal transcription of this gene. Human GFA was first cloned by McKnight et al (1992) and the functional protein was expressed in E.coli. A 3.1 kb cDNA was isolated, which contained the complete coding region of 681 amino acids. Expression of the cDNA in

E.coli produced a protein of approximately 77 kDa and increased GFA activity 4.5-fold over endogenous bacterial levels. Oki et al (1999) subcloned full-length cDNAs of human and mouse for a novel subtype of GFA, which was designated as GFA2 (the previously cloned GFA was named GFAl). Both the human and the mouse GFA2 proteins were approximately 77 kDa in size and composed of 682 amino acids of. The homologies between the human GFAl and GFA2, between the mouse GFAl and GFA2

162 Chapter 6______Introduction ______CDG-Ix and between the human GFA2 and the mouse GFA2 were 75.6%, 74.7% and 97.2%, respectively. Northern blot analysis also revealed different tissue distributions for

GFAl and GFA2, as GFAl was more highly expressed in the placenta, pancreas and testis than GFA2. Conversely, GFA2 was expressed throughout the central nervous

system, especially in the spinal cord, in comparison to weak GFAl expression. The

human GFA2 locus was mapped to chromosome 5q and the mouse GFA2 mapped to

the corresponding syntenic position of human GFA2 on mouse chromosome 11. The

human GFAl has been mapped previously to chromosome 2pl3 and the mouse GFAl

locus was assigned to the central part of chromosome 6 , syntenic to human chromosome

2pl3. Thus, both genes for GFAl and GFA2 exist in a syntenic way between the

human and the mouse. Therefore, investigations into the characterisation and detailed

involvement of GFAl and GFA2 can provide useful insights into understanding the

roles of the hexosamine pathway in various tissues, for example, in the development of

glucose toxicity and complications of diabetes.

6.1.5 a-glucosidase I deficiency (CDG-IIb)

CDG-IIb is caused by a deficiency of a-glucosidase I (De Praeter et al., 2000) (see

Figure 1.14) and is described in detail in Section 1.6.2 (Chapter 1). The isoelectric

focusing pattern of serum transferrin from the four uncharacterised patients was typical

of CDG-I and not CDG-IIb patients who showed normal serum transferrin. However,

cultured fibroblasts from the patients were analysed for a-glucosidase I activity. The

underlying reason was that the failure to immediately remove the terminal glucose

residue from the protein AT-linked oligosaccharide following its transfer by GST may

favour the reverse reaction by the enzyme as oligosaccharylhydrolase, as described in

Chapter 1, Section 1.3.11. Such an illicit behaviour of the GST can thus result in the

163 Chapter 6______Introduction ______CDG-Ix underglycosylation of glycoproteins even if there is no defect in the synthesis of the

LLO precursor.

6.1.5 Aims

The aim of the work described in this chapter was to establish assays for GDPMP, Dol-

P-Man synthase, GFA and a-glucosidase I activities in order to find out whether a

deficiency of any of the enzymes was the underlying defect in any of the CDG-Ix

patients.

Part of this work has been published (Imtiaz et al., 2000).

164 Chapter 6______Materials & Methods ______CDG-Ix

6.2 Materials and Methods 6.2.1 Patient Information and Material Four patients, NH, RM, KS and AU, were classified as CDG-Ix by their clinical features (Chapter 3) and by their abnormal isoelectric focusing patterns for serum transferrin. The patient samples used were either obtained from fibroblast cell lines for various enzymic analyses (NH, RM, KS and AU) or genetic analysis (NH, RM and

AU). In the case of KS, genomic DNA was extracted from whole blood.

6.2.2 GDP-mannose pyrophosphorylase assay

GDP-mannose pyrophosphorylase (GDPMP) is the key enzyme in the production of

GDP-a-D-marmose, which is necessary for the maimosylation of A-linked glycoproteins (Elbein 1979). GDPMP was assayed in both the forward and reverse direction.

Forward assay for measurement of GDPMP

GDPMP was assayed in the forward direction by following the production of GDP-Man and pyrophosphate (PPi) from Man-l-P and GTP:

Man-l-P + GTP ^ GDP-Man + PPi

The amount of PPi produced was measured enzymically using a pyrophosphate determination kit (Sigma P7275), which incorporated the following coupled reactions:

165 Chapter 6______Materials & Methods ______CDG-Ix

PPi-phosphofructokinase PPi + F-6 -P------F-l,6 -bisphosphate + Pi

Aldolase F-l,6 -bisphosphate— D-glyceraldehyde-3-phosphate + dihyroxyacetone phosphate

triosephosphate-isomerase D-glyceraldehyde-3-phosphate ------dihyroxyacetone phosphate

glycerophosphate 2 dihyroxyacetone phosphate + 2 P-NADH + 2 ^ dehydrogenase

2 glycerol-3-phosphate + 2 P-NAD^

In this set of reactions, two moles of NADH are oxidised to NAD per mole of pyrophosphate that is consumed The reaction was monitored spectrophotometrically at

340 nm.

Solutions

The following stock solutions were freshly prepared in Tris-HCl buffer (pH 7.5):

Tris-HCl, pH 7.5 500 mM, pH 7.5 Man-l-P 12.5 mM Sodium pyrophosphate 1 mM GTP 20 mM

Sample preparation

Cultured fibroblasts were harvested by trypsinization, resuspended in 50 pi of water and sonicated at an amplitude of 6 microns for 10 s in an MSE-Soniprep 150. The cell suspension was centrifuged for 5 min at 10 000 x g. The supernatant solution was collected and the protein concentration was determined using the method described in

Chapter 2, section 1.3.2.

166 Chapter 6______Materials & Methods ______CDG-Ix

Method

The reaction mixture (final volume of 500 pil) contained 5 mM Man-l-P, 200 pil of pyrophosphate kit and 50 pd of the patient sample containing a known amount of protein. The reaction mix was pre-incubated at 37°C for 20 min. The reaction was started by the addition of 2 mM GTP and the change in absorbance was measured spectrophotometrically using a CECIL CE2021 spectrophotometer at intervals of 5 min for Ih. For each patient assayed for GDPMP, simultaneous control reactions were carried out as described by omitting Man-l-P or GTP.

Reverse assay for measurement of GDPMP

GDPMP was assayed in the reverse direction as described by Szumilo et al (1993) by measuring the rate of production of [^"^C] mannose-l-P from GDP- [^"^C] mannose and pyrophosphate.

GDP-D-[U-^'^C] mannose (296 mCi/mmol) was obtained from Amersham Life Science,

UK. Darco G60 was purchased from Merck, UK and OptiPhase HiSafe 3™ from

Wallac, UK.

Solutions

The following stock solutions were freshly prepared in Tris-HCl buffer (pH 7.5):

Tris-HCl, pH 7.5 500 mM, pH 7.5 Sodium pyrophosphate 25 mM

MgCh 2 0 mM GDP-D-[U-^^C] mannose 46 p,M GDP-mannose 454 pM

167 Chapter 6______Materials & Methods ______CDG-Ix

Sample preparation

Cultured fibroblasts were used in this assay and were prepared as described for the measurement of GDPMP in the forward direction.

Method

The reaction mixture (final volume of 50 pil) contained: 5 mM sodium pyrophosphate,

100 pM GDP-mannose containing radiolabeled GDP- [U-^'^C] mannose (5.8 Ci / mol),

4 mM Mg CI 2 , 100 mM Tris-HCl buffer (pH 7.5) and a sample of the supernatant, containing a known amount of protein. The mixtures were incubated at 37°C for 5 min and then stopped by the addition of 0.5 ml of trichloroacetic acid. GTP and GDP-man were adsorbed selectively by the addition of 0.3 ml of acid washed charcoal (150 mg/ml of Darco G60 in water). The mixtures were vortexed vigorously, centrifuged for 5 min at 10,000g and the supernatant was collected. The charcoal was washed again and centrifuged as described before. The combined supernatants were transferred to a scintillation vial to which 2 ml of OptiPhase HiSafe 3^“ scintillation fluid was added and then vortexed thoroughly. The radioactivity of ^"^C-labelled mannose-l-P in the supernatants was measured in a Wallac 1410 liquid scintillation counter. For each patient sample assayed for GDPMP activity, a negative control reaction without cell

supernatant was carried out in tandem.

6.2.3 Dolichol phosphate mannose synthase assay

Dol-P-Man synthase was assayed by adaptation of the method described by Kim et al

(2000). All the chemicals were obtained from Sigma except the GDP-D-[U-^'^C] mannose (296 mCi/mmol), which was purchased from Amersham Life Sciences, UK.

168 Chapter 6______Materials & Methods ______CDG-Ix

Solutions

The following stock solutions were freshly prepared in Tris-HCl buffer (pH 8.0):

Tris-HCl, pH 8.0 1 M, pH 8.0 Dithiothreitol 90 mM MgCb 50 mM EDTA 10 mM GDP-D-[U-^^C] mannose 50 pM

Sample preparation

Fresh cultured fibroblasts (3 x 75 cm^ flasks) were harvested by trypsinization (Chapter

2, section 1.2.2.1). The cell pellet was sonicated on ice in 135 pi of 10 mM Tris (pH

7.5), containing 0.25 M sucrose and 15 pi protease inhibitor cocktail (Promega) at an

amplitude of 6 microns for 30 s in an MSE-Soniprep 150. The sonicate was centrifuged

at 1 000 X g for 10 min. The supernatant was aspirated and centrifuged at 105 000 x g

for 1 h in a Beckman XL-90 Ultracentrifuge which produced a pellet containing the

microsomal membranes. The pellet was resuspended in 50 pi of 100 mM Tris-HCl (pH

8.0) and the protein concentration was measured using the method described in Chapter

2, section 1.3.2.

Method

5 pg of dolichol phosphate was dried under nitrogen in a 15 ml Pyrex tube (Merck) and

dissolved in 100 mM Tris-HCl (pH 8.0) containing Triton-X-100 (0.4% v/v),

dithiothreitol (0.7% v/v), 5 mM Mg CI 2 , 1 mM EDTA and 10 (iM GDP- D- [U-'^C]

mannose. 20 pg of microsomal membranes were added to give a final volume of 50 pi

and the reaction mixture was incubated at 37°C for 15 min. The Dol-P-Man was

extracted by the addition of 0.2 ml of 4 mM Mg Cl% and 1 ml of chloroform/methanol

169 Chapter 6______Materials & Methods ______CDG-Ix

(3:2). The mixture was vortexed vigorously and the upper phase was discarded after centrifugation at 2 000 x g for 5 min. The lower phase was washed twice with 1 ml of chloroform/methanol/water/0.1 M Mg CI 2 (3:48:47:2), transferred to a scintillation vial and dried under nitrogen. 2 ml of OptiPhase HiSafe 3™ (Wallac, UK) scintillation fluid was added to the vial, which was vortexed thoroughly and the radioactivity counted on a Wallac 1410 liquid scintillation counter. For each patient sample assayed for Dol-P-

Man synthase activity, a negative control reaction without cell supernatant was carried out in tandem.

Inhibition of Dol-P-Man synthase activity

Dol-P-Man synthase was assayed in the presence of amphomycin, a potent and specific antibiotic inhibitor of the enzyme (Prado-Figueroa et al., 1994; Brown et al., 1997), to ensure that the appropriate activity was being measured. Amphomycin was kindly provided by Professor Michael Ferguson, Scotland.

Method

Amphomycin was added to the reaction mixture to give final concentrations of 0.005,

0.01 and 0.1 mg/ml. The enzyme assay was carried out as described previously but using commercially prepared canine pancreatic microsomes (Promega) instead of fibroblasts as a source of the microsomal membrane fraction. 1.5 pi (20 pg) of canine pancreatic microsomes were used for each reaction.

6.2.4 Glutamine: fructose-6-phosphate amidotransferase assay

Glutamine: fructose- 6 -phosphate amidotransferase (GFA, EC 2.6.1.16) catalyses the rate-limiting step in the hexosamine biosynthesis pathway, the conversion of fructose- 6 -

170 Chapter 6______Materials & Methods ______CDG-Ix

phosphate (F-6 -P) to glucosamine- 6 -phosphate (GlcN-6 -P) in the presence of

glutamine. The reaction was followed by measuring the rate of production of glutamate

in a coupled spectrophotometric assay.

F-6 -P + GlcN------>" GlcN-6 -P + glutamate glutamate + NAD^ +H 2 O ^ a-oxoglutarate + NADH +

NAD^ was purchased from Boehringer Mannheim. Glutamate dehydrogenase and all

other chemicals were obtained from Sigma.

Solutions

NaHi PO4, pH 7.5 100 mM, pH 7.5 KCl 100 mM F-6-P 100 mM Glutamine 100 mM EDTA 10 mM Dithiothreitol 10 mM NADP 100 mM

Sample preparation

Cultured fibroblasts were harvested by trypsinization, resuspended in 50 pil of water and

sonicated at an amplitude of 6 microns for 10 s in an MSE-Soniprep 150. The cell

suspension was centrifuged for 5 min at 10 000 x g. The supernatant solution was

collected and the protein concentration was determined using the method described in

Chapter 2, section 1.3.2.

171 Chapter 6______Materials & Methods ______CDG-Ix

Method

The assay was carried out by pre-incubating 10-50 pg of protein (final volume of

900pi) in 50 mM NaH2 PO4 (pH 7.5) containing 10 mM glutamine, 50 mM KCl, 1 mM

EDTA, 1 mM DTT, 5 mM NAD and 0.5 units/mg protein (specific activity) of glutamate dehydrogenase (EC 1.4.1.3), for 20 min at 37°C. After 20 min, 100 pi of 10 mM fructose- 6 -phosphate was added to the reaction mix and the change in absorbance was measured spectrophotometrically using a CECIL CE2021 spectrophotometer at intervals of 5 min for 30 min.

Specific activities were calculated from the rate of increase in absorbance at 340nm due to the formation of NADH at 37°C and the protein concentration.

6.2.5 a-glucosidase I assay

The assay of a-glucosidase I was adapted from the method described by De Praeter et

al (2 0 0 0 ) based on the hydrolysis of the synthetic substrate, fluorescent

tetramethylrhodamine (TMR)-labelled trisaccharide Glc (al-2) Glc (al-3) Glc (al-0)-

(CH2 )s COOCH3 (kindly donated by Dr. Monica Palcic, University of Alberta, Canada).

172 Chapter 6 Materials & Methods CDG-Ix

HqC

Glc (a1-2) Glc (a1-3) Glc (a1) - (HgOg NH 'NH

Figure 6.4: TMR-labelled trisaccharide used in assaying a-glucosidase I activity

Solutions

Buffer A 10 mM sodium phosphate, pH 6 . 8 containing polyoxyethylene 20 cetyl ether (0.2% v/v), 50 piM

phenylmethane-sulphonylfluoride and 1 fxg/ml leupeptin.

Sample preparation

Fresh cultured fibroblasts (4 x 75 cm^ flasks) were harvested by trypsinisation (Chapter

2, section 1.2.2.1). 1 volume of harvested fibroblasts was suspended in 9 vol of buffer A

and homogenised. The homogenates were centrifuged at 5 600 x g for 1 min and the

supernatants were assayed for a-glucosidase I activity. Hydrolysis by a-glucosidase I of

the TMR-trisaccharide was measured by the incubation of 15 |il of the homogenates

(containing 25-50 pg of total protein) in buffer A with 5 pi of a 1 mM solution of the

synthetic fluorescent substrate, in a total volume of 20 pi at 37°C. At various time

intervals (for example, 1, 2, 3, 24 h), 0.5 pi of the sample was removed for analysis by

thin-layer chromatography (TLC). Samples were applied 2.0 cm from the bottom of a

173 Chapter 6______Materials & Methods ______CDG-Ix

silica gel 60 F 254 plate and dried using a hair dryer. The loaded plate was placed in a glass tank containing the developing solvent (mobile phase), which consisted of 2 - propanol: water: NH4OH (7:2:1 [v/v/v]) to a depth of approximately 1.5 cm. The atmosphere in the tank had previously been equilibrated with the solvent for 1 - 2 h.

After approximately 1 h, the plate was removed and allowed to dry in air in the fume hood. Analysis and quantification of the cleavage products was carried out directly from the TLC plates using the UV/White Light Fluorescent Darkroom with UVP TMW20

Transilluminator and CCD camera with lens and filter (Ultra-Violet Products Ltd.). The software used was the GRAB-IT™ gel documentation and analysis system (Ultra-Violet

Products Ltd.) and GelWorks.

Inhibition of a-glucosidase I

Previous studies have shown that castanospermine is a competitive inhibitor of a- glucosidase I activity (Saul et al., 1983; Pan et al., 1983) giving rise to glycoproteins having Glc 3 Man 7 .9(GlcNAc) 2 structures. Therefore, to confirm that the initial hydrolysis of the TMR-trisaccharide to the TMR-disaccharide was due to the action of a-glucosidase I, the assay was also carried out in the presence of castanospermine at a final concentration of 1.8 mM.

174 Chapter 6 Materials & Methods CDG-Ix

6.2.6 Molecular biology

6.2.6.1 Dol-P-Man synthase gene (DPMI)

Three exons (3, 4 and 8) of DPMI, the gene coding for the catalytic subunit of Dol-P-

Man synthase, the enzyme that is deficient in patients with CDG-Ie, were analysed for the presence of mutations in the four CDG-Ix patients. Only these exons were analysed becasue, to date, mutations have only been reported in these exons in CDG-Ie patients

(Imbachet a i, 2000; Kim et a l, 2000).

6.2.6.1.1 Amplification of genomic DNA for the DPMI gene by PCR

Genomic DNA was extracted from cultured fibroblasts from each of the patients as described in Section 2.4.1 of Chapter 2.

6.2.6.1.2 Design and synthesis of oligonucleotide primers

The primer sequences used for the amplification of exons 3 and 8 and of exon 4 of the

DPMI gene were the same as those as described by Imbach et al (2000) and Kim et al

(2000), respectively. The primers were synthesized and purified by Genosys (Table

6.1).

Target Primer Sequence (5’-> 3’) Sequence Exon 3 DPMlex3+ TGCTTTAAAGTTCTAACAAGTGCAA DPMlex3- AGCAGGTGTGAGGGGTTAGA Exon 4 DPMlex4+ AATGTGTGCTCTTCAGGTGCT DPMlex4- TGAAAATAAGCCCAAAACCA Exon 8 DPMlex8+ ACCAATGGCCAGTGAAAGTT DPMlex8- AAACCTTACTGCTCCTTTACCA

Table 6.1: Sequence of oligonucleotide primers used to amplify exons 3, 4 and 8 of the DPMI gene.

175 Chapter 6______Materials & Methods ______CDG-Ix

6.2.6.1.3 Conditions of PCR

PCR reactions were carried out as described in Section 2.43.2 of Chapter 2 using 1.5 mmol/1 of MgCli The cycling conditions were 10 min at 96°C, with the Taq DNA polymerase added after a “hot start”, followed by 35 cycles of amplification of one min at 96°C, one min at 62-68°C, one min at 72°C and a final extension at 72°C for 10 min.

The PCR products were analysed and sequenced as described in Chapter 2.

6.2.6.2 Amplification of exon 11 of the ALG6 gene by PCR for the detection of the common mutation A333V

A333V, the most common mutation found in CDG-Ic patients was screened for in the four CDG-Ix patients. This was the only method of screening patients for CDG-Ic that was available in this laboratory during the course of this study. Exon 11 of the hALG6

gene was amplified by PCR, using genomic DNA from the CDG-Ix patients, as

described in Section 5.3.4.1 (Chapter 5). The PCR products were analysed and

sequenced as described in Chapter 2.

176 Chapter 6______Results ______CDG-Ix

6.3 Results

As none of the CDG-Ix patients had a deficiency of PMM or PMI, four other enzyme^

GDPMP, Dol-P-Man Synthase, GFA and a-glucosidase I were assayed to try to identify their basic defects.

6.3.1 GDPMP activity in fibroblasts from normal controls and CDG-I patients

GDPMP activity was assayed in the forward and reverse directions in cultured fibroblasts of the four CDG-Ix patients, two CDG-Ia, one CDG-Ib (AH), one CDG-Ic patient (BB) and in normal control fibroblasts. Unfortunately the assay in the forward direction did not give reproducible results even with attempts to optimise the assay conditions using various concentrations of substrate and enzyme. Therefore, the activity of GDPMP was assayed in the reverse direction. Experiments were carried out to optimise and validate this assay, including varying the concentrations of enzyme and the incubation time. It was found that the assay was valid using 10-40 pg of protein with incubations up to 5 min. The GDPMP activity was measured in fibroblast extracts using these optimised standard conditions (Table 6.2).

177 Chapter 6 Results CDG-Ix

CDG-Ix GDPMP activity Mean ± S.E (n) (mU/mg of protein) NH 0.37,0.69, 0.75 0.60 ± 0.11 (3) RM 0.81, 0.86,1.3,1.9 1.2 ± 0.25 (4) KS 0.52, 0.75,1.0 0.76 ± 0.13 (3) AU 1.0 1.0 Group 0.37-1.9 0.9 ± 0.10 CDG-I (a,b,c) (mU/mg of protein) Mean ± S.E (n) JB(Ia) 0.45 0.45 (1) KF(Ia) 1.2 1.2 (1) AH(Ib) 0.89 0.89 (1) BB (Ic) 0.68,0.85,1.0 0.84 ± 0.09 (3) Group 0.68-1.2 0.85 ± 0.15 Normal (mU/mg of protein) Mean ± S.E (n) Controls 1 0.64 0.64 (1) 2 0.97 0.97 (1) 3 0.45, 0.46, 0.52, 0.57, 0.57 ± 0.05 (7) 0.58, 0.6, 0.81 4 0.84 0.84 (1) Group 0.45-0.97 0.76 ± 0.09

Table 6.2: GDPMP activity in fibroblasts (U = iimol/min)

None of the CDG-Ix patients had a deficiency of GDPMP activity, eliminating defects in this enzyme as the cause of CDG-I in these patients. Normal levels of GDPMP were found in two of the CDG-Ix patients NH and KS, whereas the other two patients, RM and AU (only one assay) were found to have higher activities than the normal control range of activity (Figure 6.5).

178 Chapter 6 Results CDG-Ix

C■; ° 0.5

NH RM KS AU Normal

Figure 6.5: GDPMP activity in fibroblasts from CDG-Ix patients and normal controls Mean specific activities are shown

Although the GDPMP activity was higher in three of the CDG-Ix patients than in the control group (0.64 ± 0.05 mU/mg of protein) only in patient RM (1.2 ± 0.25 mU/mg of protein) was the activity significantly different (P<0.05) from the mean of the control group (0.76 ± 0.09 mU/mg of protein).

One of the CDG-Ia patients (KF) had an elevated level of GDPMP, whereas, the other patient diagnosed with CDG-Ia and the CDG-Ib and -Ic patients had activities within the normal reference range (Figure 6.6);

KF (la) JB (la) AH (Ib) BB (Ic) Normal

Figure 6.6: GDPMP activity in fibroblasts from CDG-Ia, Ib and Ic patients and normal controls Mean specific activities are shown

179 Chapter 6 Results CDG-Ix

6.3.2 Dol-P-Man Synthase activities

The Dol-P-Man synthase activity in canine pancreatic microsomes (CPM) was assayed using different concentrations of amphomycin, to validate the assay protocol, before the patient samples were assayed (Table 6.3).

Concentration of Dol-P-Man Synthase Activity amphomycin of canine pancreatic microsomes (mg/ml) (pmol/min/mg of protein) 0.0 495 0.05 403 0.1 309 1.0 56

Table 6.3 Dol-P-Man synthase specific activities of canine pancreatic microsomes with varying concentrations of amphomycin

The Dol-P-Man synthase activity was inhibited by approximately 90%. This potent

inhibition of the activity confirmed that the assay procedure was measuring Dol-P-man

synthase activity.

100

0 0.25 0.5 0.75 1 1.25 Concentration of Amphomycin (mg/ml)

Figure 6.7: Inhibition of canine pancreatic Dol-P-Man synthase by amphomycin

180 Chapter 6 Results CDG-Ix

6.3.2.1 Dol-P-Man synthase activity in fibroblasts from normal controls and

CDG-I patients

The Dol-P-Man synthase activity was measured in four CDG-Ix patients, two CDG-Ia, one CDG-Ic patients (BB) and in normal control fibroblasts (Table 6.4 and Figure 6.8).

CDG Ix Dol-P-Man synthase Mean ± S.E (n) (pmol/min/mg of protein) NH 26,16 21 (2) RM 12,14 13 (2) KS 23, 32,51,51 39 ± 7.0 (4) AU 12,13 13(2) Group 12-51 22 ± 6.1 CDG I (a, c) (pmol/min/mg of Mean ± S.E (n) protein) JB (la) 9,16 13(2) KF(la) 12,13 13(2) BB (Ic) 33,58 47(2) Group 9-58 24± 11 Normal (pmol/min/mg of protein) Mean ± S.E (n) Controls 1 20, 21, 25 22 ± 1.52 (3) 2 26, 30 28 (2) 3 9,15 12(2) Group 9-30 21 ± 4.7

Table 6.4: Dol-P-Man synthase activity in fibroblasts

There was not a deficiency of Dol-P-Man synthase activity in any of the CDG-lx patients, indicating that they were not cases of CDG-le. Three of the four CDG-lx patients (NH, RM and AU) were found to have normal levels of Dol-P-Man synthase, whereas KS had an elevated level (39 ± 7.0 pmol/min/mg of protein), which was significantly different (P<0.05) from the mean of the control group (21 ± 4.7 pmol/min/mg of protein). However the activity in CDG-lx patients as a group (22 ± 6.1) was not significantly different (P=0.0934) from the control group (21 ± 4.7).

