Ghent University Faculty of Sciences Department of Plant Biotechnology and Bioinformatics
Functional Analysis of the TETRASPANIN Gene Family in Plant Development and Growth
This thesis is submitted as partial fulfillment of the requirements for the degree of Doctor of Philosophy (Ph.D.) in Sciences: Biochemistry and Biotechnology
Feng WANG
Promotor: Prof. Dr. Mieke Van Lijsebettens Co-promoter: Prof. Dr. Sofie Goormachtig
VIB / Plant Systems Biology Technologiepark 927, B-9000 Gent, Belgium
This work was conducted in the Department of Plant Systems Biology (PSB) of the Flanders Institute for Biotechnology (VIB).
Feng WANG was supported by a CSC PhD fellowship grant of China.
The author and promoter give the authorization to consult and copy parts of this work for personal use only. Every other use is subject to the copyright laws. Permission to reproduce any material contained in this work should be obtained from the author.
Examination Committee
Chair Prof. Dr. Geert De Jaeger Ghent University - Department of Plant Biotechnology and Bioinformatics VIB - Department of Plant Systems Biology
Secretary Prof. Dr. Mieke Van Lijsebettens (Promoter) Ghent University - Department of Plant Biotechnology and Bioinformatics VIB - Department of Plant Systems Biology
Members Prof. Sofie Goormachtig (Co-promoter) Ghent University - Department of Plant Biotechnology and Bioinformatics VIB - Department of Plant Systems Biology
Prof. Kristiina Himanen (Reading Committee) University of Helsinki - Department of Agricultural Sciences
Prof. Gerda Cnops Institute for Agricultural and Fisheries Research, 9000 Gent, Belgium.
Prof. Filip Vandenbussche (Reading Committee) Ghent University - Department of Physiology
Prof. Ive De Smet (Reading Committee) Ghent University - Department of Plant Biotechnology and Bioinformatics VIB - Department of Plant Systems Biology
Prof. Klaas Vandepoele Ghent University - Department of Plant Biotechnology and Bioinformatics VIB - Department of Plant Systems Biology
Prof. Tom Beeckman (Reading Committee) Ghent University - Department of Plant Biotechnology and Bioinformatics VIB - Department of Plant Systems Biology. CONTENTS
SCOPE AND AIMS ...... 1 LIST OF ABBREVIATIONS ...... 2 CHAPTER 1 TETRASPANIN GENES IN PLANTS ...... 5 ABSTRACT ...... 6 Membrane Proteins ...... 8 Evolutionary and Phylogenetic Studies of Tetraspanins ...... 10 From Structure to Function ...... 17 A. Transmembrane Domains ...... 18 B. Extracellular Loops...... 18 C. Cytoplasmic Domains ...... 19 Tetraspanin-enriched Microdomains ...... 20 A. Cell Adhesion and Membrane Fusion ...... 21 B. Cell-to-cell/cell-to-environment Communication and Infections ...... 22 ACKNOWLEDGEMENTS ...... 24 CHAPTER 2 EMBRYONIC AND VEGETATIVE TETRASPANIN GENE EXPRESSION PATTERNS IDENTIFY FUNCTIONS IN SPECIFIC TISSUES, DOMAINS AND CELL TYPES ...... 25 ABSTRACT ...... 26 2.1 INTRODUCTION ...... 27 2.2 RESULTS ...... 29 2.2.1 Generation of Promoter TET-reporter Gene Lines and Analysis in Embryo, Root, Leaf and Flower .. 29 2.2.2 Most Duplicated TET Genes Have Divergent Expression Patterns in Embryonic and Vegetative Development ...... 36 2.2.3 TET5 and TET6 Redundant Genes Have a Function in Growth Control ...... 39 2.3.4 TET2 in Stomatal Development and Function ...... 41 2.3.5 TET13 Has a Function in Primary and Lateral Root Development ...... 45 2.3.6 Fluorescence Activated Cell Sorting of Synchronized tet13-1 Lateral Root Founder Cells for RNA-Seq ...... 50 2.3 DISCUSSION ...... 52 2.4 MATERIALS AND METHODS ...... 56 SUPPLEMENTAL DATA ...... 60 ACKNOWLEDGEMENTS ...... 67 CHAPTER 3 TETRASPANINS SUBCELLULAR LOCALIZATION ...... 69 ABSTRACT ...... 70 3.1 INTRODUCTION ...... 71 3.2 RESULTS ...... 72 3.2.1 Signal Peptide and Signal Anchor at the N-terminus of Tetraspanins...... 72 3.2.2 Tetraspanins Subcellular Localization Prediction ...... 72 3.2.3 Generation of TETRASPANIN Fluorescence Tag Fusion Transgenic Lines and Subcellular Localization of TETRASPANINS ...... 74 3.3 DISCUSSION ...... 79 3.4 MATERIALS AND METHODS ...... 81 SUPPLEMENTAL DATA ...... 83 CHAPTER 4 INFERRING TETRASPANINS FUNCTIONS BY LINKING EXPERIMENTAL DATA WITH BIOINFORMATIC DATA ...... 85 ABSTRACT ...... 86 4.1 INTRODUCTION ...... 87 4.2 RESULTS ...... 88 4.2.1 Meta-Analysis of TET Response to a Variety of Perturbations ...... 88 4.2.2 Regulatory Element Analysis in TETs Noncoding Regions ...... 91 A. The Regulatory Elements in TET1 Promoter and Intron Are Related to Light Regulation ...... 96 B. The Regulatory Elements in TET2 Promoter and Intron Are Related to Stress Response ...... 96 C. The Regulatory Elements in TET3 Promoter Are Related to ABA and Cold Response ...... 96 D. The Regulatory Elements in TET4 Promoter Are Related to ABA Response and Tissue-Specific ...... 97 E. The Regulatory Elements in TET5 and TET6 Promoter Regions Are Related to Sugar Response ...... 97 F. TET8 and TET9 Have the Most Regulatory Elements and are Most Diverse ...... 98 4.2.3 Inference of TETs Functions by Transcription Factors-TETs Regulatory Network Analysis ...... 99 A. Generating a Gene Regulatory Network of Upstream Regulators of TETs ...... 99 B. The Regulatory Network Provides Insights into TETs Functions ...... 99 C. TET3 Function is Flowering Response Related ...... 103 D. TET8 in Defense Response ...... 104 E. TET9 in Trichome Development ...... 105 4.2.4 Experimental Tests of TETs Response to the Perturbations ...... 106 4.3 DISCUSSION ...... 106 4.4 MATERIALS AND METHODS ...... 108 CHAPTER 5 TETRASPANIN1/TORNADO2 AND TORNADO1 TRANSCRIPTOMIC AND PROTEOMIC NETWORKS ...... 113 ABSTRACT ...... 114 5.1 INTRODUCTION ...... 115 5.2 RESULTS ...... 118 5.2.1 Transcriptome Analysis of trn Mutants ...... 118 A. A Global Expression Profiling of the trn Mutants ...... 118 B. Common Down-regulated Biological Processes in trn Mutants ...... 119 C. Common Up-regulated Biological Processes in trn Mutants ...... 122 5.2.2 TRN1 and TET1/TRN2 Protein Localization, Western Blot, Tandem Affinity Purification and GFP Pull- down ...... 126 A. Generation of GS-TRN1, RFP-TRN1 and TRN2-GFP Constructs and Plant Materials ...... 126 B. TRN1 and TRN2 Protein localization and Western Blot ...... 128 C. TRN1 Tandem Affinity Purification and TRN2 GFP-based Pull-down for Interacting Proteins ...... 129 5.3 DISCUSSION ...... 132 5.4 MATERIALS AND METHODS ...... 138 SUPPLEMENTAL DATA ...... 144 CHAPTER 6 GENERAL DISCUSSION AND PERSPECTIVES ...... 153 SUMMARY ...... 169 REFERENCES...... 171 ACKNOWLEDGEMENTS ...... 191 CURRICULUM VITA ...... 198 Scope and aims 1
SCOPE AND AIMS
Membrane proteins are associated with the membrane by means of spanning the lipid bilayer of the membrane (integral proteins), attaching to the membrane surface or to the integral proteins (peripheral proteins) or penetrating into membrane but without spanning it (lipid-anchored proteins). It is estimated that 20 to 30% of all genes in most genomes encode integral proteins. Membrane proteins such as receptor kinases have important functions in signal perception and transduction. Other membrane proteins participate in signaling pathways by recruiting receptor kinases as well as other membrane proteins in their microdomains, which are small regions of membrane that have distinct and specialized structure and functions. They act as organizing centers for cellular processes such as signaling molecules assembly and trafficking. Tetraspanins are a class of integral proteins with four-transmembrane domains. They interact with other membrane proteins and recruit them in tetraspanin-enriched microdomains (TEMs) to facilitate signaling pathways. In the animal field, tetraspanins and TEMs functions in signaling pathways related to cell proliferation, gamete fusion and pathogen invasion have been extensively characterized. However, little is known about plant tetraspanins. Only one mutant phenotype has been described so far of the 17 members of the TETRASPANIN gene family in Arabidopsis thaliana, however the molecular basis of the phenotype is not known. This PhD project aimed at elaborately characterizing the role of the Arabidopsis TETRASPANIN gene family in development and growth by achieving the following specific goals with the respective approaches: The phylogenetic relationship was analyzed to identify gene evolution and duplication. Functional redundancy and divergence were investigated by promoter-reporter gene fusion and mutational analysis. In addition, TETRASPANINS crosstalk to environmental and hormonal stimuli, regulatory elements identification, and transcription factors-tetraspanins regulatory network were studied by bioinformatic approaches. Downstream biological processes and interacting proteins of TET1/TRN2 were investigated by transcriptomic and proteomic analysis to get insight in the components of its molecular network. It is expected that specific tetraspanins will be identified as novel components of existing signaling pathways related to plant growth and development. 2 List of abbreviations
LIST OF ABBREVIATIONS
ABA Abscisic Acid BiNGO Biological Networks Gene Ontology BL Brassinolide CDK Cyclin Dependent Kinase cDNA Complementary DNA Col-0 Columbia-0 CYC Cyclin DNA Deoxyribonucleic Acid ER Endoplasmic Reticulum FACS Fluorescence-activated Cell Sorting FC Fold Change G1 Gap 1-phase G2 Gap 2-phase GA Gibberellic Acid GFP Green Fluorescent Protein GO Gene Ontology GUS Beta-glucuronidase HU Hydroxyurea JA Jasmonic Acid LR Lateral Root LRI Lateral Root Initiation LRP Lateral Root Primordium LRR Leucine-rich Repeat M Mitosis MS Mass Spectrometry NAA 1-Naphthaleneacetic acid NLS Nuclear Localization Signal NPA N-1-Naphthylphthalamic Acid PI Propidium Iodide QC Quiescent Center qRT-PCR Quantitative Reverse-transcription Polymerase Chain Reaction RAM Root Apical Meristem RFP Red Fluorescent Protein RNA Ribonucleic Acid S phase Replication Phase SA Salicylic Acid SAM Shoot Apical Meristem SD Standard Deviation SE Standard Error SLRI Synchronized Lateral Root Induction TAP Tandem Affinity Purification T-DNA Transfer DNA TET TETRASPANIN TF Transcription Factor List of abbreviations 3
TRN TORNADO UTR Untranslated Region X-Gluc 5-bromo-4-chloro-3-indolyl-β-D-glucuronic acid
CHAPTER 1 TETRASPANIN GENES IN PLANTS
Feng Wang1,2, Klaas Vandepoele1,2, Mieke Van Lijsebettens1,2*
1Department of Plant Systems Biology, VIB, B-9052 Ghent, Belgium 2Department of Plant Biotechnology and Bioinformatics, Ghent University, B-9052 Ghent, Belgium *Corresponding author.
This chapter was adapted from manuscript published in Plant Science (Volume 190, July 2012, Pages 9–15; PMID: 22608515) with modifications.
Author contributions: F.W. searched homologs (Table 2) and wrote the manuscript. K.V. made the phylogenetic tree (Figure 3) and contributed to the discussion. M.V.L. contributed to the writing of the manuscript. 6 Chapter 1
ABSTRACT Tetraspanins represent a four-transmembrane protein superfamily with a conserved structure and amino acid residues that are present in mammals, insects, fungi and plants. Tetraspanins interact with each other or with other membrane proteins to form tetraspanin-enriched microdomains that play important roles in development, pathogenesis and immune responses via facilitating cell-cell adhesion and fusion, ligand binding and intracellular trafficking. Here, we emphasize evolutionary aspects within the plant kingdom based on genomic sequence information. A phylogenetic tree based on 155 tetraspanins of 11 plant species revealed ancient and fast evolving clades. Tetraspanins were mainly present in higher plants, were duplicated in the plant genomes and predicted by the electronic Fluorescent Pictograph for gene expression analysis to be either functionally redundant or divergent. Tetraspanins contain a large extracellular loop with conserved cysteines that provide the binding sites for the interactions. The Arabidopsis thaliana TETRASPANIN1/TORNADO2/EKEKO has a function in leaf and root patterning and TETRASPANIN3 was identified in the plasmodesmatal proteome, suggesting a role in cell-cell communication during plant development.
Keywords: Gene duplication; Phylogenetic tree; Membrane protein; Development; Arabidopsis; tet1/trn2 mutant
Tetraspanin genes in plants 7
In plants, the fertilized egg cell develops gradually into a mature embryo by cell division, patterning and growth. Upon germination, the embryo develops into a seedling that grows and develops into a fertile plant mainly by the activity of the shoot and the root apical meristem (Weigel & Jürgens, 2002; Van Lijsebettens & Van Montagu, 2005). Multicellular organisms require cell-to-cell communication and signaling for their developmental programmes. The plant cell wall and plasma membrane are the interface for communication with the neighboring cells or for sensing signals from the vicinity. Many proteins are located at the cell wall and plasma membrane, some of which play roles in signal recognition, such as receptor kinases that are often anchored in the plasma membrane through membrane- spanning domains and that have an extracellular domain (e.g. leucine rich repeat) that recognizes specific molecules or ligands and a cytoplasmic domain that gets phosphorylated upon receptor-ligand interaction and activates specific signaling cascades (Trotochaud et al., 1999; Clark, 2001). These receptor kinases are also important in pathogen recognition (Lee et al., 2011). Plant cells communicate with each other mainly through plasmodesmata that span the cell wall, contain endoplasmic reticulum and are abundant in meristematic cells. Transcription factors move between cell layers through plasmodesmata in the shoot apical meristem or during flower formation to perform their function (Lucas et al., 1995; Sessions et al., 2000). The final result of these communication processes is patterning of the embryo or organ into axes, domains, tissue layers and cell types. Tetraspanins are another class of membrane proteins with two extracellular domains with specific conserved amino acid residues and motifs and a cytoplasmic amino and carboxy terminal domain that function in cell-cell communication in animals (Charrin et al., 2009). The only characterized plant tetraspanin is the Arabidopsis thaliana TETRASPANIN1/TORNADO2/EKEKO (TET1/TRN2) that functions in leaf and root patterning (Cnops et al., 2000; Olmos et al., 2003; Cnops et al., 2006; Chiu et al., 2007). In this review, a phylogenetic tree was constructed based on the sequenced genomes of 11 plant species to explore the evolution of tetraspanins in the plant kingdom. A bioinformatics tool to investigate gene expression was used to predict functional redundancy or divergence in Arabidopsis and some other plant species. Mutational analysis and proteomics are discussed as promising approaches to help elucidate the function of tetraspanins in plants.
8 Chapter 1
Membrane Proteins Membrane proteins are defined as proteins associated with a membrane. They can be classified into three groups according to the association with the membrane: integral proteins, peripheral proteins and lipid-anchored proteins (Karp, 2009) (Figure 1). The classification and properties of membrane proteins are briefly summarized in Table 1. Integral proteins are transmembrane proteins that pass entirely through the membrane with their transmembrane domains (TMDs). Some have only one TMD, whereas others have more than one. Due to the transmembrane property, they have both cytoplasmic and extracellular domains. The TM is folded to form either α-helix or β-sheet secondary structure (Santoni et al., 2000). α-helix TMD containing integral proteins are present in all types of membranes while β-sheet TMD containing integral proteins are only present in the outer membranes of Gram-negative bacteria, chloroplasts and mitochondria (Wimley, 2003). Peripheral proteins associate with the surface of the membrane or the integral proteins by noncovalent bonds (Karp, 2009). Lipid-anchored proteins are attached to the membrane without spanning it by covalently binding to lipid molecules that reside within the membrane. The lipid molecule can be phosphatidylinositol, fatty acid or a prenyl chain (Karp, 2009). Peripheral proteins and lipid-anchored proteins can reside on either cytoplasmic or extracellular side. Integral proteins and lipid-anchored proteins are permanently attached to the membrane, they can be separated from the membrane only using detergents, nonpolar solvents or denaturing agents, whereas peripheral proteins are temporarily attached to the membrane, the association can be disrupted by polar reagents (Levy & Shoham, 2005b). It was estimated that 20-30% of all genes in most genomes encode integral proteins (Krogh et al., 2001). In Arabidopsis, about 43% proteins were predicted to have more than one TMD and 18% have more than two TMDs (Ward, 2001). Membrane proteins have important roles in various cellular processes, i.e., signal perception and transduction, cell adhesion, ion transport and endocytosis (Sachs & Engelman, 2006). They are the major targets of medicinal drugs (Yildirim et al., 2007). Tetraspanins are a class of integral membrane proteins with four TMDs which delimits a cytoplasmic amino and carboxy terminal domain, two extracellular loops and one intracellular loop (Figure 2). A few features distinguish tetraspanins from the other four-TMD containing membrane proteins. They have highly conserved transmembrane helices and a unique large extracellular loop (LEL) with conserved
Tetraspanin genes in plants 9
cysteines that can form disulfide bridges to stabilize the structure of LEL (Cherukuri et al., 2004; Min et al., 2006). Most importantly, tetraspanins recruit multiple interacting proteins in a dynamic assembly to form tetraspanin-enriched microdomains (Levy & Shoham, 2005a). In this way, tetraspanins participate in cell- cell communication during different cellular processes in animals, including cell proliferation, adhesion and fusion, motility and pathogen invasion, etc (Yáñez-Mó et al., 2009).
Table 1. Classification and properties of membrane proteins. TMD, transmembrane domain. Type Association Association Isolation chemicals “Sidedness” manner strength integral TMD permanent detergents, nonpolar cytoplasmic proteins (α-helix or β-sheet) solvents, denaturing domain and agents extracellular domain peripheral noncovalent bonds temporary polar reagent cytoplasmic or proteins extracellular side lipid-anchored covalent bonds permanent detergents, nonpolar cytoplasmic or proteins solvents, denaturing extracellular side agents
Figure 1. Schematic representation of membrane proteins. Adapated from “Dept. Biol. PENN STATE” (https://wikispaces.psu.edu/pages/viewpage.action?pageId=112527206&navigatingV ersions=true) with modifications. Lipid molecule is shown in yellow.
10 Chapter 1
Figure 2. Schematic representation of tetraspanin protein. (a) Human tetraspanin structure (Levy & Shoham, 2005a) with modification. 1-4, TMDs. The conserved CCG motif in the LEL forms disulfide bridges (black lines) with additional conserved cysteines. The structure of the LEL is based on human tetraspanin CD81 (Kitadokoro et al., 2001). Other highlighted conserved cysteines at the N- and C-terminus and the intercellular loop are potential palmitoylation sites. (b) Plant tetraspanin structure based on AtTET1, “C” represents conserved cysteine residue; TM: transmembrane domain (Wang et al., 2012). Possible disulfide bridges of plant tetraspanins were not drawn in the scheme.
Evolutionary and Phylogenetic Studies of Tetraspanins Currently, 33 tetraspanins are found in the human genome, 37 in Drosophila melanogaster and 20 in Caenorhabditis elegans. They are present from protozoa to metazoa and from fungi to plants and mammals. A yeast tetraspanin has been identified from Cryptococcus neoformans (Li et al., 2012). The wide presence in almost all the organisms indicates that tetraspanins experienced a long evolutionary history. Tetraspanins were identified in the protozoan amoeba Dictyostelium discoideum (Huang et al., 2005). Normally, D. discoideum is able to live as unicell, but when stimulated by adverse conditions such as starvation, it interacts with others to form a true multicellular body. Therefore, tetraspanins of amoeba are expected to have a function in the unicell-to-multicell transition (Huang et al., 2005). Based on the phylogenetic relationships and ancestral origin of tetraspanin groups, it was suggested that tetraspanins have evolved from a single or a few ancestral gene(s) by gene duplication and divergence rather than through convergence and
Tetraspanin genes in plants 11
this evolution process had been impacted by gene loss and positive selection on coding sequence (Garcia-España et al., 2008; Huang et al., 2010). In addition to evolving independently, animal tetraspanins such as Uroplakin-Ia and Uroplakin-Ib also coevolved with their interactors UP II and UP IIIa, respectively (Garcia-España et al., 2006). Although tetraspanin sequences in different organisms have strongly diverged, some of the motifs remained conserved and stable throughout evolution, such as the CCG motif in the large extracellular loop that is present in most of the animal tetraspanins and in some fungal tetraspanins (Lambou et al., 2008; Garcia- Espana & DeSalle, 2009; DeSalle et al., 2010). Gene duplication often results in gene redundancy, which complicates the investigation of the gene function and explains why a number of the family members are functionally unknown or less known (Huang et al., 2005). Indeed, gene redundancy hampers the functional analysis of tetraspanins by using knock out mutational analysis. Only a few family members are well-studied (Yáñez-Mó et al., 2009), such as animal CD9 (Cluster of Differentiation 9), which supports sperm-egg adhesion and fusion in mice (Kaji et al., 2000; Jégou et al., 2011) and CD81 whose three-dimensional structure was the first to be elucidated (Figure 2) (Seigneuret, 2006). The most persuasive example of tetraspanin functional redundancy is the role of CD9 in sperm-egg fusion: the phenotype can be partially rescued by the injection of CD81 mRNA into CD9 mutants (Kaji et al., 2002). A reasonable explanation is that they share a similar primary structure and the same partners (Rubinstein, 2011). Thus, the weak or absent phenotypes in animal tetraspanin mutants can be explained by functional redundancy. Plant tetraspanin studies lag far behind as compared to those in animals. The model plant Arabidopsis thaliana contains 17 TETRASPANIN (AtTET1-17) genes, most of which have an unknown function (Cnops et al., 2006). We investigated sequenced plant genomes for the presence of tetraspanins using the PLAZA comparative genomics platform (Table 2) (Van Bel et al., 2012; Proost et al., 2015). Tetraspanins are mainly present in higher plants and moss Physcomitrella patens, indicating they already existed before the divergence of land plants. But they are not identified in the green algae (Chlamydomonas rheinhartii, Volvox carteri, Micromonas, Ostreococcus lucimarinus and Ostreococcus tauri) in this study neither in other studies (Boavida et al., 2013). It is hypothesized that tetraspanins might have been lost or become divergent in the distinct lineages as eukaryotes diverged because they are present in
12 Chapter 1
protozoan amoeba, fungi and plants but are absent from those unicellular chlorophyte algae (Boavida et al., 2013). Sequence similarity, secondary structure comparison or EST analysis in other species might solve the questions. A phylogenetic tree was generated based on 155 tetraspanins from 11 plant species (Figure 3). It consists of seven clades based on Arabidopsis thaliana tetraspanins. The TET1-TET2 clade consists of two sub-clades that originated by a duplication in the ancestor of angiosperms. Clades TET10 and TET7-TET9 contain moss homologs, which indicates that these are ancient tetraspanins and already existed before the split of mosses and flowering plants. The other five clades contain only homologs in monocots and dicots, suggesting that they originated later from the angiosperm ancestor. The TET3-TET4 clade contains a conserved sub-clade with short branches and a fast evolving sub-clade with long branches. The support for monocot homologs is low (bootstrap value 16%) in the clade TET7-TET9, but these genes are probably TET7-TET9 homologs. The TET13-TET17 clade includes only two Medicago truncatula tetraspanins, but 11 Arabidopsis tetraspanins with long branch distance, indicating recent sequence evolution. Arabidopsis thaliana contains several clades containing both ancient (AtTET1 & AtTET 2, AtTET5 & AtTET 6) and recent (AtTET3 & AtTET 4) gene duplications. Most sequences of Brachypodium distachyon, Oryza sativa, Sorghum bicolor and Zea mays group together, as do those from Glycine max and Medicago truncatula, reflecting their close relationships.
Tetraspanin genes in plants 13
Table 2. Number of tetraspanins in genomic sequenced plant species. The data was based on PLAZA2.5 (Van Bel et al., 2012). The species used for phylogenetic tree is indicated in bold, recently included in PLAZA3.0 is underlined (Proost et al., 2015). Initially, three tetraspanins were found in green algae (Ostreococcus lucimarinus and Ostreococcus tauri), but their secondary structures do not fit with tetraspanins topology, they have more than two extracellular loops or a larger first extracellular loop, therefore they are removed from the table. Secondary structure is analyzed with TMHMM Server v. 2.0 (http://www.cbs.dtu.dk/services/TMHMM/).
Species Number of TETs Amborella trichopoda 10 Arabidopsis lyrata 22 Arabidopsis thaliana 17 Beta vulgaris 18 Brachypodium distachyon 14 Brassica rapa 32 Capsella rubella 18 Carica papaya 13 Citrullus lanatus 16 Citrus sinensis 16 Cucumis melo 18 Eucalyptus grandis 18 Fragaria vesca 13 Glycine max 31 Gossypium raimondii 28 Hordeum vulgare 11 Lotus japonicus 12 Malus domestica 19 Manihot esculenta 23 Medicago truncatula 10 Musa acuminata 32 Oryza sativa ssp. japonica 19 Oryza sativa ssp. indica 15 Physcomitrella patens 11 Populus trichocarpa 26 Prunus persica 14 Ricinus communis 14 Setaria italica 16 Solanum lycopersicum 16 Solanum tuberosum 20 Sorghum bicolor 17 Selaginella moellendorffii 10 Thellungiella parvula 22 Theobroma cacao 18
14 Chapter 1
Vitis vinifera 11 Zea mays 17 Total 637 Used for phylogenetic tree 155
Figure 3. Maximum likelihood phylogenetic tree containing 155 tetraspanin genes in 11 plant species (Wang et al., 2012). Tetraspanin homologs were identified using sequence similarity and InterPro protein domain searches against the PLAZA 2.5 protein database (Van Bel et al., 2012). Dotted lines indicate branch lengths that were reduced 50%. Species abbreviations: AL - Arabidopsis lyrata, AT - Arabidopsis thaliana, BD - Brachypodium distachyon, GM - Glycine max, MD - Malus domestica, MT - Medicago truncatula, OS - Oryza sativa ssp. Japonica, PP - Physcomitrella patens, SB - Sorghum bicolor, VV - Vitis vinifera and ZM - Zea mays. A multiple sequence alignment was constructed using MUSCLE (Edgar, 2004) and manually edited using BioEdit. Phylogenetic tree
Tetraspanin genes in plants 15
construction was performed using PhyML (Guindon et al., 2009) (WAG model, 1000 bootstrap samples, estimated proportion of invariable sites, four substitue rate categories, gamma parameter estimated, the BIONJ distance-based tree as starting tree).
The electronic Fluorescent Pictograph browser, which is based on microarray data and visualizes gene expression patterns throughout development was used to predict whether the duplicated genes (also called paralogs) derived from the phylogenetic analysis were redundant or divergent in function (Winter et al., 2007) (Figure 4). In addition, it provided expression information on organ type and developmental stage, hence on the putative site of action of the respective TETRASPANIN genes which might be helpful to discern mutant phenotypes. The Arabidopsis TETRASPANINS AtTET1-16 gene expression patterns ranged over all types of organs and all stages of the life cycle, suggesting a wide range of functions, i.e. AtTET1 was highly expressed in the shoot apical meristem, primary root and carpel, whereas AtTET13 was only expressed in pollen. The duplicated genes AtTET1 & AtTET2, AtTET3 & AtTET4, AtTET7 & AtTET8 & AtTET9 showed some overlap in expression levels and patterns, but also specificity, i.e. both AtTET1 & AtTET2 were expressed in roots, floral buds and carpels, but AtTET1 was specific in the shoot apical meristem whereas AtTET2 was specific in developing embryos, suggesting that the AtTET1 gene has diverged in function from its duplicated gene AtTET2. AtTET4 was highly and specifically expressed in the late stages of seed development and dry seeds, suggesting it might be involved in seed dormancy in analogy to ABSCISIC ACID INSENSITIVE 3 that had a similar expression pattern and high level (Winter et al., 2007). Another set of duplicated genes AtTET8 and AtTET9 had different expression patterns, i.e. AtTET8 with high general expression in young seedlings, roots, leaves and sepals, but AtTET9 with low expression restricted to roots and sepals. The homologous genes in Glycine max, GM17G07700, GM13G01580 and GM04G19880 also had different expression patterns, i.e. in green pods, root hairs, flowers and leaves, respectively, indicating that functional divergence had occurred after gene duplication. On the contrary, The AtTET5 & AtTET6 (in roots) (Figure 4), AtTET11 & AtTET12 (in pollen) and AtTET13 & AtTET15 (in pollen) shared a similar expression pattern, respectively, which might indicate their functional redundancy and
16 Chapter 1
indispensable roles in development. In clade TET5-TET6, the Glycine max homologs GM10G35650, GM20G31900, GM02G07090 and the rice homolog OS05g03530 were also expressed in roots, suggesting high functional conservation and redundancy between different species. Interestingly, some tetraspanins in the clade TET11-TET12 had an organ-specific expression pattern, i.e. GM15G25180 was expressed specifically in flowers, GM18G22790 in roots and OS02G49630 in seeds.
Figure 4. The electronic Fluorescent Pictograph expression patterns of duplicated tetraspanins and tet1 mutant phenotypes. (a-d) The electronic
Tetraspanin genes in plants 17
Fluorescent Pictograph expression patterns of AtTET5 (a) & AtTET6 (b), AtTET14 (c) & AtTET15 (d). (e) Wild-type Ws and tet1 mutant seedlings (Wang et al., 2012). (f) tet1 mutant leaf morphology compared to wild-type (Cnops et al., 2006). (g) tet1 mutant root morphology compared to wild-type (Cnops et al., 2000).
Bioinformatics tools such as the electronic Fluorescent Pictograph will facilitate the design of strategies for functional analysis, such as the construction of double or triple mutants in the case of putatively redundant genes or the adjustment of phenotypic screening assays in the case of organ-specific gene expression. However, these meta-analysis should be considered as supplemental to but not substituting for detailed experimental gene expression analyses. Indeed, in situ hybridization using gene-specific probes or promoter activity analyses using GFP or GUS reporter genes are ideally suited to determine tissue-, domain- and cellular- specific gene activity and are essential methods to study molecular function of a gene in detail (Bruno et al., 2011). The only tetraspanin member that has been functionally characterized in plants until now is AtTET1 (Cnops et al., 2000; Olmos et al., 2003; Cnops et al., 2006; Chiu et al., 2007). All tet1/trn2 mutant alleles described had a dramatic phenotype characterized by a short primary root, small leaves and a dwarfed architecture (Figure 4). In addition, leaf symmetry, venation patterning and root epidermal patterning were disturbed in tet1/trn2 mutants due to defective transport and/or distribution of the plant hormone auxin (Cnops et al., 2000; Cnops et al., 2006). Furthermore, carpel development was affected and homozygous plants were sterile (Chiu et al., 2007), which is probably due to a defect in megasporogenesis that is promoted together with the WIH genes (Lieber et al., 2011). The dramatic phenotype of tet1/trn2 mutants corresponded with its general expression pattern (Figure 4). tet1/trn2 mutants had a defective root development: epidermal patterning was disturbed and the hairy primary roots were twisted and shortened. Hence, despite the overlapping eFP expression pattern between AtTET1 and AtTET2, mutational analysis was necessary to distinguish between functional redundancy or divergence within the duplicated TET1-TET2 gene pair.