181 Chapter 6 Results CDG-Ix

The two CDG-Ia patients had levels within the normal range whereas the CDG-Ic patient had twice the level of the mean normal control value.

° 30 m NH RM KS AU JB KF BB Normal

Figure 6.8: Dol-P-Man synthase activity of CDG-I patients and the normal control fibroblasts Mean specific activities are shown

At the same time as the enzymic analyses were being carried out, the gene encoding

Dol-P-Man synthase, DPMI, was screened for known mutations in exons 3, 4 and 8.

No variation in the sequence compared with the normal sequence for DPMI was found by direct sequencing The absence of mutations supported the enzymic analysis indicating that none of the CDG-Ix patients was type le

6.3.3 GFA activity in fibroblasts from normal controls and CDG-I patients

The GFA activity was measured in fibroblasts from on three CDG-Ix, two CDG-Ia, one

CDG-Ib (AH), one CDG-Ic (BB) patients and in normal control fibroblasts (Table 6.5 and Figure 6.9).

182 Chapter 6 Results CDG-Ix

CDG-Ix GFA activity Mean ± S.E (n) (nmol/min/mg of protein) NH 20, 27, 29, 35 28 ± 3.1 (4) RM 20, 25, 33 26 ± 3.8 (3) KS 13,15,17, 20, 20, 20 18 ± 1.2 (6) Group 13-35 24 ± 3.1 CDG-I (a,b,c) (nmol/min/mg of protein) Mean ± S.E (n) JB(Ia) 10,13,15 13 ± 1.5 (3) TB(Ia) 11,13,14,17 14 ± 1.3 (4) AH(Ib) 20, 21 21 (2) BB (Ic) 30, 33, 35, 40, 50, 50, 50 41 ± 3.3 (7) Group 10-50 22 ± 6.5 Normal (nmol/min/mg of protein) Mean ± S.E (n) Controls 1 14,14, 20, 20 17 ± 1.7 (4)

Table 6.5: GFA activity in fibroblasts

None of the CDG-Ix patients had a deficiency of GFA. Two of the CDG-Ix patients,

NH and RM, had elevated levels of GFA activity compared to the normal controls but the GFA activity in the other patient, KS was within the normal range of GFA activity.

However, the activity in the CDG-Ix patients as a group (24 ± 3.1 nmol/min/mg of protein) was not significantly different (P=0.1553) from the control patient (17 ± 1.7).

The CDG-Ix group was not significantly different from the patients in the CDG-Ia, Ib and Ic group (P=0.9300).

In the case of the CDG-Ia patients, TB was found to have a normal level of enzyme activity and JB was shown to have a specific activity that was slightly lower than the normal control range. Patient AH (CDG-Ib) had a specific activity slightly higher than normal. The GFA activity in the CDG-Ic patient, BB (41 ± 3.3 nmol/min/mg of protein) was significantly different (P<0.05) from the mean of the control patient (17 ± 1.7) and showed a two-fold higher GFA specific activity than the mean normal control value.

183 Chapter 6 Results CDG-Ix

40 I

B om lHMKS JB TB AH BB NormalNHRM

Figure 6.9: GFA activity in fibroblasts from CDG-I patients and normal controls

It was concluded that there was not a deficiency of GFA in any of the CDG-Ix patients and that the GFA activity in the CDG-Ic patient was significantly higher than in the controls.

6.3.4 Mutation analysis of hALG6 gene (CDG-Ic)

To complement the enzymic investigation, exon 11 of the hALG6 gene of the four

CDG-Ix patients was amplified by PCR and analysed by direct sequencing to look for the common mutation, A3 33 V, in this gene in CDG-Ic patients. Genomic DNA for

CDG-Ic patient BB, a positive heterozygous control for the A333V mutation and a normal control were also amplified by PCR alongside the CDG-Ix patients.

Sequencing of exon 11 for each of the four patients did not reveal any sequence changes, including the common mutation, A3 33 V. However, this mutation was detected in a heterozygous state in the known CDG-Ic patient, confirming that the PCR amplification had been successful.

184 Chapter 6 Results CDG-Ix

6.3.5 a-glucosidase I activities

To establish the TLC separation conditions and behaviour of the standards used in this method, three standards, namely TMR-trisaccharide, TMR-disaccharide and the TMR- linker were analysed by TLC, which was carried out as described in Section 6.2.5.

Figure 6 .10 shows the typical separation of these standards.

t TMR (aglycone)

contamination with Di- ( probably due to breakdown on storage)

Figure 6.10: TLC analysis of separation of TMR-labelled standards Lane 1 : TMR-labelled-Glc(al-2)Glc(al-3)Glc(al-0)-(CH2)gC00CH3-trisaccharide standard Lane 2: TMR-labelled Glc (al-3)Glc (a 1 -0)-(CH2)gC00CHg-disaccharide standard Lane 3; TMR-labelled linker (aglycone)

The separation of the three TMR-labelled standards were therefore adequate for subsequent assays of a-glucosidase I.

6.3.5.1 Inhibition of a-glucosidase I

The effect of the inhibitor, castanospermine, on the a-glucosidase I activity in normal control fibroblasts was investigated using the TMR-labelled trisaccharide to validate the assay (Figure 6.11).

185 Chapter 6 Results CDG-Ix

Aglycone

Mono-

Figure 6.11: TLC analysis of the hydrolysis of TMR-labelled trisccharide by a- glucosidase I in the presence and absence of castanospermine. Lane 1: Normal control fibroblasts incubated for 24 h without castanospermine. Lane 2: Normal control fibroblasts incubated for 3 h without castanospermine. Lane 3: Normal control fibroblasts incubated for 3 h without castanospermine followed by incubation for a further 24 h with castanospermine (1.8 mM)

Analysis of the digestion mixture produced by incubation of an extract of normal fibroblasts with the substrate for 24 h (Lane 1, Figure 6.11) showed that there was partial hydrolysis of the substrate to the monosaccharide and aglycone. A spot corresponding to TMR-disaccharide was not observed, suggesting that it was readily converted to the monosaccharide. This was confirmed by a shorter incubation at 3 h

(Lane 2, Figure 6.11), which yielded only the monosaccharide and the unhydrolysed substrate. Addition of castanospermine and further enzyme to this reaction mixture prevented further hydrolysis, indicating that the hydrolysis of the trisaccharide by a- glucosidase I and of the monosaccharide by a-glucosidase II were inhibited by the castanospermine.

6.3.S.2 a-glucosidase I activity in fibroblasts from normal controls and CDG-I patients

The a-glucosidase I activity was assayed in cultured fibroblasts from four CDG-Ix, one

CDG-Ia (KF), one CDG-Ib (AH), one CDG Ic (BB) patients and in normal control fibroblasts was assayed (Figures 6.12 and 6.13). It can be seen that after 3 hours

186 Chapter 6______Results ______CDG-Ix

(Figure 6.12) some of the trisaccharide has been hydrolysed to the monosaccharide by extracts of fibroblasts from all of the patients. This indicates that none of the patients is deficient in a-glucosidase I or II. Again the disaccharide was not detected as an intermediate in the hydrolysis. This confirms that the TMR-disaccharide is a very good substrate for a-glucosidase II and that there is a high level expression of this enzyme in fibroblasts. The absence of the aglycone, TMR, after 3 hours suggests that the removal of the inner a - 1,3 linked glucose is the rate-limiting step in the deglucosylation of glycoproteins.

The a-glucosidase I activities of the patients and normal control fibroblasts were calculated by measuring the intensities of the spots on the TLC plates (See Section

6.4.1), using the GRAB-IT™ gel documentation software and analysis system (Ultra-

Violet Products Ltd.) and Gel Works. For the first set of patients investigated (Figure

6.12), assays were carried out separately for 1, 2 and 3 hours at 37°C to monitor the

progress of the hydrolysis. The amount of monosaccharide increased linearly with time

indicating that the enzyme was stable under these conditions.

Mono

^ Tri

Figure 6.12: TLC analysis of the fluorescently labeled trisaccharide by extracts of fibroblasts from CDG-I patients Lane 1: (TMR)-labeled trisacchande Glc (al-2)Glc (al-3)Glc (al-0)-(CH2)8C00CH3 - standard. Lane 2: (TMR)-labeled disaccharide Glc (al-3)Glc (al-0)-(CH2)8C00CH3 - standard. Lane 3; Normal control-Ih. Lane 4; Normal control-2h. Lane 5; Normal control-3h. Lane 6: KS- CDG-Ix-lh. Lane 7; KS-2h. Lane 8: KS-3h. Lane 9; KF-CDG-Ia -Ih. Lane 10. KF- 2h. Lane 11; KF-3 h. Lane 12: RM- CDG-Ix-lh. Lane 13: RM-2h. Lane 14: RM-3h. Lane 15: BB-CDG-Ic-lh. Lane 16: BB-2h. Lane 17: BB-3h.

187 Chapter 6 Results CDG-Ix

The intensities of the mono- and trisaccharide spots after the 3 h incubation were quantified and the specific activities of a-glucosidase I calculated in nmol/min per mg of protein as illustrated in Table 6.6;

Sample Total Intensity Intensity Fraction Fraction Concn. mg of nmol/ Band of ofTMR- hydrolysed hydrolysed/ of protein in min/ Intensity TMR-Tri Mono to Mono min protein reaction mg (mg/ml) mix Normal 13493 10148 3345 0.25 0.14 2.4 0.04 0.18 KS 12567 10152 2415 0.19 0.11 1.8 0.03 0.18 RM 11725 8460 3265 0.28 0.16 2.6 0.04 0.20 KF(la) 10569 8737 1832 0.17 0.09 2.0 0.03 0.15 BB (Ic) 7265 5841 1424 0.20 0.11 2.6 0.04 0.14

Table 6.6: Calculation of specific activities of a-glucosidase I in the CDG-I patient fibroblasts and normal control fibroblasts Each reaction mixture contained 5 nmol of 1 mM TMR-trisaccharide substrate

The remaining two CDG-I patients (NH and AU), together with defined CDG-I patients and a normal control, were assayed for a-glucosidase I activity using the same method, but with incubation times of 3 and 24 h at 37°C. The intensities of the spots of hydrolysis products were quantified after 3 h incubation were measured (Figure 6.13).

TMR

Mono

Di-

Tri

Figure 6.13: TLC analysis of the fluorescently labeled trisaccharide by extracts of fibroblasts from CDG-I patients Lane 1: (TMR)-labelled trisaccharide Glc (al-2)Glc (aI-3)Glc (al-0)-(CH2)8C00CH3 - standard. Lane 2; (TMR)-labelled disaccharide Glc(al-3)Glc (al-0)-(CH 2)8C00CH 3- standard. Lane 3; (TMR)-labelled linker (aglycone). Lane 4: Normal control-3h. Lane 5: Normal control- 24h. Lane 6: NH- CDG-Ix-3h. Lane 7: NH-24h. Lane 8: AU-CDG-Ix-3h. Lane 9: AU-24h. Lane 10: AH- CDG-Ib-3h. Lane ll:AH-24h. Lane 12: BB- CDG-Ic -3h. Lane 13: BB-24h.

188 Chapter 6 Results CDG-Ix

Sample Total Intensity Intensity Intensity Fraction Fraction Concn. mg of nmoles/ Band of TMR of of hydrolysed hydrolysed/ of protein min/mg Intensity (aglycone) TMR. TMR- to TMR min protein in Mono Tri (aglycone) (mg/ml) reaction mix Normal 36854 6634 14280 15490 0.567 0.32 8.06 0.13 0.09 NH 25279 2851 7199 15299 0.398 0.22 6.17 0.10 0.08 AU 31451 4704 11030 15717 0.500 0.28 6.92 0.11 0.09 AH(Ib) 27384 4890 7907 14587 0.467 0.26 9.44 0.16 0.06 BB (Ic) 32287 7116 13475 11696 0.638 0.36 7.79 0.13 0.10

Table 6.7: Calculation of specific activities of a-glucosidase I in the CDG-I patient fibroblasts and normal control fibroblasts Each reaction mixture contained 3.5 nmol of ImM TMR-trisaccharide substrate.

Using the same method, De Praeter et al (2000) reported those patients with a confirmed a-glucosidase I deficiency (CDG-IIb) only had <3% residual activity compared to the normal controls. From this investigation, it is evident that none of the patients were deficient for this enzyme, when compared to the normal control.

Patient a-glucosidase I Activity % activity compared to normal control NH 89 RM 113 KS 100 AU 100 KF(Ia) 104 AH(Ib) 67 BB (Ic) 102

Table 6.8: Specific activities of a-glucosidase I in the known and unknown CDG-I patient fibroblasts. Activities were compared to activity in normal control fibroblasts assayed at the same time

189 Chapter 6______Discussion ______CDG-Ix

6.4 Discussion

The work described in this chapter was carried out between January 1998-December

2000, during which a number of new subtypes of CDG-I, CDG-Ib-If, were identified by other laboratories (See Table 1.3, Chapter 1). In all of the 6 subtypes of CDG-1 (la-lf), mutations in the respective genes have been shown to markedly diminish the enzymatic activity or functions of the protein products. A number of other key candidate enzymes responsible for the synthesis of precursor glycosyl residues involved in the biosynthesis of LLOs were therefore investigated in the four CDG-lx patients. No evidence was obtained in this project for a deficiency of GDPMP, Dol-P-Man synthase or GFA in the four CDG-lx patients. However, during this period, a deficiency of Dol-P-Man synthase was established as the cause of CDG-le in several European and American patients

(Imbachet al., 2000; Kim et al., 2000).

In a retrospective maimer, the statistical analysis of the data produced during the course of the present work suggests some interesting speculative trends in these patients. The raw data from four normal controls, four CDG-1 patients with la, lb, and Ic subtypes and four patients with uncharacterised CDG-lx were pooled in a group manner form and subjected to statistical analysis carried out using the Mann-Whitney U test. This test involves no assumptions about the distribution of the population and can be used for groups with as little as three samples in each group. In the case of GDPMP (Table 6.2), a CDG-lx patient (RM) showed a significantly higher activity (1.2 ± 0.25 mU/mg of protein, P<0.05) compared with that of the normal control group (0.76 ± 0.09 mU/mg of protein).

190 Chapter 6______Discussion ______CDG-Ix

A similar analysis of the data on Dol-P-Man synthase (Table 6.4) showed that a CDG-Ix patient (KS) had significantly higher enzyme activity (39 ± 7.0 pmol/min/mg of protein,

P<0.05) compared with the mean activity of the normal control group (21 ± 2.7

pmol/min/mg of protein). Using a similar method, a mean specific activity for Dol-P-

man synthase in control human fibroblasts has been reported to be 11.8 pmol/min/mg of

protein (Imbach et al., 2000).

The analysis of data on GFA activity showed no statistical difference among the CDG-

Ix group and the control group. However, the GFA activity of a known CDG-Ic patient

(BB) was found to be significantly higher (41 ± 3.3 nmol/min/mg of protein, P<0.05)

than that of the mean value of the normal control (17 ±1.7 nmol/min/mg of protein)

(Table 6.5).

The assays on a-glucosidase I, carried out according to the procedure described by De

Praeter et al (2000) and employing the TLC technique showed no significant variation

among all of the CDG-Ix patients compared with the control group and the CDG-Ia, -Ib

and -Ic cases (Table 6.6). The specific activities calculated for patients in this

investigation could not be compared with the results published by De Praeter et al

(2000) as the figures for specific activity were not given.

Although it is speculative, a review of the overall information available on some genetic

and enzymological aspects and structural analysis of the LLO synthesised by fibroblasts

in culture from CDG-Ix patients does provide some interesting clues as to possible

defects in their LLO synthesis.

191 Chapter 6______Discussion ______CDG-Ix

6.4.1 Case study of CDG-Ix patient NH

The enzymological investigations carried out on a CDG-Ix patient (NH) showed that the activities of PMM, PMI, PGM, PGI, GDPMP, Dol-P-Man synthase, GFA and a- glucosidase I were within the normal range. Complementary genetic analysis also confirmed the absence of mutations in the PMM2, MPI, hALG6 and DPMI genes. In some research laboratories, the structural analysis of LLOs synthesised by CDG-I patient fibroblasts is carried out by pulse-labelling the cells with radiolabelled mannose followed by extraction and HPLC analysis of the oligosaccharides. For patient NH,

LLO analysis was kindly carried out by Dr. Markus Aebi (Mikrobiologisches Institut,

Switzerland). The results indicated the accumulation of Man 9GlcNAc2 -PP-Dol,

GlciMan 9GlcNAc2 -PP-Dol and some Glc 3 Man 9GlcNAc2 -PP-Dol. This suggests a partial defect in the glucosylation of LLO intermediates. However, the patient (NH) was negative for the common mutation (A333V) in the hALG6 gene, which encodes al,3 glucosyltransferase that converts Man 9GlcNAc2 -PP-Dol into GlciMan 9GlcNAc2 -

PP-Dol. The defect in ALG6, which also results in the lack of glucosylation of LLO has been observed in patients with CDG-Ic. To date, this genetic defect in the LLO

synthesis produces the mildest clinical phenotype amongst all of the known subtypes of

CDG-I. Since, in the present study the patient NH was only screened for the common mutation (A333V) in the hALG6 gene, this finding cannot rule out the possibility of

other mutations in this gene, which may have an adverse effect on the al,3

glucosyltransferase activity and may present with a clinically severe form of CDG-Ic.

192 Chapter 6 Discussion CDG-Ix

-pp P—Kw* VM» ER Lumen X4 Lee 35 l l i p p a s e \WW_

\NW_

P- ALG5 I ■ P_

X3 ALG6 ALGIO Lec 35 l l i p p a s e L .r t . ALG8

Figure 6.14: The role of Lec35, ALG6^ ALG8 and ALGIO in the conversion of

MansGlcNAc2-PP-Dol intermediates to GIcsMançGIcNAci-PP-Dol vwi /1 dolichol, ■, N-acetylglucosamine; • , mannose; ♦ , glucose

The clinical presentation was severe in NH and his sister (not presented in this study) who died at the ages of 3.5 months and 5 days, respectively. Because lack of glucosylation of MangGlcNAc^-PP-Dol intermediate does not appear to be life- threatening as indicated by the ALG6 defect it is possible to speculate that the other two glucosyltransferases and their respective ALG8 and ALGIO genes are not involved.

Thirdly, it can be suggested that a defect in the ALG5 gene, which encodes Dol-P-Glc synthase involved in the synthesis of Dol-P-Glc from UDP-Glc and Dol-P may also not be a primary defect in NH Fourthly, it can also be suggested that a defect in the translocation of Dol-P-Glc into the ER-lumen may also be ruled out because Lec35 appears to be intact as indicated by its efficiency in the translocation of Dol-P-Man into the ER-lumen in patient NH These steps in the LLO synthesis are illustrated in Figure

6.14. Therefore, this leaves the strong possibility of a defect in the UGPl gene, which

193 Chapter 6______Discussion ______CDG-Ix encodes the cytosolic UDP-glucose pyrophosphorylase (UDPGPP), which catalyses the conversion of Glc-l-P to UDP-Glc.

The utilisation and role of Glc and/or F-6-P in the protein iV-glycosylation pathway, including the synthesis of LLO and post-transfer processing of protein iV-linked oligosaccharide during the protein-folding process have been depicted in Figure 6.15.

Genetic defects in this pathway (Figure 6.15) have not been reported so far. Besides supplying three Dol-P-Glc molecules for the synthesis of every mature LLO and one

UDP-Glc molecule per round of reglucosylation of protein #-linked high-mannose oligosaccharide during UDP-glucose:glycoprotein glucosyltransferase (UGT)- dependent reglucosylation for calnexin/calreticulin cycles of interactions (Sousa and

Parodi, 1995; Trombetta et al., 1996), UDP-Glc is also directly involved in glycogen synthesis (Alonso et al., 1995; Hellerstein et al., 1997), in the interconversion to UDP-

Gal by UDP-Gal epimerase (Silbert and Sugumaran, 1995; Furukawa and Roth, 1998) and for the synthesis of other glucose-containing molecules, such as glucosylceramide

(Varki et al., 1998).

It can be speculated that the possibility of a defect in the ER-membrane bound UDP-Glc transporter, like that of the Golgi-membrane bound GDP-fucose transporter found in the case of CDG-IIc (Lubke et al., 1999; Lübkeet al., 2001; Luhn et al., 2001) can be ruled out for two main reasons. Firstly, the serum transferrin pattern of the patient NH shows the typical protein hypoglycosylation, which is characteristic of CDG-I syndromes.

Secondly, LLO analysis on the patient’s fibroblasts also clearly demonstrates the accumulation of Man 9GlcNAc2 - and GlciMan 9GlcNac2 -LLO intermediates. If there had been a complete defect in the UDP-Glc transporter per se, there would have been no

194 Chapter 6 Discussion CDG-Ix possibility in finding such LLO intermediates. Therefore, it is highly tempting to speculate that the genetic defect is in the UGPl gene, which encodes UDP-glucose pyrophosphorylase (UDPGPP, E C 2.7.7.9). A decrease in the UDP-Glc synthesis owing to a primary defect in UGPl, may secondarily reduce the Dol-P-Glc pool required for the complete glucosylation of LLO intermediates as well as the UDP-Glc pool in the ER-lumen required for the re-glucosylation of protein A-linked

Man 9GlcNAc2 -structures by UGT for their interaction with CNX/CRT chaperones.

This dual role of UDP-Glc in LLO synthesis and ER-processing of glycoproteins may explain why the clinical presentations of NH and his sister were extremely severe.

While this is merely speculation, it can be argued that conversion of UDP-Gal by UDP-

Gal-4-epimerase can compensate the putative defect in the production of UDP-Glc from

Glc-l-P by UDP-glucose pyrophosphorylase.

F-6-P Î hexokmase T Glc ------Glc-6-P

Cvtosol Glc-l-P UDP-Gal UCiPU UDP-Gal-4-epimerase UDP-Glc transporter UDP-Glc Dol-P-Glc synthase (ALG5)

ER-Membrane Dol-P-Glc

Man»GIcNAc2-PP-Dol UMP Glucosyltransferase Phosphatase ^ (AIG6. 8, 10) UDF

ER-Lumen G lcM an, OST cicjMan, Man, +UDP-Glc GIcNAcî ------► GlcNAcz ------► GlcNAcz. -PP-Dol Protein Crls I! Protein GGTUGT

Glci Man, GlcN Acz Protein

G|c_6_p ^ Gls II

ATP Man, GIcNA c2 Protein Figure 6.15; Glucose utilisation in the protein A-glycosylation pathway

195 Chapter 6______Discussion ______CDG-Ix

A deficiency of UDP-Glc has been reported in insulin-dependent tissues of diabetic organisms, which is probably due to defective glucose transport into the cells (Spiro,

1984; Sochor et al., 1991; Robinson et al., 1993).

A mutant mammalian cell line derived from CHO cells, DonQ, has been reported to have a persistently low level of UDP-Glc (Flores-Dfaz et al., 1997) and enzymatic investigation of DonQ showed a 4% activity of UDPGPP compared to that of the wild type. Subsequent sequence analysis of UDPGPP cDNA from the mutant cell indicated the presence of a single missense mutation, G115D. The substituted glycine was located within the largest stretch of strictly conserved residues among eukaryotic

UDPGPPs, hence dramatically impairing its enzyme activity, thereby causing a cellular

UDP-Glc deficiency.

In humans, the UGPl gene has been cloned (Peng and Chang, 1993) and is localised to chromosome lq21-22 (Goss and Harris, 1997).

In conclusion, on the basis of enzymological and genetic data produced in this laboratory and the LLO analysis by Dr. Markus Aebi, Switzerland, it is recommended that NH and his family should be investigated for the possibility of mutations in the

UGPl gene.

6.4.2 Case study of CDG-Ix patient KS

KS, another CDG-Ix case is also interesting. She died in 2002 at 3.5 years of age. This patient did not have a deficiency of PMM, PMI, PGM, PGI, GDPMP, GFA or a- glucosidase I, but the Dol-P-Man synthase activity was significantly higher (39 ± 7

196 Chapter 6 Discussion CDG-Ix pmol/min/mg of protein, P<0.05) than that of the control group (21 ± 2.7 pmol/min/mg of protein). This observation provides further support to the hypothesis that a defect in

LLO synthesis or assembly pathways may up-regulate at the transcriptional level, the production of enzymes proximal and distal to the genetic defect. This point will be discussed further in the concluding remarks (Section 6.4.5). Complementary genetic analysis did not show the presence of common mutations mutations in the DPMI and hALG6 genes. The LLO analysis carried out by Dr. Markus Aebi (Mikrobiologisches

Institut, Switzerland) indicated the accumulation of Man 5 GlcNAc2 -PP-Dol and

GlcaMansGlcNAcî-PP-Dol. The presence of GlcaMansGlcNAcz-PP-Dol is intriguing and supports the idea of “bypass or salvage routes” postulated in Chapter 1, Section

1.3.1.7. It suggests that in the event of the failure of the mannosylation steps in the lumen of the ER to form Man 9GlcNAc2 -PP-Dol, the Man5GlcNAc2 -PP-Dol can be directly recruited for glucosylation (Figure 6.16).

Cytosol

Lumen ALG3

Figure 6.16 Glucosylation of MansGlcNAc 2-PP-Dol oligosaccharide as a result of a defect in the ALG3 gene.

■, N-acetylglucosam ine; #, m annose; ♦ , glucose

197 Chapter 6______Discussion ______CDG-Ix

In patient KS, it is unlikely that there is a defect either in theRFTl gene, which encodes the Rftl flippase protein responsible for the translocation of MangGlcNAci-PP-Dol from the cytoplasmic to the lumenal side of the ER membrane (Helenius et al., 2002) or in the LEC35 gene and its protein due to the presence of GlcsMansGlcNAci-PP-Dol. A defect in Lec35 would otherwise affect the glucosylation steps as well.

The addition of GlcsMangGlcNAcz oligosaccharide structures to the glycoprotein molecule in the CDG-Ix patient KS could only mitigate the adverse underglycosylation defect to some extent compared with CDG-la. The efficiency of transfer of

GlcgMangGlcNAci- or of MansGlcNAc 2 - from their lipid carriers compared to that of

GlcsMangGlcNAcz-PP-Dol is reduced by more than 20-30 fold (Jackson, 1989).

However, the presence of such glycans in the nascent ^-glycoproteins reduces the efficiency of their facilitated folding by interactions with calnexin/calreticulin and UGT.

For instance, the efficiency of a-glucosidase 11 in removing the two (al-3)-linked glucose residues decreases in the following order: Man 9>Mang>Man 7 , as reported by

Parodi (2000) using Glc 2 Man 9.7 GlcNAc2 -protein samples as substrates. The interaction with CNX/CRT also decreases in the following order:

GlciMan 9>GlciMan 8>GlciMan 7 >GlciMan 5 , with the binding of GlciMang to CNX/CRT remaining about 65% of that of GlciMau 9 . The re-glucosylation by UGT also decreases as indicated by relative ratios; Man 9 : Mang: Man 7 _5 , 1:0.5:0.15 (Parodi, 2000).

The combined effect of the reduced efficiency of transfer of truncated LLOs by OST and the impairment in the interactions with CNX/CRT in the absence of the mannosylated cluster on the protein-linked glycans would reduce the efficiency of protein folding and impede the exit from the ER by the ER-quality control system.

198 Chapter 6______Discussion ______CDG-Ix

Furthermore, these aberrantly glycosylated glycoproteins would require alternative processing routes in the Golgi prior to their complex AT-glycosylation. The overall consequence of abnormal glycosylation could present adverse phenotypes compared to milder cases of CDG-Ia.

The patient KS may have had CDG-Id with a genetic defect in ALG5, which encodes

Dol-P-Man: MangGlcNAcz-PP-dolichyl mannosyltransferase. The lack of insertion of the Man6 residue in the al-3 linkage on the al-6-linked Mans in the MangGlcNAcz-PP-

Dol abrogates all of the subsequent mannosylation steps in the ER (Figure 6.16). It is important to mention that the clinical features of KS, mainly intractable epilepsy, little or no developmental progress and microcephaly, overlap with the clinical presentation reported for the known case of CDG-Id (Komer et al., 1999) (personal communication with Professor Peter Clayton, Institute of Child Health, London). It is therefore reasonable to recommend that the DNA from KS and her parents should be investigated further for the possibility of mutations in the ALG5 gene.

An overall increase in the levels of GDPMP in the CDG-Ix group as a whole (Table 6.2) and the lack of utilisation of Dol-P-Man owing to the possibility of a defect in the ALG5 gene via a feedback mechanism may result in an increased amount of GDP-Man being recruited into GDP-fucose synthesis and this may also explain the increased fucosylation of serum transferrin and a-i-anti-trypsin being observed in this patient

(KS). It is also tempting to speculate that the initial presence of a truncated glycan in the nascent protein molecule and the secondary adaptation of these nascent glycoproteins to different protein-folding pathways may also influence the accessibility of

199 Chapter 6______Discussion ______CDG-Ix fucosyltransferase required for the core glucosylation of ^-glycoproteins as observed in a number of CDG cases.

6.4.3 Case study of CDG-Ix patients RM and AU

The two other CDG-Ix patients, RM and AU, also showed no deficiency of PMM, PMI,

PGM, GDPMP, Dol-P-Man synthase and a-glucosidase I. Complementary genetic analysis did not reveal the presence of common mutations in the DPMI and ALG6 genes. At present, no information is available on the structural analysis of LLOs from fibroblast cultures of these two patients. The GDPMP activity of patient RM was significantly (P<0.05) higher than that of the controls (Table 6.2), whilst Dol-P-Man synthase activity was within the control range. At present, no other information is available on these two CDG-Ix patients and it is not possible to predict any possible defects in the LLO synthesis or its transfer pathway.

6.4.4 Increased levels of glutamine: fructose 6-P amidotransferase

(GFA) levels in CDG-Ic patient (BB)

The GFA activity in the fibroblasts from a patient with CDG-Ic (BB) was significantly higher than in any other patients or control fibroblasts. The enzymatic activity of GFA protein is negatively regulated by its downstream products GlcNAc-6-P and UDP-

GlcNAc (Komfeld, 1967; McKnight et al., 1992). The observed increase in the GFA

activity in CDG-Ic (patient BB) is most likely due to the transcriptional up-regulation of

the GFA gene, although direct evidence based on mRNA and protein level analyses is

not yet available. Whether or not allosteric inhibition of the enzyme by its reaction products GlcNAc-6-P and UDP-GlcNAc can neutralise and repress otherwise

deleterious effects of GFA in the patient BB are not known. An increase in GFA

200 Chapter 6______Discussion ______CDG-Ix activity has been reported in patients with type II diabetes (Yki-Jarvinen et al., 1996) and it can also induce glucose toxicity and insulin resistance (Yki-Jarvinen et al., 1987;

Rossetti et al., 1990). Information on this enzyme in other CDG-Ic patients is not available and on the basis of the age group of the patients, the signs of onset of type II diabetes may be premature as yet.

The increased levels of GFA and hence of GlcNAc-6-P in CDG-Ic patient (BB) would be expected to increase the synthesis of glycosaminoglycan chains such as heparan sulphate (HS). However, Westphal et al (2000) have reported that reduced synthesis of

HS in enterocytes contributes to the protein-losing enteropathy (PLE) in this patient. As proposed by these authors, the selective loss of HS may be due to the underglycosylation and misfolding of the core syndecan-1 protein itself, which has two conserved potential N-linked glycosylation sites asparagine (NFS) at 43 and asparagine

231 (NQS). Severe PLE in children usually results from lesions where epithelial HS is preserved e.g., lymphangiectasia (Murch, 1997) or inflammatory enteropathy e.g., celiac disease and Crohn’s disease.

6.4.5 Concluding remarks

A small number of controls (4 subjects), CDG-I (4 patients) and CDG-Ix (4 patients) were used in addition to a “shot-gun” approach being employed to investigate the possible enzymological defects in only four key enzymes in LLO synthesis and processing. The data in the work described here point to a number of issues of interest.

It seems that in the presence of a genetic block in LLO synthesis and protein N- glycosylation pathway, some enzymes either proximal or distal to the metabolic block

201 Chapter 6______Discussion ______CDG-Ix show a significant increase. Whether this increase in the enzyme is owing to transcriptional up-regulation or due to feedback inhibitory/stimulatory mechanisms controlling the flux of the substrate molecules is not clear as yet. The metabolic pathways thus appear to follow “push-pull” mechanisms, which enable the cells to drive the flux of the molecules more efficiently through the metabolic block. Recent work by

Doerrler and Lehrman (1999), clearly substantiates this hypothesis. These authors have shown that protein iV-glycosylation inhibition (by tunicamycin) in human fibroblasts in culture accelerates and up-regulates LLO synthesis. Further important observations based on patient KS with respect to accumulation of Man 5 GlcNAc2 -PP-Dol and

Glc3 MansGlcNAc 2 -PP-Dol also clearly suggest that in the presence of a genetic/metabolic block, human cells are efficient in the appraisal and utilisation of bypass or salvage routes. This hypothesis is substantially supported by recent work on the over-expression of Rftl (MansGlcNAc 2 -PP-Dol flippase) in the M lg ll

Saccharomyces cerevisiae strain (ALGll encodes a GDP-Man-dependent mannosyl transferase for the synthesis of Mans or Man 4 GlcNAc2 -PP-Dol from Man 3 GlcNAc2 -PP-

Dol into the ER lumen). Only Man 3 in an al-6-linkage is mannosylated to produce

ManvGlcNAc 2 -PP-Dol, with no production of any glucosylated intermediates (Helenius et al., 2002). These observations emphasise that the synthesis of intermediates of the

LLO is highly ordered, as a defect in A L G ll abrogates any maimosylation and glucosylation at the al-3 arm and a defect 'mALG3 abolishes any further mannosylation at the a l-6 arm of the LLO intermediates.

202 Chapter 7______Introduction ______PMMl

Chapter 7

Molecular analysis of PMMl

7.1 Introduction

The search for the defective gene in CDG-Ia revealed the existence of two genes,

PMMl and PMM2, both encoding active phosphomannomutases. CDG-Ia has an autosomal recessive mode of inheritance and the disease-causing locus, as described in detail in Chapter 2, was mapped to chromosome 16 by linkage analysis (Martinsson et al., 1994). The identification of two genes, encoding active PMMs was based on their sequence similarity to the yeast PMM (SEC53) (Kepes and Schekman, 1988). The first gene, PMMl, was localised to chromosome band 22ql3 and therefore could not be the considered as the disease-causing gene (Matthijs et al., 1997a; Wada and Sakamoto,

1997). The second gene, PMM2, was mapped to chromosome band 16pl3 by linkage analysis (Martinsson et al., 1994; Matthijset al., 1996) and this confirmed the role of

PMM2 in CDG-Ia. Patients diagnosed with CDG-Ia have a deficiency of PMM and the subsequent identification of mutations in the PMM2 gene in patients with a documented

PMM deficiency provided the evidence that PMM2 is the disease-causing locus in the majority of patients (Matthijs et al., 1997a; Schollen et al., 1998; Matthijs et al., 1999;

Carchon et al., 1999).

The reasons for investigating PMMl were 1) because mutations in PMMl with its particular tissue distribution might be the cause of disease in CDG-Ix patients who have normal PMM activity in white blood cells and fibroblasts, in which PMMl is not

expressed and 2) mutations in PMM2 found in CDG-Ia patients might also be in PMMl,

compounding the defect in certain tissues (for example, brain).

203 Chapter 7______Introduction ______PMMl

7.2 Comparative analysis of the PMMl and PMM2 genes

The cDNA of PMMl has an open reading frame (ORF) of 786 bp and encodes a protein of 262 amino acids, whereas PMM2 has an ORF of 738 bp and encodes a protein of 246 amino acids. Human PMMl and PMM2 genes share 54% and 58% identity at the amino acid level with SEC53, respectively. At the DNA level (coding sequence only), the identity is 32% and 52% for PMMl and PMM2, respectively. Hence, the degree of identity with yeastSEC53 is higher for PMM2 than PMMl, which suggests thatPMM2 is closer to the ancestral gene. An alignment of human PMMl and PMM2 genes

(Matthijs et al., 1997a) revealed that there are 78 differences at the amino acid level between PMMl and PMM2, not including 4 mutational events that have led to the difference in the length of the proteins. The overall identity in the coding region of both genes was 65% at the nucleotide level and 66% at the amino acid level. PMM2, mainly due to a deletion of 7 amino acids in the N-terminal part of the protein, is shorter than

PMMl and an insertion of 2 amino acids, after position 63 and between two conserved domains is unique to PMMl.

A comparison of the genomic structure of PMMl and PMM2 carried out by Schollen et al (1998) showed that both genes are composed of eight exons and the major difference occurs in exon 8, which contains the 3’ untranslated region (540 bp for PMMl and 1599 bp for PMM2). ThePMMl gene spans approximately 13 kb of genomic DNA, whereas the size of PMM2 is at least 17 kb.

In the course of mapping PMM2, Schollen et al, (1998) identified a processed pseudogene (PMM2tp) on chromosome 18 that is closely related to PMM2 (Figure 7.1).

The overall sequence similarity between the coding region of PMM2 and the

204 Chapter 7______Introduction ______PMMl corresponding regions of the intronless PMM2jp was 88%. When compared to PMM2, several base substitutions and single base insertions or deletions are present, suggesting that the processed pseudogene has been inactivated by mutations. Several base substitutions in PMM2 that have been associated with CDG-Ia are also present at the corresponding sites in PMM2\p. It was postulated that the mutations that had arisen in the population at a slow rate had also accumulated in the pseudogene.

H HHHHH EH J- 1— 11 ■ I i ■ I ■ it 1 2 3 4 5 6 7 8 PMM2

E E K E E PM M l J l l'l ■ ■■ * 1 2 3 4 5 6 7 8

E E PMM2 Ip

Figure 7.1: Comparison of the genomic structure of the PMM2, PM M l and PMM2\p genes. An EcoRI (E) and HindlW (H) restriction map has been established for the genes. Exons-black boxes. PMM2ip represents the processed pseudogene (taken from Matthijs eta l, 1999).

205 Chapter 7 Introduction PMMl

M A VTA Q A ARRR E R V M A AP G P A L C? L F? D V D G T L T PA R Q L C L F D V D G T L T AP R 9 KI D P E V AA F L? 0 K L R s KI TK E MDD FL 9 K L R Q RV Q 1 G V V? GG S D Y C K I KI K I G VV GG S D FE K V A E 0 L G D G DE V I E K F D? Q E q L - - G N D V V E K Y D H Y V? F A E N G T V Q Y? K G R V VF P E N G L V A Y K U G K LL S K Q T 1 Q N HL G E E L LL K R Q N I Q S HL G E A L L 0 DL I N? F C? L S Y? M A? L L I Q DL I N Y c L S Y* I A K I R L P? K KR G? T F? I? E F R? N G K L F* KKR G T F* I EF R N G M L N V? S P? I? G R S C T L E? E M L N V S P 1 G R s C S 9 E E R? 1 E F S E L D? KK E? K I? R Q RI E F YEL DKK E N 1 R E K F? V E D L K T E F A G K G L K F V A D L RK E F A G K G L R F s R G? G M I S F D V F? P E T F s 1 GG Q 1 S F D V F P D G W D? K R Y C L D S L D Q D S G W D* K R Y c L R H VE N D G F D T 1 H F?F G? N E T S P GG VK T I Y F F G DK T M P GG N? D? F E I F A D? P R T? V G? H S N D H E 1 F T D P R T M G Y S R V? V S P D T? V R C E I E Q Q C V* T A P E D T R - R I E L L F P F T A H E A - F S - - - - -

Figure 7.2: Alignment of PMMl and PMM2 cDNA sequence. Top line and bottom line represents PMMl and PMM2 cDNA sequence, respectively Bold black letters in the grey boxes indicate identity between the two genes. Letters in red denote mutations or polymorphisms found in the PMM2 gene in CDG-Ia patients. *, denote similar mutations in the PMM2 pseudogene; queries the possibility of corresponding mutation in PMMl gene.

The sequence identity between the coding regions of the PMMl and PMM2 genes

(Figure 7.2) highlights two important points. Firstly, it shows the amino acid residues

in the PMMl gene that is analogous to amino acid residues that are mutated in the

PMM2 gene. In total, 33 of 42 amino acid residues, which are mutated in PMM2 are

206 Chapter 7______Introduction ______PMMl found in amino acid residues homologous in PMMl. Secondly, it shows the amino acid residue where mutations are found in the PMM2 gene and its corresponding pseudogene.

7.2.1 Mouse orthologs of PMMl and FMM2

The orthologs of PMMl and PMM2 (Pmml and Pmm2) have been cloned and localized in the mouse (Heykants et al., 2001). Pmml and Pmm2 showed approximately 90% identity at the nucleotide and amino acid level to the corresponding human genes, but had only 66% amino acid nucleotide sequence identity with each other. The ORF of

Pmml is 786 bp, which is the same in humanPMMl, which therefore encodes a protein of 262 amino acids in both organisms. The ORF of Pmm2 was shown to be 12 nucleotides shorter than that of PMM2 due to a difference in the first exon, therefore predicting a protein that is 4 amino acids shorter than its human ortholog.

Pmml and Pmm2 were localized to mouse chromosome 15 and chromosome 16, where both correspond to syntenic chromosomal regions of the human genome. The genomic structures of the mouse and human PMM genes are highly conserved in that Pmml and

Pmm2 are also composed of eight exons and a comparison between the mouse and corresponding human genes showed that all of the intron/exon boundaries are conserved.

207 Chapter 7______Introduction ______PMMl

7.2.2 Enzymatic properties and tissular distribution of PMMl and

PMM2

The existence of PMMl and PMM2, two different isoenzymes of PMM, led Pirard et al

(1997, 1999) to investigate the functions of each enzyme with respect to their kinetic properties and tissue distributions. Human recombinant PMM2, like other phosphomutases was shown to be completely dependent on the presence of a hexose bisphosphate for its activity, with glucose 1,6-bisphosphate as potent as mannose 1,6- bisphosphate. Half-maximal stimulation of PMM2 was observed at 0.5 and 1 pM maimose 1,6-bisphosphate, in the presence of 10 and 100 pM Man-l-P, respectively.

The corresponding values for recombinant PMMl were significantly higher (1.3 and

5 pM). In the presence of a saturating concentration of hexose 1,6-bisphosphate, PMMl and PMM2 converted Man-l-P into Man-6-P at approximately the same rate,

46 pmol/min/mg of protein, but were approximately 20-fold less active in converting

Glc-l-P into Glc-6-P. The Km values of PMM2 for Man-l-P and Glc-l-P were 18 and

12 pM, respectively. Human recombinant PMMl catalyzed the conversion of both

Man-l-P (Km=3.2 pM) and Glc-l-P (Km= 6 pM) to the corresponding hexose-6- phosphate. The pH-activity profile of human recombinant PMM2 was found to be identical to that of PMMl, with an optimum at pH 6.5 and about 80% of the maximal activity at pH 7.1.

The tissue distributions of PMMl and PMM2 were investigated in rat (Pirard et al.,

1999), based on the differences in their kinetic properties as well as on their reactivity to antibodies raised against the two human isozymes. PMM2 activity was most abundant

208 Chapter 7______Introduction ______PMMl in intestinal mucosa (1.83 ±0.11 units/gram of tissue) and lowest in skeletal muscle

(0.12 ± 0.01 units/gram of tissue).

Western blotting, using antibodies against PMMl and PMM2 showed that PMM2 found in all tissues investigated and appeared to be responsible for more than 90% of activity in some tissues, for example, the cerebellum (Pirard et al, 1999). The activity of PMMl was restricted to the brain and to the lungs, where it constitutes about 65 and

10% of the total PMM activity, respectively. The tissue expression patterns of the mouse orthologs (Pmml and Pmm2) were similar to those of the human enzymes

(Heykants et aL, 2001).

7.3 Aims

The rationale for screening the PMMl gene for the presence of identical mutations in the PMM2 gene was based on the hypothesis that whereas some of the mutations have been preserved in the PMM2 pseudogene, it was possible that the PMMl gene may have similar mutatidns. Since the PMMl and PMM2 genes show differential expression in different organs, demonstrated in rat tissues (Pirard et a l, 1999) and that

PMMl is predominantly expressed in the brain, it was considered important to screen

thePMMl gene in CDG-Ia patients, which show severe neurological involvement.

At the time of this investigation, the genomic sequence of PMMl had not been

published and hence, the intron/exon boundaries were not known. Therefore the aims

of this study were to 1) delineate the intron/exon boundaries of the PMMl gene using a

BLASTN database search in order to design primers for the 8 exons of the PMMl gene.

209 Chapter 7______Introduction ______PMMl

2) amplify the 8 exons of the PMMl gene of CDG-Ia and Ix patients by PGR and 3) screen the amplified PGR products by SSGP for the presence of any sequence changes.

210 Chapter 7______Materials & Methods ______PMMl

7.4 Materials and Methods

Three severe (LM, KT, JB) and three mild (KF, TB and LB) CDG-Ia patients were screened for mutations in the PMMl gene. The patients LM and KF had the same genotype (R141H/F119L), as did TB and KT (R141H/V23IM), but in both cases the patients in both groups presented with marked differences in the level of clinical severity of the disease. Patient LB was also screened as she was found to have two mutations in the PMM2 gene that had not been reported elsewhere. In addition to these patients, genomic DNA of four CDG-Ix patients (NH, KS, RM and AU), one CDG-Ic patient (BB) and one normal control was amplified for the PMMl gene by PGR and screened by SSGP.

7.4.1 Amplification of genomic DNA for the PMMl gene by PCR

Genomic DNA was extracted from whole blood or fibroblasts as described in Section

2.3.3 of Chapter 2. The eight exons of the PMMl gene were amplified using intronic primer sequences that were determined by a BLASTN search, which compares a nucleotide query against a nucleotide sequence database, of chromosome 22, where the gene is located, along with the human PMMl cDNA sequence (Matthijs et al., 1997).

The PMMl cDNA sequence was found in source genomic sequence dJ347H13 (The

Sanger Center, UK) and the intron/exon boundaries were obtained by aligning the

PMMl cDNA sequence with the source sequence.

The primers were designed using the Primer 3 design program (Whitehead Institute).

The forward and reverse primer sequences used to amplify each of the eight exons of the PMMl gene are shown in Table 7.1. The primers were synthesized and purified by

Genosys.

211 Chapter 7 Materials & Methods PMMl

Target Primer Sequence (5’-^ 3’) Sequence Exon 1 PMMlexl+ TATCCCTGAGCTGCTTCTGC PMMlexl- GTGGGAGCTTCCAATCTTCA Exon 2 PMMlex2+ dTCCTGGGTTCTCAGCACT PMMlex2- AAGACGCCCAGGAATCTCTC Exon 3 PMMlex3+ GGTCACAGACGTGGTCTCAC PMMlex3- CCCTTGGACTGCTCCACTAT Exon 4 PMMlex4+ TCCATAGTGGAGCAGTCCAA PMMlex4- CCACACTTCTCCTCCCTCAG Exon 5 PMMlex5+ GGGAGTGTGGATTCTTGTCC PMMlexS- AGGTGCCTGAAAGGGTATCA Exon 6 PMMlex6 + ACGCTCACGTGGACTGTGT PMMlex6 - GGGCAGATGGTTTGAGGAG Exon 7 PMMlex7+ GAATGAACAAGCAGCCCTTC PMMlex7- GACCTGGCTTCCTCACTGTCC Exon 8 PMMlex8 + TGGAGAGGGACTCCACCTAA PMMlexS- TCCAACACCAGGACCTCTCT

Table 7.1 Sequence of oligonucleotide primers used to amplify the 8 exons of the PMMl gene. Forward sequence (+); reverse sequence (-).

PCR was carried out as described in Chapter 2, Section 2.3.5. The PCR conditions used

to amplify the 8 exons of the PMMl gene are shown in Table 7.2.

Exon M gCb Annealing Concentration temperature °C (mmol/1) 1 1.5 66 2 1.5 66 3 1.5 62 4 1.5 68 5 1.5 62 6 1.0 62 7 1.0 62 8 1.5 66

Table 7.2: PCR conditions used for amplification of the PMMl gene.

7.4.2 SSCP

SSCP was carried out for the 8 exons of the PMMl gene, as described in Section 2.3.6

(Chapter 2).

212 Chapter 7______Results ______PMMl

7.5 Results

All of the eight exons of the PMMl gene were amplified successfully by PCR from the genomic DNA of all of the CDG-I patients and a normal control.

7.5.1 SSCP analysis of the PMMl gene

SSCP analysis of all the exons of the PMMl gene was carried out for each patient. No conformational changes were detected in any of the exons (Figures 7.3-7. 6 ) compared with the normal control.

7.5.1.1 SSCP analysis of exon 1 of the PMMl gene

1 2 3 4 5 6 7 8 9 1 0 11 12

Figure 7.3: SSCP analysis of exon 1 of PMMl gene Lanes 1-4, CDG-Ix patients. Lane 5, CDG-Ic patient. Lanes 6-11, CDG-Ia patients. Lane 12, Normal control.

The PCR product for AU was weaker in comparison to the other patients and this resulted in weaker bands shown by SSCP analysis.

213 Chapter 7 Results PMMl

7.5.1.2 SSCP of exons 2-7 of the PMMl gene

14 15 21 22

Figure 7.4: SSCP analysis of exons 2-7 of PMMl gene for CDG-Ia patients Lanes 1-7: Exon 2-LM, KT, JB, KF, TB, LB, Normal control. Lanes 8-14:Exon 3-LM, KT, JB, KF, TB, LB, Normal control Lanes 15-21: Exon 4-LM, KT, JB, KF, TB, LB, Normal control Lanes22-28: Exon 5-LM, KT, JB, KF, TB, LB, Normal control Lanes29-35: Exon 6 -LM, KT, JB, KF, TB, LB, Normal control. Lanes36-42: Exon 7-LM, KT, JB, KF, TB, LB, Normal control.

12 13 18 19 24 25 30 31

.7 *■

Figure 7.5: SSCP analysis of exons 2-7 of PMMl gene for CDG-lx patients Lanes 1-6: Exon 2-NH, KS, RM, AU, BB, Normal control. Lanes7-12: Exon 3-NH, KS, RM, AU, BB, Normal control. Lanesl3-18: Exon 4-NH, KS, RM, AU, BB, Normal control. Lanes 19-24: Exon 5-NH, KS, RM, AU, BB, Normal control. Lanes25-30: Exon 6 -NH, KS, RM, AU, BB, Normal control. Lanes31-36: Exon 7-NH, KS, RM, AU, BB, Normal control.