From Structure to Function As can be inferred from their names, tetraspanins contain four transmembrane
18 Chapter 1
domains, which delimit cytoplasmic amino and carboxy terminal domains, an intracellular loop, a small extracellular loop of 13-30 amino acids and a large extracellular loop which is quite variable in sequence and length (Levy & Shoham, 2005a; Garcia-España et al., 2008) (Figure 2). Interestingly, the large extracellular loop makes up a large part (approximately 1/3 to 1/2) of the tetraspanin protein length in animals and plants, suggesting that this domain might play a major role in tetraspanin function. In animals, tetraspanins are localized at different membranes, such as the plasma membrane, endosomes and endoplasmic reticulum. They can facilitate cell-to-cell communication or sense the stimulus from the environment at the plasma membrane. Conversely, they might act as receptors at the membrane of a certain cell organelle, such as endosomes in pathogenesis (Van Spriel & Figdor, 2010). Also, their localization at the endoplasmic reticulum might indicate a role in assisting the early biosynthesis of partner proteins (Berditchevski, 2001; Levy & Shoham, 2005a; Tu et al., 2006).
A. Transmembrane Domains The transmembrane domains are highly conserved, which might indicate their crucial role in the formation and stabilization of the tetraspanin web that has been supported by mutational analysis (Toyo-oka et al., 1999). In addition, the transmembrane domains also contribute to the protein trafficking during biosynthetic processes (Berditchevski & Odintsova, 2007). It is speculated that the conserved polar residues Asn, Gln and Glu are involved in the packing of the transmembrane domains in animals (Stipp et al., 2003). Plant transmembrane domains are also the most conserved regions that contain polar residues, such as Asn, Ser and Tyr (Cnops et al., 2006). The Arabidopsis transmembrane domains sequences are more conserved among AtTET1-AtTET10 than among AtTET11-AtTET17, which correlates with their evolutionary and phylogenetic relationship (Figure 3).
B. Extracellular Loops The extracellular loops, especially the large one, have attracted much attention, given their important roles in tetraspanin function. The large extracellular loop is comprised of a constant and a variable subdomain. The hallmark of the large extracellular loop is the highly conserved CCG motif in the variable region present in most animal tetraspanins, but absent in plants (Olmos et al., 2003; DeSalle et al., 2010). These
Tetraspanin genes in plants 19
two cysteine residues can form two intramolecular disulfide bridges with the other two cysteine residues (Kitadokoro et al., 2001). In some other cases, one or two additional disulfide bridges can be formed (Seigneuret et al., 2001). The variable region of this loop has a function in protein-protein interaction, such as in the binding of animal CD151 with α3β1-integrin (Yauch et al., 1998) and of human CD81 with HCV envelop protein E2 (Roccasecca et al., 2003). Furthermore, all anti-tetraspanin antibodies specifically bind to the large extracellular loop (Stipp et al., 2003), which supports the hypothesis that this loop is crucial in mediating the interaction between tetraspanins and their partner proteins. In the Arabidopsis TET1/TRN2 gene, single amino acid changes in the large extracellular loop of trn2-2 and trn2-3 alleles caused severe developmental defects such as the one of trn2-4 (Cnops et al., 2006) (Figure 4), which suggests its importance in tetraspanin function. Plant tetraspanins have nine cysteine residues in the large extracellular loop, which might make the formation of disulfide bridges complicated (Olmos et al., 2003; DeSalle et al., 2010). By contrast, little is known about the small extracellular loop. Strikingly, one additional cysteine residue is present in the small extracellular loop of plant tetraspanins, suggesting that this cysteine residue could be involved in the crosslinking to the cysteine residues in the large extracellular loop (DeSalle et al., 2010).
C. Cytoplasmic Domains The N- and C-terminal domains are another two variable regions besides the variable region of the large extracellular loop; however, some intracellular juxtamembrane cysteine residues, which are palmitoylation sites that contribute to the association between tetraspanins and their interactors, are relatively conserved (Berditchevski et al., 2002; Charrin et al., 2002; Yang et al., 2002; Stipp et al., 2003; Delandre et al., 2009). The C-terminal tail in animals is important for cell adhesion, membrane fusion and lysosomal targeting (Takino et al., 2003; Edrington et al., 2007; Wang et al., 2011). The deletion of plant C-terminal tail of the TET1/TRN2 gene caused a dramatic phenotype in the trn2-4 allele which suggested its importance in the TET1/TRN2 function (Cnops et al., 2006). The third cytoplasmic domain, which is less studied, is the very short intracellular loop. A palmitoylation site is present in this region that might also contribute to the association between tetraspanins and their partner proteins (Mazurov et al., 2007). Most insights in the relation between structure and function have been obtained from
20 Chapter 1
mutational analyses. However, proteomics is an emerging technology that will facilitate the study of protein function. Indeed, the Arabidopsis purified plasmodesmal proteome contained a large amount of newly identified plasmodesmal proteins, among which TET3 (At3g45600) (Fernandez-Calvino et al., 2011). The TET3 localization was confirmed by microscopy and suggested a role in cell-to-cell communication that needs to be further explored by functional analysis. Novel protein purification techniques, such as tandem affinity purification, will be applied for the purification of tetraspanin interactors and might help to identify the putative pathways in which tetraspanins play a role.
Tetraspanin-enriched Microdomains A microdomain is a notion to describe a lateral compartment in the plane of the membrane with diverse and specilized composition, structure and function that differs from the surrounding membrane (Laude & Prior, 2004; Malinsky et al., 2013). Human tetraspanin-enriched microdomain is depicted in Figure 5. Tetraspanin- associated interactions can be classified according to three levels. The interactions between tetraspanins and their non-tetraspanin partners were defined as primary interactions, such as animal CD151 and integrin α3β1 (Boucheix & Rubinstein, 2001). In humans, most of these partner proteins belong to four major groups: integrins, immunoglobulin superfamilies, ectoenzymes and intracellular signaling molecules (Rubinstein, 2011). Some of these interactions are highly stoichiometric and resistant to harsh detergents such as digitonin (Rubinstein, 2011) (Levy & Shoham, 2005a). The interactions within the family members are termed secondary interactions (Boucheix & Rubinstein, 2001). They can be either homophilic (CD9- CD9) or heterophilic (CD81-CD151) and are resistant to mild detergents (Hemler, 2005; Levy & Shoham, 2005a; Yáñez-Mó et al., 2009). Primary and secondary interactions are also referred to as direct interactions (Hemler, 2005). Some lipids, such as cholesterol and palmitate might associate with primary and secondary interaction units and form so-called tertiary interactions that result in a network or microdomain on the membrane, called tetraspanin-enriched microdomain (Charrin et al., 2009; Rubinstein, 2011). It is suggested that the palmitoylations in both tetraspanins and partner proteins are essential in mediating the formation of tetraspanin-enriched microdomains (Charrin et al., 2002; Yang et al., 2004). The tetraspanin-enriched microdomains participate in a wide range of biological and
Tetraspanin genes in plants 21
cellular processes including cell adhesion, membrane fusion, cell-to-cell or cell-to- environment communication, migration and invasion (Bailey et al., 2011; Powner et al., 2011). However, tetraspanin-enriched microdomain has not been characterized in plants so far.
Figure 5. Schematic representation of tetraspanin-enriched microdomain (Levy & Shoham, 2005b). The scheme does not represent a specific signaling pathway but only a general depiction of tetraspanin-enriched microdomain and some components reside in it. 14-3-3, a serine/threonine-binding intracellular signaling protein; EWI2, immunoglobulin superfamily member that contains an EWI motif; Gα, α-subunit of G protein; GPCR, G-protein-coupled receptors; PKC, protein kinase C; PM, plasma membrane.
A. Cell Adhesion and Membrane Fusion The human CD9 tetraspanin-enriched microdomains consisted of CD151 and its
22 Chapter 1
partner protein integrin α6β1 and had a role in animal sperm-egg cell fusion (Ziyyat et al., 2006). In analogy, tetraspanins might play a role in reproductive processes in flowering plants, in particular during double fertilization that includes two fusion events, giving rise to the embryo and the endosperm (Sprunck & Dresselhaus, 2009). Although several proteins are known in plants to function in gamete recognition and fusion such as GENERATIVE CELL SPECIFIC 1/HAPLESS 2, no role for tetraspanins has been revealed so far (Berger et al., 2008b; Sprunck & Dresselhaus, 2009). The electronic Fluorescent Pictograph browser did show that AtTET1/TRN2, AtTET7 and AtTET8 are highly expressed in carpels where the ovules containing egg cells are formed. Indeed, mutants defective in the AtTET1/TRN2 gene were sterile (Cnops et al., 1996; Cnops et al., 2000; Cnops et al., 2006; Chiu et al., 2007), probably because of unsuccessful development of the megaspore mother cell (Lieber et al., 2011), thus no gamete fusion process will take place consequently. The Arabidopsis electronic Fluorescent Pictograph tool showed that some tetraspanins are specifically expressed in anthers, such as AtTET11 and AtTET12, AtTET13 and AtTET15 (Figure 4), which are duplicated pairs according to the phylogenetic tree, suggesting their conserved and important roles in evolution and function. These expression patterns might indicate a tetraspanin function in male gamete formation or male gamete-related processes during pollination such as pollen-stigma recognition, pollen tube growth through the style tissue, or emergence at the funiculus and entry into the ovule. Such roles might be only revealed in quadruple mutants knocked-out for each one of the anther-specific tetraspanins. Recently, Arabidopsis TET expression patterns in reproductive tissues were checked by using promoter-reporter gene fusions. A number of them have redundant expression patterns in pollen and stigma, no fertility defect mutant was found, which supports the hypothesis that their function are redundant (Boavida et al., 2013).
B. Cell-to-cell/cell-to-environment Communication and Infections In addition to cell-to-cell communication, tetraspanins can also facilitate signaling or trafficking between cell and external molecules or environmental factors, such as light. Indeed, in Drosophila, the tetraspanin-enriched microdomain formed by the tetraspanin peripherin/RDS (retinal degeneration slow) and the closely related ROM- 1 (retinal outer segment membrane protein 1) is required for the membranous disc morphology of the photoreceptor outer segments that can convert light signals into
Tetraspanin genes in plants 23
graded membrane potentials (Goldberg et al., 1998; Charrin et al., 2009; Vos et al., 2010; Conley et al., 2011). In Arabidopsis, tet1/trn2 mutants exhibited auxin-related phenotypes, such as defective venation and root epidermal patterning (Cnops et al., 2006), which might indicate that auxin signaling or transport molecules, such as the transmembrane PIN family proteins (Paponov et al., 2005), could be part of the tetraspanin-enriched microdomains organized by TET1/TRN2. However, this hypothesis needs to be confirmed by further experimentation. One of the reasons that tetraspanins have been well studied in animals is because they are gateways for the pathogenesis of infectious diseases and are potential targets for therapeutics (Van Spriel & Figdor, 2010; Monk & Partridge, 2011). A fungal tetraspanin PLS1 (PUNCHLESS1) is essential for Magnaporthe grisea and Botrytis cinerea to invade the leaves of their plant hosts, such as rice and tomato (Clergeot et al., 2001; Gourgues et al., 2004). However, PLS1 partner proteins remain to be identified. Tetraspanins interact laterally with other molecules to spin their web, giving rise to tetraspanin-enriched microdomains. Thus, identifying tetraspanin-interacting molecules and determining the composition of tetraspanin-enriched microdomains by protein purification methods or proteomics will provide insights into the pathways in which they function (Le Naour, F. 2006). The tandem affinity purification on γ- secretase interactome, a protein important in Alzheimer disease, revealed its association with tetraspanin-enriched microdomains (Wakabayashi et al., 2009). We investigated the interaction between plant tetraspanins and partner proteins using the CORNET tool which is an interactive database that contains protein-protein interaction information based on predicted and experimental data (De Bodt et al., 2010). CORNET predicted interactions only between TET6-TET8 and TET7-TET9- TET13 (no other interacting protein). A search within the Plant Interactome Database did not show any interaction (Consortium, 2011). Thus tetraspanins are underrepresented in these interactome databases probably because their purification requirements interfered with tetraspanin-enriched microdomains integrity. A recent search for Arabidopsis tetraspanins interacting proteins in “Membrane-based Interactome Network Database” (MIND) yielded interacting proteins for some of tetraspanins, including TET2, TET6, TET8, TET10-TET12 and TET15. Most of the interacting proteins are transporters and enzyme. These data will help to interpret tetraspanins function when combined with functional analysis. Proteomics approaches such as tandem affinity purification are expected to contribute to the
24 Chapter 1
elucidation of tetraspanin interactors and tetraspanin-enriched microdomains (Rohila et al., 2006; Van Leene et al., 2007). In addition, transcriptome analyses of tetraspanin mutants or mutant combinations will identify molecular pathways in which they function and will generate hypotheses that will be further tested by genetic interaction studies. In conclusion, the functional characterization of tetraspanins in plant development is timely, the reverse genetic analysis of the Arabidopsis TETRASPANIN gene family using up-to-date molecular and cell biological tools will result in novel exciting insights into signaling, cell-to-cell communication and patterning mechanisms in plants.
ACKNOWLEDGEMENTS The authors would like to thank Annick Bleys for help in preparing the manuscript and the China Scholarship Council (CSC) for financial support to F.W. K.V. acknowledges the support of Ghent University (Multidisciplinary Research Partnership “Bioinformatics: from nucleotides to networks”).
CHAPTER 2 EMBRYONIC AND VEGETATIVE TETRASPANIN GENE EXPRESSION PATTERNS IDENTIFY FUNCTIONS IN SPECIFIC TISSUES, DOMAINS AND CELL TYPES
Feng Wang1,2, Antonella Muto3, Pia Neyt1,2, Davy Opdenacker1,2, Kristiina Himanen1,2,4, Tom Beeckman1,2 and Mieke Van Lijsebettens1,2
1Department of Plant Systems Biology, VIB, B-9052 Ghent, Belgium 2Department of Plant Biotechnology and Bioinformatics, Ghent University, B-9052 Ghent, Belgium 3Present address: Laboratory of Citofisiologia Vegetale, Department of Ecology, University of Calabria, Cosenza, Italy 4Present address: Department of Agricultural Sciences, University of Helsinki, Finland
This chapter was adapted from manuscript in preparation for submission.
Author contributions: F.W. made the constructs, double mutants, phenotypic analysis and wrote the chapter. F.W., A.M. and P.N. performed genetic analysis and expression analysis. F.W., P.N. and D.O. performed FACS. F.W., K.H., T.B. and M.V.L. designed the experiment. M.V.L. contributed to the writing of the chapter.
26 Chapter 2
ABSTRACT TETRASPANIN (TET) genes encode conserved four membrane proteins in multicellular organisms, they have a function in cell-to-cell communication in morphogenesis, fusion and in response to pathogens in animals. There are seventeen TET genes in the Arabidopsis genome of which only one has been functionally analyzed. pAtTET1-17:: NLS-GFP/GUS reporter lines were constructed, they are a repertoire to analyze spatial and temporal gene expression during plant development, to predict functional divergence or redundancy of duplicated or triplicated genes, and to steer mutational analyses. Several TET genes were expressed in specific domains in globular and heart stage embryos, such as vascular progenitor cells and the hypophysis, or in the progenitor cells of the stomatal cell lineage and in the pericycle at the asymmetric division preceding lateral root initiation. Mutational analysis supported a role for TET13 in promoting lateral root initiation and emergence that might be related to auxin signaling; and a redundant function for the TET5 and TET6 genes in repressing organ growth. Specific TET genes have divergent function in development, repressing or promoting cell fate specification, suggesting that TET proteins are new components involved in cellular communication.
Embryonic and vegetative tetraspanin gene expression patterns identify functions in specific 27 tissues, domains and cell types
2.1 INTRODUCTION During embryogenesis in plants, the fertilized egg cell develops gradually by consecutive, but partially overlapping, processes such as cell division, patterning and growth into the rudimentary body plan of the mature embryo. Early pattern formation generates the apical-basal axis and polarity of the body plan and the radial axis that defines the inner tissue layers of the embryo in which cells interpret their position, acquire cell fate and differentiate into specific morphologies and functions. Upon germination, the shoot and root apical meristem are activated that generate the above-ground vegetative structures and the primary root, respectively (Weigel & Jürgens, 2002; Van Lijsebettens & Van Montagu, 2005). Pattern formation in organs, tissues and neighboring cells and many developmental events such as the formation of new organs and developmental transitions occur throughout the plants life cycle in response to internal or external cues by means of long (phytohormone) and short (ligand-receptor) distance signaling mechanisms, respectively (Sparks et al., 2013). In short distance signaling, cells are competent to perceive and recognize signals from neighboring cells, the apo- or symplastic domain or the environment by means of plasma membrane proteins such as receptor kinases that bind a specific peptide ligand with their conserved extracellular leucine-rich repeat (LRR) domain, resulting in the phosphorylation of their cytoplasmic kinase domain and the activation of a downstream signaling pathway that ultimately alters the activity of a transcription factor in the nucleus to provoke a switch in the developmental program (Van Norman et al., 2011). A well-known example of LRR-mediated signal transduction in Arabidopsis is the patterning and differentiation of epidermal cells into stomatal guard cells. After recognition of the EPIDERMAL PATTERNING FACTOR (EPF) ligand, the LRR receptor kinases ERECTA (ER) and the LRR receptor-like protein, TOO MANY MOUTHS (TMM), activate the downstream YODA/MKK/MPK pathways, which negatively regulate the entry divisions by repressing SPEECHLESS (SPCH) and SCREAM/2 transcription factors (Pillitteri & Torii, 2012). Long distance signaling pathways typically relate to phytohormonal activities that regulate multiple aspects of plant development, amongst which lateral organ (lateral root, leaf, flower) initiation at sites of auxin accumulation. Auxin is synthesized at the shoot apex and transported to the root by the influx and efflux membrane proteins at the vascular tissues (Petrášek & Friml, 2009). Local auxin maxima at the pericycle result in auxin triggered degradation of AUX/IAA and the release of transcription
28 Chapter 2
factors Auxin Response Factors to activate downstream auxin signaling pathway and regulate lateral root development, including lateral root founder cells specification, lateral root initiation (LRI) and emergence (Lavenus et al., 2013). Tetraspanins are well-characterized in animal fields, they are conserved four transmembrane domain-containing proteins that interact via cystein-rich extracellular domains with each other or with proteins such as integrins to form the tetraspanin- enriched microdomains that participate in cell-to-cell communication processes during cell morphogenesis, motility and fusion (Yáñez-Mó et al., 2009). Phylogenetic studies in plants identified seventeen TETRASPANIN genes in the Arabidopsis genome, most of which are duplicated (Cnops et al., 2006; Wang et al., 2012; Boavida et al., 2013). So far, the function of only one plant tetraspanin gene has been analyzed, i.e. the Arabidopsis TETRASPANIN1/TORNADO2/EKEKO (TET1/TRN2) that plays a role in leaf lamina symmetry, venation and root epidermal patterning (Cnops et al., 2000; Cnops et al., 2006), peripheral zone identity of the shoot apical meristem (SAM) (Chiu et al., 2007) and megasporogenesis (Lieber et al., 2011). A number of Arabidopsis tetraspanins are expressed in reproductive tissues and at fertilization and localized at the plasma membrane (Boavida et al., 2013). Meta-analysis of expression, co-expression and protein interaction databases (Genevestigator, CORNET, MIND) provide information on gene function (Zimmermann et al., 2004; De Bodt et al., 2012; Jones et al., 2014). However, experimental research is required to provide information on cellular, domain and tissue specificity; indeed, spatial and temporal gene expression help to predict the functionality of a gene of interest, the redundancy or divergence amongst duplicated genes and direct further mutant analyses. Here, we present promoter TET-reporter expression studies of the entire Arabidopsis tetraspanin gene family in different organs (embryo, root, leaf and flower) during the life cycle that predicted functional divergence of a number of duplicated TET genes. Indeed, single mutants of tet2 and tet13 had defective stomatal spacing and reduced number of lateral roots, respectively, indicating a function of TET2 in early stomatal development and of TET13 in lateral root initiation. The TET5 and TET6 genes, with redundant expression in the vascular tissue, affect leaf growth as shown by the double mutant. We postulate that TET2 and TET13 have a function in developmental processes related to short and long distance signaling, respectively and that TET5 and TET6 have a function in differentiated vascular tissue.
Embryonic and vegetative tetraspanin gene expression patterns identify functions in specific 29 tissues, domains and cell types
2.2 RESULTS 2.2.1 Generation of Promoter TET-reporter Gene Lines and Analysis in Embryo, Root, Leaf and Flower The promoter activity of the TET gene family members was analyzed in organs, tissues, domains and cell types in different developmental stages in order to identify the site of gene function, and to help reveal their role in plant development. The intergenic regions between the TET genes and their upstream neighboring genes, with a maximum length 2000 bp (TET2-TET17) and 3400 bp (TET1), were cloned as promoters in front of a fusion between the GFP (with nuclear localization signal, NLS) and GUS reporter genes and transformed into Arabidopsis using floral dip. TET promoter activities were systematically investigated in at least three T2 pAtTET:: NLS-GFP/GUS lines with a single-locus insertion per construct by X-Gluc histochemical staining and were widely detected in embryo, root, leaf and flower organs throughout development rather than only in reproductive tissues (Boavida et al., 2013). The promoter activity patterns were comparable with meta-analysis data based on microarrays in Genevestigator and the electronic Fluorescent Pictograph (eFP) browser (Zimmermann et al., 2004; Winter et al., 2007), but allowed to distinguish TET gene expression at the tissue, domain and cell type level. In the early embryonic stages, from globular to heart stage, apical-basal body patterning and radial patterning into protoderm, cortex and vascular progenitor tissue layers occur. Nine TET genes, i.e. TET1, TET3, TET4, TET5, TET8, TET10, TET13, TET14 and TET15, were expressed in specific domains starting at the globular or heart stage till the mature stage, of which TET1, TET8 and TET14 gene expression occurred in specific progenitor tissue at the onset of patterning in the heart stage (Figure 1). TET1, TET4, TET5, TET10 and TET14 in vascular progenitor tissue (Figure 1). It suggested a potential role for a number of TET genes in cell fate specification. After germination, the expression of a number of TET genes, i.e. TET1, TET5, TET6, TET9 and TET14, remained in the vascular tissue of primary root and rosette leaves (Figure 2, Figure 3). TET13 with early expression in the hypophysis of the embryo was restricted to the quiescent center stem cells (QC) of the primary root, and lateral root primordia (LRP) (Figure 2), and TET3 with early expression in the apical domain of the embryo remained active in the shoot apical meristems of seedlings (Figure 3). Remarkably, TET9 was expressed in the SAM after germination (Figure 3).
30 Chapter 2
In the flower, TET1 & TET2, TET3 & TET4, TET7 & TET8 & TET9, TET10, TET11, TET13 & TET14 & TET15, TET16 were expressed in pollen (Supplemental Figure 1), indicating their role in reproductive processes, most likely in a redundant manner. Interestingly, TET15 was the only one that was active in the pollen tubes (Supplemental Figure 1). Hence, the TET promoters were active in different organs throughout development as summarized in Figure 3. However, their promoter activities were not constitutive, but specific to tissues, domains or cells within specific organs, suggesting a large range of functions in a large number of developmental pathways.
Embryonic and vegetative tetraspanin gene expression patterns identify functions in specific 31 tissues, domains and cell types
32 Chapter 2
Figure 1. TET promoter activities during embryogenesis. Transgenic plants shown are: pAtTET1:: NLS-GFP/GUS, pAtTET3:: NLS-GFP/GUS, pAtTET4:: NLS- GFP/GUS, pAtTET5:: NLS-GFP/GUS, pAtTET8:: NLS-GFP/GUS, pAtTET10:: NLS- GFP/GUS, pAtTET13:: NLS-GFP/GUS, pAtTET14:: NLS-GFP/GUS, and pAtTET15:: NLS-GFP/GUS. Columns represent consecutive developmental stages: globular, heart, torpedo and mature. The dotted lines delineate the outlines of the young embryos. Arrows in TET1, TET3 and TET14 panels indicate the promoter activity sites. Scale bars represent 0.01 mm (globular, heart and torpedo stages), 0.1 mm (mature embryo).
Embryonic and vegetative tetraspanin gene expression patterns identify functions in specific 33 tissues, domains and cell types
Figure 2. TET promoter activities in the primary root. Transgenic plants shown are: pAtTET1:: NLS-GFP/GUS (a), pAtTET3:: NLS-GFP/GUS (b), pAtTET4:: NLS-GFP/GUS (c), pAtTET5:: NLS-GFP/GUS (d and e), pAtTET6:: NLS-GFP/GUS (e and f), pAtTET8:: NLS-GFP/GUS (g), pAtTET9:: NLS-GFP/GUS (h), pAtTET10:: NLS-GFP/GUS (i), pAtTET12:: NLS-GFP/GUS (j),
34 Chapter 2
pAtTET13:: NLS-GFP/GUS (k), and pAtTET15:: NLS-GFP/GUS (l). From top row to bottom row are: root-hypocotyl transition zone, differentiation zone, meristem-elongation transition zone, meristem. E shows transverse section of transition zone and differentiation zone as indicated by the dash line in (d) and (f). ep: epidermis; c: cortex; e: endodermis; p: pericycle. Arrowheads and arrows indicate phloem pole and protoxylem, respectively. Scale bars represent 0.1 mm (a-d, f-l), 0.01 mm (e).
Embryonic and vegetative tetraspanin gene expression patterns identify functions in specific tissues, domains and cell types 35
Figure 3. TET promoter activities in shoot tissues and schematic overview of the promoter activity of the Arabidopsis TETRASPANIN gene family members. (a) TET promoter activities in vascular tissue (14-d-old), SAM and young leaf primordia (6-d-old). Transgenic plants shown are: pAtTET1:: NLS-GFP/GUS, pAtTET5:: NLS-GFP/GUS, pAtTET6:: NLS-GFP/GUS, pAtTET9:: NLS-GFP/GUS,
36 Chapter 2
and pAtTET14:: NLS-GFP/GUS. The inset shows TET9 expression in the trichome. SAM, shoot apical meristem. (b) TET3 expression in the SAM and protein localization. p, primorida. Transgenic plants shown are pAtTET3:: NLS-GFP/GUS, and 35S:TET3:GFP. The asterisk and arrows indicate the TET3 expression in layer 3 and the protein localization at plasmodesmata, respectively. (c) TET promoter activities in other tissues/cells of the shoot tissues. Transgenic plants shown are: pAtTET2:: NLS-GFP/GUS, pAtTET4:: NLS-GFP/GUS, pAtTET8:: NLS-GFP/GUS, and pAtTET12:: NLS-GFP/GUS. Arrowheads and arrows indicate the stipules and hydathodes, respectively. The inset shows TET12 expression in stipules. (d) Schematic overview of the promoter activities in different organs. Duplicated gene pairs are indicated with square brackets (The length of the square brackets does not represent the evolutionary distance). E: embryo; R: root; C: cotyledon; L: rosette leaf; F: flower; se: sepal; pe: petal; st: stamen; ca: carpel. Scale bars represent 1 mm (a, rosette and leaf), 0.1 mm (a, SAM), 5 µm (b).
2.2.2 Most Duplicated TET Genes Have Divergent Expression Patterns in Embryonic and Vegetative Development According to phylogenetic studies, TET1 & TET2, TET3 & TET4, TET5 & TET6, TET7 & TET8 & TET9, TET11 & TET12, TET16 & TET17 are duplicated genes (Cnops et al., 2006; Wang et al., 2012). TET13 either belongs to a clade together with TET14 and TET15 (Wang et al., 2012), or is classified as a single clade (Boavida et al., 2013). The promoter activity patterns were compared between the duplicated genes and the majority of gene pairs had diverged patterns in most organs, as described below. The TET1 and TET2 duplicated genes had divergent gene expression. Indeed, TET1 showed asymmetric gene expression pattern in vascular tissue precursor cells in the embryo (Figure 1). In the primary root, TET1 was predominantly expressed in the columella cells and at the vascular tissues starting from the elongation zone but not throughout the whole root (Figure 2), in the vascular tissue of cotyledons and leaves (Figure 3) and in the stigma and transmitting tissue (Supplemental Figure 1). Indeed, tet1 mutants had distinct patterning phenotypes in the root and leaves (Cnops et al., 2000; Cnops et al., 2006) and defects in the SAM (Chiu et al., 2007) and embryo development (Lieber et al., 2011), and was sterile when homozygous. Interestingly,
Embryonic and vegetative tetraspanin gene expression patterns identify functions in specific tissues, domains and cell types 37
TET2 was expressed in meristemoids, GMCs and mature guard cells (Figure 3), suggesting a function in stomatal development. TET3 was expressed and restricted to the SAM precursor cells during the embryogenesis (Figure 1) and at the organizing center in layer three of the SAM after germination (Figure 3), which is comparable to the expression pattern of the gene encoding the transcription factor WUSCHEL (WUS) (Schoof et al., 2000; Tucker et al., 2008). The TET3 protein had previously been identified from the Arabidopsis Plasmodesmal Proteome (Fernandez-Calvino et al., 2011). Indeed, we observed TET3-GFP fusion protein movement along and toward the plasma membrane and localization at the plasmodesmata (Figure 3; the movie is not shown). In the primary root, TET3 was expressed in the cortex, endodermis and pericycle at the differentiation zone and the transition zone between the primary root and the hypocotyl (Figure 2). Its duplicated gene, TET4, was expressed in root vascular tissue progenitor cells during embryonic development (Figure 1). In the primary root, the promoter activity was found in QC cells, and at the endodermis, pericycles and vascular tissues of the entire root meristem (Figure 2). TET4 was also expressed in mature stomatal guard cells at the cotyledons (Figure 3). In the flower, it was expressed at the basal region and in the mature stomatal guard cells of the anther (Supplemental Figure 1). Hence, the duplicated genes TET3 and TET4 had divergent expression patterns. The triplicated genes, TET7, TET8 and TET9, showed distinct promoter activities. TET7 was only expressed in the pollen (Supplemental Figure 1). During embryonic development, TET8 was expressed at the apical domain from the heart stage on (Figure 1). In the primary root, TET8 promoter was active in all cell layers at the differentiation zone until the transition zone between the root and the hypocotyl (Figure 2). In the rosette leaves, it was specifically active in stipules and hydathodes (Figure 3). TET9 promoter activity was restricted to the vascular tissues starting from the elongation zone in the primary root (Figure 2), cotyledons and rosette leaves (Figure 3). TET9 was also expressed at the SAM (Figure 3). Moreover, TET9 promoter was specifically active in trichomes (Figure 3). Hence, the different patterns of TET7, TET8 and TET9 promoter activity suggested diverged functions in vegetative development. TET11 was expressed in the pollen (Supplemental Figure 1), whereas TET12 in the primary root and stipules (Figure 2, Figure 3), suggesting a thoroughly diverged
38 Chapter 2
function. The triplicated genes TET13, TET14 and TET15 also showed mainly diverged expression patterns. Interestingly, the promoter activity patterns in primary root and vascular tissues were established early during the embryonic development. From the globular stage on, TET13 promoter activity was detected at the embryonal hypophysis which is the progenitor of the QC and the columella cells (Figure 1， Figure 2). Indeed, after germination in the primary root, it was active in QC cells, stem cells, the first two columella cell layers and the LRP (Figure 2). TET14 promoter activity was restricted to a few cells at both sides of the apical-basal axis at heart- stage embryos, in the vascular precursor cell strands of the cotyledon of later embryonic stages, and in the cotyledonary vascular tissues of the mature embryo (Figure 1). The promoter activity was rarely detected in the root of the mature embryo and completely undetectable in the hypocotyl or root after germination. TET15 promoter activity was found at the basal domain of the heart stage embryo (Figure 1). In the primary root, TET15 was expressed in the LR cap and columella cells (Figure 2). Additionally, TET15 was expressed in the pollen tubes and mature stomatal guard cells of sepals (Supplemental Figure 1). All three gene expression patterns were established early during the embryogenesis and their expression was sustained in seedlings, suggesting a role in determining cell fate and controlling tissue and/or organ growth. TET16 was only expressed in the pollen and the basal region of the flower (Supplemental Figure 1), while no TET17 gene expression was detected in any of the organs, which was consistent with the absence of gene expression in transcriptome data of Genevestigator or the eFP browser throughout development. However, the promoter of TET17 was reported to be active in mature pollen by using triple nuclear- localized GFP protein (Boavida et al., 2013), which may provide better sensitivity. In summary, the diverged expression patterns in many particular developmental stages or in specific tissues, domains or cells suggest that single TET gene mutants might reveal their function. Notably, a number of TETs that belong to different clades have overlapping expression patterns, i.e. during embryogenesis, in the root apical meristem, vascular tissues and pollen et al (Figure 1, Figure 2, Figure 3, Supplemental Figure 1), suggesting that combinations of TET gene mutations would be required to reveal the function of TET genes in the respective domains and tissues.