214 Chapter 7 Results PMMl

7.5.1.3 SSCP of exon 8 of the PMMl gene

Figure 7.6: SSCP analysis of exon 8 of PMMl gene for CDG-Ia and Ix patients Lane 1, NH. Lane 2, KS. Lane 3, RM. Lane 4, AU. Lane 5, BB. Lane 6, LM. Lane 7, KT. Lane 8, JB. Lane 9, KF. Lane 10, TB. Lane 11, LB. Lane 12, Normal control.

The amplification products of the 8 exons of the PMMl gene for KT was consistently weaker in comparison to the other patients as the genomic DNA was of poorer quality, which resulted in weaker bands by SSCP analysis.

215 Chapter 7______Discussion ______PMMl

7.6 Discussion

The delineation of the genomic sequence of the PMMl gene was described in this study and from the sequence data, oligonucleotide primers were designed from the intronic sequences neighbouring the intron/exon boundaries of the eight exons of the PMMl gene. Genomic DNA was amplified by PCR from six CDG-Ia patients, four CDG-Ix patients, one CDG-Ic patient and one normal control for each exon of the PMMI gene.

The PCR samples were then subjected to SSCP analysis but no conformational changes were detected. This suggests that there are no mutations or polymorphisms in the

PMMI gene in any of the CDG-I patients. However, it should be mentioned that there are limitations to the SSCP methodology, as the overall detection efficiency of this analysis is ~90% under most conditions (Fan et aL, 1993). Therefore, it is possible that anomalies in the PMMI gene in these patients may have not been identified using SSCP analysis. The explanation of a lack of phenotype/genotype correlation in patients with

CDG-Ia may have been aided if mutations had been found in the PMMI gene. This is because PMMI is restricted to the brain and lung and a disruption of the gene encoding

PMMI may account for the clinical severity of the disease, with regards to the levels of mental retardation seen in the patients.

It is concluded, with the limitation of SSCP analysis, that disruption of the PMMI gene is not the underlying genetic defect in the four CDG-Ix patients investigated or the cause of phenotypic variation in CDG-Ia patients with the same genotype. However, it is important to mention that in this study, only the coding regions and intron/exon boundaries of the PMMI gene were screened in the CDG-I patients and further investigations by mRNA analysis or protein expression would be required to confirm these results.

216 Chapter 8 Introduction Inhibitor Studies

Chapter 8

Inhibitor studies on phosphomannomutase activity

8.1 Introduction

PMM is a key enzyme in the synthesis of the lipid-linked oligosaccharide precursor required for protein AT-glycosylation (Figure 8.1). The deficiency of PMM, in CDG4a, leads to reduced levels of Man-l-P and GDP-Man and hence the under-glycosylation of proteins. The selective and reversible inhibition of PMM activity may therefore be a useful biochemical tool for studying the relationship between a decreased supply of precursors and the extent of under-glycosylation of proteins under in vitro conditions.

Glucose + Phosphate Mannose li 6-Phosphogluconate

Glc-6-Phosphatase G6PDH

Glucokinase PGI PMI Glucose Glc-6-P ^ ^ Fni-6-P ^ Man-6-P Hexokinase /-/// + ATP i

PMM PGM

Fru-1,6-bisphosphate Man-l-P Glc-l-P

GDP-Man UDP-Glc

Dol-P-Glc Dol-P-Man X * ^ Dol-PP-oligosaccharide

Glycoproteins

Figure 8.1 Simplified diagram of pathway for synthesis of glycoproteins. Phosphoglucose isomerase (PGI); Phosphoglucomutase (PGM); Phosphomannose isomerase (PMI); Phosphomannomutase (PMM) Glucose-6-phosphate dehydrogenase (G6PDH); Dolichol (Dol); Fructose (Fru); Glucose (Glc); Mannose (Man) and Phosphate (P).

217 Chapter 8 Introduction Inhibitor Studies

This chapter describes in detail the effect of two synthetic analogues of mannose, 6 R- and 65-6C-methylmannose (Figure 8.2) on the inhibition of PMM. Both of the synthetic analogues were investigated as a first step in establishing a chemically inducible phenocopy of CDG-Ia and were synthesised by Dr. George Fleet.

OH OH

HO, OH HO, OH

OH OH HO HO

65,6C-methy Imannose 6 /?,6 C-methylmannose

Figure 8.2 Structures of synthetic analogues of mannose.

The inhibition of PGM, PMI, PGI and glucose- 6 -phosphate dehydrogenase (G 6 PDH) by the mannose analogues was also investigated. Part of this work has been published

(Martin et a l, 1999).

218 Chapter 8______Materials & Methods ______Inhibitor Studies

8.2 Enzyme assays and inhibition experiments

PMM, PMI, PGM, PGI and G 6 PDH activities were assayed in extracts of cultures of normal fibroblasts in the presence and absence of the two maimose analogues.

8.2.1. PMM, PMI and PGM enzyme assays

PMM, PMI and PGM were assayed as described in Section 2.2.4 of Chapter 2 with varying concentrations of 6 R- and 65-6C-methylmannose.

8.2.2 Phosphoglucose isomerase (PGI) assay

PGI was assayed according to the method described for PMM, PGM and PMI in

Section 2.2.4, but with the following final concentration of components; 0.25 mM

NADP, 10 pg/ml glucose- 6 -phosphate dehydrogenase in 50 mM HEPES (pH 7.1),

5 mM MgCli with and without ImM fructose. The addition of the cell extract was used to initiate the timed reaction of 1 0 min after a pre-incubation of 2 min.

8.2.3 Glucose-6-phosphate dehydrogenase (G6PDH) assay

Glucose- 6 -phosphate dehydrogenase (Sigma 5885) was diluted 1 in 1000 in Hepes buffer (pH 7.1). 50 pi was assayed in the presence of final concentrations of; 0.5 mM glucose- 6 -phosphate, 0.25 mM NADP and 1 pM glucose-1,6-bisphosphate for 10 min at 30°C, in a total reaction volume of 500 pi. The production of NADPH was measured at an excitation wavelength of 340 nm and an emission wavelength of 460 nm.

219 Chapter 8 Results Inhibitor Studies

8.3 Results

8.3.1 Kinetics of PMM and PGM

In order to validate the standard assays used in the inhibition studies of the two mannose analogues, the Km values for PMM (Figure 8.3) and PGM (Figure 8.4) were calculated using the Lineweaver-Burk equation.

-100 0 50 100 150-50 1/[S]

Figure 8.3: Lineweaver-Burk plot for determining the Km value for PMM

The Km value of Man-l-P for PMM was determined to be 0.013mM and therefore the

Man-l-P substrate concentration used in the standard assay was O.lmM, which should give saturation kinetics.

-15 -10 -50 510 15 1/[S] (mM-')

Figure 8.4: Lineweaver-Burk plot for determining the Km value for PGM

220 Chapter 8 Results Inhibitor Studies

The Km value of Glc-l-P for PGM was determined to be 0.09 mM and therefore the substrate concentration of 0.5 mM was used in the standard assay, to ensure saturation kinetics.

8.3.2 Effect of 6R-6C and 65-6C-methylmannose on enzyme activities

8.3.2.1 Preliminary experiments and effects on coupling enzymes

Preliminary results showed that both 6R-6C and 65-6C-methylmannose were good inhibitors of both PMM and phosphoglucomutase PGM. As the assays of both of these enzymes involve coupled enzymic reactions, the effects of 6R-6C and 6 S-6 C- methylmannose on the coupling enzymes were also investigated. Phosphomannose isomerase (PMI) (Figure 8.5), phosphoglucose isomerase (PGI) (Figure 8 .6 ) and glucose- 6 -phosphate dehydrogenase (G 6 PDH) (Figure 8.7) activities were not inhibited by either compound, indicating that the inhibition of PMM and PGM activity by the two synthetic compounds was a specific effect on the PMM and PGM enzymes.

150-1 +6/?-6C-methylmannose -6/?-6C-methylmannose + 6S-6C-me t hylmannose 100- -65-6C- methylmannose

5 0 -

0 10 20 30 40 Time (min)

Figure 8.5: Effects of 6R- and 6S-6C-methyImannose on FMI activity

( 0 to 1 0 min = pre-incubation period)

221 Chapter 8 Results Inhibitor Studies

4 0 0 n + 67?-6C-methylmannose - 6/?-6C-methylmannose g 3 0 0 - + 6S -6C- me thylmannose % +dS-6C-methylmannose k 2 0 0 -

100-

0.0 2.5 5.0 7.5 10.0 12.5 Time (min)

Figure 8.6: Effects of 6R~ and 6S-6C-methyImannose on PGI activity

200-1 + 6 R-6 C-methy Imannose

- 6 R-6 C-methylmannose o CJ + 6 S-6 C-methylmannose o>e - 6 S-6 C-methyImannose Ë 100- o z

0.0 2.5 5.0 7.5 10.0 12.5 Time (min)

Figure 8.7: Effects of 6R- and 6S-6C-methyImannose on G6PDH activity

The inhibition of PMM by 6S-6C and 6 R-6 C-methylmannose was very similar, with both compounds inhibiting PMM activity completely at a concentration > ImM (Figure

8 .8 ). 6S-6C and 6 R-6 C-methyImannose had I50 values of 0.25mM and 0.35mM, respectively.

222 Chapter 8 Results Inhibitor Studies

150-, ■ 6S-6C metityImannose —— 6R-6C methylmannose

.2 1 0 0 -

50-

0 1 2 3 4 5 Concentration of6S-6C and 6R-6C methylmannose [mM]

Figure 8.8: Inhibition of PMM by 6S-6C and 6/?-6C-methylmannose

The dose curves for the inhibition of PMM by the two synthetic analogues are presented in a linear form (Figures 8.9 and 8.10) and in both cases shows that they both obey

Michaelis-Menten reversible kinetics.

6 . 0 -

4.5

3.0

1/V

-Ki [/’I

Figure 8.9: Inhibition of PMM by 6jR-6C-methyIniannose

223 Chapter 8 Results Inhibitor Studies

7.5n .

6.0-

4.5-

3.0-

1.5-

, / f 1 I ■ ■ 1 1 ( 1 -0.3 -0.2 -O.y-0.0 0.1 0.2 0.3 0.4 0.5 0.6 -Ki [l]

Figure 8.10: Inhibition of PMM by 6S-6C methylmannose

67?-6C-methyImannose also inhibited PGM activity (Figure 8.11) with an I 50 of approximately 0.4mM. The 50I of 65-6C-methylmannose was not carried out due to lack of sample.

150i

i 100- i Ic a 50-

0 1 2 3 4 5 Concentration of 6R-6C-methylmannose [mM]

Figure 8.11: Inhibition of PGM by 6/?-6C-methylmannose

224 Chapter 8 Results Inhibitor Studies

The dose curve for the inhibition of PGM by 6R-6C-methylmannose also showed that it obeyed Michaelis-Menten reversible kinetics, when presented in a linear form (Figure

8.12).

9.0-

7.5- y

^ 6.0-

4.5- y ^

3.0- y ^

0.6 -Ki [>] Figure 8.12: Inhibition of PGM by 6/?-6C-methylmannose (linear form)

225 Chapter 8______Discussion ______Inhibitor Studies

8.4 Discussion

In this study, PMM activity was successfully inhibited by two synthetic derivatives of mannose ( 6 S-6 C and 6 i?-6 C-methylmannose). PGM activity was also inhibited by a similar efficiency by the two derivatives, which suggests that the configuration at the

C6 position is not important. The effect of 6 /?-6 C-methylmarmose on PMM and PGM activities was similar (I 50 of approximately 0.4 mM), however the substrate concentration of Glc-l-P (0.5 mM) in the assay of PGM was greater than that of the concentration of Man-l-P in the PMM assay (0.1 mM), which suggests that 6R-6C- methylmannose is more active on PGM. The nature of both 6 S-6 C and 6R-6C- methylmarmose, i.e. whether they were competitive or non-competitive inhibitors could not be deduced from this investigation, due to a shortage in the amount available of both derivatives. Further experimental investigations would need to be carried out for the assay of PMM and PGM, using both inhibitors with varying concentrations of their respective substrates.

In conclusion, both 6 S-6 C and 6 i?-6 C-methylmaimose could be used to inhibit PMM, which would be a useful tool in investigating the underlying biochemical defect in

CDG-1. The demonstration of the inhibition of PMM and PGM by 6 S-6 C and 6R-6C- methylmannose in HepG2 cells, which synthesize transferrin, suggest that these compounds could be used to create a model system to represent CDG-la in vitro.

226 Chapter 9______General Discussion

Chapter 9

General Discussion

9.1 The lack of genotype/phenotype correlation in CDG-Ia

Within the past four years, several new subtypes of the CDG syndrome have been identified. Among these, CDG-I (types la-If) is characterised by defects in the synthesis of the lipid-linked oligosaccharide (LLO) and hence a decrease in the cellular pool of mature LLOs. This in turn reduces the rate and extent of iV-glycosylation of glycoproteins. Fifteen patients (13 families) described in this study were characterised with CDG-Ia on the basis of clinical presentation, biochemical and genetic analyses. It has been reported previously that in a number of CDG-Ia patients, the severity of disease shows some correlation with the residual PMM activities in fibroblasts and leukocytes of their patients Grünewald et al (2001). Patients, who did not present with severe CDG-Ia clinical features were shown to have between 35% and 70% residual

PMM activity in their fibroblasts compared to the mean control value. The majority of these patients with milder clinical features were compound heterozygotes for the C241S mutation in the PMM2 gene. This mutation has been found to reduce the enzyme

activity of PMM by about 50%. However, no such correlation between PMM activity

in fibroblasts and the clinical status of the disease was found in the U.K CDG-Ia patients described in the present investigation and in the results published previously

(Imtiaz et a i, 2000). Similarly, a large number of European patients also show no such

correlation (Matthijs et aL, 1998; de Lonlay et aL, 2001).

Fifty-three missense, three single base-pair deletions, one splice-site and one nonsense

mutation have been found in CDG-Ia patients worldwide (Matthijs et aL, 2000). The

227 Chapter 9______General Discussion

R141H mutation is the most frequent mutation found in CDG-Ia patients in this study and this observation is consistent with the frequency of this mutation worldwide among

CDG-Ia patients (Matthijs et at., 1997a, 1998; 2000; Kjaergaard et aL, 1998; Bjursell et aL, 2000; de Lonlay et aL, 2001; Grünewald et aL, 2001). Expression studies on a number of human PMM2 mutants using E. coli (Kjaergaard et aL, 1999; Pirard et aL,

1999) and yeast (Westphal et aL, 2001) as host cells demonstrated that mutant PMM2 proteins are definitely expressed, as their total yield was about 85% compared with the wild-type PMM2 protein. They were stable at low temperatures but were less stable at higher temperatures and also showed variation in their thermostability (Pirard et aL,

1999). Different mutations also had different effects on the kinetic properties of the mutant PMM proteins with respect to changes in the affinity for the substrate (Man-l-P) and for the co-factor (Man, 1,6-bisphosphate) as well as the Vmax (Pirard et aL, 1999).

The studies on over-expression of the R141H substitution in E. coli have demonstrated that the mutant protein has no detectable enzymatic activity (Kjaergaard et aL, 1998;

Pirard et aL, 1999). This probably explains why homozygosity for this mutation is not tolerated as it would be of lethal consequences in utero (Kjaergaard et aL, 1998;

Matthijs et aL, 2000; Schollen et aL, 2000). A defect in the early steps of LLO like the formation of GlcNAc-PP-Dol by A^-acetylglucosamine-1-phosphotransferase (GPT)

appears to be lethal because of failure to generate GPT knockout mice (Marek et aL,

1999). A defect in the elongation of GlcNAci-PP-Dol to ManiGlcNAcz-PP-Dol and to

MangGlcNAcz-PP-Dol would also be detrimental. Studies on yeast and human cell lines unequivocally provide evidence that the inhibition of #-glycosylation by the antibiotic

tunicamycin, which interferes with the enzymatic reaction catalysed by GPT in the

transfer of a GlcNAc-P residue from UDP-GlcNAc to Dol-P to make GlcNAc-PP-Dol

has lethal effects on the survival of the cell, but also up-regulates at least 10% of the

228 Chapter 9______General Discussion yeast genome involved in the ER-associated protein-translocation and protein- modification machinery (Travers et at., 2000; Ng et aL, 2000). However, the finding that 1/70 individuals in the Caucasian population are heterozygous for the R141H mutation alludes to a possible heterozygous advantage for this mutation (Matthijs et aL,

2000; Schollen et aL, 2000). A recent observation on the mutagenesis of histidine-15 to arginine in the a-subunit of pyruvate dehydrogenase (El) component predicts that the arginine side-chain has a certain space limit, which once exceeded causes a local conformational change that disturbs the active site of the protein and causes a decrease in catalytic activity (Jacobia et aL, 2002). A converse scenario in the case of the R141H substitution in the PMM2 protein in CDG-Ia may deprive the PMM2 protein of its catalytic activity. However, Pirard et al, (1999) suggested that in the presence of the

R141H mutation, the differences in the clinical presentation and in the residual PMM activity in fibroblasts from CDG-Ia patients may be due the nature of the mutation present in the second allele.

The genetic abnormality in the PMM2 gene (CDG-Ia) is by far the most prevalent defect in all of the CDG-I syndromes compared with the other subtypes (Ib-If). However, it is plausible to suggest that a large number of patients in all types of CDG-I are not being diagnosed, especially in CDG-Ia where there is 20% mortality in the first few years

(Freeze, 2001) and in general, because the diverse functions of/^-linked glycans lead to the highly variable symptoms observed in CDG patients as a whole. This wide variability and complexity of clinical symptoms means that an accurate diagnosis of

CDG is difficult and that the CDG syndromes are under-diagnosed. The precise diagnosis of some types of CDG requires highly sophisticated biochemical and genetic

229 Chapter 9______General Discussion analyses, which may be a serious handicap in the complete diagnosis of a large number of patients.

9.1.1 Diversity in the clinical phenotypes of CDG-Ia, Ib and Ic patients

There is a wide clinical diversity in the clinical presentation within each sub-type of

CDG-I. With some overlap, most of the CDG-Ia patients, can be divided into two sub groups: those with primarily neurological disease and those with multivisceral disease

(Leonard et al., 2001). The most common neurological features of both sub-groups are neonatal hypotonia, squint and psychomotor retardation. Other characteristic features, such as facial dysmorphism, inverted nipples and abnormal fat distribution may be seen in younger patients. The rate of mortality is high with the multivisceral disease, which presents in patients with failure to thrive and liver disease. Nevertheless, there is a wide spectrum of variability in phenotype, which is evident even among siblings with CDG-

Ia. The neurological abnormalities become more pronounced at a later age, with a variable degree of mental retardation, retinitis pigmentosa, seizures, and stroke-like episodes being reported. Nine of the fifteen CDG-Ia patients investigated in this study could be characterised with the multivisceral form of the disease and the remaining six, with the neurological form. All of the patients with multivisceral CDG-Ia died before the age of two and conversely, all of the patients in the neurological group have survived past the age of two. This classification of patients ran true in affected siblings of the CDG-Ia families. All fifteen patients had abnormal isoelectric focusing patterns for serum transferrin and dysmorphic features.

Patients with CDG-Ic present with a neurological disorder, which is similar to CDG-Ia but milder as dysmorphic features and cerebellar hypoplasia have not been described.

230 Chapter 9 General Discussion

CDG-Ib presents as a very different disorder compared to CDG-Ia and Ic, with protein losing enteropathy, congenital hepatic fibrosis and coagulopathy without the dysmorphic features or neurological complications observed in the other subtypes.

However, the CDG-Ib patient (AH) described in this investigation did present with abnormal fat distribution and inverted nipples, more commonly seen in patients with

CDG-Ia Similarly, the CDG-Ic patient investigated (BB) presented with protein-losing enteropathy, usually seen in CDG-Ib, and was hence considered a likely candidate for this subtype of CDG These anomalies in the clinical spectrum of these disorders confirm the difficulty faced by specialists in establishing a diagnosis.

A correlation between clinical symptoms and the extent of underglycosylation of N- glycans in CDG-I has been suggested (Aebi and Hennet, 2001). In general, the decrease of A^-glycans on glycoproteins leads to a wide spectrum of features that are seen in the different types of CDG-I (Figure 9.1).

Embryonic temaHty Penpheral neuropathy

Multi-organ failure { Epilepsy

Cerebellar Hormonal disorders i hypoplasia Stroke-like episodes

Skeletal j | j Coagulopathies and facial j j Gastrointostmai bieoding dysmorphism i i

Absent Normal CDG->a (PMM2) CDG tb (PMI) CDG-Ic (ALG6) CDG-td(ALG3)

CDG-Ib (DPMI) CDG-tf (L£C35)

Figure 9.1: Relation between the clinical presentation and the extent of underglycosylation in CDG-I patients (from Aebi and Hennet, 2001)

231 Chapter 9______General Discussion

9.1.2 CDG-Ix

There is an increasing number of CDG patients, as defined by an abnormal isoelectric focusing pattern for serum transferrin that do not belong to any of the known types of

CDG-I and are classified as CDG-Ix until the basic biochemical and molecular defects have been identified. Four of these patients, with variable clinical presentations were investigated extensively in this study, but their underlying biochemical and genetic defects were not discovered. Over 30 known genes are involved in the assembly of the lipid-linked oligosaccharide core and its subsequent transfer to nascent proteins (Freeze and Westphal, 2001). Therefore it is likely that these patients have defects in other genes in this pathway.

9.1.3 Analysis of the PMMl gene

A second gene PMMl encodes phosphomannomutase activity in certain tissues. In this study, the PMMl gene was screened (Chapter 7) for the presence of mutations in the four CDG-Ix patients to ascertain whether defects in this gene were the underlying cause of the disease. It was also screened in six CDG-Ia patients with different levels of clinical severity, to see whether the expression of PMMl contributed to the genotype/ phenotype correlation. No anomalies were found in this gene in either group of CDG-I patients, indicating that it was not disease-causing in the CDG-Ix patients or contributing to the genotype/phenotype correlation in the CDG-Ia patients examined.

9.2 Predominance of missense mutations

It is interesting that a preponderance of missense mutations has been found by molecular analysis in CDG-I patients as a whole. In a recent review of CDG-Ia mutations (Matthijs et al., 2000), 53 of the 58 mutations found in 205 families are of the

232 Chapter 9______General Discussion missense type. This is similar to the mutation analysis in this investigation where 8 of the 9 mutations found in the 13 families are missense. A preponderance of missense mutations has also been observed in the other known types of CDG-I, notably CDG-Ib and Ic, in which a reasonable number of patients has been diagnosed. During the last decade, according to the Human Gene Mutation Database (HGMD), in excess of 10,000 mutations have been identified in 1000 different ‘monogenic’ diseases (Gregersen et al.,

2001). Less than 10% of the recorded mutations are gross deletions, insertions or arrangements in the kilobase size range and less than 1% are mutations in regulatory regions of the gene. Therefore, approximately 90% of all mutations are small insertions, deletions or point mutations. These can be further subdivided into two groups, one consisting of point mutations that results in the substitution of amino acids

(missense mutations), in addition to small in-frame deletions or insertions, which subsequently cause tjie deletion or insertion of one or a few amino acids in the polypeptide chain. The second group contains ‘truncating’ mutations, such as nonsense mutations, out-of-frame deletions/insertions and splice mutations that cause a change in the reading frame and introduce a premature stop codon. Such mutant alleles would produce mRNA carrying a premature stop codon and if this stop codon is located prior to the last exon in the gene (Nagy and Maquat, 1998) would be recognised by the quality control system known as the RNA surveillance mechanism and rapidly degraded by nonsense-mediated RNA decay (NMD) (Culbertson 1999; Frischmeyer and Dietz,

1999). Therefore, only mRNA species with stop codons that are located near or in the last exon would be involved in protein synthesis. The fates of these truncated proteins depend on the protein itself and on the efficiency of the cellular protein quality control systems encountered. This also applies to mutant proteins that carry missense and small

233 Chapter 9______General Discussion in-frame amino acid insertions/deletions, which, in general, are synthesised normally and often trafficked to their destination by the normal route (Gregersen et a l, 2001).

Missense mutations account for about half of all the mutations recorded and are known to affect the folding of the polypeptide to the functional conformation and/ or to decrease the stability of the functional conformation. Both of these effects result in an increase of the proportion of mutant polypeptide present in non-functional conformations that are more susceptible to degradation or aggregation than the functional conformation (Bross et al., 1999). It is generally accepted that the effect of a mutation may be neutral (possibly beneficial), mildly impairing or totally destructive of

the function of a given protein, which in most cases of CDG is enzyme activity. As this property is inherent for each mutation, it is reflected in the different residual activities of

the mutant protein, as determined by heterologous expression of the mutant protein in

experimental cell systems. A correlation between residual enzyme activity and clinical phenotype has been observed for some diseases, for example in the fatty acid oxidation

defects, such as medium-chain acyl-CoA dehydrogenase (MCAD) deficiency (Bross et

al., 1993; Jensen et al., 1995; Andresen et al., 1997) and phenylketonuria (Gamez et al.,

2000).