Embryonic and vegetative tetraspanin gene expression patterns identify functions in specific tissues, domains and cell types 39
2.2.3 TET5 and TET6 Redundant Genes Have a Function in Growth Control Among all duplicated gene pairs, only TET5 and TET6 shared exactly the same expression pattern in all organs, tissues and cell types except for the embryos, in which TET5 was expressed in contrast to TET6 (Figure 1). At the globular stage, TET5 expression was restricted to a few cells in the center of the embryo, i.e. vascular tissue precursor cells (Figure 1), a pattern which is quite similar to that of the genes encoding a bHLH transcription factor TMO5 and its interactor LHW (De Rybel et al., 2013). After germination, both of them were expressed in the pericycle, the vascular tissues of the primary root starting from the transition zone, the hypocotyl, cotyledons and rosette leaves (Figure 2, Figure 3). Transverse sections of the primary root showed that at the meristem-elongation transition zone TET5 and TET6 were expressed in the phloem, a few procambial cells surrounding the phloem and the phloem-pole pericycle but not in the xylem (Figure 2). At the differentiation zone, they were expressed in the pericycle and all the vascular tissues except for the protoxylem (Figure 2). In the siliques, they were expressed in the funiculus that has a function in guiding the pollen tube to reach the micropyle during fertilization (Supplemental Figure 1). The redundant promoter activity patterns suggested redundant functions between TET5 and TET6. Indeed, no morphological alterations or patterning defects were observed in the roots, leaves or inflorescences of four T- DNA insertion single mutant alleles, tet5-1 (GABI-Kat: 290A02, promoter, knock- down), tet5-2 (SALK_148216, first exon, knock-out; Boavida et al., 2013), tet5-3 (SALK_020009C, second exon, knock-out) and tet6-2 (SALK_139305, promoter, knock-down) (Figure 4). Morphological analysis of three different double mutant combinations: tet6-2tet5-1, tet5-2tet6-2, tet5-3tet6-2, revealed synergistic phenotypes, such as an enlarged leaf size in seedlings at all stages of rosette development due to a significantly increased total number of cells per leaf (23238 ± sd 2967 in tet5-3tet6-2, 15495 ± sd 1635 in tet5-3 and 15197 ± sd 2887 in tet6-2) (Figure 4, Supplemental Figure 2), increased fresh weight in 21-d-old seedlings (Figure 4, Supplemental Figure 2), longer primary roots in a root growth kinetic study (Figure 4, Supplemental Figure 2), suggesting redundant functions of TET5 and TET6 in root and leaf growth. The increased organ growth in tet5tet6 double mutants and the expression of TET5 and TET6 solely in differentiated vascular tissue suggest a role in vascular cell activity such as in nutrient and photoassimilates transport
40 Chapter 2
through the phloem.
Figure 4. tet5-3tet6-2 double mutant phenotypes. (a) TET5 and TET6 scheme and T-DNA insertion. The bold, thin and breaking lines indicate exons, introns and promoter, respectively. (b) Relative TET5 and TET6 transcript level in 7-d-old seedlings measured by qRT-PCR ± sd. TET6 is up-regulated in tet6-1, thus it was not used in the double mutant analysis. (c) Rosette and leaf series of 21-d-old seedlings. From left to right were leaf 1 to leaf 8, incisions were made to make the leaves fully expanded when necessary. (d) Quantification of rosette leaf size in (c). Means are presented ± sd (n=8-10). (e) Total number of cells per leaf. Leaf 1 and/or 2 were used. Means are presented ± sd (n=3). (f) Fresh weight of 21-d-old seedlings. Only
Embryonic and vegetative tetraspanin gene expression patterns identify functions in specific tissues, domains and cell types 41
the green tissue, but not the root, was used for the experiment. (g) Primary root growth kinetics. Means are presented ± sd (n=31-39). t-test was compared between the double mutants, parental lines and wild type. Asterisks in all the graphs mark significant differences: *p < 0.05, **p < 0.01 and ***p < 0.001.
2.3.4 TET2 in Stomatal Development and Function TET2 expression was specific to stomatal guard cells and their precursor cells (Figure 5). Stomatal development involves different processes, including cell fate specification, asymmetric division, symmetric division and differentiation (Bergmann & Sack, 2007; Pillitteri & Torii, 2012). Promoter activity at certain cell types in those processes predict a role in a specific stage of stomatal development. Thus, the earliest stage of TET2 promoter activity in stomatal development was determined and the mutant phenotype was studied to understand its gene function. During stomatal development processes, the protodermal cells somehow are selected and converted into meristemoid mother cells (MMCs) (Figure 5). MMCs undergo an asymmetric entry division to create two daughter cells that have different cell fates: a small triangle-shaped daughter cell, called meristemoid, and a large neighboring daughter cell, called stomatal linage ground cell (SLGC) (Figure 5). The meristemoid is converted into a guard mother cell (GMC) either immediately after the entry division or after limited asymmetric divisions. Every asymmetric division generates a meristemoid and an SLGC (Figure 5). The SLGC can differentiate into a jigsaw puzzle-shaped pavement cell or become a MMC and undergo the asymmetric spacing division to produce a satellite meristemoid, which is often positioned far away from the preexisting meristemoid and/or stoma (Figure 5) (Bergmann & Sack, 2007; Pillitteri & Torii, 2012). TET2 promoter activity was not detected in the MMC, but it was in the stomatal meristemoid, the GMC and mature guard cells (Figure 5). The earliest stage of TET2 expression was in the meristemoid created after the entry division (Figure 5), and it remained active in the meristemoids generated after the second and the third asymmetric division (Figure 5). After each asymmetric division, TET2 expression was only restricted to the meristemoid with division activity but not to the large daughter cell that will often differentiate into the pavement cell, indicating that TET2 might have a function in regulating the meristemoid cell fate. Subsequently, TET2 mutational analysis focused on phenotypes in stomatal
42 Chapter 2
development and morphology. The tet2-1 mutant (GABI-Kat: 967G02), with a transfer DNA (T-DNA) insertion in the second intron of the gene (Figure 6), had a severe down-regulation of TET2 transcription (Figure 6) and was studied for its vegetative morphology and stomatal development. Rosette leaf shape and size were altered in tet2-1 (Figure 6), the rosette area of 4-week-old seedlings was significantly reduced (28.6 ± sd 3.4 cm2 in wild type and 18.8 ± sd 2.5 cm2 in tet2-1, p<0.001) because of a reduced area in each leaf except for leaf 1 and 2 (Figure 6). The leaf size determined by the total number of cells and the cell area, and other cellular parameters were measured in leaf 6. The total number of cells was not significantly reduced (139985 ± sd 33459 in tet2-1 and 165394 ± sd 22112 in wild type), whereas the cell area was significantly reduced (1689 ± se 48 µm2 in tet2-1 and 2064 ± 69 µm2 in wild type, p<0.05). The stomatal density, defined as the number of stomata per square milimeter, was significantly increased from 169 ± sd 20 per mm2 in wild type to 218 ± sd 20 per mm2 in tet2-1 (Figure 6). Additionally, the epidermal cell density was also significantly increased from 337 ± sd 54 per mm2 in wild type to 490 ± sd 67 per mm2 in tet2-1 (Figure 6). However, the stomatal index (the ratio of the number of stomata in a given area divided by the total number of stomata and other epidermal cells in the same area) was not significantly changed (31.0 ± sd 1.5% in wild type and 30.9 ± sd 1.2% in tet2-1) (Figure 6), indicating that the number of asymmetric divisions is not altered, and that most of the meristemoids still undergo one or two additional asymmetric divisions to generate epidermal cells before differentiating into GMCs. Thus, the increase of stomatal density can be explained by the reduction of epidermal cell size and as a result, more stomata are present in the given area. The stomata are not clustered in tet2-1 as opposed to tmm, indicating that the one-cell spacing patterning is not altered and the satellite meristemoids are not misoriented. Moreover, the guard cells are normally differentiated in tet2-1. The TET2-GFP fusion protein colocalized with the membrane marker FM4-64 at the plasma membrane of the meristemoid, the SLGC and guard cells of cotyledons (Figure 6). By taking advantage of the root as confocal imaging experimental system, we observed that TET2 was also localized in vesicles (Figure 6), suggesting a putative recycling and/or trafficking through endocytosis inhibiting the entry division and amplifying division.
Embryonic and vegetative tetraspanin gene expression patterns identify functions in specific tissues, domains and cell types 43
Figure 5. Diagram of Arabidopsis stomatal development (left) and the respective TET2 expression at the abaxial epidermis of 6-d-old cotyledons (right). Transgenic plant shown is pAtTET2:: NLS-GFP/GUS (a-e). (a) TET2 expression in the meristemoid after entry division. (b, c) TET2 expression in the meristemoid after one or two additional asymmetric divisions. The arrow indicates the meristemoid. (d, e) TET2 expression in GMC and mature guard cells, respectively. Cells in different colors are: MMC, grey; meristemoid, blue; SLGC, white; GMC, red; guard cells, green; pavement cell, light green. Scale bars represent 10 µm.
44 Chapter 2
Figure 6. tet2-1 phenotypes and protein localization. (a) TET2 scheme and T- DNA insertion. The bold lines indicate exons and the thin lines introns. (b) Relative TET2 transcript level in inflorescence tissues measured by qRT-PCR ± sd. (c) 22-d- old wild-type and tet2-1 plants. (d) Rosette leaf series of 27-d-old wild-type and tet2-1 plants. From left to right were leaf 1 to leaf 12, incisions were made to make the leaves fully expanded when necessary. (e) Quantification of rosette leaf size in (c). Means are presented ± sd (n=10-14). Asterisks in all the graphs mark significant differences: *p < 0.05, **p < 0.01 and ***p < 0.001. (f) Stomatal density, epidermal cell density and stomatal index of leaf 6 in (c). Means are presented ± sd (n=9). (g) Drawing of epidermal cells and stomata on the abaxial side of leaf 6 in (c). The
Embryonic and vegetative tetraspanin gene expression patterns identify functions in specific tissues, domains and cell types 45
images were obtained from the leaves that were drawn with a microscope equipped with a drawing tube (see Experimental Procedures). (h) TET2-GFP localization at the plasma membrane in the cotyledon. Left panel, TET2-GFP; middle panel, FM4-64; right panel, merged. M, meristemoid; SLGC, stomatal-lineage ground cell; GC, guard cell. (i) TET2 protein localization at the plasma membrane and in vesicles in the root. Arrowheads indicate the same vesicle. Scale bars represent 5 µm.
2.3.5 TET13 Has a Function in Primary and Lateral Root Development TET13 promoter activity was observed only in a few cells in the primary root meristem, upon LR initiation and in the LRP (Figure 7); hence, it was studied more in detail during these processes and the corresponding mutant was used to study primary and lateral root development. Arabidopsis root identity is early specified during embryogenesis. The cells at the basal region of the globular embryo will give rise to the hypocotyl, primary root and root stem cells. The lens-shaped cells at this region are the progenitors of the QC, which is crucial for maintaining root stem cells identity (van den Berg et al., 1997). In wild-type plants, the stem cells surrounding the QC are maintained in the undifferentiated state. During root growth, LRs are generated from the primary root, which starts with an auxin oscillation at the pericycle cells in a zone designated as the root basal meristem (De Smet et al., 2007). Consequently, these pericycle cells are selected as LR founder cells that acquire an asymmetric division activity (De Rybel et al., 2010). After the anticlinal asymmetric divisions, a single-layered primordium composed of small daughter cells flanked by two large daughter cells is formed, termed stage I (Figure 7). From stage II to VII, the anticlinal and periclinal divisions occur sequentially to form the dome-shaped primordium with two to seven layers of cells (Figure 7). At stage VIII, the LR finally emerges from the primary root (Figure 7) (Malamy & Benfey, 1997). In the primary root, TET13 was predominately detected in the QC, most of the stem cells (cortex/endodermis initials, pericycle initials, vascular tissue initials and columella initials, but not epidermis initials), the first two columella cell layers and the two middle cells in the root cap (Figure 7). Very weak expression as observed at the first one or two pericycle cells above the pericycle initials and the remaining columella cells (Figure 7). TET13 promoter activity was equally present at the two QC cells (35 seedlings were checked), in
46 Chapter 2
contrast to the key regulator of QC cell division, ERF115, the activity of which was found only in the mitotically active QC cells (Heyman et al., 2013). This indicated that TET13 expression is not cell-cycle regulated. During LR development, TET13 was active at the two neighboring pericycle cells before the asymmetric division (Figure 7). At stage I, the expression was stronger in the newly generated two small daughter cells (Figure 7). At stage II, the expression was equally strong in the tip cells at the outer layer (OL) as well as in the middle two cells at the inner layer (IL) (Figure 7). From stage III on, the expression was always stronger in the tip cells at the OL (Figure 7). When the LR was formed, the expression was at the QC and columella (Figure 7). TET13 expression value is 13.0 ± sd 0.0 at the QC when checked in the high-resolution root spatiotemporal map dataset (Brady et al., 2007), although not as high as AGL42 (AGAMOUS-LIKE 42, 59.84 ± sd 0.0) which was used as marker for fluorescence activated cell sorting. The function of TET13 in primary and LR development was studied in the T-DNA insertion line tet13-1 (SALK_011012C) in which the T-DNA is located at the first exon, resulting in a gene knock-out (Boavida et al., 2013). The primary root length was significantly reduced in tet13-1 (8.2 ± sd 1.0 cm in wild type and 6.1 ± sd 1.4 cm in tet13-1) (Figure 8). The primary root length is determined by several parameters such as meristem, elongation zone and differentiation zone size, and cell length at these zones. The meristem size, defined as the number of cells from the QC to the first elongated cell in the cortex cell file (Casamitjana-Martínez et al., 2003) was significantly reduced in tet13-1 (27 sd 3 cells) as compared to the wild type (34 4 cells) (Figure 8). Below the QC, there are one or two layers of undifferentiated columella initials that generate the differentiated columella cells containing starch that stains purple by Lugol solution. One of the functions of the QC is to keep the surrounding initials in an undifferentiated state, defective QC function resulted in a differentiated cell layer below the QC instead of the columella initial cell layer as observed in wox5 mutants (Sarkar et al., 2007). Exogenous auxin (1- naphthaleneacetic acid, NAA) or auxin transport inhibitor (N-1-naphthylphthalamic acid, NPA) promoted the differentiation of columella initial cells in wild-type seedlings, but not in mutants in auxin biosynthesis or transport (Ding & Friml, 2010). In tet13-1 mutants, one or two columella initials cell layers were measured in primary roots comparable to the wild type and no precocious differentiation of the columella initials was observed (Supplemental Figure 3), hence, columella initial cell identity was
Embryonic and vegetative tetraspanin gene expression patterns identify functions in specific tissues, domains and cell types 47
maintained in the tet13-1 mutant under normal conditions and after NAA and NPA treatment (Supplemental Figure 3). The architecture of the QC and initials was normal in the tet13-1 mutant as visualized by confocal microscopy with propidium iodide staining (Supplemental Figure 3), indicating no function of TET13 in cytokinesis. tet13-1 seedlings were equally insensitive as wild-type seedlings to hydroxyurea, a replication-blocking agent, because no dead cells were observed after propidium iodide staining (Supplemental Figure 3). Lateral root initiation stages and LR emergence were analyzed in tet13-1 mutants: stage-I LRPs were severely reduced (Figure 8), which correlated with early TET13 expression in the lateral root founder cells before the first asymmetric division (Figure 7); stage IV, V and VI were significantly increased whereas stage II, III and VII were slightly increased (Figure 8); the emerged LR density was significantly reduced (Figure 8). The LR density, defined as the number of LRP and emerged LRs per centimetre primary root, was significantly reduced (Figure 8), showing that TET13 has a role in promoting both LR initiation and LR emergence. In an assay for synchronous LRI, seedlings were first incubated on medium containing the auxin transport inhibitor NPA, then transferred to NAA medium after which synchronous LRI was monitored (Himanen et al., 2002). The TET13 promoter activity was induced after 2 h of NAA induction at the xylem pole of the pericycle, which coincides with the onset of LRI (Figure 8); after 3 h NAA induction, two clear blue lines marked the pericycle (Figure 8), indicating that TET13 expression is auxin inducible and specific for pericycle cells. The DR5:: GUS reporter gene was expressed at sites of auxin accumulation such as the QC and columella in the primary root and in the lateral root founder cells at the root basal meristem (Figure 8). In the tet13-1 mutant, the DR5:: GUS reporter gene was not or very weakly expressed at the basal meristem in eight out of thirteen tested seedlings (Figure 8), indicating that auxin accumulation in the lateral root founder cells is affected. Three high expression lines of P35S:TET13 were very similar to the control line with respect to primary root length, root meristem size and emerged lateral root density, no significant differences were observed (Supplemental Figure 4). This could be due to the stoichiometric interaction between tetraspanins and their interacting proteins (Yauch et al., 1998).
48 Chapter 2
Figure 7. TET13 promoter activities in the primary root and LRP. Transgenic plant shown is pAtTET13:: NLS-GFP/GUS (a-m). (a) Overview of part of the primary root. The expression pattern in the black square is magnified in (d). Asterisks in the inset indicate the LRP. (b) TET13 promoter activity visualized by the X-Gluc staining in the primary root tip. (c) Confocal image of TET13::NLS-GFP in the primary root tip. The root is counterstained with propidium iodide. (d-m) Detailed expression analysis of TET13 at different stages during LR development. Corresponding developmental stages I-VII and EM are indicated in the top right corner. IL and OL: inner and outer layers; ep: epidermis; c: cortex; en: endodermis; p: pericycle. Arrowheads indicate the division planes. The inset in (h) shows the top view of stage IV. Scale bars represent 0.1 mm (a and the inset), 10 µm (b-m).
Embryonic and vegetative tetraspanin gene expression patterns identify functions in specific tissues, domains and cell types 49
Figure 8. tet13-1 root phenotypes and NAA induced promoter activity. (a) tet13- 1 scheme, 12-d-old seedlings of Col-0 and tet13-1 growing vertically under 24-h light condition. (b) Primary root growth kinetics. Means are presented ± sd (n=35-42). (c, d) Root meristem size of 6-d-old seedlings. Means are presented ± sd (n=28-39). Arrows indicate the boundary between the root meristem and the transition zone. (e) Staging of LRP densities of 11-d-old seedlings. EMLR, emerged lateral root. Means are presented ± sd (n=20). Asterisks in all the graphs mark significant differences: *p < 0.05, **p < 0.01 and ***p < 0.001. (f-k) NAA induced TET13 promoter activity. The seedlings were grown on 10 µM NPA medium for 72 hours after germination and then
50 Chapter 2
transferred to 10 µM NAA medium. (l, m) DR5:: GUS expression patterns at the root basal meristem in 7-d-old wild-type and tet13-1 seedlings. Scale bars represent 0.1 mm (c, l, m), 0.5 mm (f-k). Transgenic plants shown are: DR5:: GUS (f-h, l), pAtTET13:: NLS-GFP/GUS (i-k) and tet13-1 x DR5:: GUS (m).
2.3.6 Fluorescence Activated Cell Sorting of Synchronized tet13-1 Lateral Root Founder Cells for RNA-Seq To identify downstream LR initiation signaling pathway controlled by TET13, we decided to carry out transcriptomic analysis in tet13-1 with RNA-Seq. However, TET13 transcript level is very low in the total RNA of primary root. To enrich for the transcriptional changes during LR initiation, the lateral root founder cells were isolated from primary roots by using synchronized lateral root induction (SLRI) system and fluorescence activated cell sorting approach (FACS) (Himanen et al., 2002; De Smet et al., 2008). In short, tet13-1 (Col-0 background) was crossed with pAtTET13:: NLS-GFP/GUS (Col-0 background). The pedigree was checked in the F2 generation by genotyping PCR and fluorescence stereomicroscopy, respectively, tet13-1 was homozygous and pAtTET13:: NLS-GFP/GUS was heterozygous. The F3 generation seeds were germinated on half MS medium containing 10 µM NPA for 72 h to inhibit auxin transport and LR initiation. Afterwards the seedlings were transferred onto half MS medium containing 10 µM NAA to synchronize LR initiation. TET13 promoter activity was induced after 2 h NAA treatment (Figure 9), which is the time point that the nuclei start to move to the common cell wall. Regarding the LR initiation, the promoter activity was restricted to the xylem pole pericycle cells in tet13-1xpAtTET13:: NLS-GFP/GUS seedlings which was the same as that in the control pAtTET13:: NLS-GFP/GUS seedlings (Figure 9). The promoter was also active in the root meristem (Supplemental Figure 5). According to the SLRI system, 3 h and 4 h treatments are the time points that the nuclei reach the common cell wall and prepare for the asymmetric division (G1 and G1/S transition stage). 6 h treatment is the asymmetric division onset point (G2/M transition stage). After 12 h, stage I is accomplished (Himanen et al., 2002; Vanneste et al., 2005). Since the promoter activity was relative weaker after 2 h treatment, 3 h treatment was chosen as the first time point for the RNA-Seq experiment. To have sufficient transcriptional changes, 8 h treatment was chosen as the second time point
Embryonic and vegetative tetraspanin gene expression patterns identify functions in specific tissues, domains and cell types 51
instead of 6 h. The setup of RNA-Seq was summarized in Supplemental Figure 6. To evaluate the capacity of NLS-GFP for FACS, pAtTET13:: NLS-GFP/GUS was compared in a pilot experiment with J0121, which is a Haseloff GAL4-GFP enhancer trap line with cytoplasmic GFP expression specific in xylem pole pericycle cells and has been proved to be suitable for FACS (Laplaze et al., 2005; De Smet et al., 2008). After protoplasting, the GFP was maintained in both pAtTET13:: NLS-GFP/GUS and J0121 cells (Figure 10). Approximately 10000 to 20000 GFP positive cells were sorted and yielded a total of ~100 ng RNA with good quality as measured by Pico analysis (data not shown). To conclude, pAtTET13:: NLS-GFP/GUS and tet13- 1xpAtTET13:: NLS-GFP/GUS are suitable for SLRI, FACS and RNA-Seq experiments. At the moment the thesis is being revised, RNA-Seq experiment is in process in VIB Nucleomics Core.
Figure 9. NAA induced TET13 promoter activity. Top panel, pAtTET13:: NLS- GFP/GUS. Bottom panel, tet13-1xpAtTET13:: NLS-GFP/GUS.
52 Chapter 2
Figure 10. GFP visualization after protoplasting. (a, b) 3 h and 8 h NAA treated J0121 samples after protoplasting. (c, d) 3 h and 8 h NAA treated pAtTET13:: NLS- GFP/GUS samples after protoplasting. Arrows indicate GFP positive cells.
2.3 DISCUSSION Arabidopsis TETRASPANIN genes are expressed in different organs/tissues and cell types during embryonic and vegetative development. Intriguingly, the onset of expression coincided with the onset of patterning and cell specification at globular or heart stage embryos (TET1, TET3, TET4, TET5, TET8, TET10, TET13, TET14 and TET15) and in seedlings at the initiation of the stomatal cell lineage (TET2), or at the asymmetric division in the primary root pericycle upon lateral root initiation (TET13), which suggests a role for these TET genes in cell specification. Plant cells are surrounded by a rigid but dynamic cell wall which prevents them from migration during specification, hence they acquire their fate by positional information from neighboring cells. The cellular communication involves diffusible or actively transported molecules such as peptides, small RNAs, transcription factors or phytohormones, that upon recognition by competent cells trigger signaling cascades that result in the initiation or repression of specific developmental programs (Sparks et al., 2013). TET2 is expressed in the meristemoids and stomatal density is increased in tet2-1, however, the stomatal index is not altered in tet2-1, indicating that the asymmetric division and cell spacing is not affected. The increase of stomatal density could be a
Embryonic and vegetative tetraspanin gene expression patterns identify functions in specific tissues, domains and cell types 53
consequence of reduced epidermal cell size, thereby, more stomata are found in a given area. TET2 is expressed in the mature stomatal guard cells, while the morphology is not changed, suggesting TET2 might have a role in stomatal function, i.e. stomatal closure, which controls gas and water vapour exchange, and the phenotypes described in tet2-1 are indirect effects of stomatal function. A test of stomatal aperture under ABA, cold and drought condition would verify this hypothesis. Several receptor-ligand pairs, such as EPF2-ER, EPF1-ERL1 or TMM control the entry and amplifying divisions during stomatal development by signaling to the SPCH transcription factor (Pillitteri & Torii, 2012). TET2, which is located at the plasma membrane and in vesicles, could facilitate one of these receptor-ligand complexes to negatively regulate stomatal development. EPF1 and EPF2 have similar expression patterns and their mutants, especially epf2, have a similar stomatal phenotype as tet2-1, such as an increased stomatal density (Hara et al., 2009). Whether the early expression of TET2 in meristemoid is related to a function in differentiated guard cells is doubtful, it would rather indicate an early function in stomatal development which might be investigated in the future. TET13 expression in the lateral root founder cells and the gradual spatial pattern in the LRP resembles the auxin reporter gene DR5:: GUS at the LRP tip cells, in which auxin reaches a maximum level and regulates LR development (Benková et al., 2003). The significant reduction of stage-I LRP density in tet13-1 indicates that the initiation of the LR is affected and TET13 is required to promote LR initiation. This nicely correlates with the promoter activity at the two lateral root founder cells before the asymmetric divisions and the early inducible expression by NAA. The reduced LRI and emergence in the tet13-1 line and the defective auxin distribution in the lateral root founder cells at the basal meristem, as shown by the DR5::GUS reporter gene analysis, suggest that TET13 has a function in auxin local distribution or being a downstream target of auxin signaling rather than long distance signaling, i.e. transport from shoot to root (Sparks et al., 2013). The emerged LR density is significantly reduced. However, stage-II to -VII LRP densities are significantly increased, indicating that the emergence of the LR is somehow affected in tet13-1, which is highly regulated by the transcellular auxin-dependent signaling pathway that results in cell wall remodelling in the adjacent endodermal, cortical and epidermal cells overlaying the primordium (Swarup et al., 2008). Thus, TET13 positively regulates two different aspects of LR development: LR initiation and emergence,
54 Chapter 2
which fits with promoter activity throughout LR development. The TET3 expression pattern in the embryo resembles that of the WUS gene at the SAM organizing center (Schoof et al., 2000; Tucker et al., 2008), WUS migrates through plasmodesmata to the central zone of the SAM to activate the transcription of the CLV3 (Yadav et al., 2011); the CLV1 receptor kinase that recognizes the CLV3 ligand is also localized to the plasmodesmata (Stahl et al., 2013). The WUS-CLV regulatory loop controls the self-regulation of the SAM. The TET3 promoter activity domain, protein localization and mobility suggest that TET3 might have a role in SAM maintenance by facilitating intercellular trafficking. The duplicated TET genes have diverged expression patterns during development, despite their homologous coding regions, suggesting evolvement of different regulatory elements in their promoters a phenomenon called neofunctionalization (Moore & Purugganan, 2005). Only the TET5 and TET6 duplicated genes have the same promoter activity pattern in post-embryonic vascular tissues, and the double mutants revealed a function in repressing leaf and root growth. The vascular tissue consists of two distinct types of cells, xylem and phloem, which are differentiated from the vascular meristematic procambium (Carlsbecker & Helariutta, 2005). The promoter activities in cells surrounding procambial cells and the phloem suggest that TET5 and TET6 might have a redundant function in phloem specification or differentiation, presumably affecting it function, such as in nutrient or photoassimilates transport. No venation patterning defect was observed in the double mutant, supporting the hypothesis that they have a role in vascular tissue differentiation rather than in patterning. The different promoter activities between TET5 and TET6 in embryonic vascular tissue precursor cells are in contrast to their redundant activities in post-embryogenesis. Indeed, some vascular tissue-related genes are active early in the vascular tissue precursors, but have only effects at a later stage or during postembryonic growth (De Rybel et al., 2014). Thus, it is possible that TET5 and TET6 function is related to differentiated vascular tissue during the postembryonic development. Arabidopsis tetraspanins can form homo- and heterodimers when expressed in yeast (Boavida et al., 2013). The redundant function of TET5 and TET6 suggests that for proper expression, heterodimers need to be formed or interaction with a common protein/ligand is required, which needs further testing. The overlapping expression patterns between members of different gene pairs, such as TET5 & TET6 and TET9 in vascular tissue, TET4 and TET10 in
Embryonic and vegetative tetraspanin gene expression patterns identify functions in specific tissues, domains and cell types 55
root apical meristem, and TET1 & TET2, TET3 & TET4, TET7 & TET8 & TET9, TET10, TET11, TET13 & TET14 & TET15 and TET16 in pollen might refer to the convergent evolution of TET gene function in specific tissues or cells. So far, the observed phenotypes in the mutants are rather mild (except for tet1), this could be due to the overlapping expression patterns. In Drosophila melanogaster, tetraspanin gene LATE BLOOMER (LBM) is expressed in the motoneurons during embryogenesis and its mutant has mild phenotype. Only when knocking out LBM together with the other two motoneuron-expressed TETs would result in significantly enhanced phenotypes (Fradkin et al., 2002). This strongly suggests that double, triple, quadruple or quintuple mutants might be necessary to reveal Arabidopsis tetraspanins functions. TET proteins contain a small and large extracellular loop with conserved cysteines that are known to mediate disulfide bridge formation in the large extracellular loop (Seigneuret et al., 2001), which is important for the interaction with other proteins. Moreover, the cysteines adjacent to the transmembrane domains are also important sites for the interaction after the palmitoylation (Levy & Shoham, 2005). These cysteines are also present in Arabidopsis tetraspanins, that might facilitate interactions with peptides, cell wall related proteins or other TET proteins to form multimeric complexes. Indeed, a number of TET interacting proteins have been described in the Membrane-based Interactome Network Database (MIND) (Jones et al., 2014), amongst which receptor kinases, enzymes, cell wall associated proteins and transporters that locate at different compartments in the cell suggesting a wide range of activities of the respective tetraspanin webs. In conclusion, our mutational analyses showed for the first time that the TET2, TET5, TET6 and TET13 genes function in vegetative development, i.e. stomatal development, organ growth and lateral root initiation and emergence, respectively. Moreover, the TET genes are expressed in various cell types, domains and tissues in embryonic and vegetative stages, suggesting a function in a number of developmental pathways; hence, they might be novel components of described developmental pathways related to cellular (stomata, vasculature, pollen) or domain (SAM, RAM) specification and growth. Their localization at the plasma membrane (TET2), plasmodesmata (TET3) and/or vesicles (TET2) suggests that they assist in cell-to-cell communication at membranous interfaces where they putatively interact with other proteins such as transporters and kinases (MIND database) to repress or
56 Chapter 2
promote developmental pathways. Determination of the composition of the respective tetraspanin networks in planta will be necessary to link them to the respective signaling or transport processes.
2.4 MATERIALS AND METHODS Materials The mutant lines tet2-1 (GABI-Kat: 967G02), tet5-1 (GABI-Kat: 290A02), tet5-2 (SALK_148216), tet5-3 (SALK_020009C), tet6-2 (SALK_139305) and tet13-1 (SALK_011012C) were obtained from Arabidopsis GABI-Kat (http://www.gabi-kat.de/) and the European Arabidopsis Stock Center (http://www.arabidopsis.org/), respectively. The presence of the T-DNA was confirmed by PCR with a T-DNA- specific and gene-specific primers (Supplemental Table 1). Growth Conditions Seeds were surface sterilized and stratified at 4°C for two nights and moved to the growth chamber. For TET:: NLS-GFP/GUS lines, 6-d-old seedlings grown vertically at 21°C under 24-h light conditions (75~100 µmol m-2 s-1) were used for SAM and root analysis; 14-d-old seedlings corresponding to the growth stage 1.04 (Boyes et al., 2001) and grown horizontally at 21°C under 16-h light/ 8-h dark conditions were used for cotyledon, emerging leaf 1, 2, 3 and 4 primordia analysis; 6-week-old plants grown in the soil at 21°C under 16-h light/ 8-h dark conditions were used for analysis of inflorescences, different stages of flowers, siliques and embryos. For tet2-1 leaf series, seeds were germinated in Jiffy soil directly and grown at 21°C under 16/8-h light/dark conditions.
Promoter and Open Reading Frame Cloning, Construction of Expression Vectors and Plant Transformation Promoter sequences and open reading frame sequences were amplified with primers listed in Supplemental Table 1 and cloned into the entry vectors using BP clonase (Invitrogen) to generate the entry clone (Hartley et al., 2000). The expression clones were constructed by LR clonase (Invitrogen) with the entry clone and the destination vector pMK7S*NFm14GW (promoter:: NLS-GFP/GUS), pK7FWG2 (35S:TET2:GFP) and pK2GW7 (35S:TET13) (Karimi et al., 2007). The positive plasmids were transferred into Agrobacterium tumefaciens pMP90 cells. All constructs were transferred into Arabidopsis ecotype Columbia-0 (Col-0) by floral dip transformation.
Embryonic and vegetative tetraspanin gene expression patterns identify functions in specific tissues, domains and cell types 57
25 mg transgenic seeds of the T1 generation was used for high density plating. The resistant seedlings were transferred into soil for T2 generation seed harvest. For pAtTET1-17:: NLS-GFP/GUS reporter lines, the number of T-DNA loci was analyzed in 7 to 35 T2 populations per construct after germination on kanamycin, three lines per construct with a single-locus insertion (except for pTET1 lines which contain 2 or 3 loci) were analyzed by X-Gluc histochemical staining to score the promoter activity during development.
Histochemical, Histological, Phenotypic Analysis and Statistical Tests The 5-bromo-4-chloro-3-indolyl-β-D-glucuronide (X-Gluc) assay was performed as described previously (Coussens et al., 2012). The ovules were cleared overnight in an 8: 2: 1 (g: mL: mL) mixture of chloral hydrate: distilled water: glycerol and mounted on the microscope slides with the same solution (Grini et al., 2002). For the LRP staging and a better visualization of the TET13 expression pattern in the LRP, the samples were treated as described previously with some modifications (Malamy & Benfey, 1997). Both fresh and stained samples were fixed in 70% ethanol overnight and transferred into 4% HCl, 20% methanol and incubated at 62°C for 40 minutes and 7% NaOH, 60% ethanol at room temperature for 15 minutes. The samples were then rehydrated for 10 minutes in either 60%, 40%, 20% and 10% ethanol at room temperature. Finally, the samples were infiltrated in 25% glycerol, 5% ethanol for 10 minutes and mounted with 50% glycerol. The root meristem size was determined as the number of cells in the cortex cell file from the QC to the first elongated cell (Casamitjana-Martínez et al., 2003). The samples were mounted with 50% lactic acid and observed immediately. For the hydroxyurea, NAA and NPA treatment, 5-d-old seedlings were transferred onto the MS medium supplemented with 1 mM hydroxyurea, 1 µM NAA or 1 µM NPA for 24 h, respectively. Seedlings treated with hydroxyurea were counterstained with PI and observed with a confocal microscope. Seedlings treated with NAA or NPA were stained with Lugol solution to stain the starch granules for 1 min, mounted with chloral hydrate and checked immediately with microscope. Root transverse section was done as described previously (De Smet et al., 2004). NPA inhibition and NAA induction of lateral root initiation were done as described previously (Himanen et al., 2002). All samples were imaged with a binocular Leica microscope or an Olympus DIC-
58 Chapter 2
BX51 microscope. The confocal images were taken with an Olympus Fluo View FV1000 microscope or Zeiss LSM5 Exciter confocal. The fluorescence was detected after a 488 nm (GFP), 543 nm (propidium iodide, PI) or 514 nm (FM4-64) excitation and an emission of 495-520 nm for GFP, 590-620 nm for PI and 600-700 nm for FM4-64. For the stomata and epidermal cells imaging, leaves were fixed in 100% ethanol overnight and mounted with 90% lactic acid. The leaf area was measured with the ImageJ software (http://rsbweb.nih.gov/ij/). The stomata and epidermal cells on the abaxial side were drawn with a DMLB microscope equipped with a drawing tube and differential interference contrast objectives. The stomatal density, index and total number of cells per leaf were determined as described previously (De Veylder et al., 2001). Means between samples were compared by a two-tailed Student’s t-test, an f-test was assessed for the equality between population variances.
Quantitative Real-time PCR Analysis Total RNA was prepared with the RNeasy kit (QIAGEN). One µg RNA was used as template to synthesize cDNA with the iScript cDNA synthesis Kit (Bio-Rad). The expression level was analyzed on a LightCycler 480 apparatus (Roche) with SYBR Green and all reactions were performed in three technical replicates. Expression levels were normalized to reference genes PP2A and UBC.
SLRI, Protoplasting and FACS SLRI was performed as described previously (Himanen et al., 2002). After 3 h and 8 h NAA treatment, primary roots were dissected and harvested for protoplasting as described previously with some modifications (Bargmann & Birnbaum, 2010). Cut the roots 2 to 3 times but not macerated. Transfer cut roots directly into 8 ml protoplasting solution (1.25% Cellulase (Yakult, Japan), added freshly, 0.3% Macerozyme (Yakult, Japan), added freshly, 0.4 M Mannitol, 20 mM MES, 20 mM
KCl, 0.1% BSA, 10 mM CaCl2, bring pH to 5.7 with 1 M Tris/HCl pH 7.5) in the Erlenmeyer flask without touching the wall of the flask. Incubate the flask on a shaker at 100 rpm for 2 h. Filter the protoplast containing solution from the Erlenmeyer flask to 50 ml falcon tubes through a 40 micron filter. Put 7 ml of wash solution (the same as protoplasting solution but without Cellulase and Macerozyme) in a flask to pool
Embryonic and vegetative tetraspanin gene expression patterns identify functions in specific tissues, domains and cell types 59
protoplasts and then again filter through the same filter. Transfer ~15 ml solution in 15 ml falcon tube and centrifuge at 150 g (~1000 rpm) for 10 min at room temperature. Discard the supernatant and redissolve the pellet in 500 µL of wash buffer gently. FACS was performed as described previously (Bargmann & Birnbaum, 2010). Total RNA was prepared with RNeasy Micro Kit (Qiagen, #74004) according to the manufacturer’s instructions.
60 Chapter 2
SUPPLEMENTAL DATA
Supplemental Figure 1. TET promoter activities in flower organs. Transgenic plants shown are: pAtTET1:: NLS-GFP/GUS (a, c), pAtTET2:: NLS-GFP/GUS (c), pAtTET3:: NLS-GFP/GUS (c), pAtTET4:: NLS-GFP/GUS (a, c), pAtTET5:: NLS- GFP/GUS (a-c), pAtTET6:: NLS-GFP/GUS (a-c), pAtTET7:: NLS-GFP/GUS (c), pAtTET8:: NLS-GFP/GUS (a, c), pAtTET9:: NLS-GFP/GUS (c), pAtTET10:: NLS-
Embryonic and vegetative tetraspanin gene expression patterns identify functions in specific tissues, domains and cell types 61
GFP/GUS (c), pAtTET11:: NLS-GFP/GUS (c), pAtTET13:: NLS-GFP/GUS (c), pAtTET14:: NLS-GFP/GUS (a, c), pAtTET15:: NLS-GFP/GUS (b, c), and pAtTET16:: NLS-GFP/GUS (a, c). (a) Overview of whole inflorescences and single flowers. Arrowheads and arrows indicate the stigma transmitting tract and the basal part of the flower, respectively. Insets in TET4 and TET8 show stomatal guard cells at the anther and the magnification of the stigma and transmitting tissue, respectively. (b) TET5 and TET6 activities in the funiculus. TET15 activity in the pollen tube and stomatal guard cells of the sepal. (c) TET promoter activities in the pollen and stamen filament tissues. Scale bars represent 1 mm (a), 0.1 mm (b, c).
Supplemental Figure 2. tet5tet6 double mutants phenotypes. (a) Rosette and leaf series of 21-d-old seedlings. From left to right were leaf 1 to leaf 8, incisions were made to make the leaves fully expanded when necessary. (b) Quantification of the rosette leaf size in (a). Means are presented ± sd (n=8-10). (c) Fresh weight of 21-d-
62 Chapter 2
old seedlings. Only the green tissue, but not the root, was used for the experiment. (d, e) Primary root growth kinetics. Means are presented ± sd (n=31-39). t-test was compared between the double mutants, parental lines and wild type. Asterisks in all the graphs mark significant differences: *p < 0.05, **p < 0.01 and ***p < 0.001.
Supplemental Figure 3. tet13-1 primary root morphology. (a, b) Lugol solution staining of starch in differentiated columella cells and the quantification. Means are presented ± sd (n=125-130). Black arrows and white arrows indicate QC and the columella initial cells, respectively. (c, d) Lugol solution staining of starch in differentiated columella cells after treatment with NAA or NPA. 5-d-old seedlings growing under 24-h light condition were transferred onto medium containing 1 μM
Embryonic and vegetative tetraspanin gene expression patterns identify functions in specific tissues, domains and cell types 63
NAA or 1 μM NPA for 24 hours. Black arrows indicate the QC. (e) QC and columella cells organization. The root is counterstained with propidium iodide. (f, g) Root meristem after hydroxyurea treatment and the quantification. 6-d-old seedlings growing under 24-h light condition were transferred onto medium containing 1mM hydroxyurea for 24 hours. The root is counterstained with propidium iodide. Scale bars represent 0.01 mm (a-d), 0.1 mm (e), 0.02 mm (f, g).
Supplemental Figure 4. TET13 overexpression lines analysis. (a) Relative TET13 transcript level in seedlings measured by qRT-PCR ± sd. The value in Col-0 is indicated above the graph. (b) Primary root growth kinetics. Means are presented ± sd (n=26-37). (c) Root meristem size of 6-d-old seedlings. Means are presented ± sd (n=20-21). (d) EMLR density of 13-d-old seedlings. Means are presented ± sd (n=26- 37).
64 Chapter 2
Supplemental Figure 5. Overview of NAA induced TET13 promoter activity in primary root. Top panel, pAtTET13:: NLS-GFP/GUS. Bottom panel, tet13- 1xpAtTET13:: NLS-GFP/GUS.
Supplemental Figure 6. Setup of RNA-Seq combined with FACS. pAtTET13:: NLS-GFP/GUS is used as control. 3 replicates for each genotype and time point, result in a total of 12 samples.
Embryonic and vegetative tetraspanin gene expression patterns identify functions in specific tissues, domains and cell types 65
Supplemental Table 1. Primers used in the study. Primer Name Sequence (5'-3') Purpose pAtTET1attB4F GGGGACAACTTTGTATAGAAAAGTTGGAATAGAAT promoter cloning CTTCTAACACAATGGAG pAtTET1attB1R GGGGACTGCTTTTTTGTACAAACTTGTCTTTTTTGG promoter cloning GAGAGATGAGAG pAtTET2attB4F GGGGACAACTTTGTATAGAAAAGTTGGAGATGCAT promoter cloning CTGGAATTTGACG pAtTET2attB1R GGGGACTGCTTTTTTGTACAAACTTGTTAAATTTTC promoter cloning TCTCTCTCTCTCTCT pAtTET3attB4F GGGGACAACTTTGTATAGAAAAGTTGGATAGAAAT promoter cloning GTGTGTATTCAGTAAGG pAtTET3attB1R GGGGACTGCTTTTTTGTACAAACTTGTAGCTTAGG promoter cloning GTTTTGAGGTTTTC pAtTET4attB4F GGGGACAACTTTGTATAGAAAAGTTGGACTACATTT promoter cloning TCCAGGAAAAGCTAATG pAtTET4attB1R GGGGACTGCTTTTTTGTACAAACTTGTGGCGATTTT promoter cloning GTTTTTGTTGAATATG pAtTET5attB4F GGGGACAACTTTGTATAGAAAAGTTGGAAGTTTCC promoter cloning TACATATTCTCTG pAtTET5attB1R GGGGACTGCTTTTTTGTACAAACTTGTTTTCCTTCT promoter cloning CTCTCCTTTTTT pAtTET6attB4F GGGGACAACTTTGTATAGAAAAGTTGGATGCCTCT promoter cloning TCTTTGTTTTTAAATG pAtTET6attB1R GGGGACTGCTTTTTTGTACAAACTTGTAGTAGTAAT promoter cloning GTTATCAAGAAG pAtTET7attB4F GGGGACAACTTTGTATAGAAAAGTTGGATTCACAC promoter cloning AAGAATCTCTCTT pAtTET7attB1R GGGGACTGCTTTTTTGTACAAACTTGTCGCTTTTTG promoter cloning TTCCGGCGG pAtTET8attB4F GGGGACAACTTTGTATAGAAAAGTTGGAAAATTTAA promoter cloning AATAGTGCTTCAAAG pAtTET8attB1R GGGGACTGCTTTTTTGTACAAACTTGTGGTTTAGAT promoter cloning TCAGAGAGAAAG pAtTET9attB4F GGGGACAACTTTGTATAGAAAAGTTGGACCGTGAC promoter cloning TATTATTATTATTTTTA pAtTET9attB1R GGGGACTGCTTTTTTGTACAAACTTGTGGTGATGAT promoter cloning TGAAGAAG pAtTET10attB4F GGGGACAACTTTGTATAGAAAAGTTGGATAGAAGA promoter cloning ATCAAAGAGAG pAtTET10attB1R GGGGACTGCTTTTTTGTACAAACTTGTTTTTTCAAG promoter cloning GTTGTTGCTTTTG pAtTET11attB4F GGGGACAACTTTGTATAGAAAAGTTGGATTTCATTT promoter cloning TTCCATATCAAATG pAtTET11attB1R GGGGACTGCTTTTTTGTACAAACTTGTTTTTGGAAA promoter cloning TTTGCTTTCTCC pAtTET12attB4F GGGGACAACTTTGTATAGAAAAGTTGGAATAGTCA promoter cloning TATGGAAATTATTTG pAtTET12attB1R GGGGACTGCTTTTTTGTACAAACTTGTTGTTTATCG promoter cloning GCGGTTATTTG pAtTET13attB4F GGGGACAACTTTGTATAGAAAAGTTGGAAAACATTA promoter cloning TATTATTTCAAAATA pAtTET13attB1R GGGGACTGCTTTTTTGTACAAACTTGTTATCGTGTA promoter cloning
66 Chapter 2
AAGAGAAAGGG pAtTET14attB4F GGGGACAACTTTGTATAGAAAAGTTGGATGCTTCTT promoter cloning TTTCAAAGAGTG pAtTET14attB1R GGGGACTGCTTTTTTGTACAAACTTGTTATTGGAGA promoter cloning GCTTCAAGGACAG pAtTET15attB4F GGGGACAACTTTGTATAGAAAAGTTGGAGGCTGAT promoter cloning CTGATCAATGAATTG pAtTET15attB1R GGGGACTGCTTTTTTGTACAAACTTGTGTGAAAGT promoter cloning GAAAGAAAG pAtTET16attB4F GGGGACAACTTTGTATAGAAAAGTTGGAATTAAAAA promoter cloning TCTTTCCGG pAtTET16attB1R GGGGACTGCTTTTTTGTACAAACTTGTTGTTAAGAA promoter cloning CCCTGTTCG pAtTET17attB4F GGGGACAACTTTGTATAGAAAAGTTGGAAGAAAAT promoter cloning CTTACCTGCAAATCTCAG pAtTET17attB1R GGGGACTGCTTTTTTGTACAAACTTGTTGTTGTTTT promoter cloning TTGGTATAGACCTG qPP2A_F TAACGTGGCCAAAATGATGC qRT-PCR qPP2A_R GTTCTCCACAACCGCTTGGT qRT-PCR qUBC_F CTGCGACTCAGGGAATCTTCTAA qRT-PCR qUBC_R TTGTGCCATTGAATTGAACCC qRT-PCR TET2 qPCR_F CAGACGCAGACTGTTACTTATG qRT-PCR TET2 qPCR_R ATATGAGAACAACGACTGTGATG qRT-PCR TET2 attB1F GGGGACAAGTTTGTACAAAAAAGCAGGCTTAGAAG gene cloning GAGATAGAACCATGGCGTTAGCGAATAACTTAACG TET2 attB2R GGGGACCACTTTGTACAAGAAAGCTGGGTCGACC gene cloning, the CAACCTTGTTTGTATTTG stop codon is excluded TET5 qPCR_F TACTGTGTTGGCTGTTGCG qRT-PCR TET5 qPCR_R GACTGTTCCCATCCAGGTCT qRT-PCR TET6 qPCR_F CAGCTCATCCTTACCATCCA qRT-PCR TET6 qPCR_R CCACCAGTAATAGTCCCAACG qRT-PCR TET13 qPCR_F TGCTTCGATTGTGATTCATGT qRT-PCR TET13 qPCR_R AGGATCCTTAACCAGGCAAA qRT-PCR TET13 attB1F GGGGACAAGTTTGTACAAAAAAGCAGGCTTAGAAG gene cloning GAGATAGAACCATGGCGAGAGATAAAGAAGATC TET13 attB2R GGGGACCACTTTGTACAAGAAAGCTGGGTCCTATT gene cloning TCTGACTTTCTCGAAGG tet2-1 LP TGAGTTGTGATCACGAAAAACAC genotyping PCR tet2-1 RP TATTGATCGGACTTTTGCTGG genotyping PCR tet5-1 LP AATATGCAAGTTTGAATCCGG genotyping PCR tet5-1 RP AAACCCATGAGTGCGACTATG genotyping PCR tet5-2 LP ACATGCCGTAACGTCCATAAG genotyping PCR tet5-2 RP CAAGCCAGCAAGAATTTTCAG genotyping PCR tet5-3 LP TAAGCACCCTTCCGTTATGTG genotyping PCR tet5-3 RP GCTCAGTCACTTGTTCCAAGC genotyping PCR tet6-2 LP TTGTATAAAGCGGTTCCGATG genotyping PCR tet6-2 RP TGGGTGTACAAGACTTGACCC genotyping PCR
Embryonic and vegetative tetraspanin gene expression patterns identify functions in specific tissues, domains and cell types 67
tet13-1 LP CTCGAAGGATCCTTAACCAGG genotyping PCR tet13-1 RP AATCTGGGTCAACAACAAACG genotyping PCR LBb1_3 ATTTTGCCGATTTCGGAAC genotyping PCR GABI_o8409 ATATTGACCATCATACTCATTGC genotyping PCR
ACKNOWLEDGEMENTS The authors would like to thank Annick Bleys for help in preparing the manuscript, Matyas Fendrych in confocal imaging, Carina Braeckman for plant transformation. This work was supported by the China Scholarship Council (CSC) (predoctoral fellowship to F.W.), and by the Ministero dell' Istruzione, dell'Università e della Ricerca (MIUR) (predoctoral fellowship to A.M.).
CHAPTER 3 TETRASPANINS SUBCELLULAR LOCALIZATION
Feng Wang1,2, Antonella Muto1,2,3, Pia Neyt1,2, Mieke Van Lijsebettens1,2
1Department of Plant Systems Biology, VIB, B-9052 Ghent, Belgium 2Department of Plant Biotechnology and Bioinformatics, Ghent University, B-9052 Ghent, Belgium 3Present address: Laboratory of Citofisiologia Vegetale, Department of Ecology, University of Calabria, Cosenza, Italy
Author contributions: F.W. made the constructs, did the confocal microscopy imaging and wrote the chapter. A.M. and P.N. did genetic analysis. F.W. and M.V.L. designed the experiments. M.V.L. contributed to the writing of the chapter.
70 Chapter 3
ABSTRACT Tetraspanin membrane proteins do not have a signal peptide at their N-terminus according to prediction programmes. Therefore, the membrane localization might be directed by other targeting signal such as signal anchor in the sequence or post- translational modification. Tetraspanins were predominantly localized at the plasma membrane. In addition, they were also localized at certain organelles or compartments, i.e., TET3 localized at the plasmodesmata. TET11 was found at vesicles and newly formed plasma membrane in dividing cells, suggesting a function in cell wall/membrane components delivery during plasma membrane formation. TET14 and TET16 localized at the endoplasmic reticulum (ER)-like structure. The concentrated localization pattern of some tetraspanins, i.e., TET1, as visualized by bright spots at the plasma membrane, supported the concept of tetraspanin-enriched microdomains.
Tetraspanins subcellular localization 71
3.1 INTRODUCTION A signal peptide, which is also referred to as targeting signal or localization signal, is a short sequence typically between 15 and 40 amino acids long at the N-terminus of the proteins that are designated to the secretory pathway. After targeting to the destination membraneous compartments, such as the ER, the signal peptide is recognized and cleaved by signal peptidase and a mature protein is formed (von Heijne, 1990). The signal peptide containing proteins are transported to the destinations in a co- translational translocation way, meaning that they are translocated during the translation process that takes place in ER-bound ribosomes. This requires the recognition of signal peptide by a signal recognition particle (Powers & Walter, 1997). Most of the proteins that target to the plasma membrane, reside in ER, golgi, endosomes or lysosomes use the co-translational translocation way. Proteins without signal peptide use post-translational translocation way to target to the destinations, such as the nucleus, mitochondria, chloroplasts and the plasma membrane (Mitra et al., 2006), meaning that they are translocated after the translation in free ribosomes. The translocation to the destination, for example, the plasma membrane, is facilitated by other membrane-bound proteins. Targeting to the nucleus, mitochondria and chloroplasts are dependent on the nuclear localization signal, presequence and transit peptide and the N-terminal, respectively. The signal peptide is present in the majority of type I membrane-bound proteins. Most of type II and multi-spanning membrane-bound proteins are directed to the membraneous compartments by their N-terminal transmembrane helices, which will not be cleaved, therefore, they are referred to as signal anchor in order to be distinguished from signal peptide. Both signal peptide and anchor are hydrophobic, but the signal anchor has longer hydrophobic regions without cleavage sites. However, the cleavage site is not sufficient to distinguish the two signal sequences from each other (Petersen et al., 2011). Some online programmes have been developed to predict signal peptide and SignalP 3.0 appeared to be the best method (Bendtsen et al., 2004; Choo et al., 2009). It includes the hidden Markov model method to distinguish signal peptide, signal anchor and other proteins. Recently, the updated and advanced version, SignalP 4.0, was designed to discriminate between signal peptide and signal anchor, it is a purely neural network-based method, which has been proved to perform better than the hidden Markov model (Petersen et al.,
72 Chapter 3
2011). Protein subcellular localization and dynamics are highly related to function. Mammalian tetraspanins have been shown to localize at different compartments and some are quite dynamic in organizing tetraspanin-enriched microdomains (Penas et al., 2000). In Arabidopsis, tetraspanin localization was only reported in reproductive tissues (Boavida et al., 2013). Even for the functionally characterized TET1 there is no localization information available. Most of the TETs are duplicated genes, whether they have the same or different protein localization is not known yet. In order to obtain more information for understanding their functions, tetraspanin protein localization was analyzed in primary roots.
3.2 RESULTS 3.2.1 Signal Peptide and Signal Anchor at the N-terminus of Tetraspanins SignalP 3.0 predicted a few TETs to have signal peptides, including TET2, TET9- TET12, TET14 and TET16. TET15 is a non-secretory protein and the rest have signal anchor. Whereas SignalP 4.0 predicted only TET2 and TET8 to have signal peptides with cleavage sites at the 25th and 27th amino acids, respectively. Signal peptide has not been reported in mammalians tetraspanins so far and the N-terminus has important role in tetraspanin function (Stipp et al., 2003), thus it is unlikely that tetraspanins have signal peptide that can be cleaved. Additionally, since SignalP 4.0 is better in discriminating between signal peptide and signal anchor, we conclude that most of the Arabidopsis tetraspanins do not have signal peptide, the signal sequence is considered as signal anchor. Even though tetraspanins do not have signal peptide, the N- terminus is important for correct protein subcellular localization and subsequently the correct function, therefore, the fluorescence tags such as GFP and RFP were fused to the C-terminal end of tetraspanins in the following studies.
3.2.2 Tetraspanins Subcellular Localization Prediction The prediction of subcellular localization would help to choose the markers when tetraspanins are localized at the organelles that are not distinguishable according to the structure. Three different online programmes were used to predict tetraspanins subcellular localization, including TargetP 1.1 (Emanuelsson et al., 2000), Predotar (Small et al., 2004) and Plant-mPLoc (Chou & Shen, 2010) (Table 1). The localization
Tetraspanins subcellular localization 73
assignment of TargetP is based on the predicted presence of N-terminus presequences, including chloroplast transit peptide, mitochondrial targeting peptide and secretory pathway signal peptide. Therefore, it focuses on predicting protein that is targeted to the chloroplast, mitochondrion and secretory pathway. The success rate is about 85% for plant. Predotar has a very low rate of false positives compared with other similar programmes, it mainly predicts the localization at ER, mitochondrion and plastids. Plant-mPLoc is developed by integrating gene ontology information, functional domain information and sequential evolutionary information. Compared to the other programmes, it has the capacity to predict as many as 12 subcellular location sites. TargetP 1.1 predicted the majority of TETs as secreted proteins without specifying the destination, whereas Predotar predicted most of TETs as ER localized proteins. Plant-mPLoc showed all of TETs localized at plasma membrane while TET7, TET14- TET17 had additional localization, such as golgi, chloroplast and mitochondrion (Table 1).
74 Chapter 3
Table 1. Tetraspanins subcellular localization prediction and experimental observation. C, chloroplast; Cyto, cytoplasm; ER, endoplasmic reticulum; G, golgi; M, mitochondrion; N, nucleus. PM, plasma membrane; S, secretory pathway. Experimental observation in this study is summarized in the last column. TargetP 1.1 Predotar Plant-mPLoc TET-GFP/RFP protein TET1 S Elsewhere PM PM, vesicles TET2 S ER PM PM, vesicles TET3 S ER PM plasmodesmata, vesicles TET4 S ER PM \ TET5 S ER PM PM, vesicles TET6 S ER PM PM, vesicles TET7 S ER PM, G \ TET8 S ER PM PM, cytoplasmic fractions TET9 S ER PM \ TET10 S ER PM cytoplasma, vesicles TET11 S ER PM PM, newly formed PM, vesicles TET12 S Elsewhere PM PM, cytoplasm TET13 Elsewhere Elsewhere PM \ TET14 S ER PM, C PM, ER-like TET15 Elsewhere Elsewhere PM, C, Cyto, M, N PM, cell sap of vacuole TET16 Elsewhere ER PM, C PM, ER-like TET17 S ER PM, N \
3.2.3 Generation of TETRASPANIN Fluorescence Tag Fusion Transgenic Lines and Subcellular Localization of TETRASPANINS TETs without the stop codon were cloned into the entry vectors using genomic DNA or cDNA. Initially, we suspected that the duplicated TETs might have similar localization. In order to allow their colocalization, duplicated TETs were fused with different fluorescence tags, such as GFP, RFP and CFP. The expression constructs were made with the entry vectors and the destination vectors pK7FWG2, pB7RWG2 or pH7CWG2 to generate 35S:: TET-GFP, 35S:: TET-RFP or 35S:: TET-CFP constructs, respectively (Figure 1). Since 35S:: TET8-GFP transgenic seedlings were lethal, TET8 was fused with its endogenous promoter by multisite gateway approach to generate pTET8:: TET8-GFP expression construct (Figure 1). The constructs were transformed into Arabidopsis wild-type Col-0 plants by floral dip. 35S:: TET1-GFP construct was previously generated in the group and transformed into trn2-4 heterozygous plants. In T2 generation, the number of T-DNA insertion loci was determined with the resistant and sensitive segregation test by germinating the seeds on medium containing the selective agent. Only the lines with one T-DNA insertion
Tetraspanins subcellular localization 75
locus were used for confocal microscopy imaging (Supplemental Table 1). For 35S:: TET1-GFP transgenic lines, the lines with one T-DNA insertion locus were further tested for phenotypic complementation analysis. The complemented lines were used for confocal microscopy imaging (Supplemental Table 1). We took advantage of the Arabidopsis primary root as confocal microscopy imaging experimental system for most of TET localization, except for TET3 which was imaged in cotyledons. The ones fused with GFP were counterstained with the plasma membrane marker dye FM4-64 whereas the ones fused with RFP were not. The localization patterns were compared between duplicated TET genes if possible.
Figure 1. Schemes of tetraspanin expression constructs. (a) Expression constructs with 35S promoter. (b) TET8 expression construct. LB, left border; RB, right border; Kan, kanamycin resistance gene; Bar, Basta; Hyg, hygromycin resistance gene; 35S, CaMV promoter; T35S, 35S terminator; eGFP, enhanced GFP; eCFP, enhanced CFP.