Bross et al (1999) have hypothesised how genetic predisposition and environmental

factors may modulate the residual levels of the functional mutant protein. They suggest

that a mutation that has a severe impact on the folding propensity may, under optimal

conditions (genetic background and environmental circumstances) result in a subclinical

phenotype, whereas a mild mutation under adverse circumstances could give rise to

severe phenotype (Figure 9.2). This means that a mutation with a potentially more

234 Chapter 9 General Discussion severe primary impact on the affected protein may on some occasions result in less severe consequences than a mutation with a mild impact. In both cases, certain modulating factors may alter the phenotype between individuals and for one individual at certain time points.

Truncating Mild Severe mutation e.g mutation mutation deletion

Effect of missense mutations Neutral Severe Effect of cellular factors: Quality control system and mutant protein degradation Total residual enzymic High Low or functional activity Effect of other factors

Probability and severity of clinical symptoms Asymptomatic Mild Severe

Threshold for clinical disease

Figure 9.2: The influence of cellular and other factors on the residual protein function of mutant/variant proteins (adapted from Bross et ai, 1999)

Therefore, Bross et al (1999) suggested that, as with other environmental and genetic factors, components of the protein quality control systems have the potential to modulate the outcome of primary deficiencies. The severity of clinical symptoms may result from the combination of variations in genes that encode the components of protein quality control systems and sequence changes or polymorphisms in other genes that mildly impair folding. Wolf (1997) has suggested that the molecular pathogenic mechanism operative in such circumstances could potentially account for the often- observed phenotypic variability between patients that harbour the same disease-causing mutations. Therefore, the high frequency of missense mutations could explain the vast

235 Chapter 9______General Discussion range of clinical phenotypes seen in patients with the various subtypes of CDG-I and the lack of any genotype/phenotype correlation seen in CDG-Ia in the present and other investigations. In vitro expression studies of mutant alleles described in patients with

CDG-Ia (Pirard et al., 1999; Kjaergaard et al., 1999) and CDG-Ic (Imbach et al., 2000;

Westphal et a l, 2000), have provided a valuable insight into the disease-causing effect of a mutation. However, this may not reflect the amount of mutant proteins present in the cell in vivo, for example, in mutant proteins with defects in the catalytic centres, which is relevant in CDG-Ie, where mutations occur in the catalytic subunit of Dol-P-

Man synthase, encoded by the DPMI gene. This is also applicable to oligomeric enzymes with defective subunit interaction (Gregersen et al., 2001). In the case of folding mutations, an imbalance between functional and non-functional protein may also be seen. As mentioned previously, the quality control mechanisms sort the nascent polypeptides into those that have the properly folded conformation and those, which have misfolded proteins and are degraded by intracellular proteases. Therefore, the balance of these routes is dependent on the nature of the mutation as well as on the cellular conditions. The quality control efficiency in different tissues and individuals may obscure the genotype/phenotype picture.

In conclusion, CDG is a complex disorder due predominantly to missense mutations, most of which result in residual function of the mutant proteins. A primary enzyme deficiency is necessary but may not be sufficient for the clinical disease to occur.

Knowledge gained concerning the roles of chaperones in folding and the influence of protein quality control systems on the effects of missense mutations need to be taken

into account (Gregersen et al., 2001) in interpreting the effect of mutations on the clinical phenotype and in formulating potential forms of therapy.

236 Chapter 9______General Discussion

9.3 Possible avenues of therapy in CDG

To date, CDG-Ib (PMI-deficient) and CDG-IIc (GDP-fucose transporter defect) are the only types of CDG, which are amenable to treatment (Chapter 1, Sections 1.5.2.2 and

1.6.3, respectively). No efficient treatment has been suggested for the other CDG diseases except CDG-la, where trials with mannose therapy have not been successful.

Although mannose is able to correct glycosylation in PMM-deficienct fibroblasts in vitro (Panneerselvam and Freeze; 1995; Panneerselvam and Freeze, 1996; Komer et al.,

1998), trials with oral and intravenous administration of mannose in CDG-la patients did not produce any clinical or biochemical improvement (Jaeken and Casaer; 1997;

Panneerselvam et al., 1997; Marquardt et al., 1997). The reason why mannose is effective in vitro is still not fully understood but it has been suggested that perhaps it stimulates the residual PMM activity by increasing the concentration of the substrate

Man-6-P (Jaeken et al., 2001). Only a few studies regarding the bioavailability, absorption, fate and incorporation of mannose into glycoproteins in higher animals have been conducted (Herman, 1971). A study in humans has demonstrated that oral mannose is inefficiently absorbed by the gut (Wood and Cahill, 1963). Recent investigations have shown that mannose is efficiently taken up by control fibroblasts

(Panneerselvam and Freeze, 1996; Alton et al., 1997) possibly via a specific mannose transporter, but not by fibroblasts deficient in PMM (Dupre et al., 1997). An investigation by Alton et al (1998) showed that radiolabelled mannose is a better precursor than radiolabelled glucose for glycan synthesis in cultured hepatoma cells.

However, this does not prove that the cells are dependent on exogenous mannose for correct glycosylation, as the preferential labelling exhibited by mannose may be reflective of the isotopic equilibration of Man-6-P and Glc-6-P pools P (Jaeken et al.,

237 Chapter 9______,______General Discussion

2001). Although oral mannose therapy for CDG-Ia has not been successful, suitably modified derivatives of Man-l-P, such as non-toxic acetoxymethyl esters that enter cells

(Schultz et al., 1993, 1994) may offer another route to providing the missing substrate

in CDG-Ia. At present, gene therapy or enzyme replacement therapy cannot be

considered suitable for patients with CDG syndromes as a number of organs are

affected in this group of disorders and specific targeting would be of great difficulty.

9.4 Identification of CDG defects

A structured analytical protocol to ensure the correct diagnosis of patients presenting

with characteristic symptoms of CDG is required, as physicians are becoming

increasingly aware of the diverse and multisystemic clinical presentations of CDG.

Usually, a suspected patient is tested for abnormal glycosylation by isoelectric focusing,

ion-exchange analysis or agarose gel electrophoresis of serum transferrin (For reviews.

See Keir et al., 1999; Freeze, 2001; Jaeken et al., 2001). Isoelectric focusing of serum

transferrin is the most widely used method for the diagnosis of CDG as it indicates

abnormal or under-glycosylation of protein. However, it has limitations as not all types

of CDG can be detected, for example, CDG-IIb and CDG-IIc and some CDG-Ia patients

with a proven genetic and enzymatic defects, have been reported to have normal

transferrin patterns (Fletcher et al., 2000; Dupre et al., 2001). The analysis of other

plasma or serum glycoproteins (Harrison et al., 1992; Krasnewich et al., 1995;

Krasnewich and Gahl, 1997) and P-trace protein in cerebrospinal fluid (Pohl et al.,

1997; Grünewald et al., 1999) can also be used to detect abnormal glycosylation in

CDG patients. Once a positive result for abnormal glycosylation has been obtained

from any of these diagnostic methods, enzyme assays are carried out on cultured

fibroblasts or leukocytes. In addition, in some diagnostic centres, fibroblasts are

238 Chapter 9______General Discussion metabolically labelled with ecxogenous [2-^H] mannose to determine the glycosylation efficiency, structure of the lipid- and protein-bound oligosaccharide chains. The levels of various metabolic intermediates, for example Man-l-P (Komer et al., 1998) or GDP-

Man (Rush et al., 2000) are also measured. The presence of altered levels of various metabolic intermediates or oligosaccharide structures can be helpful in suggesting the location of the enzymic defects in the AT-glycosylation biosynthetic pathway. After confirmation of the enzymic or protein deficiency, specific disease-causing mutations in the corresponding genes can be detected. It is essential to show that the supposed mutation is not a polymorphism by screening normal chromosomes for the putative mutation and by functional expression studies of the mutant allele. Recently, Denaturing

High Performance Liquid Chromatography (DHPLC) has been introduced by some diagnostic centres as a rapid, sensitive and semi-automated mutation screening method based on the different melting properties of homoduplexes versus heteroduplexes.

DHPLC has been optimised for screening the specific genes associated with CDG-I subtypes, la-If.

This stmctured approach has been successful in elucidating the biochemical and genetic defects in patients with known types of CDG. Similarly, this cascade of steps is the most effective way to detect the underlying defects in patients with CDG-Ix.

9.5 Concluding remarks and Future Work

In all cases of the CDG-I syndromes (la-If) as well as in the CDG-II syndromes, a large number of cellular ^-glycoproteins acquire normal A^-glycosylation as a result of the

“leaky” nature of the basic genetic defects of LLO biosynthesis. These fully and properly VV-glycosylated glycoproteins pass through the ER-quality control system and

239 Chapter 9______General Discussion

reach their destined location as functionally active molecules. These AT-glycoproteins

contribute to the survival of the cell and the fetus as well as post-natal development and progress into adult life with a varying degree of severity and multi-system involvement

in all of the CDG-I and CDG-II diseases.

In contrast, the iV-glycoproteins, which remain non-glycosylated or undergo partial

glycosylation, i.e. only some of their potential ^-glycosylation sites are occupied by

fully mature glycans (Glc^MangGlcNAcz-) and/or carry truncated N-lined glycans are

withheld by the ER-quality control system.

Investigations carried out in this study using the two synthetic analogues of mannose

(Chapter 8) demonstrated the successful inhibition of phosphomannomutase in vitro. It

would be interesting to use them to mimic CDG-Ia chemically, by inhibiting the

phosphomannomutase reversibly in human cell lines. This would offer an analogous

tool to tunicamycin in studies on inhibition of protein iV-glycosylation.

Gene expression studies using gene chips, such as the Affymetrix system would also be

interesting for studying CDG. They may reveal patterns of expression of genes, which

show the basis of the severity or susceptibility to defects in glycosylation.

240 Appendix

Appendix

Patient CB JBLB TB VB DCMC Family Number 1 2 3 4.1 4.2 5 6 Sex female male female male female male female Genotype R141H/ R141H/ F183S/ R141H/ R141H/ ■/ 284delT/ V231M G208A D148N V231M V231M V231M G208A PMM activity 0.18 0.05 0.05 0.24 0.02 0.13 0.07 FMI + + + + + + + Transferrin pattern typel typel typel typel type 1 type 1 typel Age at presentation Birth 3 weeks 6 months Birth Birth 3 months Birth

Survival >18/12 - - + + + --

Failure to thrive + + - + + + + Dysmorphology

Long fingers/toes + - + -- + +

Inverted nipples + + - + + + +

Fat pads + - + + + - +

Contractures + -- + + + +

Low set ears ----- + - Neurological Hypotonia + + + + + + + Developmental delay + + + + + + +

Sensorineural deafiiess + + - -- - -

Seizures --- - + --

Cerebral/cerebellar + - + - - + atrophy Ophthalmic

Oculomotor apraxia + - + + - + -

Squint - - + + + -- Gastrointestinal Poor feeder + + + + + + +

Hepatomegaly - + + -- + -

Ascites + ------

Diarrhoea + ------Cardiovascular

Cardiomyopathy + + - - - + +

Pericardial effusion + + ---- + Laboratory

Hypoalbuminaemia + + - - - + -

Coagulopathy + -- - - + - Other ASD nephrotic kyphosis kyphosis kyphosis laryngo- recurrent recurrent tracheo- infections infections malacia

Table Al: Clinical, enzymatic and genetic details of CDG-Ia patients ASD = atrial septal defect

241 Appendix

Patient JD KFLM JR TS JSKT EW Family Number 7 8 9 10 11.1 11.2 12 13 Sex male female male female male male female female Genotype R141H/ R141H/ R141H/ I132N/ R141H/ R141H/ R141H/ R141H/

F119L F119L F119L --- V231M T237M PMM activity 0.00 0.1 0.25 0.23 NDND 0.13 0.05 FMI + + + + ND ND + + Transferrin pattern typ el typ el typ el typel typel typel typel type 1 Age at presentation 2 months 10 weeks 2 months Birth Birth Birth 5 weeks 3 years

Survival >18/12 + + - - --- +

Failure to thrive - + + + + + + - Dysmorphology

Long fingers/toes - + + + - - + -

Inverted nipples + + + + + - + -

Fat pads + - + + -- + +

Contractures ---- + + - +

Low set ears --- + - + -- Neurological

Hypotonia + + + + + - + + Developmental delay + + + + + + + +

Sensorineural deafness - --- + - + -

Seizures - + ------

Cerebral/cerebellar + + + + + + -- atrophy Ophthalmic

Oculomotor apraxia -- + + + + + +

Squint - + - - - - + + Gastrointestinal

Poor feeder + + + + -- + -

Hepatomegaly - - + - + ---

Ascites - - -- + + --

Diarrhoea + + - - -- + - Cardiovascular

Cardiomyopathy ' - + - + - + -

Pericardial effusion + - + - + --- Laboratory

Hypoalbuminaemia + - + - + + + -

Coagulopathy + - -- + + - + Other reduced venous minor marked PDA kyphosis ERG sinus VUR GOR throm bosis

Table A l (cont): Clinical, enzymatic and genetic details of CDG-Ia patients ERG = electroretinogram, VUR = vesico-ureteric reflux, GOR = gastro-oesophageal reflux, PDA = patent ductus arteriosus

242 References

References

Adair WL, Jr. and Cafmeyer N (1987) Characterization of the Saccharomyces Cerevisiae Cis-Prenyltransferase Required for Dolichyl Phosphate Biosynthesis. Arc/i Biochem Biophys 259: 589-596.

Aebi M, Gassenhuber J, Domdey H and te H S (1996) Cloning and Characterization of the ALG3 Gene of Saccharomyces Cerevisiae. Glycobiology 6: 439-444.

Aebi M and Hennet T (2001) Congenital Disorders of Glycosylation: Genetic Model Systems Lead the Way.Trends Cell Biol 11:136-141.

Albright CF and Robbins R W (1990) The Sequence and Transcript Heterogeneity of the Yeast Gene ALGl, an Essential Mannosyltransferase Involved in N-Glycosylation. J Biol Chem 265: 7042-7049.

Alonso MD, Lomako J, Lomako W M and Whelan W J (1995) A New Look at the Biogenesis of Glycogen. FA5EB J 9: 1126-1137.

Alton G, Kjaergaard S, Etchison J R, Skovby F and Freeze H H (1997) Oral Ingestion of Mannose Elevates Blood Mannose Levels: a First Step Toward a Potential Therapy for Carbohydrate-Deficient Glycoprotein Syndrome Type l.Biochem Mol Med 60: 127- 133.

Alton G, Hasilik M, Niehues R, Panneerselvam K, Etchison J R, Fana F and Freeze H H (1998) Direct Utilization of Mannose for Mammalian Glycoprotein Biosynthesis. Glycobiology 8: 285-295.

Alvarado E, Nukada T, Ogawa T and Ballou C E (1991) Conformation of the Glucotriose Unit in the Lipid-Linked Oligosaccharide Precursor for Protein GXycosyXdXion. Biochemistry 30: 881-886.

Anand M, Rush J S, Ray S, Doucey M A, Weik J, Ware F E, Hofsteenge J, Waechter C J and Lehrman M A (2001) Requirement of the Lec35 Gene for All Known Classes of Monosaccharide-P- Dolichol-Dependent Glycosyltransferase Reactions in Mammals. Mol Biol Cell 12: 487-501.

Andresen BS, Bross P, Udvari S, Kirk J, Gray G, Kmoch S, Chamoles N, Knudsen I, Winter V, Wilcken B, Yokota I, Hart K, Packman S, Harpey J P, Saudubray J M, Hale D E, Bolund L, Kolvraa S and Gregersen N (1997) The Molecular Basis of Medium- Chain Acyl-CoA Dehydrogenase (MCAD) Deficiency in Compound Heterozygous Patients: Is There Correlation Between Genotype and Phenotype? Hum Mol Genet 6: 695-707.

Arnold SM, Fessier L I, Fessier J H and Kaufman R J (2000) Two Homologues Encoding Human UDP-Glucose:Glycoprotein Glucosyltransferase Differ in MRNA Expression and Enzymatic Actiwity. Biochemistry 39: 2149-2163.

243 ______References ______

Austen BM, Westwood O M R (1991) Protein Targeting and Secretion (edited by Rickwood D). IRL Press

Babovic-Vuksanovic D, Patterson M C, Schwenk W F, O'Brien J F, Vockley J, Freeze H H, Mehta D P and Michels V V (1999) Severe Hypoglycemia As a Presenting Symptom of Carbohydrate-Deficient Glycoprotein Syndrome./ f 135: 775-781.

Barnes G, Hansen W J, Holcomb C L and Rine J (1984) Asparagine-Linked Glycosylation in Saccharomyces Cerevisiae: Genetic Analysis of an Early Step. Mo/ Ce//5/0/4:2381-2388.

Barone R, Carchon H, Jansen E, Pavone L, Fiumara A, Bosshard N U, Gitzelmann R and Jaeken J (1998) Lysosomal Enzyme Activities in Serum and Leukocytes From Patients With Carbohydrate-Deficient Glycoprotein Syndrome Type lA (Phosphomaimomutase Deficiency). J Inherit Metab Dis 21: 167-172.

Bassam BJ, Caetano-Anolles G and Gresshoff P M (1991) Fast and Sensitive Silver Staining of DNA in Polyacrylamide Ge\s. Anal Biochem 196: 80-83.

Bause E (1983) Structural Requirements of N-Glycosylation of Proteins. Studies With Proline Peptides As Conformational Probes. Biochem J 209: 331-336.

Bause E, Schweden J, Gross A and Orthen B (1989) Purification and Characterization of Trimming Glucosidase I From Pig lAvti.Eur J Biochem 183: 661-669.

Bause E, Breuer W, Schweden J, Roeser R and Geyer R (1992) Effect of Substrate Structure on the Activity of Man9-Mannosidase From Pig Liver Involved in N-Linked Oligosaccharide Processing. 5«r/5/oc/iew 208: 451-457.

Baynes JW, Hsu A F and Heath E C (1973) The Role of Mannosyl-Phosphoryl- Dihydropolyisoprenol in the Synthesis of Mammalian Glycoproteins. J Biol Chem 248: 5693-5704.

Beck PJ, Orlean P, Albright C, Robbins P W, Gething M J and Sambrook J F (1990) The Saccharomyces Cerevisiae DPMI Gene Encoding Dolichol-Phosphate- Mannose Synthase Is Able to Complement a Glycosylation-Defective Mammalian Cell Line. Mo/ Cell Biol 10: 4612-4622.

Benton BK, Plump S D, Roos J, Lennarz W J and Cross F R (1996) Over-Expression of S. Cerevisiae G1 Cyclins Restores the Viability of Algl N-Glycosylation Mutants. Cwrr Genet 29: 106-113.

Benton BK, Plump S D, Roos J, Lennarz W J and Cross F R (1996) Over-Expression of S. Cerevisiae G1 Cyclins Restores the Viability of Algl N-Glycosylation Mutants. Curr Genet 19: 106-113.

Bernstein M, Kepes F and Schekman R (1989) Sec59 Encodes a Membrane Protein Required for Core Glycosylation in Saccharomyces Cerevisiae. Mo/ Cell Biol 9: 1191- 1199.

244 References

Bjursell C, Stibler H, Wahlstrom J, Kristiansson B, Skovby F, Stromme P, Blennow G and Martinsson T (1997) Fine Mapping of the Gene for Carbohydrate-Deficient Glycoprotein Syndrome, Type I (CDGl): Linkage Disequilibrium and Founder Effect in Scandinavian Families. Genomics 39: 247-253.

Bjursell C, Wahlstrom J, Berg K, Stibler H, Kristiansson B, Matthijs G and Martinsson T (1998) Detailed Mapping of the Phosphomannomutase 2 (PMM2) Gene and Mutation Detection Enable Improved Analysis for Scandinavian CDG Type I Families. Eur J Hum Genet 6: 603-611.

Bjursell C, Erlandson A, Nordling M, Nilsson S, Wahlstrom J, Stibler H, Kristiansson B and Martinsson T (2000) PMM2 Mutation Spectrum, Including 10 Novel Mutations, in a Large CDG Type lA Family Material With a Focus on Scandinavian Families.//«m Mutat 16: 395-400.

Bosch M, Trombetta S, Engstrom U and Parodi A J (1988) Characterization of Dolichol Diphosphate Oligosaccharide: Protein Oligosaccharyltransferase and Glycoprotein- Processing Glucosidases Occurring in Trypanosomatid Protozoa. J Biol Chem 263: 17360-17365.

Breuer W and Bause E (1995) Oligosaccharyl Transferase Is a Constitutive Component of an Oligomeric Protein Complex From Pig Liver Endoplasmic Reticulum. Eur J Biochem 228: 689-696.

Bross P, Andresen B S, Winter V, Krautle F, Jensen T G, Nandy A, Kolvraa S, Ghisla S, Bolund L and Gregersen N (1993) Co-Overexpression of Bacterial GroESL Chaperonins Partly Overcomes Non- Productive Folding and Tetramer Assembly of E. Coli-Expressed Human Medium-Chain Acyl-CoA Dehydrogenase (MCAD) Carrying the Prevalent Disease-Causing K304E Mutation. Biochim Biophys Acta 1182: 264-274.

Bross P, Corydon T J, Andresen B S, Jorgensen M M, Bolund L and Gregersen N (1999) Protein Misfolding and Degradation in Genetic Diseases. Hum Mutat 14: 186- 198.

Brown JR, Guther M L, Field R A and Ferguson M A (1997) Hydrophobic Mannosides Act As Acceptors for Trypanosome Alpha- Mannosyltransferases. Glycobiology 7: 549- 558.

Burda P, Borsig L, Rijk-van Andel J, Wevers R, Jaeken J, Carchon H, Berger E G and Aebi M (1998) A Novel Carbohydrate-Deficient Glycoprotein Syndrome Characterized by a Deficiency in Glucosylation of the Dolichol-Linked Oligosaccharide. J Clin Invest 102: 647-652.

Burda P and Aebi M (1999) The Dolichol Pathway of N-Linked Glycosylation.Bioc/ii/w Biophys Acta 1426: 239-257.

Burda P, Jakob C A, Beinhauer J, Hegemann J H and Aebi M (1999) Ordered Assembly of the Asymmetrically Branched Lipid-Linked Oligosaccharide in the Endoplasmic Reticulum Is Ensured by the Substrate Specificity of the Individual Glycosyltransferases. Glycobiology 9:617-625.

245 References

Camp LA, Chauhan P, Farrar J D and Lehrman M A (1993) Defective Mannosylation of Glycosylphosphatidylinositol in Lec35 Chinese Hamster Ovary Cells. J Biol Chem 268: 6721-6728.

Carchon H, van Schaftingen E, Matthijs G and Jaeken J (1999) Carbohydrate-Deficient Glycoprotein Syndrome Type lA (Phosphomannomntase-Deficiency).BiocAim Biophys Acta 1455: 155-165.

Carlberg M, Drieu A, Blegen H, Wang M, Hjertman M, Zickert P, Hoog A and Larsson O (1996) Mevalonic Acid Is Limiting for N-Linked Glycosylation and Translocation of the Insulin-Like Growth Factor-1 Receptor to the Cell Surface. Evidence for a New Link Between 3-Hydroxy-3-Methylglutaryl-Coenzyme a Reductase and Cell Growth./ Biol Chem 271: 17453-17462.

Chakraborty A, Saha D, Bose A, Chatterjee M and Gupta N K (1994) Regulation of EIF-2 Alpha-Subunit Phosphorylation in Reticulocyte Lysate. Biochemistry 33: 6700- 6706.

Chapman AE and Calhoun J C (1988) Effects of Glucose Starvation and Puromycin Treatment on Lipid-Linked Oligosaccharide Precursors and Biosynthetic Enzymes in Chinese Hamster Ovary Cells in Vivo and in Vitro. Arch Biochem Biophys 260: 320- 333.

Chapman D and Hoffmann W (1980) Enzyme Function and Membrane lA^iàs. Biochem Soc Trans 8: 32-34.

Charlwood J, Clayton P, Johnson A, Keir G, Mian N and Winchester B (1997) A Case of the Carbohydrate-Deficient Glycoprotein Syndrome Type 1 (CDGS Type 1) With Normal Phosphomannomutase Activity. J Inherit Metab Dis 20: 817-826.

Charlwood J, Clayton P, Keir G, Mian N, Young E and Winchester B (1998) Prenatal Diagnosis of the Carbohydrate-Deficient Glycoprotein Syndrome Type lA (CDGIA) by a Combination of Enzymology and Genetic Linkage Analysis After Amniocentesis or Chorionic Villus Sampling. PrenatDiagn 18: 693-699.

Charuk JH, Tan J, Bemardini M, Haddad S, Reithmeier R A, Jaeken J and Schachter H (1995) Carbohydrate-Deficient Glycoprotein Syndrome Type II. An Autosomal Recessive N-Acetylglucosaminyltransferase II Deficiency Different From Typical Hereditary Erythroblastic Multinuclearity, With a Positive Acidified-Serum Lysis Test (HEMPAS). Eur J Biochem 230: 797-805.

Chaves-Olarte E, Florin I, Boquet P, Popoff M, Eichel-Streiber C and Thelestam M (1996) UDP-Glucose Deficiency in a Mutant Cell Line Protects Against Glucosyltransferase Toxins From Clostridium Difficile and Clostridium Sordellii. J Biol Chem 271: 6925-6932.

Chojnacki T and Dallner G (1988) The Biological Role of Dolichol. Biochem J 251: 1- 9.