Some bright TET1-GFP spots were observed at the plasma membrane, which might represent local concentration of TET1-GFP in either tetraspanin webs or in vesicles (Figure 2). In addition, TET1-GFP was visualized in bright cytoplasmic spots that presumably correspond to vesicles. These vesicles were located near the foci on the plasma membrane suggesting they originated by internalization or endocytosis. This
76 Chapter 3
vesicular localization pattern was more obvious in lateral root cap cells (Figure 2). Some ring shape patterns were observed on or close to the plasma membrane that did not colocalize with FM4-64 indicating they were at the cytoplasm (Figure 2). TET2-GFP was localized at the plasma membrane and vesicles that colocalized with FM4-64 (Figure 2). TET3-GFP was localized at the plasmodesmata of cotyledon epidermal cells (Figure 2), confirming its identification in the Arabidopsis Plasmodesmal Proteome (Fernandez-Calvino et al., 2011). Besides, we observed some bright TET3-GFP fusion protein movement along and toward the plasma membrane, suggesting a function in trafficking. TET4 was not successfully cloned because of mismatches in the coding region.
Figure 2. TET1, TET2 and TET3 protein localization. (a) and (b) 35S:: TET1-GFP in lateral root cap cells. Arrows and arrowheads indicate vesicles and ring shape structures, respectively. (c) 35S:: TET2-GFP in root epidermal cells. Arrows indicate vesicles. (d) and (e) 35S:: TET3-GFP in the epidermal cells of cotyledon. Arrowheads indicate plasmodesmata. Arrows indicate the moving vesicles underneath the plasma membrane, the picture was extracted from a time lapse film. Scale bars represent 5 µm (a-c) and 10 µm (d and e).
Tetraspanins subcellular localization 77
TET5-GFP was colocalized with FM4-64 at the plasma membrane and vesicles (Figure 3). TET6-RFP had similar localization as TET5-GFP (Figure 3), this fits with their redundant functions as described in Chapter 2. Driven by the endogenous promoter, TET8-GFP colocalized with FM4-64 at the plasma membrane of the epidermal cells at the differentiation zone. Additionally, some cytoplasmic fractions were also observed (Figure 4). TET9-RFP was negative. TET10-GFP was the only one that was not localized at the plasma membrane. It localized at the cytoplasm. Some bright spots were observed (Figure 4). TET11-GFP colocalized with FM4-64 at the plasma membrane and vesicles. Interestingly, it also localized at the newly formed plasma membrane during cell division (Figure 5). TET12-RFP localized at the plasma membrane and cytoplasm (Figure 5), which was quite different from its duplicated pair TET11. TET13-CFP was negative. TET14-GFP localized at the plasma membrane and cytoplasmic structures resembling the ER (Figure 6). TET15- RFP localized at the plasma membrane and the cell sap, some bright spots were found both inside and outside of the cell sap (Figure 6). TET16-GFP localized at the plasma membrane and ER-like organelle surrounding the nucleus (Figure 6). Since TET17 promoter activity was negative, its protein localization was not checked. The localization of the TET fusion proteins in primary roots using confocal microscopy are summarized in the right column of Table 1.
Figure 3. TET5 and TET6 protein localization. (a) 35S:: TET5-GFP in root epidermal cell. Arrows indicate the same vesicle. (b) 35S:: TET6-RFP in root epidermal cell of the differentiation zone. Arrows indicate vesicle like structures. Scale bars represent 5 µm (a) and 10 µm (b).
78 Chapter 3
Figure 4. TET8 and TET10 protein localization. (a) pTET8:: TET8-GFP in root epidermal cell of the differentiation zone. (b) 35S:: TET10-GFP in lateral root cap cell. Scale bars represent 5 µm (a) and 10 µm (b).
Figure 5. TET11 and TET12 protein localization. (a) and (b) 35S:: TET11-GFP in root epidermal cells. Arrows indicate the same vesicle. Arrowheads indicate the newly formed plasma membrane. (c) 35S:: TET12-RFP in lateral root cap cell and root epidermal cells. Scale bars represent 5 µm.
Tetraspanins subcellular localization 79
Figure 6. TET14, TET15 and TET16 protein localization. (a) 35S:: TET14-GFP in root epidermal cell. Arrows indicate the ER-like structure. (b) and (c) 35S:: TET15-RFP in root epidermal cell. Arrows indicate bright spot inside of the vacuole. (c) shows provacuoles as indicated by arrowheads. (d) 35S:: TET16-GFP in root epidermal cell. Arrows indicate the ER-like structure. Scale bars represent 5 µm.
3.3 DISCUSSION Tetraspanins were predominantly localized at the plasma membrane (except for TET10), In addition, they were also localized at other organelles, suggesting they might function in both intercellular and intracellular signaling pathways. These localization patterns fit with the hypothesis that a targeting sequence, preferentially a signal anchor, is present at the N-terminus to target them to the designated organelles. The predicted localization results seem to be quite different from each other. In fact, the secretory pathway is a very general pathway which includes targeting proteins to the ER and plasma membrane. Therefore, TargetP 1.1 is capable of discriminating secreted proteins from those targeted to the chloroplast and mitochondrion. Plant- mPLoc is more precise at predicting the plasma membrane localization while Predotar is not as ideal as the other two programmes in our study. The predicted localization results were not always consistent with the experimental results, except for TET14 and TET16 ER localization and the general plasma membrane localization. These programmes use different methods and approaches to
80 Chapter 3
train the dataset and they focus on different organelles. In addition, signal peptide or signal anchor is not the only factor that determines the localization, post-translational modification such as myristoylation can affect protein localization (Warden et al., 2001) and mannose 6-phosphate is a necessary targeting signal for proteins targeted to the lysosomes (Pohlmann et al., 1995). Another targeting signal is signal patch, which is far away from each other in the primary sequence, it is only functional when protein folding brings them together (Yang et al., 2012). Signal patch is difficult to be predicted. Sometimes a particular sequence at other regions of the protein can determine the targeting, such as the C-terminal KDEL sequence that is necessary for targeting proteins from the plasma membrane back to the ER (Majoul et al., 1996). The prediction programmes cannot take all of these factors into account, thus the predicted localization is not always the same as experimental observation. Some tetraspanins were not evenly located at the plasma membrane, they showed concentrated localization as visualized by some bright spots or regions, such as TET1-GFP, TET5-GFP and TET6-RFP. These localization patterns might relate to tetraspanin-enriched microdomains in which they can form tetraspanin-tetraspanin interaction directly or via intermediate proteins (Levy & Shoham, 2005). Additionally, although driven by the constitutive 35S promoter, these concentrated patterns were only observed in a certain type of cells, such as TET1-GFP in the lateral root cap cells, suggesting its function is cell type specific, in analogy with some mammalian tetraspanins (Yáñez-Mó et al., 2009). The localization at certain organelles or during a certain process suggests specific functions. For example, TET14-GFP and TET16-GFP localized at the ER-like structure, suggesting they might have functions in protein folding and transport. TET11-GFP was found at vesicles and the newly formed plasma membrane, suggesting its function in the delivery of cell wall and cell membrane components to the dividing cell plane for the formation of the cell plate. TET15-RFP localized inside the vacuole, some bright spots were also found. Vacuole has several functions in plant cells, such as maintaining the internal pH, supporting cell structure and most importantly, in autophagy. Thus, TET15 might function in transporting waste such as misfolded proteins or harmful materials into the vacuole for degradation. One of the most interesting properties of plasma membrane localized proteins is the polarized localization that is due to the polarized transport of some molecules, such as auxin and its transporting proteins PINs (Friml, 2003). So far only TET6-RFP is likely to be
Tetraspanins subcellular localization 81
preferentially localized at both basal and apical part of the epidermal cells at the differentiation zone, this needs further investigation and quantification, such as using endogenous promoter instead of the 35S promoter. So far, the duplicated pairs showed mainly different subcellular localization, supporting the conclusion in chapter 2 that they have diverged functions.
3.4 MATERIALS AND METHODS Growth Conditions Seeds were germinated on Murashige and Skoog medium supplemented with 1% (w/v) sucrose, 0.8% (w/v) agarose, pH 5.7. Seeds on the plates were vernalized at 4 °C in the darkness for 2 nights. For the confocal microscopy imaging, seeds were germinated vertically at 21°C under 24 h light condition and grown for 6 days. For genetic analysis, seeds were germinated horizontally at 21°C under 16 h light regime condition and grown for two weeks.
Generation of Expression Vectors and Plant Materials TETs open reading frame sequences were amplified with primers listed in Supplemental Table 2 and cloned into the entry vectors using BP clonase (Invitrogen) to generate the entry clone (Hartley et al., 2000). The expression clones were constructed by LR clonase (Invitrogen) with the entry clone and the destination vector pK7FWG2 (35S:: TETs-GFP), pB7RWG2 (35S:: TETs-RFP), pH7CWG2 (35S:: TETs- CFP) or pK7m34GW (pTET8:: TET8-GFP). 35S:: TET1-GFP was previously generated in the group. The positive plasmids were transferred into Agrobacterium tumefaciens pMP90 cells. All of the constructs were transferred into wild-type Col-0 plants. 35S:: TET1-GFP was previously transferred into trn2-4 (Col-0) heterozygous plants in the group. Plant transformation was done by floral dip transformation. 25 mg transgenic seeds of the T1 generation was used for high density plating. The resistant seedlings were transferred to soil for T2 generation seed harvest. The number of T-DNA loci was analyzed in 12 to 13 T2 populations per construct after germination on kanamycin (50 mg/L), DL-Phosphinothricin (50 µM/L) or hygromycin (15 µg/ml). The complementation of trn2-4 was analyzed with the lines containing one T-DNA insertion locus in T2 after germination on growth medium without antibiotics.
82 Chapter 3
Signal Peptide, Signal Anchor and Subcellular localization Prediction The signal peptide and signal anchor were predicted with SignalP 4.0 server (http://www.cbs.dtu.dk/services/SignalP-4.0/) (Petersen et al., 2011). The subcellular localization prediction were done with TargetP 1.1 server (http://www.cbs.dtu.dk/services/TargetP/) (Emanuelsson et al., 2000), Predotar (https://urgi.versailles.inra.fr/predotar/predotar.html) (Small et al., 2004) and Plant- mPLoc (http://www.csbio.sjtu.edu.cn/bioinf/plant-multi/) (Chou & Shen, 2010). The default settings were used.
Confocal Microscopy Imaging The confocal images were taken with an Olympus Fluo View FV1000 microscope or Zeiss LSM5 Exiter confocal. The fluorescence was detected after a 488 nm (GFP), 543 nm (RFP) and 514 nm (FM4-64) excitation and an emission of 495-520 nm for GFP, 590-620 nm for RFP and 600-700 nm for FM4-64. The seedlings were incubated with 2 µM FM4-64 for 5 min in liquid half MS medium on ice, washed out three times with the same medium on ice and mounted on the microscopy slide with the same medium.
Tetraspanins subcellular localization 83
SUPPLEMENTAL DATA Supplemental Table 1. Tetraspanin fluorescence tag fusion transgenic lines. The lines listed below are with one insertion locus except for pTET8:: TET8-GFP which was not tested by genetic analysis. 35S:: TET1-GFP was transformed into trn2-4 and the phenotype was complemented in these lines. The rest were transformed into Col-0. Lines in bold were used for confocal microscopy imaging. Constructs Lines 35S:: TET1-GFP D3, D6, D12, D36, D37, D40 35S:: TET2-GFP A1, A3, A4, A6, B2, B3, B4 35S:: TET2-RFP A1, B2 35S:: TET3-GFP A1, A3, A4, A5, A6, B2, B4, B5, B6 35S:: TET5-GFP A3, A6, B4, B6 35S:: TET6-RFP A1, A4, A5, A6, B1, B3, B4, B6 35S:: TET7-CFP A1, A5, B1, B4, B6 pTET8:: TET8-GFP A1, A2, B6, B7 35S:: TET9-RFP A3, A5, B2, B3, B4, B6 35S:: TET10-GFP A2, A3, A5, B1, B2, B3, B4, B5, B6 35S:: TET11-GFP A2, A4, A6, B2, B3, B4, B5 35S:: TET12-RFP A1, A3, A7, A8, B1 35S:: TET13-CFP A1, A2, A5, B3, B4 35S:: TET14-GFP A2, A4, A5, A6, B1, B2, B3, B6 35S:: TET15-RFP A1, A2, A3, A4, A6, B1, B3, B5 35S:: TET16-GFP A1, A2, A3, A4, A6, B1, B3, B4, B5, B6 35S:: TET17-RFP A1, A2, A3, A5, A6, B1, B3, B4
Supplemental Table 2. Primers used in the study. Primer Name Gene specific sequence (5'-3') Purpose TET2CDSattB1 ATGGCGTTAGCGAATAACTTAACG TET2 cloning TET2CDSattB2 GACCCAACCTTGTTTGTATTTG TET2 cloning TET3CDSattB1 ATGAGAACAAGCAACCATCTCATAGGTTTAG TET3 cloning TET3CDSattB2 AAGATGGAAATGACTAGGATGTGATTTTG TET3 cloning TET5CDSattB1 ATGAACAGAATGAGCAATACAG TET5 cloning TET5CDSattB2 ATACCGATCTCTCCCATG TET5 cloning TET6CDSattB1 ATGTACAGATTCAGCAACACAG TET6 cloning TET6CDSattB2 GTAAAGCTGCTCTTTCTTTTCG TET6 cloning TET8CDSattB1 ATGGCTCGTTGTAGCAACAATCTCG TET8 cloning TET8CDSattB2 AGGCTTATATCCGTAGGTACG TET8 cloning TET10CDSattB1 ATGGGTATGGGCACAAGCACTTTCG TET10 cloning TET10CDSattB2 AAACTGTTTTGGTACTGTTG TET10 cloning
84 Chapter 3
TET11CDSattB1 ATGTTTCGAGTTAGCAATTTCATG TET11 cloning TET11CDSattB2 GACAGAATCACTTTTCCTAG TET11 cloning TET12CDSattB1 ATGCTCCGGCTAAGCAACGCCG TET12 cloning TET12CDSattB2 GAAGAACCGGCGCTTCCATGG TET12 cloning TET14CDSattB1 ATGAAGTCACAAAGCCATAAG TET14 cloning TET14CDSattB2 TCTAAACAAAGAGGTGAGG TET14 cloning TET15CDSattB1 ATGGCTGATAATGCTCAAGTAG TET15 cloning TET15CDSattB2 ACCCTTGAATCGTTCCCAAAAAG TET15 cloning TET16CDSattB1 ATGGCGACCATAATCCTTATATG TET16 cloning TET16CDSattB2 AGAATAATAGCCCCTATAATCA TET16 cloning The sequences GGGGACAAGTTTGTACAAAAAAGCAGGCTTAGAAGGAGATAGAACC and GGGGACCACTTTGTACAAGAAAGCTGGGTC were added to the front of attB1 and attB2 sequences, respectively. The stop codon was removed from attB2 primers.
CHAPTER 4 INFERRING TETRASPANINS FUNCTIONS BY LINKING EXPERIMENTAL DATA WITH BIOINFORMATIC DATA
Feng Wang1,2, Jan Van de Velde1,2, Klaas Vandepoele1,2, Mieke Van Lijsebettens1,2
1Department of Plant Systems Biology, VIB, B-9052 Ghent, Belgium 2Department of Plant Biotechnology and Bioinformatics, Ghent University, B-9052 Ghent, Belgium
Author contributions: F.W. identified the co-regulated genes of TETs, generated the heat maps, analyzed the data, performed experiments and wrote the chapter. J.V.d.V. wrote the method of GRN generation, performed regulatory elements identification and GRN generation together with K.V.. F.W., K.V. and M.V.L. designed the experiment. K.V., M.V.L. contributed to the writing of the chapter.
86 Chapter 4
ABSTRACT Developmental cues and response to stress are two major processes determining gene differential expression and adjusting plant growth. Meta-analysis shows that TETs respond to a variety of perturbations, such as ABA, cold, drought and pathogen which correlates with the presence of the respective regulatory elements identified from TETs promoter regions. Moreover, the tissue specific regulatory elements explain TETs tissue specific expression patterns, such as TET4 in the radicle and embryo and TET8 in the endosperm. A transcription factor-TET transcriptional regulatory network was generated based on the available ChIP data, known transcription factor binding sites and co-expression data. Integrating the results from these three analyses with TET expression patterns predicted functions for TET3 in flowering, TET8 in defense response and TET9 in trichome development. The regulatory networks inferred from the bioinformatics is hypothesis-generating that need to be confirmed by experimental testing.
Inferring tetraspanins functions by linking experimental data with bioinformatic data 87
4.1 INTRODUCTION The promoter regions are enriched with regulatory elements, most of which are binding sites of transcription factors (TFs). Genes that are regulated by the same TFs or share the same regulatory elements are more likely to have function in the same developmental pathway or response to the same perturbation condition. This provides a clue for the study of the genes of interest. However, some of the regulatory elements are false due to the short, simple and repetitive sequence of these regulatory elements in the whole genome. Thus, it is important to identify and distinguish the functional elements from the false ones. One of the experimental approaches is chromatin immunoprecipitation (ChIP) combined with sequencing (ChIP-Seq) or microarray (ChIP-chip) to identify the binding sites for the specific regulatory proteins such as TFs. However, this method is highly relying on the quality and the specificity of the antibodies to the regulatory proteins. As a result, the available number of experiments and the regulatory protein-binding sites identified are limited. So far, the Arabidopsis genome contains more than 1000 TFs (Guo et al., 2005), but only a small number of genome-wide binding maps of these TFs have been reported (Thibaud-Nissen et al., 2006; Lee et al., 2007; Kaufmann et al., 2009; Morohashi & Grotewold, 2009; Oh et al., 2009; Zheng et al., 2009; Kaufmann et al., 2010; Sun et al., 2010; Yant et al., 2010; Ouyang et al., 2011; Yu et al., 2011; Wang & Perry, 2013). The second approach is genome-wide identification of DNase I Hypersensitive sites (DHs). DHs are chromatin regions which are sensitive to cleavage by DNase I enzyme. These open chromatin regions have lost the condensed structure and make it accessible for the binding of TFs. DHs have been demonstrated as a powerful approach to identify the regulatory elements in human (Boyle et al., 2011; Song et al., 2011; Thurman et al., 2012) and Arabidopsis genome (Zhang et al., 2012). However, the tissues used in Arabidopsis were restricted to the leaves and closed flower buds (Zhang et al., 2012), meaning that root and embryo specific expressed genes are absent. The third approach is the search of conserved orthologous regulatory sequences from multiple, evolutionarily diverse species (Hughes et al., 2005). Regulatory sequences that are preserved through evolution are more likely to be biologically relevant. The genes that are co-expressed under a certain condition and in the same tissue are often been considered as co-regulated. These genes have higher possibilities to act in the same biological pathway. Not surprisingly, they should also share some
88 Chapter 4
common regulatory elements. Combining the regulatory element analysis with the co- regulated genes will narrow down the number of regulatory elements and give more specific insights into the biological functions for the genes of interest. We have shown that TET promoters are active in a variety of tissues and cell types. These tissue and cell type specific activities are often the result of the presence of regulatory elements in the non-coding regions. In addition, they are also responsible for the gene response to certain perturbations. On top of this, the TFs bind to these elements to regulate gene expression and consequently affect downstream pathways. In this chapter, we analyzed TET expression in response to different perturbations, identified regulatory elements in TET promoter regions and the TFs that target TETs. By integrating these three approaches together with TET promoter activities, TETs functions are inferred.
4.2 RESULTS 4.2.1 Meta-Analysis of TET Response to a Variety of Perturbations During growth, plants need to balance between developmental and stress related gene expression which is dependent on regulatory elements in their promoters and transcription factors that recognize them. A gene that responds to certain perturbations suggests that it has a function in the related pathway. Therefore, a TET-perturbation heat map was generated based on the microarray experiments in the Genevestigator database, upon a specific perturbation, up-regulation of a TET is represented by red color and down-regulation by green color (Figure 1). The heat map represents a selection of perturbations that TETs respond to, according to their gene expression patterns in certain organs, tissues, the phenotypes of their mutants and the connection between different perturbations.
TET1 is highly up-regulated by the brassinolide (BL) and boric acid (H3BO3) treatment (Figure 1) but not by BL treatment alone (data not shown). Boron is taken up by the roots and transported via the xylem to other parts of the plant. It is assumed that boron is involved in the lignification of the cell wall and differentiation of the xylem. Brassinosteroids have been found to promote xylogenesis (Clouse & Sasse, 1998). Brassinosteroids are necessary for inducing entry into the final stage of tracheary element differentiation in cultured Zinnia elegans cells (Yamamoto et al., 1997). TET1 is expressed in the vascular tissues, this suggests it might have a
Inferring tetraspanins functions by linking experimental data with bioinformatic data 89
function in tracheary element formation, which involves xylem differentiation, cell wall synthesis, lignification and programmed cell death. TET2 is up-regulated by ABA, cold, drought, heat treatment and in scrm-D mute double mutant background (Figure 1). TET2 is expressed in meristemoid cells during early stomatal development and later, in the stomatal guard cells. In tet2-1 mutant, the stomatal density and epidermal cell density were significantly increased, indicating that TET2 has a function in entry and amplifying divisions during stomatal development. However, there is no stomata morphological phenotype in the mutant. ABA is a stress related hormone, it can mimic cold, drought stress and trigger stomatal closure. Thus, TET2 function in stomatal guard cells might be related to stomatal closure. scrm-D mute double mutant was highly enriched with meristemoids and lacked pavement cells and mature guard cells, suggesting that the meristemoids were over produced from the entry divisions or the amplifying divisions, which is consistent with up-regulation of TET2 because it has a function in entry and amplifying divisions. TET3 and TET4 are up-regulated by ABA, cold, drought and in CBF3 overexpression background seedlings (Figure 1). CBF3 is a transcription factor that binds to the DRE/CRT cis-elements of cold and dehydration-responsive genes. This suggests TET3 function is ABA, cold and drought regulated. TET8 and TET9 are mainly up-regulated by pathogen and elicitor induction (Figure 1). In addition, TET8 has been found to respond to tomato yellow leaf curl Sardinia virus (Lucioli et al., 2014). TET10 is up-regulated by antimycin A and hydroxyurea (Figure 1). Antimycin A is a mitochondrial electron transport inhibitor, which can prevent cell cycle S-phase entry, root meristem activation and growth, resulting in the reduction of root meristem size (Xiong et al., 2013). Hydroxyurea is a replication-inhibitor that triggers DNA replication stress. DNA replication defective mutant is sensitive to hydroxyurea, as visualized by propidium iodide stained dead cells at the root meristem (Cools et al., 2011). Genes that regulate replication are inducible upon hydroxyurea treatment (Yi et al., 2014). TET10 shows a gradient of expression that is stronger at the root meristem where the cells are highly mitotically active and weaker at the elongation zone. This expression pattern and the inducibility by antimycin A and hydroxyurea suggest TET10 might have a function in regulating root meristem and DNA replication.
90 Chapter 4
TET16 is 63 times up-regulated during pollen tube growth (Figure 1) and it is expressed specifically in pollen, suggesting a function in this process.
Figure 1. Heat map of TET response to different perturbations. The perturbations were collected from the dataset in Genevestigator. Red and green color represent up- and down-regulation, respectively. Color scale represents fold- change between -2.0 and 2.0, the values beyond this range are shown in the same color as -2.0 and 2.0.
Inferring tetraspanins functions by linking experimental data with bioinformatic data 91
4.2.2 Regulatory Element Analysis in TETs Noncoding Regions The regulatory elements residing in noncoding regions are most responsible for the gene response to perturbations, as they are the binding sites of the TFs. To understand TETs response to perturbations, we performed the identification of regulatory elements in the TETs noncoding regions. For each TET, the co-regulated genes are identified from Genevestigator, defined as positively co-expressed in the same tissue and under the same perturbation. Thus, they are more likely to function in the same pathway with the respective TET. The common regulatory elements were first identified from the co-regulated genes, then recovered from TET. A work flow with the key procedures and parameters for the regulatory element identification is shown in Figure 2. The noncoding regions refer to 2000bp upstream from the translation start site, introns and 1000bp downstream from the translation stop codon. More than seven hundred regulatory elements were identified from 2000bp upstream, introns and 1000bp downstream of TETs co-regulated genes. About 200 were recovered from sixteen TET genes (no result for TET17), 140 were mapped to 2000bp upstream, 50 to the introns and 22 to 1000bp downstream, respectively, hence, most of the regulatory elements were present in the promoter regions. We mainly focused on the promoter regions in the following analysis. Most of the regulatory elements are identified by DHs, meaning they are functionally related to transcription activity and necessary for the binding of proteins such as TFs. Stress response elements, such as drought, cold and ABA response elements are the major elements present in different TETs, i.e., TET2, TET3 and TET4. ChIP-Seq and ChIP- chip have been well introduced to identify the target genes of MADS-domain TFs and other ABC model related TFs in floral organ development, such as APETALA1 (AP1) (Kaufmann et al., 2010), AGAMOUS-Like15 (AGL15) (Zheng et al., 2009), APETALA2 (AP2) (Yant et al., 2010). The binding sites of these TFs are widely present in the noncoding regions of TET genes. To avoid the repetition, these TFs are excluded from Table 1 and will not be described in this topic but in 4.2.3.
92 Chapter 4
Figure 2. Work flow of regulatory element identification from TETs. The perturbations resulting in up-regulation of TET were selected to create a new dataset. The fold-change is larger than 2, however for some of the TETs the fold- change is set at 1.5, otherwise no perturbation can be identified or not large enough as a dataset for the following co-expression analysis, p-value is always set at smaller than 0.05. The co-regulated genes of TETs were identified from the newly created dataset. The common regulatory elements were mapped to the co-regulated genes first, then sorted and ranked according to the parameters. For a detailed procedure, see METHODS.
Inferring tetraspanins functions by linking experimental data with bioinformatic data 93
Table 1. Selection of the regulatory elements in TETs promoters and introns. The regulatory elements shown in the table are selected from the entire list according to following the criteria: they are mainly identified by DNase I Hypersensitivity (DHs) assays and present at 2kb up-stream regions (except for POLASIG3 and MYB2CONSENSUSAT of TET2 which are in the intron), most importantly, the presence of these regulatory elements can explain TETs expression or response to the perturbations. The common regulatory elements between TET8 and TET9 are underlined. DHs, DNase I Hypersensitive sites. CM, conserved motif identified from orthologs. Motif, raw regulatory element sequence in the dataset. The sequences of the regulatory elements are not shown in the table, only the description is shown. The perturbations that TETs response to are derived from Figure 1 and are listed in the last column. Enrichment-fold is defined as the ratio of observed score over the estimated score. Gene Analysis Description pvalue qvalue Enrichment Function Perturbation -fold TET1 CM IBOXCORE 0.025 0.406 4.469 Involved in binding of MYB factors of light-regulated genes BL, high in tomato (Rose et al., 1999). light CM IBOX 0.046 0.729 5.721 Binding site of light-regulated genes (Giuliano et al., 1988). CM GATA PROMOTER MOTIF 0.044 0.702 3.618 Recognized by all of the GATA family transcription factors (Morceau et al., 2004). TET2 DHs POLASIG3 0.009 0.585 2.769 Abiotic stresses; response to cold (Lindlof et al., 2009). ABA, cold, Motif SV40COREENHAN 0.001 0.046 2.499 Drought response; stomata closure (Fang et al., 2008). drought, DHs MYB2CONSENSUSAT Dehydration response (Guo et al., 2014). heat, 0.007 0.400 4.193 hypoxia Motif TATCCACHVAL21 0.006 0.357 3.101 Fungal infection; GA treatment (Saibo et al., 2003; Bergmann, 2004). TET3 DHs DRE-like promoter motif 0.017 0.255 3.888 Dehydration response (Narusaka et al., 2003). ABA, cold, DHs LTREATLTI78 0.006 0.083 15.268 Low-temperature responsive element (Higo et al., 1999). drought, CBF2 OX, DHs CBFHV Dehydration response (Cakir & Olcay, 2013). 0.029 0.442 3.237 CBF3 OX DHs DRECRTCOREAT 0.006 0.092 5.467 Dehydration response (Cakir & Olcay, 2013). DHs DRE2COREZMRAB17 0.043 0.648 5.319 Dehydration response (Rashid et al., 2013). DHs LTRECOREATCOR15 0.025 0.374 3.423 Cold response (Baker et al., 1994; Jiang et al., 1996). TET4 DHs ABF1 0.004 0.202 5.418 ABSCISIC ACID RESPONSIVE ELEMENT-BINDING ABA, cold, FACTOR 1. Binds to ABA response elements (Choi et al., drought, 2000). CBF3 OX DHs RYREPEATLEGUMINBOX 0.007 0.384 4.543 Seed-specific and ABI3 related element (Chandrasekharan
94 Chapter 4
et al., 2003). DHs ABRERATCAL 0.015 0.835 2.355 Present at the promoter region of AmCBL1 gene. The promoter is a vascular-specific multiple-stress-inducible promoter (Guo et al., 2010). DHs ABRE-like binding site 0.015 0.818 2.867 Present at the ABI4 and ABI5 target genes (Reeves et al., motif 2011). DHs GADOWNAT 0.000 0.001 7.701 Present at GA-downregulated genes and ABA-regulated genes (Ogawa et al., 2003; Huang et al., 2007). DHs RYREPEATBNNAPA 0.006 0.318 3.551 Seed-specific and ABI3 related element (Ezcurra et al., 2000). TET5 DHs AMMORESIIUDCRNIA1 0.019 0.839 5.319 Response to sugar (Li et al., 2006). BL, Hypoxia, Motif SEF1 0.007 0.686 1.895 Sugar response (Contim et al., 2003; Waclawovsky et al., Germination 2006). Motif ANAC092; AT5G39610 0.001 0.086 1.662 Encodes a NAC-domain transcription factor. Positively regulates aging-induced cell death and senescence in leaves (Matallana-Ramirez et al., 2013). TET6 Motif CMSRE-1 0.003 0.094 9.842 Response to sugar (Maeo et al., 2001; Afoufa-Bastien et BL, Hypoxia, al., 2010; Li et al., 2013). Germination TET8 DHs CPBCSPOR 0.001 0.180 1.956 Critical for Cytokinin-enhanced Protein Binding in vitro; Pathogen, pathogen/elicitor related (Fusada et al., 2005; Shi et al., EF-Tu, 2010). FLG22, DHs BES1; AT1G19350 0.001 0.102 1.548 Brassinosteroids, pathogen response (Nakashita et al., Pollen tube 2003; Belkhadir et al., 2012). growth DHs MYB46; AT5G12870 0.000 0.005 3.451 Related to fungus (Ramirez et al., 2011a; Ramirez et al., 2011b). DHs MYB4; AT4G38620 0.006 0.955 1.948 JA, SA, wounding, UV-B (Jin et al., 2000; Schenke et al., 2011). DHs WRKY70;AT3G56400 0.001 0.124 1.763 Function as activator of SA-dependent defense genes and a repressor of JA-regulated genes. MAPK cascade, defense response to bacterium and fungus (Li et al., 2004). DHs AP3SV40 0.003 0.497 2.002 AP-3 binding site consensus sequence in enhancer regions of Simian virus 40, Mouse mammary tumor virus, Murine leukemia viruses, Interleukin 2 (Mercurio & Karin, 1989). DHs CGCGBOXAT 0.000 0.000 3.263 Recognized by AtSR1-6, induced by temperature extremes, UVB, salt, wounding; ethylene, abscisic acid; methyl jasmonate, salicylic acid (Yang & Poovaiah, 2002). DHs -300ELEMENT 0.001 0.192 2.298 Endosperm-specific expression (Thomas & Flavell, 1990).
Inferring tetraspanins functions by linking experimental data with bioinformatic data 95
DHs AACACOREOSGLUB1 0.001 0.120 1.882 Involved in controlling the endosperm-specific expression (Wu et al., 2000). Motif MYB98; AT4G18770 0.007 0.795 1.527 MYB98 is expressed exclusively in the synergid cells. MYB98 also is expressed in endosperm (Kasahara et al., 2005). TET9 DHs CPBCSPOR 0.002 0.141 5.645 Critical for Cytokinin-enhanced Protein Binding in vitro; Pathogen, pathogen/elicitor related (Fusada et al., 2005; Shi et al., EF-Tu, 2010). FLG22, IAA DHs BES1; AT1G19350 0.001 0.126 2.231 Brassinosteroids, pathogen response (Nakashita et al., 2003; Belkhadir et al., 2012). DHs ELRECOREPCRP1 0.000 0.000 4.556 Elicitor Responsive Element core of parsley PR1 genes. Required for elicitor responsiveness. (Rushton et al., 1996; Eulgem et al., 1999) DHs CGCGBOXAT 0.001 0.052 2.280 Recognized by AtSR1-6, induced by temperature extremes, UVB, salt, wounding; ethylene, abscisic acid; methyl jasmonate, salicylic acid (Yang & Poovaiah, 2002). DHs WBBOXPCWRKY1 0.010 0.934 1.808 Elicitor response elements in the promoters of parsley PR1 genes (Rushton et al., 1996).
96 Chapter 4
A. The Regulatory Elements in TET1 Promoter and Intron Are Related to Light Regulation TET1 is up-regulated by high light condition according to the perturbation heat map (Figure 1). The regulatory element analysis shows that light-regulated gene binding sites are enriched at both the promoter and intron region, such as the IBOXCORE and IBOX motif (Giuliano et al., 1988; Rose et al., 1999) (Table 1). Another enriched regulatory element is GATA PROMOTER MOTIF (Table 1) that can be recognized by all of the GATA family TFs (Morceau et al., 2004), including GATA2, which has been identified as a key transcriptional regulator that mediates the crosstalk between brassinosteroid and light signaling pathways (Luo et al., 2010).
B. The Regulatory Elements in TET2 Promoter and Intron Are Related to Stress Response The regulatory elements identified from the TET2 promoter and intron regions are mainly related to stress response, including cold, dehydration, and drought response (Table 1). The combination of closely related elements is important for understanding the regulation of complex cellular processes (Lindlof et al., 2009), such as stomatal closure. The presence of these stress response elements nicely fits with the up- regulation of TET2 in response to ABA, cold and drought (Figure 1), which can induce stomatal closure. Given that TET2 is expressed in the mature stomatal guard cells while no morphological defect was observed, TET2 function in the mature stomatal guard cell might relate to stomatal closure caused by stress condition.
C. The Regulatory Elements in TET3 Promoter Are Related to ABA and Cold Response TET3 is up-regulated by ABA, cold, drought and in CBF3 overexpression background (Figure 1). Interestingly, the TET3 promoter region is enriched with cold and drought responsive elements (Table 1). TET3 expression at the SAM organizing center suggests it might have a role in SAM identity maintenance or floral transition. Temperature has been demonstrated to influence flowering time (Ausin et al., 2005). One of the regulatory elements in the TET3 promoter region is CBFHB that is the binding site of CBF3 (CRT/DRE binding factor 3). CBF3 is rapidly induced in response to low temperature, it encodes a transcription activator that controls the
Inferring tetraspanins functions by linking experimental data with bioinformatic data 97
expression of genes containing the C-repeat/dehydration responsive element in their promoters. Overexpression of CBF3 can induce the expression of target cold- regulated genes (Gilmour et al., 2000). Given TET3 expression pattern, regulatory element at the promoter region and the response to cold, TET3 may have a function in floral transition and the transcriptional level could be cold inducible.
D. The Regulatory Elements in TET4 Promoter Are Related to ABA Response and Tissue-Specific Similar to TET3, TET4 is also up-regulated by ABA, cold, drought and in CBF3 overexpression background (Figure 1). Its promoter is enriched with ABA response elements (Table 1). Interestingly, TET4 harbors tissue-specific regulatory elements (Table 1). RYREPEATLEGUMINBOX and RYREPEATBNNAPA are widely distributed in seed specific promoters of monocots and dicots (Ezcurra et al., 2000; Chandrasekharan et al., 2003). RYREPEATLEGUMINBOX affects spatial regulation in the radicle and mediates high levels of expression in the embryo (Chandrasekharan et al., 2003). ABRERATCAL is present at the promoter region of CBL1 gene that is a calcium sensor regulates drought, cold and salt signals in Arabidopsis, its promoter is vascular-specific and multiple-stress-inducible (Guo et al., 2010). The presence of these regulatory elements in the TET4 promoter region explains TET4 strong expression in the radicle of mature embryo and in the root vascular tissue after germination.
E. The Regulatory Elements in TET5 and TET6 Promoter Regions Are Related to Sugar Response Although TET5 and TET6 have the same expression pattern in the vascular tissues, their promoters do not have the same regulatory elements (Table 1). However, the regulatory elements identified from the promoter region of TET5 (SEF1 and AMMORESIIUDCRNIA1) and TET6 (CMSRE-1) point to the function of sugar response. The soybean Sucrose Binding Protein (GmSBP2) promoter was able to drive the reporter gene expression specifically to the phloem of leaves, stems and roots of tobacco (Contim et al., 2003), several tissue-specific controlling elements were found in the GmSBP2 promoter region, including the SEF1 motif (Waclawovsky et al., 2006). CMSRE-1 element was found to be present at the promoter regions of
98 Chapter 4
the genes that are inducible by sugar, such as β-amylase gene in sweet potato (Maeo et al., 2001) and Calcineurin B-line1 gene in Arabidopsis (Li et al., 2013).
F. TET8 and TET9 Have the Most Regulatory Elements and are Most Diverse TET8 and TET9 promoter regions have the most regulatory elements which are related to diverse functions (Table 1), such as defense and pathogen response, endosperm-specific expression. TET8 and TET9 are highly up-regulated by pathogen and elicitors (Figure 1) and correspondingly, the promoter regions are enriched with common defense response regulatory elements, which is not the case for the other TETs. Additionally, three endosperm-specific expression elements were identified at TET8 promoter region (Table 1), which fits with TET8 expression in the endosperm (Figure 3). One of them is the MYB98 binding site, MYB98 expression is observed in the synergid cells (Kasahara et al., 2005). Presumably TET8 is expressed in the synergid cells as well (Figure 3), this needs further investigation. The regulatory elements identified from TET7, TET10-TET15 do not have clear links to their expression patterns or inducible conditions. Most of these regulatory elements are identified from raw motif dataset.
Figure 3. TET8 promoter activities in endosperm (a) and synergid cells (b). Transgenic plants shown are: pAtTET8:: NLS-GFP-GUS. Arrows indicate endosperm (a) and synergid cells (b), respectively. Scale bars represent 0.1 mm (a) and 0.01 mm (b). (c) scheme of an ovule, adapted from (Sundaresan & Alandete-Saez, 2010).
Inferring tetraspanins functions by linking experimental data with bioinformatic data 99
4.2.3 Inference of TETs Functions by Transcription Factors-TETs Regulatory Network Analysis Genes that are regulated by certain TFs suggest they have similar functions with the TFs and participate in the downstream pathways. ChIP-Seq and ChIP-chip can identify direct target genes of TFs, however, ChIP experiment can be dependent on the tissue or condition, a conserved binding motif analysis of this TF can be used to further extend the set of predicted target genes (Van de Velde et al., 2014). To extend the knowledge about TETs functions in different aspects of plant development, a TFs-TETs transcriptional regulatory network was generated.
A. Generating a Gene Regulatory Network of Upstream Regulators of TETs In order to obtain an understanding of the transcriptional regulation of TETs, different regulatory datasets were integrated to generate an overview (Figure 4). A set of known cis-regulatory motifs were mapped on conserved noncoding sequences in Arabidopsis thaliana (Van de Velde et al., 2014). In this way a conserved motif gene regulatory network was obtained. A subset of this network with regard to the TETs is displayed in the figure as arrows labelled “conserved”. Genes that display differential expression (DE) in publicly available datasets upon perturbation (knock-out or overexpression) of the TFs followed by expression profiling with microarray or RNA- Seq are labelled “DE”. All publicly available TF-ChIP data was reprocessed through an analysis pipeline consisting of quality control, platform-specific signal processing, and peak calling to generate TF-target interactions (Heyndrickx et al. 2014 in press). A subset of this network with regard to the TETs is displayed in the figure as arrows labelled “ChIP”. Co-expression was determined between all TFs and target TET genes using the Pearson correlation coefficient based on 11 CORNET expression compendia (De Bodt et al., 2012). These interactions are shown in different colours in the figure with the specific expression compendium mentioned for each colour.
B. The Regulatory Network Provides Insights into TETs Functions Most of the TETs are regulated by multiple TFs, i.e. TET3, TET4, TET8, TET9 and TET14. Some duplicated TETs share common TFs, i.e. TET3 and TET4, TET8 and TET9. TETs are regulated in distinct pathways, such as light response, circadian clock, floral organ identity, flowering initiation and defense response. Genetic manipulation of the TFs would result in the differential expression of TF and
100 Chapter 4
eventually of its the target genes. Thus the transcription rates of TETs in the TFs perturbed genetic backgrounds were checked in Genevestigator and summarized in Figure 5 to facilitate the interpretation of TFs-TETs regulation. By analysing and integrating TFs function and expression patterns from published data, TETs expression patterns described in Chapter 1 and the transcription rates information between TFs and TETs collected from Genevestigator, TETs functions were inferred.
Figure 4. TFs-TETs regulatory network. Nodes and arrows depict genes and regulatory interactions, yellow and grey rounded rectangles are TFs and TETs, respectively. The arrows do not represent any positive or negative regulation between the TFs and TETs. Regulation identified by ChIP-Seq
Inferring tetraspanins functions by linking experimental data with bioinformatic data 101
and conserved binding motif are shown with doubled lines and solid lines, respectively. Differentially expressed regulation is shown with dashed lines. Condition-specific co-expression are shown in different colors: leaf (green), seed (purple), root (red), abiotic (yellow), biotic (brown), development (orange), stress (pink) and hormone (blue). TETs were identifed from the top 300 co-expression genes with the TFs. The binding motif of TFs identified by ChIP and conserved motif in this figure are the same as those in Table 1. To avoid repetition, they are only described in this topic. AGL15: AGAMOUS-LIKE 15, AP1: APETALA1, AP2: APETALA2, AP3: APETALA3, ATAF2: ARABIDOPSIS NAC DOMAIN CONTAINING PROTEIN 81, BES1: BRI1-EMS-SUPPRESSOR 1, EIN3: ETHYLENE-INSENSITIVE 3, ERF115: ETHYLENE RESPONSE FACTOR 115, FHY3: FAR-RED ELONGATED HYPOCOTYLS 3, GL3: GLABRA3, LFY: LEAFY, MYB4: MYB DOMAIN PROTEIN 4, PI: PISTILLATA, PIF4: PHYTOCHROME INTERACTING FACTOR 4, PIF5: PHYTOCHROME INTERACTING FACTOR 5, PRR5: PSEUDO-RESPONSE REGULATOR 5, SEP3: SEPALLATA3, SR1/CAMTA3: SIGNAL RESPONSIVE 1/CALMODULIN-BINDING TRANSCRIPTION ACTIVATOR 3, TOC1: TIMING OF CAB EXPRESSION 1.
102 Chapter 4
Figure 5. Heat map of TFs and the target TETs expression levels in TFs genetic background. (a) Heat map of TFs and the target TETs expression levels as based on the analysis in figure 4. The genetic backgrounds are listed on the top of the heat map. Red and green color represent up- and down-regulation, respectively. Color scale represents fold-change between -2.0 and 2.0, the values beyond this range are shown in the same color as -2.0 and 2.0. “+” indicate the expression levels of the TFs and “x” indicate the target TETs. In “35S::amiR-mads-2_strong” and “pif4-101 pif5-3” backgrounds, the black and white colours are used to distinguish TFs and their respective target TETs. (b) Summary of the correlation between TFs and TETs. Arrows and blunt-ended arrows indicate positive and negative correlation, respectively.
Inferring tetraspanins functions by linking experimental data with bioinformatic data 103
C. TET3 Function is Flowering Response Related Three of the TFs that regulate TET3 identified by ChIP or conserved motif have a function in flowering response (PRR5, Pseudo-Response Regulator 5; AGL15, AGAMOUS-Like 15; PIF4, PHYTOCHROME INTERACTING FACTOR 4). PRR5 positively regulates flowering while AGL15 acts redundantly with AGL18 as a repressor of flowering (Adamczyk et al., 2007; Nakamichi et al., 2007). PIF4 is necessary for the thermal acceleration of flowering in short photoperiods (Kumar et al., 2012). Another flowering gene, LFY (LEAFY), is found to be differentially expressed with TET3 (Figure 4). Overexpressing LFY can result in early flowering (Kobayashi et al., 1999). In the heat map of TFs-TETs expression levels (Figure 5), AGL15 and TET3 expression levels are negatively correlated in agl15 agl18 double mutant background. PIF4 expression level is positively correlated with TET3 (Figure 5). LFY and TET3 expression levels are negatively correlated in all of the five LFY genetic background (Figure 5). During the development, TET3 expression is positively correlated with PPR5 and PIF4 while negatively with AGL15 and LFY, especially at the flowering stage where the expression of AGL15 and LFY increase and TET3 decreases (Figure 6). These results suggest TET3 is differentially regulated by multiple TFs and is involved in flowering response and SAM- inflorescence meristem transition.
104 Chapter 4
Figure 6. Expression level of TET3 and the related TFs in different developmental stages. The developmental stages depicted at the bottom of the figure are: germinated seed, seedling, young rosette, developed rosette, flowering, young flower, developed flower, flowers and silique, mature siliques, senescence. The picture was generated from Genevestigator. Black square indicates TFs and TET3 expression level at flowering. The PI and BES1 TFs that also regulate TET3 are not shown in the figure.
D. TET8 in Defense Response Three of the TFs that regulate TET8 are involved in defense response, such as SR1/CAMTA3 (SIGNAL RESPONSIVE 1; CALMODULIN-BINDING TRANSCRIPTION ACTIVATOR 3), MYB4 and EIN3 (ETHYLENE-INSENSITIVE3) (Figure 4). Loss of function sr1 mutant shows enhanced resistance to fungal and bacterial pathogens, indicating SR1 suppresses defense response (Nie et al., 2012). MYB4 is a transcriptional repressor, its expression is early up-regulated by elicitor FLG22 (Schenke et al., 2011) which can be recognized by LRR receptor kinase FLS2 (FLAGELLIN-SENSITIVE 2) and activate the downstream immune signaling pathway (Asai et al., 2002). Interestingly, FLS2 expression is directly controlled by functionally redundant EIN3 and EIN3-like in an ethylene-dependent manner. ChIP result
Inferring tetraspanins functions by linking experimental data with bioinformatic data 105
confirmed two EIN3 binding sites in FLS2 promoter (Boutrot et al., 2010). TET8 is also identified as the target gene of EIN3 by ChIP (Figure 4). In the heat map of TFs- TETs expression levels, TET8 is up-regulated in two loss of function sr1 alleles and down-regulated in ein3-1eil1-1 double mutant (Figure 5), indicating TET8 expression is antagonistically regulated by SR1 and EIN3 in the immune signaling pathway.
E. TET9 in Trichome Development One of the TFs that regulate TET9 is GL3 (GLABRA 3) (Figure 4), which is involved in both leaf and root epidermal cell fate specification. In the leaf, GL3 is expressed in the area where the trichome is formed and also in the developing and young trichome. It has a role in promoting trichome formation. TET9 is expressed in the leaf, in trichome initial cells and mature trichome (Figure 7). By looking into Arabidopsis tissue specific data source in eFP Browser (Winter et al., 2007), we noticed that TET9 expression level is increased in the gl3-sst sim (glabra3-shapeshifter siamese) double mutant (Figure 7) (Marks et al., 2007; Marks et al., 2009).
Figure 7. TET9 expression pattern. (a) Rosette leaf and mature trichome. (b) SAM and trichome initial cells at leaf primordia indicated by arrows. Transgenic plant shown is pAtTET9:: NLS-GFP-GUS. (c) TET9 expression levels in the trichome of Col-0 (64.46 ± sd 48.17), gl3-sst (62.24 ± sd 24.19), gl3-sst sim double mutant (152.1 ± sd 110.68) and gl3-sst nok double mutant (84.93 ± sd 15.89). Picture modified from eFP Browser (Winter et al., 2007). Scale bars represent 1 mm (a) and 0.1 mm (b).
106 Chapter 4
4.2.4 Experimental Tests of TETs Response to the Perturbations To confirm TET8 in defense response, the elicitors FLG22 and EF-Tu were used to mimic pathogen infection and monitor TET8 expression. TET8 was significantly induced by both FLG22 and EF-Tu (Figure 8). This nicely fits with the perturbation heat map, regulatory elements in the promoter region and TFs-TET8 regulatory network. Moreover, we noticed that TET8 overexpression transgenic seedlings (35S:: TET8-GFP) are lethal, while the transgenic seedlings with GFP fused at the N- terminal of TET8 (35S:: GFP-TET8) or the endogenous promoter fusion (pAtTET8:: TET8-GFP) are normal (Figure 8). N-terminal GFP might interfere with the signal peptide at the TET8 N-terminus and with TET8 localization and proper function.
Figure 8. TET8 expression levels after EF-Tu and FLG22 treatment and transgenic TET8 seedling lethal phenotype. (a) TET8 expression levels measured by qRT-PCR after 2h elicitor treatment at the concentration of 1µM. CYP81F2 and FADLOX were used as positive control (Denoux et al., 2008). Means are presented ± sd. (b) TET8 transgenic seedlings carrying different constructs on 50mg/L kanamycin medium. Left, 28-d-old negative seedling. Middle, 28-d-old 35S:: TET8-GFP seedling. Right, 16-d-old pTET8:: TET8-GFP seedling. The constructs were transformed into Col-0 background.
4.3 DISCUSSION According to the phylogenetic analysis, most of the TETs are duplicated (Wang et al., 2012). However, gene expression analysis using transgenic lines with promoter- reporter gene fusion (proTETs:: NLS-GFP-GUS) showed that the duplicated genes
Inferring tetraspanins functions by linking experimental data with bioinformatic data 107
have divergent expression patterns indicating that the regulatory elements have evolved in the TET promoters, resulting in an altered TET gene expression in space and time, a phenomenon called neofunctionalization (Lucioli et al., 2014). The regulatory elements analysis explained the molecular nature of the divergence. Regulatory elements even differed in TET5 and TET6, that have redundant expression pattern. Meta-analysis of gene response to certain perturbations gives a general idea about the gene function in biological processes. However, these responses, as measured by the differential expression, could be due to the indirect or secondary regulation. The regulatory elements residing in the gene noncoding regions are most responsible for the gene response to the perturbations, as they are the binding sites of the TFs that regulate genes expression. The enrichment of certain stress response regulatory elements can support the hypothesis of response to the perturbations. Furthermore, the regulatory elements analysis also reveals more information that are not reflected by the perturbations, such as tissue specific expression elements and biological function elements such as sugar response and transport. The perturbations selected to generate the heap map (Figure 1) are based on our current knowledge about TETs according to the expression patterns, phenotypes and the correlation between each perturbations. It only represents part of the entire available perturbation in Genevestigator, as a result, some of the perturbations might be overlooked for certain TETs. The identification of upstream transcription factors that bind to these regulatory elements makes the inferences of gene functions more solid, especially when the transcription factors and the target genes have overlapping expression patterns in the tissues and cell types. The results obtained from the three approaches have to be interpreted in an integral level rather than individually. They support each other or one another in hypothesis generating. TET3 is expressed at the SAM organizing center, responds to cold and drought perturbations, cold and dehydration response regulatory elements are enriched at the promoter region, it is regulated by AGL15 and PRR5, all these results indicate that TET3 could have a role in cold induced flowering response. Flowering time is not altered in the knock-out tet3 mutants growing under 21°C, 16h light condition (data not shown), further experiment on flowering time under lower temperature condition will be necessary to validate TET3 function. TET3 function might be also regulated by
108 Chapter 4
light quality and circadian clock, simply because PIF4 also targets TET3. However, PIF4 expression level is increased at higher temperature and it is necessary for the thermal induction of flowering in short photoperiods by activating FLOWERING LOCUS T (FT) (Kumar et al., 2012). FT, SOC1 and LFY are considered as floral integrator genes (Simpson & Dean, 2002). FT is expressed in the leaf phloem and the protein moves to the SAM to activate SOC1, subsequently activating LFY (Corbesier & Coupland, 2006), whose expression level is negatively correlated with TET3, while PIF4 is positively correlated with TET3 (Figure 4, Figure 5). TET3 protein is localized at the plasmodesmata, which is important for the transport between cells and low temperature causes plasmodesmata closure (Bilska & Sowinski, 2010). In conclusion, TET3 might have a role in flowering response and probably is low temperature dependent. TET8 has a role in defense response according to both meta-analysis and experimental analysis, but it is still not clear which pathway(s) it participates in since plant defense involves different mechanisms, such as pattern-triggered immunity and effector-triggered immunity (Jones & Dangl, 2006). The downstream pathways largely overlap (Tsuda & Katagiri, 2010). The phytohormones such as salicylic acid, jasmonic acid and ethylene also contribute to the pathways and the cross talks result in different effects (Robert-Seilaniantz et al., 2011). Regarding TET8 plasma membrane localization (Chapter 3), TET8 might be an upstream component that facilitates signal perception and/or transduction by recruiting other receptors or kinases in its microdomain. But the interacting proteins identified from MINDS are quite limited, most importantly, they have low interaction score, meaning that they are identified only once or twice out of four split-ubiquitin assays (Jones et al., 2014). In order to identify the correct interacting proteins, the pathogen or elicitor treatment should be necessary. Yet, it is not clear whether TET8 has a positive or negative role in defense response, but the results obtained so far seem to point to a positive role, a direct resistance test is still necessary to prove the hypothesis.
4.4 MATERIALS AND METHODS Growth Conditions Seeds were germinated on Murashige and Skoog medium supplemented with 1% (w/v) sucrose, 0.8% (w/v) agarose, pH 5.7. Seeds were vernalized at 4 °C in the darkness for 2 nights and moved to the growth chambers. For elicitors treatment, the
Inferring tetraspanins functions by linking experimental data with bioinformatic data 109
seedlings were transferred into liquid MS medium supplemented with elicitors and kept on the shaker for 1h. RNA preparation, cDNA synthesis, qRT-PCR and X-Gluc were done as Chapter 2.
Heat Map Generation of TETs Response to Different Perturbations Using Genevestigator The perturbations were selected from Genevestigator “Perturbation” tool, covering the categories “biotic, chemical, elicitor, hormone, light intensity, stress and genetic background”. Wild-type genetic background experiments were preferable, unless specified. The values represent fold-change converted from Log(2)-ratio. The values were polled in Excel to generate the heat map with the software “genesis”.
Regulatory Element Analysis in TET Promoter Regions Identification of Co-regulated Genes in Genevestigator 1. Platform: ATH1:22k array (Default). 2. Generation of the perturbation platform: The up-regulated perturbations are first selected for the gene of interest to create a new platform. Fold-change>2 (for some TETs, this can be 1.5 instead of 2.0, otherwise no perturbations can be identified or not large enough as a platform for the following co-expression analysis), p- value<0.05. 3. Co-expression analysis: The co-expressed genes were identified from the perturbation platform across the categories “Anatomy” and “Perturbation”. For each category, top 200 positive correlated genes are shown. Pearson correlation coefficient as the measure of similarity between genes. 4. Co-regulated gene identification: The overlapping genes were defined as co- regulated genes. Regulatory Elements Identification 1. Generation of the motif database: The motif database consists of three different collections: 1), RAW data: Including all the regulatory element sequences identified/predicted so far. 2), DNase I Hypersensitive sites (DHs): Including genome- wide identified regulatory elements in Arabidopsis. 3), conserved motif: The elements that are conserved in promoters (max 2000bp upstream), introns and downstream (max 1000bp) of orthologs, e.g., Arabidopsis tetraspanin is used as reference gene to
110 Chapter 4
generate the orthologous gene family in 11 other genomic sequenced dicot species and the sequence conservation is evaluated. 2. Common regulatory elements identification: The common regulatory elements were identified by aligning the sequences of the promoters, introns and downstream of the co-regulated genes. 3. Candidate regulatory elements identification (parameters to narrow down the list): 1), the common regulatory elements have to be recovered from tetraspanin genes. 2), the regulatory elements have to be at the promoter region, unless identified by DHs or ChIP if they are at the introns. 3), The regulatory elements that are identified by DHs and ChIP are preferable, then the conserved motif and the raw motif.
Generating a Gene Regulatory Network (GRN) of Upstream Regulators of TETs: TFs-TETs Regulatory Network In order to understand the transcriptional regulation of TETs, different regulatory datasets were integrated to generate an overview. A set of known cis-regulatory motifs compiled from the different databases and literature were mapped on conserved non-coding sequences in Arabidopsis thaliana (Van de Velde et al., 2014). In this way a conserved motif gene regulatory network was obtained for 157 TFs for which specific motif information was available. This resulted in a GRN of 40,758 interactions for 11,354 target genes. A subset of this network with regard to the TETs is displayed in the figure as arrows labelled “conserved”. Genes that display differential expression (DE) in publicly available datasets upon perturbation (knock-out or overexpression) of the TF followed by expression profiling with microarray or RNA-Seq are labelled “DE”. All publicly available TF-ChIP data was reprocessed through an analysis pipeline consisting of quality control, platform-specific signal processing, and peak calling. The resulting integrated network comprised 27 unique TFs binding near 15,188 potential target genes, covering 46,619 unique TF-target interactions (Heyndrickx et al. 2014 in press). A subset of this network with regard to the TETs is displayed in the figure as arrows labelled “ChIP”. Co-expression was determined between all TFs and target genes using the Pearson correlation coefficient based on 11 CORNET expression compendia. CAST clustering of the correlation coefficients with an upper limit of 300 interactions was used to
Inferring tetraspanins functions by linking experimental data with bioinformatic data 111
delineate the top 300 co-expressing genes. Only TF-target interactions that showed significant co-expression in less than four compendia were used as an additional filter to obtain specificity. These interactions are shown in different colors in the figure with the specific expression compendium mentioned for each color. For a detailed description, see Van de Velde et al., 2014.
CHAPTER 5 TETRASPANIN1/TORNADO2 AND TORNADO1 TRANSCRIPTOMIC AND PROTEOMIC NETWORKS
Feng Wang1,2, Pia Neyt1,2, Michiel Bontinck1,2, Dominique Eeckhout1,2, Eveline Van De Slijke1,2, Geert Persiau1,2, Geert De Jaeger1,2, Mieke Van Lijsebettens1,2
1Department of Plant Systems Biology, VIB, B-9052 Ghent, Belgium 2Department of Plant Biotechnology and Bioinformatics, Ghent University, B-9052 Ghent, Belgium
Author contributions: F.W. performed the majority of the experiments (transcriptome, double mutants, confocal imaging, Western blot, data analysis) and wrote the chapter. P.N. performed transcriptome, genetic analysis of plant materials and provided technical assistance. M.B., E.V.D.S. and G.P. carried out the TAP experiments. D.E. analyzed the raw TAP list and wrote the method for TAP experiments. F.W., G.D.J. and M.V.L. designed the experiments. G.D.J. and M.V.L. contributed to the writing of the chapter.
114 Chapter 5
ABSTRACT TETRASPANIN1/TORNADO2 (TET1/TRN2) has a function in leaf and root patterning. In trn2 mutants, rosette leaf size was significantly reduced due to the asymmetric and narrow leaf blade, which was caused by severely reduced cell number. Rosette leaves and primary roots showed helical growth phenotypes. A second locus, TRN1, encodes a unique gene with an LRR domain and homology to DAPK or Roco proteins. Its mutant displays phenotypes very similar to the ones of trn2 mutants. In trns, transcripts related to cell cycle process, microtubule-based movement, shoot and leaf development were down-regulated while hormone signaling, biosynthesis processes and defense response were up-regulated. Tandem affinity purification identified the TRN2 putative interacting proteins, FLOT1 and FLOT2, which function in clathrin-independent endocytosis, shoot apical meristem identity maintenance and cell cycle regulation. We speculate that TRNs regulate plant development positively through endocytosis, microtubule-based movement and cell cycle while negatively regulating hormone response.
Tetraspanin1/tornado2 and tornado1 transcriptomic and proteomic networks 115
5.1 INTRODUCTION The shoot apical meristem (SAM) is a small dome shape domain that generates above-ground organs such as leaves, stems and flowers throughout the plant’s lifetime. It is a highly organized structure that contains three different zones: a central zone at the very summit that consists of three layers (L1-L3) of stem cells, which is maintained by an underlying organizing center, the cells at L1 and L2 divide anticlinally while cells at L3 divide in all orientations. As the stem cells continuously divide, their descendants are pushed downward to the rib zone below the organizing center to produce stem tissues. The descendants are pushed outward to the peripheral zone surrounding the central zone to give rise to leaf primordia (Steeves & Sussex, 1989). A typical feature of the stem cells is that they are maintained in an undifferentiated status, i.e. cells are small and cytoplasmic, no differentiated plastids and extremely small vacuoles (Laux et al., 1996). They actively undergo cell division to self-renew and replenish the cells used up for lateral primordia initiation. SAM identity maintenance is crucial for normal plant aerial organ development and structure formation. A gene regulatory network composed of WUS (WUSCHEL) and CLVs (CLAVATA) controls this maintenance (Schoof et al., 2000). The transcription factor WUS expresses in the organizing center and moves to L1 and L2 to activate the expression of CLV3 peptide (Yadav et al., 2011). In turn, CLV3 binds to receptor- like kinase CLV1 to inhibit WUS expression (Schoof et al., 2000; Ogawa et al., 2008). Mutation in WUS results in vacuolated stem cells and a flat SAM structure, disturbed shoot and floral meristem development, ectopic primordia initiation across mutant apices. Another factor in SAM autoregulation is STM (SHOOT MERISTEMLESS), which is expressed in the meristem and required for the shoot meristem maintenance (Barton & Poethig, 1993). STM and its related genes such as KNAT1 are necessary to specify cell indeterminacy between stem cell and primordia (Byrne et al., 2002), for example, STM promotes meristem identity by repressing AS1 (ASYMMETRIC LEAVES1) (Byrne et al., 2000), whose activity is necessary for leaf primordia specification and leaf patterning. In turn, AS1 prevents KNAT1 and KNAT2 expression in primordia founder cells (Byrne et al., 2000). Phytohormone such as cytokinin is also proposed to participates in regulating SAM activity by stimulating cell division through increasing D-type cyclins (Riou-Khamlichi et al., 1999; Fletcher, 2002). Additionally, cytokinin increases the expression of STM and KNAT1, which mutually appear to promote cytokinin accumulation (Fletcher, 2002).