Clayton P, Winchester B, di Tomaso E, Young E, Keir G and Rodeck C (1993) Carbohydrate-Deficient Glycoprotein Syndrome: Normal Glycosylation in the Fetus. Lancet 341: 956.

246 ______References ______

Clayton PT, Winchester B G and Keir G (1992) Hypertrophic Obstructive Cardiomyopathy in a Neonate With the Carbohydrate-Deficient Glycoprotein SyndromQ. J Inherit Metab Dis 15: 857-861.

Cleasby A, Wonacott A, Skarzynski T, Hubbard R E, Davies G J, Proudfoot A E, Bernard A R, Payton M A and Wells T N (1996) The X-Ray Crystal Structure of Phosphomannose Isomerase From Candida Albicans at 1.7 Angstrom Resolution. Nat Struct Biol 3: 470-479.

Coddeville B, Carchon H, Jaeken J, Briand G and Spik G (1998) Determination of Glycan Structures and Molecular Masses of the Glycovariants of Serum Transferrin From a Patient With Carbohydrate Deficient Syndrome Type II. Glycoconj J 15: 265- 273.

Colussi PA, Taron C H, Mack J C and Orlean P (1997) Human and Saccharomyces Cerevisiae Dolichol Phosphate Mannose Synthases Represent Two Classes of the Enzyme, but Both Function in Schizosaccharomyces Pombe. Proc Natl Acad Sci U S A 94: 7873-7878.

Comer FI and Hart G W (2000) 0-Glycosylation of Nuclear and Cytosolic Proteins. Dynamic Interplay Between 0-GlcNAc and 0-Phosphate. J Biol Chem 275: 29179- 29182.

Crick DC, Rush J S and Waechter C J (1991) Characterization and Localization of a Long-Chain Isoprenyltransferase Activity in Porcine Brain: Proposed Role in the Biosynthesis of Dolichyl Phosphate. / Aewroc/iem 57: 1354-1362.

Crick DC and Waechter C J (1994) Long-Chain Cis-Isoprenyltransferase Activity Is Induced Early in the Developmental Program for Protein N-Glycosylation in Embryonic Rat Brain CcWs. JNeurochem 62: 247-256.

Crimaudo C, Hortsch M, Gausepohl H and Meyer D I (1987) Human Ribophorins I and II: the Primary Structure and Membrane Topology of Two Highly Conserved Rough Endoplasmic Reticulum-Specific Glycoproteins. EMBOJ 6: 75-82.

Crook ED, Daniels M C, Smith T M and McClain D A (1993) Regulation of Insulin- Stimulated Glycogen Synthase Activity by Overexpression of Glutamine: Fructose-6- Phosphate Amidotransferase in Rat-1 Fibroblasts. Diabetes 42: 1289-1296.

Culbertson MR (1999) RNA Surveillance. Unforeseen Consequences for Gene Expression, Inherited Genetic Disorders and Cancer. Trends Genet 15: 74-80.

Daniel PF, Winchester B and Warren C D (1994) Mammalian Alpha-Mannosidases— Multiple Forms but a Common Purpose? Glycobiology 4: 551-566.

Daniels MC, Kansal P, Smith T M, Paterson A J, Kudlow J E and McClain D A (1993) Glucose Regulation of Transforming Growth Factor-Alpha Expression Is Mediated by Products of the Hexosamine Biosynthesis VaXhwây. Mol Endocrinol 7: 1041-1048.

Daran JM, Dallies N, Thines-Sempoux D, Paquet V and Francois J (1995) Genetic and Biochemical Characterization of the UGPl Gene Encoding the UDP-Glucose Pyrophosphorylase From Saccharomyces Cerevisiae.EwrJBiochem 233: 520-530.

247 ______References ______

Datta B, Ray M K, Chakrabarti D, Wylie D E and Gupta N K (1989) Glycosylation of Eukaryotic Peptide Chain Initiation Factor 2 (EIF-2)- Associated 67-KDa Polypeptide (P67) and Its Possible Role in the Inhibition of EIF-2 Kinase-Catalyzed Phosphorylation of the EIF-2 Alpha- Subunit. J Biol Chem 264: 20620-20624. de Koning TJ, Borland L, van Diggelen O P, Boonman A M, de Jong G J, van Noort W L, De Schryver J, Duran M, van d B, I, Gerwig G J, Berger R and Poll-The B T (1998) A Novel Disorder of N-Glycosylation Due to Phosphomannose Isomerase Deficiency. Biochem Biophys Res Commun 245: 38-42. de Koning TJ, Nikkels P G, Borland L, Bekhof J, Be Schrijver J E, van Hattum J, van Diggelen O P, Duran M, Berger R and Poll-The B T (2000) Congenital Hepatic Fibrosis in 3 Siblings With Phosphomannose Isomerase Deficiency. Virchows Arch 437: 101- 105. de Lonlay P, Cuer M, Vuillaumier-Barrot S, Beaune G, Castelnau P, Kretz M, Durand G, Saudubray J M and Seta N (1999) Hyperinsulinémie Hypoglycemia As a Presenting Sign in Phosphomannose Isomerase Deficiency: A New Manifestation of Carbohydrate- Deficient Glycoprotein Syndrome Treatable With Mannose. 135: 379-383. de Lonlay P, Seta N, Barrot S, Chabrol B, Drouin V, Gabriel B M, Joumel H, Kretz M, Laurent J, Le Merrer M, Leroy A, Pedespan D, Sarda P, Villeneuve N, Schmitz J, van Schaftingen E, Matthijs G, Jaeken J, Komer C, Munnich A, Saudubray J M and Cormier-Daire V (2001) A Broad Spectrum of Clinical Presentations in Congenital Disorders of Glycosylation I: a Series of 26 Cases. J Med Genet 3S: 14-19.

Be Praeter CM, Gerwig G J, Bause E, Nuytinck L K, Vliegenthart J F, Breuer W, Kamerling J P, Espeel M F, Martin J J, Be Paepe A M, Chan N W, Dacremont G A and Van Coster R N (2000) A Novel Disorder Caused by Defective Biosynthesis of N- Linked Oligosaccharides Due to Glucosidase I Deficiency.Aw /J/m w Genet 66: 1744- 1756.

DeGasperi R, Thomas L J, Sugiyama E, Chang H M, Beck P J, Orlean P, Albright C, Waneck G, Sambrook J F, Warren C D and . (1990) Correction of a Defect in Mammalian GPI Anchor Biosynthesis by a Transfected Yeast Gene. Science 250: 988- 991.

Di Rocco M, Barone R, Adami A, Burlina A, Carrozzi M, Dionisi-Vici C, Gatti R, larmetti P, Parini R, Raucci U, Roccella M, Spada M and Fiumara A (2000) Carbohydrate-Deficient Glycoprotein Syndromes: the Italian Experience. J Inherit Metab Dis 23: 391-395.

Distler J, Braun C, Ebert A and Piepersberg W (1987) Gene Cluster for Streptomycin Biosynthesis in Streptomyces Griseus: Analysis of a Central Region Including the Major Resistance Gene. Mol Gen Genet 208: 204-210.

Doering TL, Masterson W J, Hart G W and Englund P T (1990) Biosynthesis of Glycosyl Phosphatidylinositol Membrane Anchors. J Biol Chem 265: 611-614.

248 ______References ______

Doerrler WT and Lehrman M A (2000) A Water-Soluble Analogue of Glucosaminylphosphatidylinositol Distinguishes Two Activities That Palmitoylate Inositol on GPI Anchors. Biochem Biophys Res Commun 267: 296-299.

Dupre T, Ogier-Denis E, Cormier-Daire V (1997) Mannose facilitative transport in type I carbohydrate-deficient glycoprotein syndrome fibroblasts. Glycoconjugate J 14 (suppl 1): S44

Dupre T, Cuer M, Barrot S, Baraier A, Cormier-Daire V, Munnich A, Durand G and Seta N (2001) Congenital Disorder of Glycosylation la With Deficient Phosphomannomutase Activity but Normal Plasma Glycoprotein Pattern. Clin Chem 4 7 : 132-134.

Durand G and Seta N (2000) Protein Glycosylation and Diseases: Blood and Urinary Oligosaccharides As Markers for Diagnosis and Therapeutic Monitoring. Clin Chem 46: 795-805.

Elhammer AP, Poorman R A, Brown E, Maggiora L L, Hoogerheide J G and Kezdy F J (1993) The Specificity of UDP-GalNAc: Polypeptide N- Acetylgalactosaminyitransferase As Inferred From a Database of in Vivo Substrates and From the in Vitro Glycosylation of Proteins and Peptides. JB /o/ Chem 268: 10029- 10038.

Etchison JR and Freeze H H (1997) Enzymatic Assay of D-Mannose in Serum. Clin Chem 43: 533-538.

Etzioni A, Frydman M, Pollack S, Avidor I, Phillips M L, Paulson J C and Gershoni- Baruch R (1992) Brief Report: Recurrent Severe Infections Caused by a Novel Leukocyte Adhesion V^ficiency.NEnglJMed 327: 1789-1792.

Etzioni A, Phillips L M, Paulson J C and Harlan J M (1995) Leukocyte Adhesion Deficiency (LAD) U.Ciba FoundSymp 189: 51-58.

Etzioni A and Tonetti M (2000) Leukocyte Adhesion Deficiency II-From A to Almost Z. Immunol Rev 178: 138-147.

Fan E, Levin D B, Glickman B W and Logan D M (1993) Limitations in the Use of SSCP Analysis. Mutai Res 288: 85-92.

Ferguson MA and Williams A F (1988) Cell-Surface Anchoring of Proteins Via Glycosyl-Phosphatidylinositol Stmcimts.Annu Rev Biochem 57: 285-320.

Ferro-Novick S, Hansen W, Schauer I and Schekman R (1984) Genes Required for Completion of Import of Proteins into the Endoplasmic Reticulum in Yeast. J Cell Biol 98: 44-53.

Fletcher JM, Matthijs G, Jaeken J, van Schaftingen E and Nelson P V (2000) Carbohydrate-Deficient Glycoprotein Syndrome: Beyond the Screen. J Inherit Metab Dis 23: 396-398.

249 ______References ______

Flores-Diaz M, Alape-Giron A, Persson B, Pollesello P, Moos M, Eichel-Streiber C, Thelestam M and Florin I (1997) Cellular UDP-Glucose Deficiency Caused by a Single Point Mutation in the UDP-Glucose Pyrophosphorylase Gene./Bio/ Chem 272: 23784- 23791.

Forstner G (1995) Signal Transduction, Packaging and Secretion of Mucins. Annu Rev Physiol 57: 585-605.

Freeze HH (1998) Disorders in Protein Glycosylation and Potential Therapy: Tip of an Iceberg? / Pe/iflir 133: 593-600.

Freeze HH and Aebi M (1999) Molecular Basis of Carbohydrate-Deficient Glycoprotein Syndromes Type I With Normal Phosphomaimomutase Activity. Biochim Biophys Acta 1455:167-178.

Freeze HH (2001) Update and Perspectives on Congenital Disorders of Glycosylation. Glycobiology 11: 129R-143R.

Freeze HH and Westphal V (2001) Balancing N-linked glycosylation to avoid disease. Biochimie 83: 791-799

Frischmeyer PA and Dietz H C (1999) Nonsense-Mediated MRNA Decay in Health and Disease. Hum Mol Genet 8: 1893-1900.

Frydman M, Etzioni A, Eidlitz-Markus T, Avidor I, Varsano I, Shechter Y, Orlin J B and Gershoni-Baruch R (1992) Rambam-Hasharon Syndrome of Psychomotor Retardation, Short Stature, Defective Neutrophil Motility, and Bombay Phenotype. Aw J Med Genet 44: 297-302.

Fu J, Ren M and Kreibich G (1997) Interactions Among Subunits of the Oligosaccharyltransferase Complex./B/o/ Chem 272: 29687-29692.

Fukuda MN (1999) HEMP AS. Hereditary Erythroblastic Multinuclearity With Positive Acidified Serum Lysis Test. B/ocA/w Biophys Acta 1455: 231-239.

Furukawa K and Roth S (1985) Co-Purification of Galactosyltransferases From Chick- Embryo lAvtx.BiochemJ 221\ 573-582.

Gamez A, Perez B,, Ugarte M and Desviat L R (2000) Expression Analysis of Phenylketonuria Mutations. Effect on Folding and Stability of the Phenylalanine Hydroxylase Protein. JB /o/ Chem 275: 29737-29742.

Gavel Y and von Heijne G (1990) Sequence Differences Between Glycosylated and Non-Glycosylated Asn-X- Thr/Ser Acceptor Sites: Implications for Protein Engineering. Protein Eng 3: 433-442.

Gitzelmaim R, Steinmann B and Tuchschmid P (1989) Patients With Hereditary Fructose Intolerance Have Normal Erythrocyte Aldolase Activity. C/w ChimActa 181: 163-166.

250 ______References ______

Gonzalez DS, Karaveg K, Vandersall-Naim A S, Lai A and Moremen K W (1999) Identification, Expression, and Characterization of a CDNA Encoding Human Endoplasmic Reticulum Mannosidase I, the Enzyme That Catalyzes the First Mannose Trimming Step in Mammalian Asn-Linked Oligosaccharide Biosynthesis. J Biol Chem 274: 21375-21386.

Goss SJ and Harris H (1977) Gene Transfer by Means of Cell Fusion. II. The Mapping of 8 Loci on Human Chromosome 1 by Statistical Analysis of Gene Assortment in Somatic Cell Hybrids. J Cell Sci 25: 39-57.

Gregersen N, Bross P, Andrese B S, Pedersen C B, Corydon T J and Bolund L (2001) The Role of Chaperone-Assisted Folding and Quality Control in Inborn Errors of Metabolism: Protein Folding Disorders. J Inherit Metah Dis 24: 189-212.

Grinnell BW, Walls J D and Gerlitz B (1991) Glycosylation of Human Protein C Affects Its Secretion, Processing, Functional Activities, and Activation by Thrombin. J Biol Chem 266: 9778-9785.

Grünewald S, Huyben K, de Jong J G, Smeitink J A, Rubio E, Boers G H, Conradt H S, Wendel U and Wevers R A (1999) Beta-Trace Protein in Human Cerebrospinal Fluid: a Diagnostic Marker for N-Glycosylation Defects in Bram. Biochim Biophys Acta 1455: 54-60.

Grünewald S, Imbach T, Huijben K, Rubio-Gozalbo M E, Verrips A, de Klerk J B, Stroink H, Rijk-van Andel J F, Van Hove J L, Wendel U, Matthijs G, Hennet T, Jaeken J and Wevers R A (2000) Clinical and Biochemical Characteristics of Congenital Disorder of Glycosylation Type Ic, the First Recognized Endoplasmic Reticulum Defect in N-Glycan Synthesis. Ann Neurol 47: 776-781.

Grünewald S, Schollen E, van Schaftingen E, Jaeken J and Matthijs G (2001) High Residual Activity of PMM2 in Patients' Fibroblasts: Possible Pitfall in the Diagnosis of CDG-Ia (Phosphomannomutase Deficiency). Am / / / m w Genet 68 : 347-354.

Haltiwanger RS, Busby S, Grove K, Li S, Mason D, Medina L, Moloney D, Philipsberg G and Scartozzi R (1997) 0-Glycosylation of Nuclear and Cytoplasmic Proteins: Regulation Analogous to Phosphorylation? Biochem Biophys Res Commun 231: 237- 242.

Harding BN, Dunger D B, Grant D B and Erdohazi M (1988) Familial Olivopontocerebellar Atrophy With Neonatal Onset: a Recessively Inherited Syndrome With Systemic and Biochemical Abnormalities. J Neurol Neurosurg Psychiatry 51: 385-390.

Hamik-Ort V, Prakash K, Marcantonio E, Colman D R, Rosenfeld M G, Adesnik M, Sabatini D D and Kreibich G (1987) Isolation and Characterization of CDNA Clones for Rat Ribophorin I: Complete Coding Sequence and in Vitro Synthesis and Insertion of the Encoded Product into Endoplasmic Reticulum Membranes. J Cell Biol 104: 855- 863.

251 ______References ______

Harrison HH, Miller K L, Harbison M D and Slonim A E (1992) Multiple Serum Protein Abnormalities in Carbohydrate-Deficient Glycoprotein Syndrome: Pathognomonic Finding of Two-Dimensional Electrophoresis? Clin Chem 38: 1390- 1392.

Hart GW, Brew K, Grant G A, Bradshaw R A and Lennarz W J (1979) Primary Structural Requirements for the Enzymatic Formation of the N- Glycosidic Bond in Glycoproteins. Studies With Natural and Synthetic Peptides. J Biol Chem 254: 9747- 9753.

Hart GW (1997) Dynamic 0-Linked Glycosylation of Nuclear and Cytoskeletal Proteins. Annu Rev Biochem 66: 315-335.

Hashimoto H, Sakakibara A, Yamasaki M and Yoda K (1997) Saccharomyces Cerevisiae VIG9 Encodes GDP-Maimose Pyrophosphorylase, Which Is Essential for Protein Glycosylation./B/o/ Chem 272:16308-16314.

Hassell JR, Kimura J H and Hascall V C (1986) Proteoglycan Core Protein Families. Annu Rev Biochem 55: 539-567.

Hayashi K (1991) PCR-SSCP: a Simple and Sensitive Method for Detection of Mutations in the Genomic DNA. PCR Methods Appl 1: 34-38.

Helenius A and Aebi M (2001) Intracellular Functions of N-Linked Glycans. Science 291: 2364-2369.

Helenius J, Davis TW, Marolda CL, Walter P, Valvano MA and Aebi M (2002) Translocation of lipid-linked oligosaccharides across the ER membrane requires Rftl protein. Nature 415: 447-450

Heller L, Orlean P and Adair W L, Jr. (1992) Saccharomyces Cerevisiae Sec59 Cells Are Deficient in Dolichol Kinase Activity. Proc Natl Acad Sci USAS9: 7013-7016.

Hellerstein MK, Letscher A, Schwarz J M, Cesar D, Shackleton C H, Turner S, Neese R, Wu K, Bock S and Kaempfer S (1997) Measurement of Hepatic Ra UDP-Glucose in Vivo in Rats: Relation to Glycogen Deposition and Labeling Patterns. Am J Physiol 272: E155-E162.

Hemming FW (1983) The Biosynthesis of Polyisoprenoid Chains. Bioc/iew Soc Trans 11: 497-504.

Hendriksz CJ, McClean P, Henderson M J, Keir D G, Worthington V C, Imtiaz F, Schollen E, Matthijs G and Winchester B G (2001) Successful Treatment of Carbohydrate Deficient Glycoprotein Syndrome Type lb With Oral Mannose.Arc/f Dis Child 85: 339-340.

Herman RH (1971) Mannose Metabolism. l.A m J Clin Nutr 24: 488-498.

Hettkamp H, Legler G and Bause E (1984) Purification by Affinity Chromatography of Glucosidase I, an Endoplasmic Reticulum Hydrolase Involved in the Processing of Asparagine-Linked Oligosaccharides. EwrJBiocAc/M 142: 85-90.

252 ______References ______

Heykants L, Schollen E, Grünewald S and Matthijs G (2001) Identification and Localization of Two Mouse Phosphomannomutase Genes, Pmml and Pmm2. Gene 270: 53-59.

Heyne K, Henry H, Messerli B, Bachmann C, Stephani U, Tissot J D and Weidinger S (1997) Apolipoproteih J Deficiency in Types I and IV Carbohydrate-Deficient Glycoprotein Syndrome (Glycanosis CT>G). Eur J Pediatr 156: 247-248.

Higashi Y, Strominger J L and Sweeley C C (1967) Structure of a Lipid Intermediate in Cell Wall Peptidoglycan Synthesis: a Derivative of a C55 Isoprenoid Alcohol. Proc Natl Acad Sci U SA 57: 1878-1884.

Hill HD, Jr., Schwyzer M, Steinman H M and Hill R L (1977) Ovine Submaxillary Mucin. Primary Structure and Peptide Substrates of UDP-N- Acetylgalactosamine:Mucm Transferase./B/o/ Chem 252: 3799-3804.

Holt GD and Hart G W (1986) The Subcellular Distribution of Terminal N- Acetylglucosamine Moieties. Localization of a Novel Protein-Saccharide Linkage, O- Linked GlcNAc.JBW Chem 261: 8049-8057.

Horslen SP, Clayton P T, Harding B N, Hall N A, Keir G and Winchester B (1991) Olivopontocerebellar Atrophy of Neonatal Onset and Disialotransferrin Developmental Deficiency SyndiomQ. Arch Dis Child 66: 1027-1032.

Hubbard SC and Robbins P W (1980) Synthesis of the N-Linked Oligosaccharides of Glycoproteins. Assembly of the Lipid-Linked Precursor Oligosaccharide and Its Relation to Protein Synthesis in Viwo.JBiol Chem 255: 11782-11793.

Huffaker TC and Robbins P W (1983) Yeast Mutants Deficient in Protein Glycosylation.fm eVarZ USASO: 7466-7470.

Hughes RC, Mills G and Stojanovic D (1983) Hybrid, Sialylated N-Glycans Accumulate in a Ricin-Resistant Mutant of Baby Hamster Kidney BHK Cells. Carbohydr Res 120: 215-234.

Hutchesson AC, Gray R G, Spencer D A and Keir G (1995) Carbohydrate Deficient Glycoprotein Syndrome; Multiple Abnormalities and Diagnostic Delay.Arch Dis Child 72: 445-446.

Imbach T, Burda P, Kuhnert P, Wevers R A, Aebi M, Berger E G and Hennet T (1999) A Mutation in the Human Ortholog of the Saccharomyces Cerevisiae ALG6 Gene Causes Carbohydrate-Deficient Glycoprotein Syndrome Type-Ic.Proc Natl Acad Sci U SA 96: 6982-6987.

Imbach T, Schenk B, Schollen E, Burda P, Stutz A, unewald S, Bailie N M, King M D, Jaeken J, Matthijs G, Berger E G, Aebi M and Hennet T (2000) Deficiency of Dolichol- Phosphate-Mannose Synthase-1 Causes Congenital Disorder of Glycosylation Type le. J Clin Invest 105: 233-239.

Imbach T, Grünewald S, Schenk B, Burda P, Schollen E, Wevers R A, Jaeken J, de Klerk J B, Berger E G, Matthijs G, Aebi M and Hennet T (2000) Multi-Allelic Origin of Congenital Disorder of Glycosylation (CDG)-Ic./7mw Genet 106: 538-545.

253 ______References ______

Imperial! B and Hendrickson T L (1995) Asparagine-Linked Glycosylation: Specificity and Function of Oligosaccharyl TransferasQ. Bioorg Med Chem 3 :1565-1578.

Imtiaz F, Worthington V, Champion M, Beesley C, Charlwood J, Clayton P, Keir G, Mian N and Winchester B (2000) Genotypes and Phenotypes of Patients in the UK With Carbohydrate- Deficient Glycoprotein Syndrome Type 1 ./ Inherit Metab Dis 23: 162-174.

Jackson BJ, Warren C D, Bugge B and Robbins P W (1989) Synthesis of Lipid-Linked Oligosaccharides in Saccharomyces Cerevisiae: Man2GlcNAc2 and ManlGlcNAc2 Are Transferred From Dolichol to Protein in Vivo. Arch Biochem Biophys 272: 203-209.

Jackson BJ, Kukuruzinska M A and Robbins P (1993) Biosynthesis of Asparagine- Linked Oligosaccharides in Saccharomyces Cerevisiae: the Alg2 Mutation. Glycobiology 3: 357-364.

Jacobia SJ, Korotchkina L G and Patel M S (2002) Characterization of a Missense Mutation at Histidine-44 in a Pyruvate Dehydrogenase-Deficient Patient. Biochim Biophys Acta 1586: 32-42.

Jaeken J, Proesmans W, Eggermont E, Van Hoof F, Den Tandt W, Standaert L, Van Herck G and Corbeel L (1980) Niemaim-Pick Type C Disease and Early Cholestasis in Three Brothers. Paediatr Belg 33: 43-46.

Jaeken J, van Eijk H G, van der H C, Corbeel L, Eeckels R and Eggermont E (1984) Sialic Acid-Deficient Serum and Cerebrospinal Fluid Transferrin in a Newly Recognized Genetic Syndrome. Clin ChimActa 144: 245-247.

Jaeken J, Stibler H and Hagberg B (1991) The Carbohydrate-Deficient Glycoprotein Syndrome. A New Inherited Multisystemic Disease With Severe Nervous System Involvement. Acta Paediatr Scand Suppl 375: 1-71.

Jaeken J, Kint J and Spaapen L (1992) Serum Lysosomal Enzyme Abnormalities in Galactosaemia. Lancet 340 : 1472-1473.

Jaeken J, De Cock P, Stibler H, Van Geet C, Kint J, Ramaekers V and Carchon H (1993) Carbohydrate-Deficient Glycoprotein Syndrome Type l \ J Inherit Metab Dis 16: 1041.

Jaeken J and Carchon H (1993) The Carbohydrate-Deficient Glycoprotein Syndromes: an Overview. J Inherit Metab Dis 16: 813-820.

Jaeken J, Schachter H, Carchon H, De Cock P, Coddeville B and Spik G (1994) Carbohydrate Deficient Glycoprotein Syndrome Type II: a Deficiency in Golgi Localised N-Acetyl-Glucosaminyltransferase \\.Arch Dis Child 71: 123-127.