116 Chapter 5
Cell cycle is the most fundamental process in plant post-embryonic development, it enables the meristematic cells to self-renew and produce new cells for organ formation and development, thus the correct regulation of cell cycle is pivotal for normal plant development and architecture. It consists of two major phases: interphase that proceeds in three stages: Gap1 (G1), Synthesis (S) and Gap2 (G2) whereas M phase includes mitosis and cytokinesis. In short, at G1, cells start to grow and expand, organelles like chloroplasts and mitochondria duplicate to prepare for DNA synthesis. At S, the cells replicate their DNA. At G2, the cells continue to grow and prepare for entering the mitotic phase, at M phase, the cells divide into two daughter cells (Dewitte & Murray, 2003). Like in other eukaryotic organisms, the plant cell cycle is governed by cyclin-dependent kinases (CDKs). Different CDK-cyclin complexes trigger the onset of DNA replication and mitosis by phosphorylating a number of substrates at G1/S and G2/M transition points, respectively (Inzé & De Veylder, 2006). The catalytic CDK subunits are responsible for recognizing the substrate proteins, they are inactive unless bound to the appropriate cyclins that have roles in discriminating different substrate proteins. In addition, CDK activities can be inhibited by phosphorylation by WEE1 kinases or the binding of inhibitor proteins that might block the assembly of CDK-cyclin complexes (Dewitte & Murray, 2003). The CDK-cyclin complexes and their regulatory factors guarantee the correct transitions between different phases and the replication of DNA. The mechanical separation of the chromosomes and the division into two daughter cells will take place in the mitotic phase, that includes four sequential phases (prophase, metaphase, anaphase and telophase) and an event called cytokinesis. Although a set of activities takes place successively or simultaneously, such as preprophase band formation, mitotic spindle assembly, chromosomes segregation, phragmoplast formation and cell wall synthesis, they are all related to microtubule-based movement. Microtubules are components of the cytoskeleton. They are found throughout the cytoplasm and formed by the polymerization of globular proteins alpha and beta tubulin (Heald & Nogales, 2002). Microtubules are important for M phase because they rearrange with actin filaments to form the preprophase band to indicate the future division plane and the site where the cell wall will form. As the preprophase band dissolves, the nucleated microtubules form the mitotic spindle and attach to the kinetochores at the centromeres of the chromosomes to segregate them correctly. The microtubules rearrange again to form the phragmoplast to organize the cell wall
Tetraspanin1/tornado2 and tornado1 transcriptomic and proteomic networks 117
synthesis and finally the parent cell divides into two daughter cells (Kost et al., 2002). Microtubule assembly or orientation defective mutants normally result in aberrant cell division or cell morphology (Li et al., 2010; Ambrose et al., 2011; Pietra et al., 2013). In addition to the function in cell division, microtubules also function in determining cell elongation direction and cell morphology. This function is carried out by the cortical microtubule arrays and orientation. In the elongation zone of the Arabidopsis root, the cortical microtubules are arranged into transverse arrays, allowing the cells to elongate perpendicularly to the longitudinal axis (Furutani et al., 2000). Quite a lot of cortical microtubules mutants have some phenotypes in common, such as the helical growth of organs and dwarf seedlings (Buschmann & Lloyd, 2008). TETRASPANIN1/TORNADO2 (TET1/TRN2) has a function in leaf and root patterning (Cnops et al., 2000; Cnops et al., 2006). A second locus, TRN1, encodes a unique gene with an LRR domain and homology to DAPK or Roco proteins that displays mutant phenotypes very similar to trn2 mutants (Cnops et al., 1996b; Cnops et al., 2000; Cnops et al., 2006; Marin et al., 2008). trn mutants have dramatic and pleiotropic phenotypes during development. In trn mutants, rosette leaf size was significantly reduced due to the asymmetric and narrow leaf blade, which was caused by severely reduced cell number and vacuolated cells in leaf primordia. Flow cytometry revealed that the transition from mitotic cell division to cell expansion occurred earlier in trn mutants (Cnops et al., 2006). Double mutant analysis showed that TRN1 and TRN2 are epistatic to AS1 (ASYMMETRIC LEAVES1) in leaf asymmetry (Cnops et al., 2006). Venation patterning in cotyledons and rosette leaves was affected in trn as reflected by lower complexity and less continuity of venation network, which could be caused by altered auxin distribution (Cnops et al., 2006). SAM peripheral zone was enlarged compared to the central stem cell zone in trn2 (Chiu et al., 2007), inflorescence and floral organs development were affected, such as shorter stem, amorphous petals and siliques and the plants were sterile (Olmos et al., 2003). A striking phenotype of trn mutants was twisting and helical growing organs, such as the inflorescence stems, rosette and cauline leaves, carpels and primary roots (Cnops et al., 2000; Cnops et al., 2006; Chiu et al., 2007). In trn mutants, the severe and pleiotropic phenotypes related to SAM identify, leaf development, organ morphology and cell cycle suggest TRNs are key components in signaling pathways. To identify downstream specific and common molecular processes differentially expressed in trn mutants, transcriptome analysis was
118 Chapter 5
performed. Tetraspanins are well known for their roles in signaling pathway by interacting with each other and other proteins within tetraspanin-enriched microdomains. Therefore, with the expectation to identify the interacting proteins of TET1/TRN2 and TRN1, GFP-based pull-down and Tandem Affinity Purification (TAP) were performed, respectively. We postulate that TET1/TRN2 and TRN1 are new components in signaling pathways.
5.2 RESULTS 5.2.1 Transcriptome Analysis of trn Mutants A. A Global Expression Profiling of the trn Mutants A transcriptome analysis of trn1-2 and trn2-4 shoot tissues, including leaf 1 to 4 and the apex, was carried out using Agilent tiling array V4. Since trn homozygotes were sterile, the heterozygous seed stock was used for the experiment, homozygotes were distinguished by leaf phenotype from the wild type and heterozygotes at seedling stage 11 to 13 day-old, with leaves 3 & 4 visible and leaves 1 & 2 fully expanded (stage 1.03) (Boyes et al., 2001). Only homozygotes were harvested for RNA preparation. Compared to the wild type, 2531 and 1483 genes were differentially expressed in trn1-2 and trn2-4 mutants (P<0.05, FC FC>2), of which respectively 857 and 379 were down-regulated while 1674 and 1104 were up-regulated, 216 genes were commonly down-regulated and 762 were commonly up-regulated (Figure 1). BiNGO (Biology Networks Gene Ontology) (Maere et al., 2005) analysis showed no GO category in the common down-regulated dataset, hence, the less stringent FC>1.6 was used, which identified 771 common down-regulated genes (Figure 1).
Figure 1. Overview of the differentially expressed genes in trn mutants identified by Agilent microarray analysis. Venn diagrams showing overlap
Tetraspanin1/tornado2 and tornado1 transcriptomic and proteomic networks 119
between trn1-2 and trn2-4. (a) Down- and up regulated genes identified at P value<0.05 and FC>2. (b) Down-regulated genes identified at P value<0.05 and FC>1.6.
B. Common Down-regulated Biological Processes in trn Mutants BiNGO analysis showed that the down-regulated genes (P<0.05, FC>1.6) participate in three major processes: 1) developmental processes, including shoot formation and leaf development; 2) regulation of biological processes, such as regulation of cell cycle; 3) cellular processes, including microtubule-based movement, cytokinesis, spindle and phragmoplast assembly (Table 1). The genes represented in the GO category of leaf development are mainly transcription factors that function in regulating shoot meristem formation, lateral organ and leaf formation (Table 2), such as TCP family transcription factors (Koyama et al., 2007), GROWTH REGULATING FACTORS and JAGGED transcription factor (Dinneny et al., 2004; Wang et al., 2011). Quite a number of cell cycle regulatory genes were down-regulated in trn mutants (Table 3), in addition to genes related to cytokinesis, spindle and phragmoplast assembly. These GOs correlated with the asymmetric and narrow leaf laminas in trn mutants with severely reduced cell number (Cnops et al., 2006).
120 Chapter 5
Table 1. GO categories in common down-regulated genes. BiNGO identified 58 biological processes at the significance level P<0.05, only the most biologically relevant processes are listed, for a full list, see Supplemental Table 1. Biological processes P-value Cluster Total frequency frequency Developmental phyllome development 1.07E-04 21d /618c 222b/22304a processes leaf development 2.78E-04 19/618 201/22304 stomatal complex development 1.72E-02 5/618 27/22304 shoot formation 3.82E-02 3/618 10/22304 secondary shoot formation 3.82E-02 3/618 10/22304 Regulation of regulation of cell cycle 3.02E-09 21/618 111/22304 biological regulation of development, 3.65E-02 5/618 33/22304 processes heterochronic Cellular microtubule-based movement 7.25E-07 12/618 45/22304 processes cytokinesis 2.02E-05 10/618 41/22304 organelle organization 9.36E-05 36/618 526/22304 phragmoplast assembly 3.97E-04 4/618 6/22304 cytokinesis by cell plate formation 3.97E-04 6/618 19/22304 spindle assembly 3.82E-02 2/618 3/22304 Reproductive anther development 3.82E-02 5/618 34/22304 processes floral organ formation 3.92E-02 4/618 21/22304 Cellular nucleosome assembly 4.19E-03 8/618 55/22304 component chromosome condensation 3.82E-02 2/618 3/22304 organization Metabolic DNA metabolic process 2.36E-03 22/618 311/22304 process reciprocal meiotic recombination 1.75E-02 4/618 16/22304 a, total number of annotated genes in BiNGO. b, total number of genes in the process defined by BiNGO. c, number of down-regulated genes used by BiNGO to make the entire biological process. d, number of down-regulated genes in the process.
Tetraspanin1/tornado2 and tornado1 transcriptomic and proteomic networks 121
Table 2. Genes in leaf development GO category of common down-regulated genes in trn mutants. Minus indicates down-regulation. Gene FC in FC in Description trn1-2 trn2-4 AT3G15030 -2.43 -2.37 TCP4, TCP family transcription factor 4. Plays a pivotal role in the control of morphogenesis of shoot organs. AT5G08070 -2.29 -1.80 TCP17 AT2G45480 -2.01 -1.88 GRF9 (GROWTH REGULATING FACTOR 9), transcription activator that plays a role in the regulation of cell expansion in leaf and cotyledons tissues. AT4G37740 -1.64 -1.71 GRF2, transcription activator. AT1G68480 -2.44 -1.97 JAGGED, zinc finger protein, controls the morphogenesis of lateral organs. AT3G61970 -1.89 -1.71 NAG2 (NGATHA2), transcription factor, regulates lateral organ growth. AT1G01030 -2.14 -2.18 NAG3 AT5G53950 -2.11 -1.67 CUC2 (CUP-SHAPED COTYLEDON 2), transcription activator, regulates SAM formation. Controls leaf margin development and required for leaf serration. AT4G11140 -1.69 -2.02 CRF1 (CYTOKININ RESPONSE FACTOR 1), transcriptional activator, component of the cytokinin signaling pathway involved in cotyledons, leaves and embryos development. AT4G18750 -1.91 -1.89 DOT4 (DEFECTIVELY ORGANIZED TRIBUTARIES 4), involved in leaf and root development. AT5G03790 -2.13 -1.68 ATHB-51 (HOMEOBOX51), transcription factor, has roles in meristem identity and leaf morphogenesis. AT1G04020 -1.80 -1.89 BARD1 (BREAST CANCER ASSOCIATED RING 1), transcription coactivator, loss of function mutations cause defects in meristem organization. AT2G30420 -3.08 -2.54 MYB-like transcription factor ETC2 (ENHANCER OF TRY AND CPC 2), involved in epidermal cell fate specification. AT2G42260 -1.81 -1.76 UVI4 (UV-B-INSENSITIVE 4), negative regulator of the anaphase-promoting complex/cyclosome ubiquitin ligase, inhibits premature cell differentiation. AT5G06650 -4.60 -2.51 GIS2 (GLABROUS INFLORESCENCE STEMS 2), transcription factor, required for the initiation of inflorescence trichomes. AT4G32810 -1.73 -2.50 CCD8 (CAROTENOID CLEAVAGE DIOXYGENASE 8), involved in strigolactones biosynthesis. AT3G17185 -1.92 -1.86 miscRNA, encodes a trans-acting siRNA that regulates the expression of auxin response factor genes. AT3G07610 -1.81 -1.82 IBM1 (INCREASE IN BONSAI METHYLATION 1), histone demethylase, transcription factor. AT5G23940 -1.79 -1.79 HXXXD-type acyl-transferase family protein.
122 Chapter 5
Table 3. Genes in regulation of cell cycle GO category of common down- regulated genes in trn mutants. Minus indicates down-regulation. Gene FC in FC in Description trn1-2 trn2-4 AT2G38620 -4.27 -1.87 CDKB1;2 AT1G73690 -1.90 -2.04 CDKD1;1 AT1G44110 -1.70 -2.02 CYCA1;1 AT1G15570 -2.09 -2.06 CYCA2;3 AT1G80370 -1.90 -1.93 CYCA2;4 AT5G43080 -1.83 -1.80 CYCA3;1 AT4G37490 -1.87 -1.96 CYCB1;1 AT5G06150 -1.73 -1.83 CYCB1;2 AT2G17620 -2.06 -2.25 CYCB2;1 AT1G76310 -1.74 -1.85 CYCB2;4 AT1G16330 -1.70 -1.91 CYCB3;1 AT4G34160 -1.67 -1.62 CYCD3;1 AT5G67260 -2.00 -1.64 CYCD3;2 AT5G10440 -1.93 -1.97 CYCD4;2 AT5G02110 -1.72 -1.87 CYCD7;1 AT4G11920 -1.65 -1.90 CCS52A2 (CELL CYCLE SWITCH PROTEIN 52 A2), required for meristem organization and maintenance of QC identity. AT5G24330 -1.81 -2.02 ATXR6 (TRITHORAX-RELATED PROTEIN 6), may act as a positive regulator of the G1-S transition. AT5G48820 -1.95 -1.74 ICK6 (INHIBITOR/INTERACTOR WITH CYCLIN- DEPENDENT KINASE), binds and inhibits CYCD2- 1/CDKA-1 complex kinase activity. AT2G33560 -1.87 -1.93 Mitotic spindle checkpoint protein BUBR1 (BUDDING UNINHIBITED BY BENZYMIDAZOL 1-RELATED 1), essential component of the mitotic checkpoint. AT3G48160 -2.07 -1.80 DEL1 (DP-E2F-LIKE 1), transcription factor, controls the timing of endocycle onset and inhibits endoreduplication. AT3G57860 -1.72 -1.95 UVI4-LIKE (UV-B-INSENSITIVE 4-LIKE)
C. Common Up-regulated Biological Processes in trn Mutants BiNGO analysis showed the up-regulated genes (P<0.05, FC>2) participate in two major processes: 1), response to stimulus, such as response to hormone stimulus and defense response to fungus; 2), metabolic process, including ethylene and jasmonic acid biosynthetic process (Table 4). Phytohormones have important and pleiotropic roles in regulating plant growth. In trn mutants, a number of phytohormones signaling pathways and biosynthetic pathways were up-regulated, such as jasmonic acid (JA), auxin, salicylic acid (SA), ABA and ethylene (Table 4), suggesting TRNs act as repressors of these signaling and biosynthetic pathways.
Tetraspanin1/tornado2 and tornado1 transcriptomic and proteomic networks 123
The phytohormones such as ethylene, SA and JA not only regulate plant development, but also defense response. It has been shown that excessive endogenous JA synthesis and exogenous application of JA can trigger the inhibition of cell cycle and root growth (Liechti & Farmer, 2002; Światek et al., 2002; Nelissen et al., 2010). It correlated with the inhibited root growth and dwarf phenotype of trn mutants (Cnops et al., 2000), therefore, the following studies focused on TRNs in JA biosynthesis and signaling pathways. The genes represented in the GO category of response to JA stimulus are involved in both JA biosynthetic and signaling pathways (Table 5). LOX3, AOS and AOCs, which are the genes in the first three steps of JA biosynthesis in chloroplast, were highly up-regulated in trn mutants (Table 5). Previously described JA signaling reporter genes, such as VSP1, VSP2 and THI2 are present (Table 5) (Love et al., 2012).
Table 4. GO categories in common up-regulated genes. BiNGO identified 74 biological processes at the significance level P<0.05, only the most biologically relevant processes are listed, for a full list, see Supplemental Table 2. Biological processes P-value Cluster Total frequency frequency metabolic oxylipin biosynthetic process 1.23E-04 6d/601c 24b/22304a process JA biosynthetic process 4.51E-04 6/601 20/22304 ethylene biosynthetic process 3.94E-02 4/601 22/22304 alkene biosynthetic process 4.10E-02 4/601 23/22304 response response to JA stimulus 4.11E-08 21/601 148/22304 to stimulus response to auxin stimulus 4.16E-04 22/601 282/22304 response to wounding 2.27E-03 13/601 133/22304 defense response to fungus 2.59E-03 12/601 117/22304 response to ABA stimulus 1.21E-02 18/601 272/22304 JA mediated signaling pathway 1.34E-02 6/601 39/22304 response to SA stimulus 4.55E-02 10/601 135/22304 cytokinin mediated signaling pathway 4.56E-02 5/601 39/22304 a, total number of annotated genes in BiNGO. b, total number of genes in the process defined by BiNGO. c, number of up-regulated genes used by BiNGO to make the entire biological process. d, number of up-regulated genes in the process.
124 Chapter 5
Table 5. Genes in response to JA stimulus GO category of common up- regulated genes in trn mutants. FC in FC in Gene Description trn1-2 trn2-4 AOS, allene oxide synthase, catalyzes dehydration of AT5G42650 2.36 2.75 the hydroperoxide to allene oxide. AT3G25760 4.12 4.74 AOC1, allene oxide cyclase 1 AT3G25770 11.09 8.09 AOC2, allene oxide cyclase 2 AT3G25780 8.02 6.18 AOC3, allene oxide cyclase 3 LOX3, a lipoxygenase catalyzes the oxygenation of AT1G17420 2.42 2.38 fatty acids. JMT, an S-adenosyl-L-methionine:jasmonic acid AT1G19640 3.52 2.66 carboxyl methyltransferase that catalyzes the formation of methyl jasmonate from jasmonic acid. JA biosynthetic process biosynthetic JA ST2A, a sulfotransferase acts specifically on 11- and At5G07010 3.59 2.46 12-hydroxyjasmonic acid. AT1G17380 5.56 6.87 JAZ5, Jasmonate-zim-domain protein 5 AT1G72450 2.24 2.29 JAZ6 AT2G34600 15.22 21.32 JAZ7
AT1G70700 2.83 3.08 JAZ9 AT3G23240 4.89 3.13 ERF1, ethylene response factor AT5G47220 7.65 6.64 ERF2 AT1G06160 3.19 2.71 ERF59 AT3G16470 4.13 3.59 JR1, JA-responsive gene AT4G23600 4.11 3.00 JR2 VSP1, VEGETATIVE STORAGE PROTEIN 1, an AT5G24780 13.49 11.26 acid phosphatase similar to soybean vegetative storage proteins AT5G24770 11.34 9.42 VSP2 AT3G23250 6.30 5.34 MYB15 THI2, a thionin which is a cysteine rich protein having
JA mediated signaling pathway signaling mediated JA AT1G72260 3.60 7.07 antimicrobial properties AT1G28480 4.16 3.36 GRX480, a member of the glutaredoxin family TAT3, a tyrosine aminotransferase that is responsive AT2G24850 41.08 28.92 to treatment with jasmonic acid
Double mutants were made between trn and JA biosynthetic mutant aos and JA signaling mutant coi1-1. AOS encodes an allene oxide synthase. It catalyzes dehydration of the hydroperoxide to an unstable allene oxide in the early JA biosynthetic pathway in the chloroplast (Delker et al., 2006). COI1 (CORONATINE INSENSITIVE1) encodes an F-box protein and functions as a receptor for jasmonate (Katsir et al., 2008). It forms SCFCOI1 complex with CUL1 and ASK1/2 to target the JAZs proteins for ubiquitination and degradation via the 26S proteasome pathway (Yan et al., 2013). As a result, the transcription factors are released from the repressing complex and activate the downstream signaling pathway (Thines et al.,
Tetraspanin1/tornado2 and tornado1 transcriptomic and proteomic networks 125
2007). qRT-PCR results showed that AOS was up-regulated in both trn1-2 and trn2-4 mutants but COI1 expression level was not affected (Figure 2), which fits with the microarray results. The coi1-1 trn1-5, aos trn1-5, trn2-7 coi1-1 double mutants were obtained in F3 and genotyped. They showed trn phenotypes (Figure 3). However, neither coi1-1 nor aos has a leaf phenotype. Therefore, the double mutant analysis was not informative to conclude that TRNs have functions in JA biosynthetic or signaling pathways.
Figure 2. AOS and COI1 expression levels in trn mutants. Means are presented ± se.
Figure 3. Double mutant phenotypes between trns and aos, coi1-1. The seedlings shown were grown on MS medium horizontally under 16h-light/8h-dark condition for four weeks.
126 Chapter 5
5.2.2 TRN1 and TET1/TRN2 Protein Localization, Western Blot, Tandem Affinity Purification and GFP Pull-down In mammalians, the most common interactors of tetraspanin are specific members of the integrin and the immunoglobulin superfamilies (Levy & Shoham, 2005). However, no plant tetraspanin interactor has been reported so far. In Arabidopsis, TET1/TRN2 has been functionally analyzed before (Cnops et al., 2000; Cnops et al., 2006). A second locus, TRN1, encodes a unique protein with an LRR domain and homology to DAPK or Roco proteins, the trn1 mutant displays phenotypes very similar to those of trn2 mutants (Cnops et al., 1996a; Cnops et al., 2000; Cnops et al., 2006; Marin et al., 2008). TRN1 is predicted to be a cytoplasmic protein. Microarray analysis showed that the common differentially expressed genes in trn mutants are involved in cell cycle, cell division, leaf development, phytohormones biosynthetic and signaling pathways, suggesting TRNs are upstream components of these pathways. Identification of interacting proteins could position TRNs in a specific signaling pathway that would help to understand their functions.
A. Generation of GS-TRN1, RFP-TRN1 and TRN2-GFP Constructs and Plant Materials TRN1 full length genomic sequences with and without stop codon were cloned into the entry vectors. Subsequently, the expression constructs were made with the entry vectors and the destination vectors pKCTAP and pKNGSTAP to generate 35S:: TRN1-GS and 35S:: GS-TRN1 constructs, respectively (Figure 4. GS tag combines two IgG binding domains of protein G from Streptococcus with the streptavidin- binding peptide (SBP) separated by two tobacco etch virus (TEV) protease cleavage sites). The constructs were transformed into both Arabidopsis cell suspension cultures and trn1-2 heterozygous plants. To visualize protein localization, 35S:: TRN1-RFP and 35S:: RFP-TRN1 constructs were transformed into trn1-2 heterozygous plants (Figure 4). 35S:: TRN2-GFP and 35S:: GFP-TRN2 constructs were previously generated in the group and transformed into trn2-4 heterozygous plants (Figure 4). In T2 generation, the number of T-DNA insertion loci was first determined with the resistant and sensitive segregation test by germinating the seeds on medium containing the selective agent. The lines with one insertion locus were used for phenotypic complementation analysis. The result showed that 35S:: GS- TRN1, 35S:: RFP-TRN1 and 35S:: TRN2-GFP complement trn1-2 and trn2-4
Tetraspanin1/tornado2 and tornado1 transcriptomic and proteomic networks 127
phenotypes to wild type plants, respectively. Therefore, the homozygous transgenic plants carrying these constructs were used for future protein localization, TAP and GFP-based pull-down studies.
Figure 4. Schemes of TRN1 and TRN2 expression constructs. For the purpose of phenotype complementation, the tags were fused both behind and in front of the TRNs, respectively. Since trns were sterile, the constructs were transformed into the heterozygous plants. (a) 35S:: TRN1-GS and 35S:: GS-TRN1 constructs. (b) 35S:: TRN1-RFP and 35S:: RFP-TRN1 constructs. (c) 35S:: TRN2-GFP and 35S:: GFP-TRN2 constructs. LB, left border; RB, right border; Kan, kanamycin resistant gene; Bar, Basta; 35S, CaMV promoter; GStag, GS-TAP tag, it combines two IgG binding domains of protein G from Streptococcus with the streptavidin-binding peptide (SBP) separated by two TEV protease cleavage sites; T35S, 35S terminator; prolD, promoter of root-specific rolD root-inducing genes of Agrobacterium rhizogenes; eGFP, enhanced GFP; eGFPER, eGFP with endoplasmic reticulum-targeting signal.
128 Chapter 5
B. TRN1 and TRN2 Protein localization and Western Blot TRN1 is predicted to be localized at the cytoplasm by Cell eFP Browser (Winter et al., 2007). Driven by 35S promoter, RFP-TRN1 cytoplasmic localization was demonstrated (Figure 5). TRN2-GFP was localized at the plasma membrane as visualized by colocalization with the plasma membrane dye FM4-64 (Figure 5). Strikingly, bright spots were observed at the plasma membrane, which might represent local concentration of TRN2-GFP in either tetraspanin webs or in vesicles. In addition, TRN2-GFP was visualized in bright cytoplasmic spots that presumably corresponds to vesicles (Figure 5). These vesicles were located near the foci on the plasma membrane suggesting they originated by internalization or endocytosis. This vesicular localization pattern was more obvious in lateral root cap cells (Figure 5). Since TRN1 is a cytoplasmic protein, buffer HB (Homogenization Buffer) was used for protein extraction and anti-GS antibody was used for its detection. Western blot showed that GS-TRN1 was abundantly expressed in the transgenic seedlings (Figure 6). Some lower molecular weight bands were also observed, which could be due to the nonspecific antibody binding or the protein degradation process via 26S proteasome. To test whether the small fragments were caused by degradation, the plant samples were treated with 50 µM proteasome inhibitor MG132 overnight, no difference between treated and untreated samples was observed (Figure 6), indicating that the small fragments were due to nonspecific binding of the antibody. Different detergents were tested to extract TRN2-GFP protein, i.e. 0.8% DDM (dodecyl maltoside) and 1% digitonin. The results indicated that 0.8% DDM was more efficient than 1% digitonin (Figure 6).
Figure 5. TRN1 and TRN2 protein localization. (a) 35S:: RFP-TRN1 in root epidermal cells. Arrow indicates cytoplasm.
Tetraspanin1/tornado2 and tornado1 transcriptomic and proteomic networks 129
(b) 35S:: TRN2-GFP in lateral root cap cells. Arrows and arrowhead indicate vesicles and plasma membrane visualized by FM4-64 staining, respectively. Scale bars represent 10 µm.
Figure 6. Western blot of GS-TRN1 and TRN2-GFP. For each sample, 50 μg protein samples were loaded on the gel. (a) GS-TRN1 Western blot. The plant samples were grown for 6 days in liquid 1/2 MS medium at 85rpm under 16h-light/8h-dark condition. TRN1 molecular weight: 157kDa, GS tag molecular weight: 20kDa. 1, protein ladder; 2-9, different individual 35S:: GS-TRN1 samples; 10, negative control. The expected bands are indicated with red rectangle. (b) GS-TRN1 Western blot after MG132 treatment. 1, protein ladder; 2-3, 35S:: GS- TRN1 + MG132; 4-5, 35S:: GS-TRN1 + DMSO. (c) TRN2-GFP Western blot. The plant samples were grown for 14 days on MS medium under 16h-light/8h-dark condition. 0.8% DDM and 1% digitonin were used for protein purification. TRN2 molecular weight: 30kDa, GFP molecular weight: 20kDa. 1 & 6, protein ladder; 2, negative control purified with 0.8% DDM; 3, negative control purified with 1% digitonin; 4 & 5, 35S:: TRN2-GFP purified with buffer 0.8% DDM; 7 & 8, 35S:: TRN2-GFP purified with buffer 1% digitonin. The expected bands are indicated with red rectangle.
C. TRN1 Tandem Affinity Purification and TRN2 GFP-based Pull-down for Interacting Proteins For both TRN1 and TRN2, no interacting protein could be identified in Arabidopsis cell suspension culture-derived extracts, which might be due to the non-differentiated
130 Chapter 5
nature of the cell culture. Thus, the following purifications were on seedlings. Only one potential interacting protein was identified for TRN1, which is a 6- phosphogluconate dehydrogenase family protein. Function inferred from the similarity suggests it has a function in catalysing the oxidative decarboxylation of 6- phosphogluconate to ribulose 5-phosphate and CO2, with concomitant reduction of NADP to NADPH. As the protein score is only 56, it is possible that this protein is background. For TRN2, a total of nine GFP-based pull-down experiments were done in seedlings. Two of them failed to recover TRN2, which made the results unreliable, therefore all of the purified proteins were considered as background. We noticed that the growth of 35S:: TRN2-GFP seedlings was delayed compared to the wild type seedlings in these two experiments, leaf 1 and 2 were not visible and the roots were extremely short, which was mainly caused by the half strength MS medium. Thus, the other seven GFP-based pull-down experiments were done with seedlings growing in MS medium for 10 days instead of in half MS medium for 6 days. Moreover, the input protein was increased from 50 mg to 100 mg. Buffer Triton-x-100 and C12E8 were used in four GFP-based pull-down experiments, but no interacting protein were identified. A more sensitive mass spectrometry approach was used in the latest two DDM purifications, as a result, more interacting proteins were identified (Table 6). The photosystem related proteins, with low protein score were abundant in different purification experiments, they might be background. FLOTILLIN1 (FLOT1) and FLOT2 were identified with high protein scores (Table 6, Supplemental Table 3), thus are more likely to be interacting proteins. There are three FLOTs in Arabidopsis thaliana. Sequence similarity from UniProt showed they may act as a scaffolding protein within caveolar membranes, functionally participating in the formation of caveolae or caveolae-like vesicles. FLOT1 has been shown to function in clathrin- independent endocytosis, FLOT1 knockdown mutants showed reduced shoot and root meristem size due to the reduction of cell numbers and the seedlings showed dwarf phenotype (Li et al., 2012). Human flotillin family contains two homologous isoforms that can form homo- and hetero-oligomers to participate in various cellular processes, such as actin cytoskeleton reorganization, endocytosis and cellular signal transduction (Bickel et al., 1997; Langhorst et al., 2005; Babuke & Tikkanen, 2007). Silencing of FLOT1 inhibited breast cancer cell proliferation and tumorigenicity (Lin et al., 2011).