Jaeken J, Pirard M, Adamowicz M, Pronicka E and van Schaftingen E (1996) Inhibition of Phosphomaimose Isomerase by Fructose 1-Phosphate: an Explanation for Defective N-Glycosylation in Hereditary Fructose Intolerance. Pediatr Res 40: 764-766.

Jaeken J, Matthijs G, Barone R and Carchon H (1997a) Carbohydrate Deficient Glycoprotein (CDG) Syndrome Type l.J Med Genet 34: 73-76.

254 References

Jaeken J, Artigas J, Barone R, Fiumara A, de Koning T J, Poll-The B T, Rijk-van Andel J F, Hoffmann G F, Assmann B, Mayatepek E, Pineda M, Vilaseca M A, Saudubray J M, Schluter B, Wevers R and van Schaftingen E (1997b) Phosphomannomutase Deficiency Is the Main Cause of Carbohydrate- Deficient Glycoprotein Syndrome With Type I Isoelectrofocusing Pattern of Serum Sialotransferrins. J Inherit Metab Dis 20: 447-449.

Jaeken J and Casaer P (1997) Carbohydrate-Deficient Glycoconjugate (CDG) Syndromes: a New Chapter of NcuTopSiediatncs. Europ J Paediatr Neurol 1: 61-66.

Jaeken J, Matthijs G, Saudubray J M, Dionisi-Vici C, Bertini E, de Lonlay P, Henri H, Carchon H, Schollen E and van Schaftingen E (1998) Phosphomannose Isomerase Deficiency: a Carbohydrate-Deficient Glycoprotein Syndrome With Hepatic-Intestinal Presentation.Am/ / / m w Gener 62: 1535-1539.

Jaeken J, Matthijs G, Carchon H, van Schaftingen E (2001) The Metabolic and Molecular Bases of Inherited Disease (8* Edition) Scriver C R (ed.) Volume 1: 1601- 1622.

Jaeken J and Matthijs G (2001) Congenital Disorders of Glycosylation. Annu Rev Genomics Hum Genet 2: 129-151.

Jakob CA, Burda P, Roth J and Aebi M (1998) Degradation of Misfolded Endoplasmic Reticulum Glycoproteins in Saccharomyces Cerevisiae Is Determined by a Specific Oligosaccharide Structure./Ce//Bio/ 142: 1223-1233.

Jensen TG, Bross P, Andresen B S, Lund T B, Kristensen T J, Jensen U B, Winther V, Kolvraa S, Gregersen N and Bolund L (1995) Comparison Between Medium-Chain Acyl-CoA Dehydrogenase Mutant Proteins Overexpressed in Bacterial and Mammalian Cells. Hum Mutat 6: 226-231.

Jentoft N (1990) Why Are Proteins 0-Glycosylated? Trends Biochem Sci 15: 291-294.

Kaiden A, Rosenwald A G, Cacan R, Verbert A and Krag S S (1998) Transfer of Two Oligosaccharides to Protein in a Chinese Hamster Ovary Cell B211 Which Utilizes Polyprenol for Its N-Linked Glycosylation Intermediates.ArcA Biochem Biophys 358: 303-312.

Kalz-Fuller B, Bieberich E and Bause E (1995) Cloning and Expression of Glucosidase I From Human Hippocampus. EurJ Biochem 231: 344-351.

Kanehisa M (1988) A Multivariate Analysis Method for Discriminating Protein Secondary Structural Segments. Protein Eng 2: 87-92.

Kaplan HA, Welply J K and Lennarz W J (1987) Oligosaccharyl Transferase: the Central Enzyme in the Pathway of Glycoprotein Assembly. B/ocA/m Biophys Acta 906: 161-173.

Kasturi L, Chen H and Shakin-Eshleman S H (1997) Regulation of N-Linked Core Glycosylation: Use of a Site-Directed Mutagenesis Approach to Identify Asn-Xaa- Ser/Thr Sequons That Are Poor Oligosaccharide Acceptors. Biochem 323J ( Ft 2): 415- 419.

255 ______References ______

Kaufinan RJ (1999) Stress Signaling From the Lumen of the Endoplasmic Reticulum: Coordination of Gene Transcriptional and Translational Controls. Genes Dev 13: 1211- 1233.

Kaushal GP and Elbein A D (1985) Purification and Properties of UDP- GlcNAc:Dolichy 1-Phosphate GlcNAc-1- Phosphate Transferase. Activation and Inhibition of the Enzyme. Chem 260 :16303-16309.

Kean EL (1982) Activation by Dolichol Phosphate-Mannose of the Biosynthesis of N- Acetylglucosaminylpyrophosphoryl Polyprenols by the Retina./Biol Chem 257: 7952- 7954.

Kean EL, Wei Z, Anderson V E, Zhang N and Sayre L M (1999) Regulation of the Biosynthesis of N- Acetylglucosaminylpyrophosphoryldolichol, Feedback and Product Inhibition./ 5 /0 / Chem 274: 34072-34082.

Keir G, Winchester 3 G and Clayton P (1999) Carbohydrate-Deficient Glycoprotein Syndromes: Inborn Errors of Protein Glycosylation. A/i/i Clin Biochem 36 ( Ft 1): 20- 36.

Kelleher DJ, Kreibich G and Gilmore R (1992) Oligosaccharyltransferase Activity Is Associated With a Protein Complex Composed of Ribophorins I and II and a 48 Kd Protein. Cell 69: 55-65.

Kelleher DJ and Gilmore R (1994) The Saccharomyces Cerevisiae Oligosaccharyltransferase Is a Protein Complex Composed of Wbplp, Swplp, and Four Additional Polypeptides. / Bio/ Chem 269: 12908-12917.

Kelleher DJ and Gilmore R (1997) DADl, the Defender Against Apoptotic Cell Death, Is a Subunit of the Mammalian Oligosaccharyltransferase. Proc Natl Acad Sci USA94: 4994-4999.

Kelly WG, Dahmus M E and Hart G W (1993) RNA Polymerase II Is a Glycoprotein. Modification of the COOH-Terminal Domain by 0-GlcNAc. / Biol Chem 268: 10416- 10424.

Kepes F and Schekman R (1988) The Yeast SEC53 Gene Encodes Phosphomannomutase. / Biol Chem 263: 9155-9161.

Kessler C, Mi H and Hartman G R (1982) Competition of Rifampicin With Binding of Substrate and RNA to RNA Polymerase. Ewr/B/oc/icm 122: 515-518.

Kim S, Westphal V, Srikrishna G, Mehta D P, Peterson S, Filiano J, Karnes P S, Patterson M C and Freeze H H (2000) Dolichol Phosphate Mannose Synthase (DPMI) Mutations Define Congenital Disorder of Glycosylation le (CDG-Ie)./ Clin Invest 105: 191-198.

Kjaergaard S, Skovby F and Schwartz M (1998) Absence of Homozygosity for Predominant Mutations in PMM2 in Danish Patients With Carbohydrate-Deficient Glycoprotein Syndrome Type l.EurJHum Genet 6: 331-336.

256 References

Kjaergaard S, Skovby F and Schwartz M (1999) Carbohydrate-Deficient Glycoprotein Syndrome Type lA: Expression and Characterisation of Wild Type and Mutant PMM2 in E. Coli. EurJ Hum Genet 7: 884-888.

Knauer R and Lehle L (1994) The N-Oligosaccharyltransferase Complex From Yeast. FEBS Lett 344: 83-86.

Knauer R and Lehle L (1999) The Oligosaccharyltransferase Complex From Yeast. Biochim Biophys Acta ,1426 : 259-273.

Komer C, Knauer R, Holzbach U, Hanefeld F, Lehle L and von Figura K (1998) Carbohydrate-Deficient Glycoprotein Syndrome Type V: Deficiency of Dolichyl-P- Glc:Man9GlcNAc2-PP-Dolichyl GlucosyItransferase. Proc Natl Acad Sci U S A 95: 13200-13205.

Komer C, Lehle L and von Figura K (1998) Abnormal Synthesis of Mannose 1- Phosphate Derived Carbohydrates in Carbohydrate-Deficient Glycoprotein Syndrome Type I Fibroblasts With Phosphomannomutase Deficiency. Glycobiology 8: 165-171.

Komer C, Knauer R, Stephani U, Marquardt T, Lehle L and von Figura K (1999) Carbohydrate Deficient Glycoprotein Syndrome Type IV: Deficiency of Dolichyl-P- Man:Man(5)GlcNAc(2)-PP-Dolichyl MannosyItransferase.EMBO J 18: 6816-6822.

Komfeld R (1967) Studies on L-Glutamine D-Fmctose 6-Phosphate Amidotransferase. I. Feedback Inhibition by Uridine Diphosphate-N-Acetyl glucosamine. J Bi o/ Chem 242: 3135-3141.

Komfeld R and Komfeld S (1985) Assembly of Asparagine-Linked Oligosaccharides. Annu Rev Biochem 54: 631-664.

Krag SS (1998) The Importance of Being Dolichol. Bioc/iew Biophys Res Commun 243: 1-5.

Krasnewich D and Gahl W A (1997) Carbohydrate-Deficient Glycoprotein Syndrome. Adv Pediatr 44: 109-140.

Krasnewich DM, Holt G D, Brantly M, Skovby F, Redwine J and Gahl W A (1995) Abnormal Synthesis of Dolichol-Linked Oligosaccharides in Carbohydrate- Deficient Glycoprotein Syndrome. Glycobiology 5: 503-510.

Kukuruzinska MA and Lennon K (1998) Protein N-Glycosylation: Molecular Genetics and Functional Significance. CritRev Oral Biol Med 9: 415-448.

Kukuruzinska MA and Lennon-Hopkins K (1999) ALG Gene Expression and Cell Cycle Viogitssion. Biochim Biophys Acta 1426: 359-372.

Kumar V, Heinemann F S and Ozols J (1995) Purification and Characterization of Hepatic Oligosaccharyltransferase. BiocAcm Mol Biol Int 36: 817-826.

Kumar V, Korza G, Heinemann F S and Ozols J (1995) Human Oligosaccharyltransferase : Isolation, Characterization, and the Complete Amino Acid Sequence of 50-KDa Subunit. Arch Biochem Biophys 320: 217-223.

257 ______References ______

Landberg E, Pahlsson P, Lundblad A, Ametorp A and Jeppsson J O (1995) Carbohydrate Composition of Serum Transferrin Isoforms From Patients With High Alcohol Consumption. Biochem Biophys Res Commun 210: 267-274.

Lehrman MA (1991) Biosynthesis of N-Acetylglucosamine-P-P-Dolichol, the Committed Step of Asparagine-Linked Oligosaccharide Assembly. Glycobiology 1: 553-562.

Lehrman MA (2001) Oligosaccharide-Based Information in Endoplasmic Reticulum Quality Control and Other Biological Systems./Bio/ Chem 276: 8623-8626.

Lennon K, Pretel R, Kesselheim J, te H S and Kukuruzinska M A (1995) Proliferation- Dependent Differential Regulation of the Dolichol Pathway Genes in Saccharomyces Cerevisiae. Glycobiology 5: 633-642.

Leonard J, Grünewald S and Clayton P (2001) Diversity of Congenital Disorders of Glycosylation. La/zcer 357: 1382-1383.

Low P, Dallner G, Mayor S, Cohen S, Chait B T and Menon A K (1991) The Mevalonate Pathway in the Bloodstream Form of Trypanosoma Brucei. Identification of Dolichols Containing 11 and 12 Isoprene Residues. / Bio/ Chem 266: 19250-19257.

Lubke T, Marquardt T, von Figura K and Komer C (1999) A New Type of Carbohydrate-Deficient Glycoprotein Syndrome Due to a Decreased Import of GDP- Fucose into the Golgi. / Bio/ Chem 274: 25986-25989.

Lubke T, Marquardt T, Etzioni A, Hartmann E, von Figura K and Komer C (2001) Complementation Cloning Identifies CDG-IIc, a New Type of Congenital Disorders of Glycosylation, As a GDP-Fucose Transporter Deficiency.Aior Genet 28: 73-76.

Luhn K, Wild M K, Eckhardt M, Gerardy-Schahn R and Vestweber D (2001) The Gene Defective in Leukocyte Adhesion Deficiency II Encodes a Putative GDP-Fucose Transporter. Nat Genet 28: 69-72.

Mai Z, Horohov D W and Klei T R (1998) Hypoxanthine PhosphoribosyItransferase CDNA in Gerbils (Meriones Unguiculatus). Lob A«im Sci 48:179-183.

Marek KW, Vijay I K and Marth J D (1999) A Recessive Deletion in the GlcNAc-1- Phosphotransferase Gene Results in Peri-Implantation Embryonic Lethality. Glycobiology 91263-1271. :

Marquardt T, Bmne T, Luhn K, Zimmer K P, Komer C, Fabritz L, van der W N, Vormoor J, Freeze H H, Louwen F, Biermann B, Harms E, von Figura K, Vestweber D and Koch H G (1999) Leukocyte Adhesion Deficiency II Syndrome, a Generalized Defect in Fucose Metabolism. J Pediatr 134: 681-688.

Marquardt T, Luhn K, Srikrishna G, Freeze H H, Harms E and Vestweber D (1999) Correction of Leukocyte Adhesion Deficiency Type II With Oral Fucose. Blood 94: 3976-3985.

258 ______References ______

Marquardt T and Freeze H (2001) Congenital Disorders of Glycosylation: Glycosylation Defects in Man and Biological Models for Their Study. BW Chem 382: 161-177.

Marshall S, Bacote V and Traxinger R R (1991) Discovery of a Metabolic Pathway Mediating Glucose-Induced Desensitization of the Glucose Transport System. Role of Hexosamine Biosynthesis in the Induction of Insulin Resistance. J Biol Chem 266: 4706-4712.

Martin A, Rambal C, Berger V, Perier S and Louisot P (1998) Availability of Specific Sugars for Glycoconjugate Biosynthesis: a Need for Further Investigations in Man. Biochimie 80: 75-86.

Martin A, Watterson M P, Brown A R, Imtiaz F, Winchester B G, Watkin D J, Fleet G W J (1999) 6R- and 6S-6C-Methylmannose fron D-mannuronolactone. Inhibition of phosphoglucomutase and phosphomannomutase: agents for the study of the primary metabolism of mannose. Tetrahedron Assymmetry 10: 355-366

Martinsson T, Bjursell C, Stibler H, Kristiansson B, Skovby F, Jaeken J, Blennow G, Stromme P, Hanefeld F and Wahlstrom J (1994) Linkage of a Locus for Carbohydrate- Deficient Glycoprotein Syndrome Type I (CDGl) to Chromosome 16p, and Linkage Disequilibrium to Microsatellite Marker D16S406. Hum Mol Genet 3: 2037-2042.

Matthijs G, Legius E, Schollen E, Vandenberk P, Jaeken J, Barone R, Fiumara A, Visser G, Lambert M and Cassiman J J (1996) Evidence for Genetic Heterogeneity in the Carbohydrate-Deficient Glycoprotein Syndrome Type I {CT>G1).Genomics 35: 597- 599.

Matthijs G, Schollen E, Pardon E, Veiga-Da-Cunha M, Jaeken J, Cassiman J J and van Schaftingen E (1997a) Mutations in PMM2, a Phosphomannomutase Gene on Chromosome 16pl3, in Carbohydrate-Deficient Glycoprotein Type I Syndrome (Jaeken Syndrome). Nat Genet 16: 88-92.

Matthijs G, Schollen E, Pirard M, Budarf M L, van Schaftingen E and Cassiman J J (1997b) PMM (PMMl), the Human Homologue of SEC53 or Yeast Phosphomannomutase, Is Localized on Chromosome 22ql3. Genomics 40: 41-47.

Matthijs G, Schollen E, van Schaftingen E, Cassiman J J and Jaeken J (1998a) Lack of Homozygotes for the Most Frequent Disease Allele in Carbohydrate-Deficient Glycoprotein Syndrome Type lA .A m J Hum Genet 62: 542-550.

Matthijs G, Schollen E, Cassiman J J, Cormier-Daire V, Jaeken J and van Schaftingen E (1998b) Prenatal Diagnosis in CDGl Families: Beware of Heterogeneity. Eur J Hum Genet 6: 99-104.

Matthijs G, Schollen E, Heykants L and Grünewald S (1999) Phosphomannomutase Deficiency: the Molecular Basis of the Classical Jaeken Syndrome (CDGS Type la). Mol Genet Metab 68: 220-226.

259 ______References ______

Matthijs G, Schollen E, Bjursell C, Erlandson A, Freeze H, Imtiaz F, Kjaergaard S, Martinsson T, Schwartz M, Seta N, Vuillaumier-Barrot S, Westphal V and Winchester B (2000) Mutations in PMM2 That Cause Congenital Disorders of Glycosylation, Type la (CDG-Ia). Hum Mutat 16: 386-394.

McClain DA, Paterson A J, Roos M D, Wei X and Kudlow J E (1992) Glucose and Glucosamine Regulate Growth Factor Gene Expression in Vascular Smooth Muscle Cells. Proc Natl Acad Sci USAS9: 8150-8154.

McKnight GL, Mudri S L, Mathewes S L, Traxinger R R, Marshall S, Sheppard P O and O'Hara P J (1992) Molecular Cloning, CDNA Sequence, and Bacterial Expression of Human Glutamine:Fructose-6-Phosphate Amidotransferase. / Chem 267: 25208- 25212.

McLachlan KR and Krag S S (1994) Three Enzymes Involved in Oligosaccharide-Lipid Assembly in Chinese Hamster Ovary Cells Differ in Lipid Substrate Preference. J Res 35: 1861-1868.

Mellquist JL, Kasturi L, Spitalnik S L and Shakin-Eshleman S H (1998) The Amino Acid Following an Asn-X-Ser/Thr Sequon Is an Important Determinant of N-Linked Core Glycosylation Efficiency.Biochemistry 37: 6833-6837.

Menon AK, Mayor S and Schwarz R T (1990) Biosynthesis of Glycosyl- Phosphatidylinositol Lipids in Trypanosoma Brucei: Involvement of Mannosyl- Phosphoryldolichol As the Mannose Donor. EMBO J 9: 4249-4258.

Miletich JP and Broze G J, Jr. (1990) Beta Protein C Is Not Glycosylated at Asparagine 329. The Rate of Translation May Influence the Frequency of Usage at Asparagine-X- Cysteine Sites. J Biol Chem 265: 11397-11404.

Miller SA, Dykes D D and Polesky H F (1988) A Simple Salting Out Procedure for Extracting DNA From Human Nucleated Celts. Nucleic Acids Res 16:1215.

Mills K, Mills P B, Clayton P T, Johnson A W, Whitehouse D B and Winchester B G (2001) Identification of Alpha(l)-Antitrypsin Variants in Plasma With the Use of Proteomic Technology. Clin Chem 47: 2012-2022.

Moremen KW, Trimble R B and Herscovics A (1994) Glycosidases of the Asparagine- Linked Oligosaccharide Processing Pathway. Glycobiology 4:113-125.

Moss J, Balducci E, Cavanaugh E, Kim H J, Konczalik P, Lesma E A, Okazaki I J, Park M, Shoemaker M, Stevens L A and Zolkiewska A (1999) Characterization of NAD: Arginine ADP-Ribosyltransferases. Mo/Cc//B/oc/icm 193: 109-113.

Murch SH (1997) The Molecular Basis of Intractable Diarrhoea of Infancy. Baillieres Clin Gastroenterol 11: 413-440.

Murphy LA and Spiro R G (1981) Transfer of Glucose to Oligosaccharide-Lipid Intermediates by Thyroid Microsomal Enzymes and Its Relationship to the N- Glycosylation of 'Proteins. J Biol Chem 256: 7487-7494.

260 References

Nagy E and Maquat L E (1998) A Rule for Termination-Codon Position Within Intron- Containing Genes: When Nonsense Affects RNA Abundance. Trends Biochem Sci 23: 198-199.

Nakashima T, Sekiguchi T, Kuraoka A, Fukushima K, Shibata Y, Komiyama S and Nishimoto T (1993) Molecular Cloning of a Human CDNA Encoding a Novel Protein, DADl, Whose Defect Causes Apoptotic Cell Death in Hamster BHK21 Cells. Mol Cell Biol 13: 6367-6374.

Nehrke K, Hagen F K and Tabak L A (1996) Charge Distribution of Flanking Amino Acids Influences 0-Glycan Acquisition in Vivo./Bio/ Chem 271: 7061-7065.

Ng DT, Spear E D and Walter P (2000) The Unfolded Protein Response Regulates Multiple Aspects of Secretory and Membrane Protein Biogenesis and Endoplasmic Reticulum Quality Control. J Cell Biol 150: 77-88.

Niehues R, Hasilik M, Alton G, Komer C, Schiebe-Sukumar M, Koch H G, Zimmer K P, Wu R, Harms E, Reiter K, von Figura K, Freeze H H, Harms H K and Marquardt T (1998) Carbohydrate-Deficient Glycoprotein Syndrome Type Ib. Phosphomannose Isomerase Deficiency and Mannose Therapy./ Clin Invest 101: 1414-1420.

Nilsson IM and von Heijne G (1993) Determination of the Distance Between the Oligosaccharyltransferase Active Site and the Endoplasmic Reticulum Membrane. / Biol Chem 268: 5798-5801.

Ning B and Elbein A D (2000) Cloning, Expression and Characterization of the Pig Liver GDP-Mannose Pyrophosphorylase. Evidence That GDP-Mannose and GDP-Glc Pyrophosphorylases Are Different Vroitim. Eur J Biochem 267: 6866-6874.

O'Connell B, Tabak L A and Ramasubbu N (1991) The Influence of Flanking Sequences on 0-G\ycosy\dXion. Biochem Biophys Res Commun 180: 1024-1030.

O'Connell BC, Hagen F K and Tabak L A (1992) The Influence of Flanking Sequence on the 0-Glycosylation of Threonine in V itro./ Biol Chem 267: 25010-25018.

Ohkura T, Fukushima K, Kurisaki A, Sagami H, Ogura K, Ohno K, Hara-Kuge S and Yamashita K (1997) A Partial Deficiency of Dehydrodolichol Reduction Is a Cause of Carbohydrate-Deficient Glycoprotein Syndrome Type I J Biol Chem 272: 6868-6875.

Oki T, Yamazaki K, Kuromitsu J, Okada M and Tanaka I (1999) CDNA Cloning and Mapping of a Novel Subtype of Glutamine:Fructose-6- Phosphate Amidotransferase (GFAT2) in Human and Mouse. Genomics 57: 227-234.

Orita M, Suzuki Y, Sekiya T and Hayashi K (1989) Rapid and Sensitive Detection of Point Mutations and DNA Polymorphisms Using the Polymerase Chain Reaction. Genomics 5: 874-879.

Orlean P, Albright C and Robbins P W (1988) Cloning and Sequencing of the Yeast Gene for Dolichol Phosphate Mannose Synthase, an Essential Protein. / B/o/ Chem 263: 17499-17507.

261 ______References ______

Orlean P (1990) Dolichol Phosphate Mannose Synthase Is Required in Vivo for Glycosyl Phosphatidylinositol Membrane Anchoring, O Mannosylation, and N Glycosylation of Protein in Saccharomyces Cerevisiae.Mo/ Cell Biol 10: 5796-5805.

Pan YT, Hori H, Saul R, Sanford B A, Molyneux R J and Elbein A D (1983) Castanospermine Inhibits the Processing of the Oligosaccharide Portion of the Influenza Viral Hemagglutinin. Biochemistry 22: 3975-3984.

Panneerselvam K and Freeze H H (1995) Enzymes Involved in the Synthesis of Mannose-6-Phosphate From Glucose Are Normal in Carbohydrate Deficient Glycoprotein Syndrome ¥\bxoh\?iSXs. Biochem Biophys Res Commun 208: 517-522.

Panneerselvam K and Freeze H H (1996) Mannose Corrects Altered N-Glycosylation in Carbohydrate-Deficient Glycoprotein Syndrome Fibroblasts. J Clin Invest 97: 1478- 1487.

Panneerselvam K, Etchison J R and Freeze H H (1997) Human Fibroblasts Prefer Mannose Over Glucose As a Source of Mannose for N-Glycosylation. Evidence for the Functional Importance of Transported Marmose. JB W Chem 272: 23123-23129.

Parodi AJ (2000) Protein Glucosylation and Its Role in Protein Folding. Annu Rev Biochem 69: 69-93.

Paterson AJ and Kudlow J E (1995) Regulation of Glutamine:Fructose-6-Phosphate Amidotransferase Gene Transcription by Epidermal Growth Factor and Glucose. Endocrinology 136: 2809-2816.

Peng HL and Chang HY (1993) Cloning of a human liver UDP-glucose pyrophosphorylase cDNA by complementation of the bacterial galU mutation. FEBS Lett 329 (1-2): 153-8

Pirard M, Collet J F, Matthijs G and van Schaftingen E (1997) Comparison of PMMl With the Phosphomannomutases Expressed in Rat Liver and in Human Cells. FEBS Lett 411: 251-254.

Pirard M, Matthijs G, Heykants L, Schollen E, Grünewald S, Jaeken J and van Schaftingen E (1999) Effect of Mutations Found in Carbohydrate-Deficient Glycoprotein Syndrome Type IA on the Activity of Phosphomannomutase 2. FEBS Lett 452: 319-322.

Pohl S, Hoffmann A, Rudiger A, Nimtz M, Jaeken J and Conradt H S (1997) Hypoglycosylation of a Brain Glycoprotein (Beta-Trace Protein) in CDG Syndromes Due to Phosphomannomutase Deficiency and N-Acetylglucosaminyl- Transferase II Deficiency. Glycobiology 7:1077-1084.

Prado-Figueroa M, Raper J and Opperdoes F R (1994) Possible Localisation of Dolichol-Dependent MannosyItransferase of Trypanosoma Brucei to the Rough Endoplasmic Reticulum. Mol Biochem Parasitol 63: 255-264.

Proudfoot AE, Turcatti G, Wells T N, Payton M A and Smith D J (1994) Purification, CDNA Cloning and Heterologous Expression of Human Phosphomannose Isomerase. Eur J Biochem 219: 415-423.

262 ______References ______

Quellhorst GJ, Jr., Hall C W, Robbins A R and Krag S S (1997) Synthesis of Dolichol in a Polyprenol Reductase Mutant Is Restored by Elevation of Cis-Prenyl Transferase Activity. ArcA Biochem Biophys 343: 19-26.

Ramaekers VT, Stibler H, Kint J and Jaeken J (1991) A New Variant of the Carbohydrate Deficient Glycoproteins ^ynéiomt.J Inherit Metab Dis 14: 385-388.

Reiss G, te H S, Zimmerman J, Robbins P W and Aebi M (1996) Isolation of the ALG6 Locus of Saccharomyces Cerevisiae Required for Glucosylation in the N-Linked Glycosylation Pathway.Glycobiology 6: 493-498.

Rine J, Hansen W, Hardeman E and Davis R W (1983) Targeted Selection of Recombinant Clones Through Gene Dosage Effects. Proc Natl Acad Sci t/ 5 A 80: 6750-6754.

Robinson KA, Sens D A and Buse M G (1993) Pre-Exposure to Glucosamine Induces Insulin Resistance of Glucose Transport and Glycogen Synthesis in Isolated Rat Skeletal Muscles. Study of Mechanisms in Muscle and in Rat-1 Fibroblasts Overexpressing the Human Insulin Receptor. D/abercs 42: 1333-1346.

Roos MD, Han I O, Paterson A J and Kudlow J E (1996) Role of Glucosamine Synthesis in the Stimulation of TGF-Alpha Gene Transcription by Glucose and EGF. Am J Physiol 270: C803-C811.

Roos MD, Su K, Baker J R and Kudlow J E (1997) O Glycosylation of an Spl-Derived Peptide Blocks Known Spl Protein Interactions. Mol Cell Biol 17: 6472-6480.

Rosenwald AG and Krag S S (1990) Lec9 CHO Glycosylation Mutants Are Defective in the Synthesis of Dolichol. /LipiV/ Res 31: 523-533.

Rossetti L, Giaccari A and DeFronzo R A (1990) Glucose Toxicity. Diabetes Care 13: 610-630.

Runge KW, Huffaker T C and Robbins P W (1984) Two Yeast Mutations in Glucosylation Steps of the Asparagine Glycosylation Pathway./B/o/ Chem 259: 412- 417.

Rush JS, Panneerselvam K, Waechter C J and Freeze H H (2000) Mannose Supplementation Corrects GDP-Mannose Deficiency in Cultured Fibroblasts From Some Patients With Congenital Disorders of Glycosylation (CDG). Glycobiology 10: 829-835.

Sagami H and Lennarz W J (1987) Glycoprotein Synthesis in Drosophila Kc Cells. Biosynthesis of Dolichol- Linked Saccharides./Bio/ Chem 262: 15610-15617.

Saiki RK, Scharf S, Faloona F, Mullis K B, Horn G T, Erlich H A and Amheim N (1985) Enzymatic Amplification of Beta-Globin Genomic Sequences and Restriction Site Analysis for Diagnosis of Sickle Cell Anemia. Science 230: 1350-1354.

Sambrook J and Gethmg M J (1989) Protein Structure. Chaperones, Paperones. Nature 342: 224-225.

263 ______References ______

Saul R, Chambers J P, Molyneux R J and Elbein A D (1983) Castanospermine, a Tetrahydroxylated Alkaloid That Inhibits Beta- Glucosidase and Beta- Glucocerebrosidase. Arc/i Biochem Biophys 221: 593-597.

Sayeski PP and Kudlow J E (1996) Glucose Metabolism to Glucosamine Is Necessary for Glucose Stimulation of Transforming Growth Factor-Alpha Gene Transcription. J Biol Chem 271:15237-15243.

Sayeski PP, Wang D, Su K, Han I O and Kudlow J E (1997) Cloning and Partial Characterization of the Mouse Glutamine:Fructose-6- Phosphate Amidotransferase (GFAT) Gene VxomoXex. Nucleic Acids Res 25:1458-1466.

Schachter H (1994) 9th Annual Symposium on Biotechnology: the New Biology of Carbohydrates. University College London Medical School, 16-17 December 1993. GlycoconjJ 11: v-vii.

Schachter H (1999) Molecular Basis of Glycoconjugate Disease. B/oc/iim Biophys Acta 1455: 61-62.

Schachter H (2001) Congenital Disorders Involving Defective N-Glycosylation of Proteins. Cell Mol Life Sci 58: 1085-1104.

Schenk B, Aebi M, Imbach T, Berger E G, Rennet T, Matthijs G (2000b) N-linked protein glycosylation in the ER of Saccharomyces cerevisiae: a tool to define the molecular cause of different types of CDG. In: Congenital Disorders of Glycosylation, 2000, p. 7, Freeze H (ed.) The Burnham Institute, La Jolla, Calif.

Schenk B, Fernandez F and Waechter C J (2001a) The Ins(Ide) and Out(Side) of Dolichyl Phosphate Biosynthesis and Recycling in the Endoplasmic Reticulum. Glycobiology 11: 61R-70R.

Schenk B, Imbach T, Frank C G, Grubenmann C E, Raymond G V, Hurvitz H, Raas- Rotschild A, Luder A S, Jaeken J, Berger E G, Matthijs G, Rennet T and Aebi M (2001) MPDUl Mutations Underlie a Novel Human Congenital Disorder of Glycosylation, Designated Type If. J Clin Invest 108: 1687-1695.

Schollen E, Pardon E, Heykants L, Renard J, Doggett N A, Callen D F, Cassiman J J and Matthijs G (1998) Comparative Analysis of the Phosphomannomutase Genes PMMl, PMM2 and PMM2psi: the Sequence Variation in the Processed Pseudogene Is a Reflection of the Mutations Found in the Functional Gene. Hum Mol Genet 7:157-164.

Schollen E, Dorland L, de Koning T J, van Diggelen O P, Huijmans J G, Marquardt T, Babovic-Vuksanovic D, Patterson M, Imtiaz F, Winchester B, Adamowicz M, Pronicka E, Freeze H and Matthijs G (2000) Genomic Organization of the Human Phosphomannose Isomerase (MPI) Gene and Mutation Analysis in Patients With Congenital Disorders of Glycosylation Type Ib (CDG-Ib).i/Mm Mutat 16: 247-252.

Schollen E, Kjaergaard S, Legius E, Schwartz M and Matthijs G (2000) Lack of Hardy- Weinberg Equilibrium for the Most Prevalent PMM2 Mutation in CDG-Ia (Congenital Disorders of Glycosylation Type la). Eur J Hum Genet 8: 367-371.

264 ______References ______

Schultz C, Vajanaphanich M, Harootunian A T, Sammak P J, Barrett K E and Tsien R Y (1993) Acetoxymethyl Esters of Phosphates, Enhancement of the Permeability and Potency of CAM?. J Biol Chem 268: 6316-6322.

Schultz C, Vajanaphanich M, Genieser H G, Jastorff B, Barrett K E and Tsien R Y (1994) Membrane-Permeant Derivatives of Cyclic AMP Optimized for High Potency, Prolonged Activity, or Rapid Reversibility. Mo/ Pharmacol 46: 702-708.

Schweden J, Borgmarm C, Legler G and Bause E (1986) Characterization of Calf Liver Glucosidase I and Its Inhibition by Basic Sugar Analogs. Arch Biochem Biophys 248:335-340.

Seta N, Bamier A, Hochedez F, Besnard M A and Durand G (1996) Diagnostic Value of Western Blotting in Carbohydrate-Deficient Glycoprotein Syndrome. C/m ChimActa 254:131-140.

Shailubhai K, Pratta M A and Vijay I K (1987) Purification and Characterization of Glucosidase I Involved in N-Linked Glycoprotein Processing in Bovine Mammary Gland. Biochem J 247: 555-562.

Shakin-Eshleman SH, Spitalnik S L and Kasturi L (1996) The Amino Acid at the X Position of an Asn-X-Ser Sequon Is an Important Determinant of N-Linked Core- Glycosylation Efficieiicy./B/o/ Chem 271: 6363-6366.

Sharma CB, Lehle L and Tanner W (1981) N-Glycosylation of Yeast Proteins. Characterization of the Solubilized Oligosaccharyl Transferase. Eur J Biochem 116: 101-108.

Shimma Y, Nishikawa A, bin K B, Eto A and Jigami Y (1997) A Defect in GTP Synthesis Affects Mannose Outer Chain Elongation in Saccharomyces Cerevisiae. Mol Gen Genet 256: 469-480.

Shinabarger D, Berry A, May T B, Rothmel R, Fialho A and Chakrabarty A M (1991) Purification and Characterization of Phosphomannose Isomerase-Guanosine Diphospho-D-Mannose Pyrophosphorylase. A Bifunctional Enzyme in the Alginate Biosynthetic Pathway of Pseudomonas Aeruginosa. J Biol Chem 266: 2080-2088.

Silberstein S, Kelleher D J and Gilmore R (1992) The 48-KDa Subunit of the Mammalian Oligosaccharyltransferase Complex Is Homologous to the Essential Yeast Protein W S?1.J Biol Chem 267: 23658-23663.

Silberstein S and Gilmore R (1996) Biochemistry, Molecular Biology, and Genetics of the Oligosaccharyltransferase.FASEB J 10: 849-858.

Silbert JE and Sugumaran G (1995) Intracellular Membranes in the Synthesis, Transport, and Metabolism ofViotQO^ycdiO.^.Biochim Biophys Acta 1241: 371-384.

Singh N and Tartakoff A M (1991) Two Different Mutants Blocked in Synthesis of Dolichol-Phosphoryl- Mannose Do Not Add Glycophospholipid Anchors to Membrane Proteins: Quantitative Correction of the Phenotype of a CHO Cell Mutant With Tunicamycin. Mol Cell Biol 11: 391-400.

265 ______References ______

Smith PK, Krohn R I, Hermanson G T, Mallia A K, Gartner F H, Provenzano M D, Fujimoto E K, Goeke N M, Olson B J and Klenk D C (1985) Measurement of Protein Using Bicinchoninic Acid. Anal Biochem 150: 76-85.

Sochor M, Kunjara S, Baquer N Z and McLean P (1991) Regulation of Glucose Metabolism in Livers and Kidneys of NOD Mice. Diabetes 40:1467-1471.

Sousa M and Parodi A J (1995) The Molecular Basis for the Recognition of Misfolded Glycoproteins by the UDP-GlcGlycoprotein Glucosyltransferase. EMBO J 14: 4196- 4203.

Spiro MJ (1984) Effect of Diabetes on the Sugar Nucleotides in Several Tissues of the Rat. Diabetologia 26: 70-75.

Stagljar I, te H S and Aebi M (1994) New Phenotype of Mutations Deficient in Glucosylation of the Lipid- Linked Oligosaccharide: Cloning of the ALG8 Locus. Proc Natl Acad Sci U SA 91: 5977-5981.

Stibler H, Allgulander C, Borg S and Kjellin K G (1978) Abnormal Microheterogeneity of Transferrin in Serum and Cerebrospinal Fluid in Alcoholism. Acta Med Scand 204: 49-56.

Stibler H (1979) Direct Immunofixation After Isoelectric Focusing. An Improved Method for Identification of Cerebrospinal Fluid and Serum Proteins. J Neurol Sci 42: 275-281.

Stibler H and Jaeken J (1990) Carbohydrate Deficient Serum Transferrin in a New Systemic Hereditary Syndrome.Arc/i Dis Child 65: 107-111.

Stibler H and Cederberg B (1993) Diagnosis of the Carbohydrate-Deficient Glycoprotein Syndrome by Analysis of Transferrin in Filter Paper Blood Spots. Acm Paediatr 82: 55-59.

Stibler H, Blennow G, Kristiansson B, Lindehammer H and Hagberg B (1994) Carbohydrate-Deficient Glycoprotein Syndrome: Clinical Expression in Adults With a New Metabolic Discdisc. J Neurol Neurosurg Psychiatry 57: 552-556.

Stibler H, Holzbach U and Kristiansson B (1998) Isoforms and Levels of Transferrin, Antithrombin, Alpha(l)-Antitrypsin and Thyroxine-Binding Globulin in 48 Patients With Carbohydrate- Deficient Glycoprotein Syndrome Type I. Scand J Clin Lab Invest 58: 55-61.

Stoll J, Robbins A R and Krag S S (1982) Mutant of Chinese Hamster Ovary Cells With Altered Mannose 6-Phosphate Receptor Activity Is Unable to Synthesize MannosyIphosphoryldolichol. Proc U SA19: 2296-2300.

Stoll J, Rosenwald A G and Krag S S (1988) A Chinese Hamster Ovary Cell Mutant F2A8 Utilizes Polyprenol Rather Than Dolichol for Its Lipid-Dependent Asparagine- Linked Glycosylation Reactions. JP/o/ Chem 263:10774-10782.

266 References

Sturla L, Etzioni A, Bisso A, Zanardi D, De Rora G, Silengo L, De Flora A and Tonetti M (1998) Defective Intracellular Activity of GDP-D-Mannose-4,6-Dehydratase in Leukocyte Adhesion Deficiency Type II FEBS Lett 429: 274-278.

Sturla L, Puglielli L, Tonetti M, Berninsone P, Hirschberg C B, De Rora A and Etzioni A (2001) Impairment of the Golgi GDP-L-Fucose Transport and Unresponsiveness to Fucose Replacement Therapy in LAD II VdXitnXs.Pediatr Res 49: 537-542.

Szumilo T, Drake R R, York J L and Elbein A D (1993) GDP-Maimose Pyrophosphorylase. Purification to Homogeneity, Properties, and Utilization to Prepare Photoaffinity Analogs./Bio/ Chem 268:17943-17950.

Tan J, DAgostaro A F, Bendiak B, Reck F, Sarkar M, Squire J A, Leong P and Schachter H (1995) The Human UDP-N-Acetylglucosamine: Alpha-6-D-Mannoside- Beta-1,2- N- Acetylglucosaminyltransferase II Gene (MGAT2). Cloning of Genomic DNA, Localization to Chromosome 14q21, Expression in Insect Cells and Purification of the Recombinant Protein. Eur J Biochem 231: 317-328.

Tan J, Dunn J, Jaeken J and Schachter H (1996) Mutations in the MGAT2 Gene Controlling Complex N-Glycan Synthesis Cause Carbohydrate-Deficient Glycoprotein Syndrome Type II, an Autosomal Recessive Disease With Defective Brain Development. Am J Hum Genet 59: 810-817.

te HS, Janetzky B, Lehle L and Aebi M (1992) The Yeast WBPl Is Essential for Oligosaccharyl Transferase Activity in Vivo and in V itro.BM BO/11: 2071-2075.

te HS and Aebi M (1994) The Genetic Interaction of Kar2 and Wbpl Mutations. Distinct Functions of Binding Protein BiP and N-Linked Glycosylation in the Processing Pathway of Secreted Proteins in Saccharomyces Cerevisiae. Eur J Biochem 222: 631-637.

Tessier DC, Dignard D, Zapun A, Radominska-Pandya A, Parodi A J, Bergeron J J and Thomas D Y (2000) Cloning and Characterization of Mammalian UDP-Glucose Glycoprotein: Glucosyltransferase and the Development of a Specific Substrate for This Enzyme. Glycobiology 10: 403-412.

Titani K, Kumar S, Takio K, Ericsson L H, Wade R D, Ashida K, Walsh K A, Chopek M W, Sadler J E and Fujikawa K (1986) Amino Acid Sequence of Human Von Willebrand Factor. Biochemistry 25: 3171-3184.

Tomita S, Inoue N, Maeda Y, Ohishi K, Takeda J and Kinoshita T (1998) A Homologue of Saccharomyces Cerevisiae Dpmlp Is Not Sufficient for Synthesis of Dolichol- Phosphate-Marmose in Mammalian Cells. J Biol Chem 273: 9249-9254.

Torres CR and Hart G W (1984) Topography and Polypeptide Distribution of Terminal N-Acetylglucosamine Residues on the Surfaces of Intact Lymphocytes. Evidence for O- Linked GlcNAc. J Biol Chem 259: 3308-3317.

Travers KJ, Patil C K, Wodicka L, Lockhart D J, Weissman J S and Walter P (2000) Functional and Genomic Analyses Reveal an Essential Coordination Between the Unfolded Protein Response and ER-Associated Degradation. Cell 101: 249-258.

267 ______References ______

Traxinger RR and Marshall S (1992) Insulin Regulation of Pyruvate Kinase Activity in Isolated Adipocytes. Crucial Role of Glucose and the Hexosamine Biosynthesis Pathway in the Expression of Insulin Action. J Bio/ Chem 267: 9718-9723.

Trimble RB, Byrd J C and Maley F (1980) Effect of Glucosylation of Lipid Intermediates on Oligosaccharide Transfer in Solubilized Microsomes From Saccharomyces Cerevisiae./Bio/ Chem 255:11892-11895.

Trombetta ES, Simons J F and Helenius A (1996) Endoplasmic Reticulum Glucosidase II Is Composed of a Catalytic Subunit, Conserved From Yeast to Mammals, and a Tightly Bound Noncatalytic HDEL-Containing Subunit. J Biol Chem 271: 27509- 27516.

Trowbridge IS, Hyman R, Ferson T and Mazauskas C (1978) Expression of Thy-1 Glycoprotein on Lectin-Resistant Lymphoma Cell Cmts.EurJ Immunol 8: 716-723.

Van Geet C and Jaeken J (1993) A Unique Pattern of Coagulation Abnormalities in Carbohydrate-Deficient Glycoprotein Syndwme. Pediatr Res 33: 540-541. van Ommen CH, Peters M, Barth P G, Vreken P, Wanders R J and Jaeken J (2000) Carbohydrate-Deficient Glycoprotein Syndrome Type la: a Variant Phenotype With Borderline Cognitive Dysfunction, Cerebellar Hypoplasia, and Coagulation Disturbances. J Pediatr 136: 400-403. van Pelt J, Bakker J Velmans M H and Spaapen L J (1996) Carbohydrate-Deficient Transferrin Values in Neonatal and Umbilical Cord Blood. J Inherit Metab Dis 19: 253- 256. van Schaftingen E and Jaeken J (1995) Phosphomannomutase Deficiency Is a Cause of Carbohydrate-Deficient Glycoprotein Syndrome Type l.FEBS Lett 311: 318-320.

Van H, V, Bobrow M, Bodmer W F, Povey S, Gardiner S E and Hopkinson D A (1975) Assignment of the Genes for Human Mitochondrial Malate Dehydrogenase to Chromosome 7, for Marmose Phosphate Isomerase and Pyruvate Kinase to Chromosome 15, and. Probably, for Human Esterase-D to Chromosome 13 Using Man- Mouse Hybrids. Birth Defects Orig Artie Ser 11: 183-187.

Varki A (1998) Factors Controlling the Glycosylation Potential of the Golgi Apparatus. Trends Cell Biol 8: 34-40.

Verostek MF, Atkinson P H and Trimble R B (1993) Glycoprotein Biosynthesis in the Alg3 Saccharomyces Cerevisiae Mutant. I. Role of Glucose in the Initial Glycosylation of Invertase in the Endoplasmic Reticulum./B/o/ Chem 268:12095-12103.

Vuillaumier-Barrot S,' Hetet G, Bamier A, Dupre T, Cuer M, de Lonlay P, Cormier- Daire V, Durand G, Grandchamp B and Seta N (2000) Identification of Four Novel PMM2 Mutations in Congenital Disorders of Glycosylation (CDG) la French Patients./ Med Genet 31: 579-580.

Wada Y, Nishikawa A, Okamoto N, Inui K, Tsukamoto H, Okada S and Taniguchi N (1992) Structure of Serum Transferrin in Carbohydrate-Deficient Glycoprotein Syndrome. Biochem Biophys Res Commun 189: 832-836.

268 ______References ______

Wada Y, Gu J, Okamoto N and Inui K (1994) Diagnosis of Carbohydrate-Deficient Glycoprotein Syndrome by Matrix- Assisted Laser Desorption Time-of-Flight Mass Spectrometry. Biol Mass Spectrom 23: 108-109.

Wada Y and Sakamoto M (1997) Isolation of the Human Phosphomannomutase Gene (PMMl) and Assigmnent to Chromosome 22ql3. Genomics 39: 416-417.

Wang Y, Abemethy J L, Eckhardt A E and Hill R L (1992) Purification and Characterization of a UDP-GalNAc:Polypeptide N- Acetylgalactosaminyltransferase Specific for Glycosylation of Threonine Residues. JB W Chem 267:12709-12716.

Wang Y, Agrwal N, Eckhardt A E, Stevens R D and Hill R L (1993) The Acceptor Substrate Specificity of Porcine Submaxillary UDP- GalNAcPolypeptide N- AcetylgalactosaminyItransferase Is Dependent on the Amino Acid Sequences Adjacent to Serine and Threonine Residues. Chem 268: 22979-22983.

Watzele G and Tanner W (1989) Cloning of the Glutamine:Fructose-6-Phosphate Amidotransferase Gene From Yeast. Pheromonal Regulation of Its Transcription. J Biol Chem 264: 8753-8758.

Wells L, Vosseller K and Hart G W (2001) Glycosylation of Nucleocytoplasmic Proteins: Signal Transduction and O- GlcNAc. Science 291: 2376-2378.

Westphal V, Murch S, Kim S, Srikrishna G, Winchester B, Day R and Freeze H H (2000a) Reduced Heparan Sulfate Accumulation in Enterocytes Contributes to Protein- Losing Enteropathy in a Congenital Disorder of Glycosylation.Am / Pa^/io/157: 1917- 1925.

Westphal V, Schottstadt C, Marquardt T and Freeze H H (2000b) Analysis of Multiple Mutations in the HALG6 Gene in a Patient With Congenital Disorder of Glycosylation Ic. Mol Genet Metab 70: 219-223.

Westphal V, Enns G M, McCracken M F and Freeze H H (2001a) Functional Analysis of Novel Mutations in a Congenital Disorder of Glycosylation la Patient With Mixed Asian Ancestry. Mol Genet Metab 73: 71-76.

Westphal V, Kjaergaard S, Davis J A, Peterson S M, Skovby F and Freeze H H (2001b) Genetic and Metabolic Analysis of the First Adult With Congenital Disorder of Glycosylation Type lb: Long-Term Outcome and Effects of Mannose Supplementation. Mol Genet Metab 73: 77-85.

Wilson IB, Gavel Y and von Heijne G (1991) Amino Acid Distributions Around O- Linked Glycosylation Sites. B/oc/icm 7 275 ( Ft 2): 529-534.

Winchester B, Clayton P, Mian N, di Tomaso E, Dell A, Reason A and Keir G (1995) The Carbohydrate-Deficient Glycoprotein Syndrome: an Experiment of Nature in Glycosylation. Bioc/iem Soc Trans 23: 185-188.

Wolf U (1997) Identical Mutations and Phenotypic Variation. i/«m Genet 100: 305-321.

Wood EC Jr, Cahill GF Jr (1963) Mannose Utilisation in Man. J Clin Invest 42: 1300

269 References

Yamashita K, Ideo H, Ohkura T, Fukushima K, Yuasa I, Ohno K and Takeshita K (1993) Sugar Chains of Serum Transferrin From Patients With Carbohydrate Deficient Glycoprotein Syndrome. Evidence of Asparagine-N-Linked Oligosaccharide Transfer Deficiency./5 /0 / Chem 268: 5783-5789.

Yki-Jarvinen H, Mott D, Young A A, Stone K and Bogardus C (1987) Regulation of Glycogen Synthase and Phosphorylase Activities by Glucose and Insulin in Human Skeletal Muscle. J Clin Invest 80: 95-100.

Yki-Jarvinen H, Daniels M C, Virkamaki A, Makimattila S, DeFronzo R A and McClain D (1996) Increased Glutamine:Fructose-6-Phosphate Amidotransferase Activity in Skeletal Muscle of Patients With 'HlTJiDM. Diabetes 45: 302-307.

Yuasa I, Ohno K, Hashimoto K, lijima K, Yamashita K and Takeshita K (1995) Carbohydrate-Deficient Glycoprotein Syndrome: Electrophoretic Study of Multiple Serum Glycoproteins. Bram Dev 17: 13-19.

Zhou Y and Jiang R Z (1991) Recognition Sequence Specificity of Signal Peptidase I and the Role of Signal Peptide in Secretion of Protein in Bacillus Subtilis. Sci China B 34:1082-1091.

Zuber C, Spiro M J, Guhl B, Spiro R G and Roth J (2000) Golgi Apparatus Immunolocalization of Endomaimosidase Suggests Post- Endoplasmic Reticulum Glucose Trimming: Implications for Quality Control. Mo/B/o/ Cell 11: 4227-4240.

270