Tetraspanin1/tornado2 and tornado1 transcriptomic and proteomic networks 131
Table 6. TRN2 interacting proteins identified by GFP-based pull-down. exp, experiment. Blank value indicates the protein was not purified in the experiment. digitonin DDM DDM exp 3 exp 8 exp 9 AGI code Description Protein score AT5G25250 FLOT1; FLOTILLIN1 1039 876 AT5G25260 FLOT2 747 563 AT5G46700 TRN2 210 447 479 AT1G54000 GLL22, GDSL-like Lipase 626 423 577 AT3G20370 TRAF-like family protein 226 201 AT3G16470 JAL35, Jacalin-related lectin 35 148 138 AT3G14220 GDSL-like Lipase 84 118 89 AT1G54030 GLL25, MVP1 95 112 106 AT4G02520 GSTF2, glutathione S-transferase PHI 2 111 157 AT4G23600 JR2, JASMONIC ACID RESPONSIVE 2 101 130 AT2G47730 GSTF8, glutathione S-transferase PHI 8 92 125 AT5G57490 VDAC4, voltage dependent anion channel 4 72 AT2G38380 Peroxidase superfamily protein 69 AT1G54040 ESP, epithiospecifier protein 59 149 AT2G30870 GSTF10 54 108 AT3G50820 PSBO2, photosystem II subunit O-2 44 78 AT2G30860 GSTF9; glutathione S-transferase PHI 9 245 AT4G38970 FBA2, fructose-bisphosphate aldolase 2 100 AT2G39310 JAL22 99 AT3G61440 CYSC1, cysteine synthase C1 78 AT1G64200 VHA-E3, vacuolar H+-ATPase subunit E isoform 3 68 AT1G54220 Dihydrolipoamide acetyltransferase 64 AT1G47600 BGLU34, beta glucosidase 34 56 AT1G03130 PSAD-2, photosystem I subunit D-2 230 ATCG00340 PSAB, photosystem I 112 ATCG01060 PSAC, iron-sulfur cluster binding 178
Interestingly, all of the three interacting proteins that had been identified three times are from GDSL-like Lipase family, including GLL22, GLL25/MVP1 and AT3G14220 (Table 6). GLL22 was previously identified as a component of the PYK10/BGLU23 complex (Babuke & Tikkanen, 2007). PYK10/BGLU23 is a β-glucosidase that is a major protein of endoplasmic reticulum (ER) bodies. GLL25/MVP1 is involved in maintaining ER morphology and had been shown to interact with PYK10/BGLU23 and its complex components, one of which is GLL22 (Nakano et al., 2012). Other PYK10 complex components identified as TRN2 interacting protein were JAL35
132 Chapter 5
(Jacalin-related lectin 35) and JAL22, JAL22 was defined as “inhibitor-type lectin” of PYK10/BGLU23 complex as opposed to “polymerizer-type lectin” (Nagano et al., 2008). The uncharacterized BGLU34 and GLL25/MVP1 interacting protein TRAF-like family protein AT3G20370 is also present in the interacting protein list. However, PYK10/BGLU23 is one of the most abundant proteins purified when the TAP experiment was done with seedlings, it even appears in wild-type and GFP control TAP experiments. As a result, PYK10/BGLU23 is always considered as background. Frequently, the components of protein complexes are purified together, so the PYK10/BGLU23 complex components and its interacting proteins mentioned above might be background, especially those only purified once or with low protein scores.
5.3 DISCUSSION Transcriptome analysis of trn mutants showed that the majority of the genes were up- regulated, suggesting a repressive function of TRNs. Among the up-regulated biological processes, phytohormone signaling pathways were prominent, including auxin, JA, SA, ABA and cytokinin signaling pathways. The putative repressive role of TRNs might compare to the TOPLESS (TPL) protein, which is a co-repressor in auxin and JA signaling (Szemenyei et al., 2008; Pauwels et al., 2010). The interactome network revealed a global regulatory role for TPL in hormone response, including ABA, SA and ethylene in addition to auxin and JA as well as in stress response and developmental processes, such as leaf development, meristem maintenance and floral transition (Arabidopsis Interactome Mapping Consortium, 2011; Causier et al., 2012). Thus, TPL appears to be a master co-repressor at the top of the crosstalk between hormone response, development and stress response. TRNs might have similar roles in hormone and stress response. Taking the TRNs protein localization into account, it might be upstream of the signaling pathways, with a function in signal transduction from plasma membrane to nucleus via different cytoplasmic organelles. Hormone signaling pathways are highly dependent on the presence of the hormones. Upon the perception of the hormone molecules by the receptors, the repressive complexes are targeted for degradation, resulting in the release of transcription factors to activate gene expression (Santner & Estelle, 2010). JA biosynthesis related genes were highly up-regulated in trns, suggesting increased JA synthesis and elevated JA concentration, as a result the JA signaling pathway was up-regulated. JA can induce defense response (Robert-Seilaniantz et al., 2011), thus the up-regulated
Tetraspanin1/tornado2 and tornado1 transcriptomic and proteomic networks 133
defense response pathway in trns could be a secondary effect of elevated JA synthesis and concentration or the crosstalk between the hormone signaling. qRT- PCR demonstrated that the JA synthesis, AOS gene expression level was up- regulated in trns, however, the double mutant analysis between trns and aos could not clearly conclude that TRNs functions in JA synthesis. Cell cycle process was affected in trns, as cell cycle related genes were down- regulated, such as the G1/S transition regulators ATXR6 and CYCD3;1 (Menges et al., 2006; Raynaud et al., 2006), the mitotic checkpoint gene BUBR1 and the G2/M transition regulator CYCB1;1 (Qin et al., 1996). Human FLOT1 has a positive role in G1/S phase transition (Lin et al., 2011), the affected cell cycle process in trns, especially in trn2 might at least partially due to the affected G1/S transition through the signaling pathway that requires TRN2-FLOT1 complex since FLOT1 is identified as TRN2 interacting protein in our study. B-type cyclins transcripts are absent until S phase, rise during G2, reach a maximum during G2 and early M phase, and decrease rapidly as M phase progresses (Dewitte & Murray, 2003). A set of B-type cyclins were down-regulated in trns. D-type cyclin expression was associated with proliferating tissues and was excluded from differentiated tissues, for example, overexpression of CYCD3;1 dramatically increased leaf cell number (Dewitte et al., 2003). CYCD3;1 transcripts accumulated in proliferating shoot tissues, i.e. meristem, young leaf and developing vascular tissues (Dewitte et al., 2003). Four of the D-type cyclins were down-regulated in trns including CYCD3;1. Cell number was severely reduced in trns (Cnops et al., 2006), which could be partially due to the down- regulation of a number of cell cycle genes. Although these cell cycle genes are involved in different phases of the cell cycle process, the majority of them are functioning in G1, S and G2 phases, suggesting they affected DNA replication in trns prior to cell division. Interestingly, a few microtubule-based processes were down- regulated in trns, such as spindle and phragmoplast assembly, cell plate formation and cytokinesis, which are required in mitotic phase. These processes are all closely related to microtubule assembly. The down-regulation of these processes, together with the affected interphase, suggest that the reduced cell number in trns was the consequence of several impaired cell cycle stages. Transcription factors regulate cell cycle processes by regulating cyclin expression (Berckmans & De Veylder, 2009), such as TCP family transcription factor TCP20 that binds to the promoter of CYCB1;1 and this binding site was necessary for the high expression level of CYCB1;1 in the
134 Chapter 5
G2/M phase (Li et al., 2005). TCPs have pivotal roles in controlling morphogenesis of cotyledons and leaves, such as TCP4 (Koyama et al., 2007). TCP4 and TCP17 were present in the down-regulated GO cluster “leaf development”, which mainly consists of transcription factors that have functions in regulating lateral organ growth, morphogenesis and meristem organization, such as JAG (Huang & Tindall, 2007), GRF 2 and GRF9 (Wang et al., 2011). The down-regulation of these transcription factors might contribute to the asymmetric leaf morphology, reduced lamina cell number and altered SAM organization in trns (Cnops et al., 2006; Chiu et al., 2007). Apart from participating in cell division processes, the microtubules also have important roles in a number of other cellular processes, such as maintaining the cell structure as they are components of the cytoskeleton and provide the platforms for intracellular transport, i.e. the movement of vesicles (Wacker et al., 1997; Wickstead & Gull, 2011). The cortical microtubules that underlie the plasma membrane are oriented parallel to the cell wall (Lucas & Shaw, 2008). They have important roles in determining the direction of cell elongation and organ growth. In the elongation zone of the Arabidopsis root, the cortical microtubules are arranged in transverse arrays, allowing the cells to elongate perpendicularly to the longitudinal axis (Furutani et al., 2000). In the spr1 (spiral1) and spr2 mutants, the cortical microtubules showed left- handed helical arrays, consequently, the root epidermal cells at the elongation and differentiation zone showed right-handed (corkscrew) helical growth phenotype while the epidermal cells at the root meristem were normal (Furutani et al., 2000). spr2 mutants additionally showed right-handed twisting in petioles, resulting in twisted rosettes. The twisted rosette and dwarf phenotype of spr1 spr2 double mutant resemble trns, but the leaf symmetry was not affected in spr1 spr2 (Furutani et al., 2000). Common phenotypes of most of the irregular microtubule orientation mutants are the helical organ growth and dwarf plants (Buschmann & Lloyd, 2008). A dramatic phenotype of trns is the helical growth of organs, including primary root, rosette leaves, stem and floral organs (Cnops et al., 2000; Chiu et al., 2007), suggesting that the cortical microtubule arrays might be disordered in trns. Indeed, a number of microtubule associated genes are down-regulated in trns. One of the questions is: do TRNs directly or indirectly interact with microtubules to regulate microtubule assembly and arrays? It has been shown that mammalian tetraspanins are anchored to the actin microfilaments cytoskeleton through direct binding to ezrin-radixin-moesin linkers (Sala-Valdes et al., 2006), but the interaction with tubulin microtubules
Tetraspanin1/tornado2 and tornado1 transcriptomic and proteomic networks 135
cytoskeleton has not been reported. Indeed, no actin or tubulin was identified as TRNs interacting protein. Even on the TAP background protein list of TRNs, actins and tubulins do not have very high protein score. This suggests that some proteins may act as bridge to link TRNs to cytoskeleton to maintain cell morphology. TRN2 interacting protein AtFLOTs might be such candidates because human FLOT homo- and hetero-oligomers are anchored to the actin cytoskeleton via interaction with vinexin family members (Kimura et al., 2001). Alternatively, the helical phenotype of trns might be a dose effect caused by the down-regulation of a number of microtubule genes through TRNs-dependent signaling pathway as revealed by the transcriptome analysis. Only few TRN1 and TRN2 interacting proteins were identified by using GS and GFP tags, respectively. A new tag GSgreen has been fused with TRN2 and its endogenous full length promoter into the expression vector pH8m34GW-FAST to generate the pTRN2:: TRN2-GSgreen construct to refine the purification in seedlings (Bontinck et al., unpublished data. In GSgreen tag, IgG are replaced by GFP, allowing localization analysis of the bait, ChIP and single step purification. GFP and SBP are separated by rhinovirus 3C protease). Two purifications with a highly sensitive mass spectrometry identified the interacting proteins of TRN2: FLOT1 and FLOT2 with high protein score. The interaction between tetraspanins and their interacting proteins are highly stoichiometric (Yauch et al., 1998). This higher score of FLOTs than the bait protein itself suggests multiple FLOTs can interact with a single TRN2. This is supported by the presence of multiple predicted palmitoylation sites in TRN2 juxtamembrane regions. The other reason could be the differences in the quantification caused by the ionization efficiency during mass spectrometry. In human, there are only two FLOTs that form homo- or hetero-oligomers while there are three in Arabidopsis, suggesting a different oligomerization mechanism. AtFLOT3 has lower similarity to AtFLOT1 and AtFLOT2 than that between AtFLOT1 and AtFLOT2. AtFLOT1 was identified from detergent-resistant membranes (DRMs) (Neumann-Giesen et al., 2004), that are membrane rafts, a kind of specific plasma membrane microdomains that facilitate cellular trafficking and participate in clathrin- independent endocytosis and signaling (Morrow et al., 2002). Recently, a role for AtFLOT1 in clathrin-independent endocytosis has been demonstrated (Li et al., 2012). In atflot1 knock down mutants, cell division was defective in seedling, the number of cells was reduced at SAM and RAM and cells vacuolated rapidly, resulting in dwarf
136 Chapter 5
seedlings (Li et al., 2012). Additionally, the SAM showed a flat shape rather than dome shape, which resembles the wus mutant (Laux et al., 1996), suggesting cell differentiation occurred earlier and more quickly. A reduced cell proliferation phenotype was observed in human breast cancer cells: upon silencing FLOT1, G1/S phase transition was prevented (Lin et al., 2011). Interestingly, the phenotype was correlated with the transcriptional change of a series of cell cycle genes through up- regulation of the transcription factor FOXO3a, which has been found to be able to up- regulate the CDK inhibitors p21Cip1 and p27Kip1 and down-regulate the CDK regulator cyclin D1 (Huang & Tindall, 2007). Indeed, p21Cip1 and p27Kip1 were up-regulated and CDK regulator cyclin D1 was down-regulated (Lin et al., 2011). The similar phenotypes between trn2, atflot1 and human flot1 suggest that TRN2 might interact with AtFLOTs homo- or hetero-oligomers to recruit other proteins in their microdomains to regulate cell cycle process through clathrin-independent endocytosis. In some mammalian tetraspanins, the intracellular juxtamembrane cysteines are palmitoylated and these palmitoylation sites contribute to their interaction (Charrin et al., 2002; Yang et al., 2002). These cysteines are conserved in nearly all tetraspanins. TRN2 is also predicted to have these cysteines (Boavida et al., 2013). Human FLOTs are membrane associated proteins, but they do not have transmembrane domains. Instead, they also have palmitoylation sites at the N- terminal regions, allowing them to associate with the membrane (Morrow et al., 2002; Neumann-Giesen et al., 2004). Although the palmitoylation sites in AtFLOTs have not been experimentally verified, the sequence alignment between human FLOTs and AtFLOTs might help to predict the palmitoylation sites and support the hypothesis that TRN2 might interact with AtFLOTs.
Tetraspanin1/tornado2 and tornado1 transcriptomic and proteomic networks 137
Figure 7. Model of TRNs signaling pathways. TRNs regulate plant development and defense response through different signaling pathways. TRN2 interacts with FLOTs dimers in the microdomain at the plasma membrane. The signal is transmitted through endocytosis to the nucleus. TRN1 might be a component in the cytoplasm and participate in the signaling transmission. A few downstream signaling pathways are activated or repressed. TRNs negatively regulate hormone response, especially JA synthesis and signaling that function in repressing cell cycle. TRN2 regulates cell cycle directly or indirectly via some of the transcription factors to promote development. The activated microtubule response regulates microtubule-based movement to maintain cell and organ morphology and cell cycle. Alternatively, TRNs might interact with microtubules directly to regulate M phase. The cell wall is shown in single green line; plasma membrane in double blue line; TRN2-FLOTs microdomain in orange. The N-terminal of FLOT1 and FLOT2 are anchored into the plasma membrane without traversing it. For the simplicity, only the FLOT1-FLOT2 heterodimer is shown in the scheme and it is positioned at the N- terminal of TRN2, however, the interaction could form via other palmitoylated intracellular juxtamembrane cysteines of TRN2. Microtubules are in thin blue lines
138 Chapter 5
underneath plasma membrane. Other unidentified putative interacting proteins are shown in grey. TFs, transcription factors; MT, microtubule; CK, Cytokinin; ET, ethylene; ABA, Abscisic acid; SA, Salicylic acid; JA, Jasmonic acid.
5.4 MATERIALS AND METHODS Plant Materials and Growth Conditions The mutant lines trn1-5 (GABI-Kat: 292G08) and trn2-7 (GABI-Kat: 254G01) were obtained from Arabidopsis GABI-Kat (http://www.gabi-kat.de/). The presence of the T- DNA was confirmed by PCR with T-DNA-specific and gene-specific primers (Supplemental Table 4). aos (N6149, At5g42650) and coi1-1 were kindly provided by Prof. Godelieve Gheysen and Prof. Alain Goossens, respectively. aos is a T-DNA insertion knock-out mutant (Park et al., 2002). coi1-1 is a single nucleotide mutation that converted codon 467 (W) into a translation stop codon (Xie et al., 1998). This single nucleotide mutation also changed the Xcm I cleavage site CCA-9N-TGG to CCA-9N-TGA. For coi1-1 genotyping, a 1.5 kb PCR product was first amplified from genomic DNA. Then the PCR product was digested with Xcm I, the PCR product from wild-type DNA was cut into 1 kb and 0.5 kb fragments but the product from homozygous DNA was not. The transgenic lines used for Western blot, TAP and GFP-based pull-down are: 35S:: GS-TRN1 (PKNmTAP-TRN1, #7470, in trn1-2, A-1-3 or A-1-8; 1 insertion locus, phenotype complemented, T3 generation, homozygous), 35S:: TRN2-GFP (TRN2- GN in trn2-4, D-40-7; 1 insertion locus, phenotype complemented, T3 generation, homozygous). Seeds were germinated on Murashige and Skoog medium supplemented with 1% (w/v) sucrose, 0.8% (w/v) agarose, pH 5.7. Seeds on plates were vernalized at 4 °C in the darkness for 2 nights and germinated at 21°C under a 16 h light regime.
Quantitative Real-time PCR (qRT-PCR) Analysis Total RNA was prepared with the RNeasy kit (QIAGEN). One µg RNA was used as template to synthesize cDNA with the iScript cDNA synthesis Kit (Bio-Rad). The expression level was analyzed on a LightCycler 480 apparatus (Roche) with SYBR Green and all reactions were performed in three technical replicates. Expression levels were normalized to reference genes PP2A and UBC.
Tetraspanin1/tornado2 and tornado1 transcriptomic and proteomic networks 139
Microarray Analysis trn1-2, trn2-4 and wild-type WS seeds were sown on 1/2MS medium, vernalized for one night and germinated at 21°C under a 16 h light regime for 11 to 13 days (stage 1.03) (Boyes et al., 2001) until leaves 3 & 4 were visible and leaves 1 & 2 were fully expanded in order to distinguish homozygous mutants from heterozygous or wild- type seedlings. The harvesting started around 10A.M. and only took half hour. The cotyledons were cut off, only the upper vegetative parts were harvested. Total RNA was extracted with the RNeasy Plant Mini Kit (Qiagen) and the samples were analyzed at the VIB MicroArrays Facility (Nucleomics Core, Leuven, Belgium) with the Agilent tiling array V4, a loop design with 4 biological replicates corresponding to 4 pools of 50 to 80 trn plants, and 3 genotypes was proposed, so a total of 6 hybridizations was required. To visualize over-represented Gene Ontology (GO) categories, common up-regulated and down-regulated data sets were analyzed with BiNGO (Biology Networks Gene Ontology) (Maere et al., 2005).
Generation of Expression Vectors and Plant Transformation TRN1 open reading frame sequences were amplified with primers listed in Supplemental Table 4 and cloned into the entry vectors using BP clonase (Invitrogen) to generate the entry clone (Hartley et al., 2000). The expression clones were constructed by LR clonase (Invitrogen) with the entry clone and the destination vector pB7RWG2 (35S:: TRN1- RFP), pB7WGR2 (35S:: RFP-TRN1), pKCTAP (35S:: TRN1-GS), pKNGSTAP (35S:: GS-TRN1) (Bürckstümmer et al., 2006; Karimi et al., 2007; Van Leene et al., 2007; Van Leene et al., 2008). 35S:: TRN2-GFP and 35S:: GFP-TRN2 were previously generated in the group. The positive plasmids were transferred into Agrobacterium tumefaciens pMP90 cells. 35S:: TRN1-RFP, 35S:: RFP-TRN1, 35S:: TRN1-GS and 35S:: GS-TRN1 were transferred into trn1-2 (Ws) heterozygous plants. 35S:: TRN2- GFP and 35S:: GFP-TRN2 were previously transferred into trn2-4 (Col-0) heterozygous plants in the group. Plant transformation was done by floral dip transformation. 25 mg transgenic seeds of the T1 generation was used for high density plating. The resistant seedlings were transferred into soil for T2 generation seed harvest. The number of T-DNA loci was analyzed in 6 to 10 T2 populations per construct after germination on kanamycin or DL-Phosphinothricin. The complementation was analyzed with the lines containing one T-DNA insertion locus in
140 Chapter 5
T2 after germination on growth medium without antibiotics.
Confocal Microscopy Imaging The confocal images were taken with an Olympus Fluo View FV1000 microscope or Zeiss LSM5 Exiter confocal. The fluorescence was detected after a 488 nm (GFP), 543 nm (RFP) and 514 nm (FM4-64) excitation and an emission of 495-520 nm for GFP, 590-620 nm for RFP and 600-700 nm for FM4-64. The seedlings were incubated with 2 µM FM4-64 for 5 min in liquid half MS medium on ice, washed out three times on ice and mounted on the microscopy slide with the same medium.
Western Blot Plant materials (30-40 mg) of 6 day-old in liquid 1/2 MS medium growing at 85 rpm under 16h-light/8h-dark condition or 14 day-old on MS medium under 16h-light/8h- dark condition were ground to homogeneity in liquid nitrogen. For GS-TRN1, 30 µl of
extraction buffer (25 mM Tris-HCl pH7.6, 15 mM MgCl2, 150 mM NaCl, 15 mM p-
Nitrophenyl phospate, 60mM β-glycerophosphate, 0.1% NP-40, 0.1 mM Na3VO4, 1 mM NaF, 1 mM PMSF, 1 μM E64, EDTA-free Ultra complete tablet Easypack (1/10 mL) (Roche Diagnostics, Brussels, Belgium), 5% Ethylene glycol) was added and homogenized by vortex for 1 min. The samples were flash frozen in liquid nitrogen, thawed on ice, homogenized again by vortex for 1 min and centrifuged twice for 15 min at 14000rpm at 4°C, each time the supernatants were kept and transferred into pre-cooled new eppendorf tubes. For TRN2-GFP, DDM and digitonin were dissolved
in A-buffer (25 mM Tris-HCl pH7.6, 15 mM MgCl2, 150 mM NaCl, 15 mM p-
Nitrophenyl phospate, 60 mM β-glycerophosphate, 0.1 mM Na3VO4, 1 mM NaF, 5% Ethylene glycol) to make 4% and 5% stock solution, respectively. To avoid foaming,
24 µl of 40/50 buffer (25 mM Tris-HCl pH7.6, 15 mM MgCl2, 150 mM NaCl, 15 mM p-
Nitrophenyl phospate, 60 mM β-glycerophosphate, 0.1 mM Na3VO4, 1 mM NaF, 1 mM PMSF, EDTA-free Ultra complete tablet Easypack (1/50 mL) (Roche Diagnostics, Brussels, Belgium), 1 μM E64, 5% Ethylene glycol) was added to the ground plant materials for homogenization as described above. Then 6 µl of the stock solution was added to the double homogenized samples and mixed gently by pipetting. The samples were incubated for 1 h at 4°C on a rotating wheel before centrifugation as described above. Protein concentration was determined by Bradford assay (Bio-rad, Hercules, CA). Protein samples were denatured in Laemmli buffer for
Tetraspanin1/tornado2 and tornado1 transcriptomic and proteomic networks 141
10 min at 95°C on a heating block before sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). Fifty µg of total protein extract was resolved by SDS- PAGE on 0.75 mm 12% Mini-PROTEAN® TGXTM precast gels (Bio-Rad, Hercules, CA) for 20 min at 300 V, 400 mA in 1xTGX running buffer. Resolved proteins were transferred to PVDF membrane using Trans-Blot® TurboTM Mini PVDF transfer packs and the Trans-Blot® TurboTM Transfer system (Bio-rad, Hercules, CA). Blotted PVDF membrane was incubated in blocking solution (3% skim milk (w/v) in TBST buffer (50 mM Tris, 150 mM NaCl pH8.0, 0.1% Triton X-100)) overnight at 4°C shaking slowly on an orbital shaker, followed by incubating the membrane with antiPAP (peroxidase- anti-peroxidase, for GS tag) or antiGFP antibodies in blocking solution for 1 h at room temperature shaking slowly on an orbital shaker. Membrane was washed 1 x 15 min and 3 x 5 min with TBST buffer. For GFP tag, membrane was incubated with a secondary antibody in blocking solution for 1 h at room temperature shaking slowly on an orbital shaker, followed by the same washing procedures. Bound antibodies were detected by mixing equal volume of oxidizing reagent and enhanced luminol reagent (Perkinelmer, Waltham, MA), incubating for 1 min and dried with tissues. Membrane was placed in a film cassette and exposed to an Amersham hyperfilm™ ECL film (GE Healthcare, Wauwatosa, WI) in a dark room, where autoradiograms were also developed.
TRN1 Tandem Affinity Purification and LC-MS/MS Analysis Sterilized seeds were germinated in liquid medium (2.15 g/L Murashige and Skoog basal salt mixture (MS), 10 g/L sucrose, 0.5 g/l MES, 0. 1 g/L myo-inositol) in shake flasks under a short day regime (8 h light/16 h dark). After 6 days, seedlings were harvested, frozen in liquid nitrogen and stored at −80°C. Total protein extract preparation, tandem affinity purification and LC-MS/MS analysis was performed as before (Van Leene et al., in press), with some minor adaptations. Briefly, 50 g of seedlings were ground in liquid nitrogen with a kitchen blender for 10 min and 100 ml of ice-cold extraction buffer complemented with 0.1% benzonase was added. The extract was incubated for 30 min at 4°C. After two centrifugation steps of 20 min at 36,900 g at 4°C, the extract was filtered through a double layer of Miracloth. Protein concentration was determined via the Bradford protein assay (BIORAD). The whole protein extract was loaded on 250 μL IgG Sepharose beads in a polyprep column with a peristaltic pump at a flow rate of 1 mL/min. After washing the column with 37.5
142 Chapter 5
mL wash buffer, the IgG beads were transferred to a 1.5 mL Protein LoBind tube. 100U TEV protease was added and the beads were incubated for 1 h at 4°C on a tube rotator. After 30 min, an additional 100U protease was added. The mixture was transferred to a Mobicol column and the eluate collected in a 2-mL Protein LoBind tube. The beads were washed two times with 500 μL wash buffer, this was added to the eluate. The pooled eluate (2 mL) was incubated on 100 μL equilibrated Streptavidin beads for 1 h at 4°C on a tube rotator in the 5-mL tube. The mixture was transferred to a polyprep chromatography column and washed with 10 mL wash buffer on a vacuum manifold system. 1 mL Streptavidin elution buffer was applied to the polyprep column for 5 min and the eluate was slowly collected by gravity in a 1.5- mL Protein LoBind tube. Per 1-mL Streptavidin eluate, 333 μL trichloroacetic acid was added to obtain a final concentration of 25%. The proteins were precipitated by incubating the mixture overnight ice. Precipitated proteins were centrifuged down at 20,800 g in a microfuge for 15 min at 4°C. The supernatant was removed carefully and the pellet was washed twice with 500 μL ice-cold HCl/acetone solution. Precipitated proteins were centrifuged down at 20,800 g in a microfuge for 15 min at 4°C. The supernatant was removed and the pellet air-dried. The pellet was dissolved in 30 μl 1× NuPAGE Sample Buffer, heated for 10 min at 70°C and separated in a short run of 7 min on a 4%–12% gradient NuPAGE gel (Invitrogen). Proteins were visualized with colloidal Coomassie Brilliant Blue staining. A broad zone, containing all eluted proteins, was cut from the protein gel, sliced into 24 gel plugs, and processed and digested with trypsin as one sample. LC-MS/MS runs on LTQ Orbitrap Velos, and peak list generation and submission for protein homology-based identification on the TAIRplus database were done as described in Van Leene et al., in press. A list of background proteins was assembled by combining background proteins our previous background list (Van Leene et al., 2010) and background proteins from control GS purifications on mock, GFP-GS, and GUS-GS cell culture and seedlings extracts, identified with LTQ Orbitrap VELOS. To obtain the final list of interactors, this background list was subtracted from the list of identified proteins.
TRN2 GFP-Based Pull-Down and LC-MS/MS Analysis Sterilized seeds were germinated in liquid medium (2.15 g/L Murashige and Skoog basal salt mixture (MS), 10 g/L sucrose, 0.5 g/L MES, 0. 1 g/L myo-inositol) in shake flasks under a short day regime (8 h light/16 h dark). After 10 days, seedlings were
Tetraspanin1/tornado2 and tornado1 transcriptomic and proteomic networks 143
harvested, frozen in liquid nitrogen and stored at −80°C. Total protein extract preparation was performed as before (Van Leene et al., 2010), with some minor adaptations. Briefly, 15 g of seedlings were grinded in liquid nitrogen in a blender and 30 ml of extraction buffer complemented with 0.1% benzonase and 1% DDM or 1% digitonin was added. The extract was incubated for 30 min at 4°C. After two centrifugation steps of 20 min at 36,900 g, the extract was filtered through a double layer of Miracloth. Protein concentration was determined via the Bradford protein assay (BIORAD). 100 mg protein was incubated with 30 μl effective, pre-equilibrated GFP-Trap_A agarose beads (Chromotek) for 1 h, gently rotating at 4°C. The unbound fraction was removed from the beads after a centrifugation at 450 g for 5 min at 4°C. Beads were transferred to a Mobicol column and washed with 6 ml wash buffer containing 0.2% DDM. The bound fraction was eluted with 40 μl 1xNuPAGE (Invitrogen) sample buffer at 70°C with regular mixing. Eluted proteins were precipitated by adding 9 volumes of ice-cold EtOH and overnight incubation at −70°C. Precipitated proteins were centrifuged at 13,000 g for 20 min at 4°C. EtOH was removed and the pellet air-dried. The pellet was dissolved in 30 μl 1× NuPAGE Sample Buffer, heated for 10 min at 70°C and separated in a short run of 7 min on a 4%–12% gradient NuPAGE gel (Invitrogen). Proteins were visualized with colloidal Coomassie Brilliant Blue staining. A broad zone, containing all eluted proteins, was cut from the protein gel, sliced into 24 gel plugs, and processed and digested with trypsin as one sample. LC-MS/MS runs on LTQ Orbitrap Velos, and peak list generation and submission for protein homology-based identification on the TAIRplus database were done as described in Van Leene et al., in press. A list of nonspecific background proteins was assembled by combining background proteins from control GFP pull downs on mock, GFP and GUS-GFP cell culture and seedlings extracts, with our previous background list (Van Leene et al., 2010) and background proteins from control GS purifications on mock, GFP-GS, and GUS-GS cell culture and seedlings extracts, identified with LTQ Orbitrap VELOS. To obtain the final list of interactors, this background list was subtracted from the list of identified proteins.
144 Chapter 5
SUPPLEMENTAL DATA Supplemental Table 1. 58 GO categories in common down-regulated genes. Cluster Total Biological processes P-value frequency frequency regulation of cell cycle 3.02E-09 21d/618c 111b/22304a microtubule-based process 1.51E-07 18/618 101/22304 microtubule-based movement 7.25E-07 12/618 45/22304 cell cycle process 1.58E-06 18/618 122/22304 cell cycle 1.58E-06 20/618 152/22304 cytokinesis 2.02E-05 10/618 41/22304 organelle organization 9.36E-05 36/618 526/22304 anatomical structure formation involved 1.07E-04 14/618 103/22304 in morphogenesis phyllome development 1.07E-04 21/618 222/22304 shoot development 1.07E-04 25/618 300/22304 shoot system development 1.24E-04 25/618 304/22304 leaf development 2.78E-04 19/618 201/22304 DNA conformation change 3.18E-04 12/618 87/22304 organ development 3.18E-04 42/618 719/22304 system development 3.18E-04 42/618 720/22304 DNA packaging 3.18E-04 10/618 60/22304 chromosome organization 3.73E-04 19/618 210/22304 phragmoplast assembly 3.97E-04 4/618 6/22304 assembly of actomyosin apparatus 3.97E-04 4/618 6/22304 involved in cell cycle cytokinesis actomyosin structure organization 3.97E-04 4/618 6/22304 cytokinesis by cell plate formation 3.97E-04 6/618 19/22304 cell cycle cytokinesis 9.71E-04 6/618 22/22304 cellular component organization 1.34E-03 48/618 935/22304 cell division 1.60E-03 10/618 75/22304 DNA metabolic process 2.36E-03 22/618 311/22304 multicellular organismal development 3.36E-03 72/618 1655/22304 cellular component assembly 4.02E-03 19/618 258/22304 nucleosome assembly 4.19E-03 8/618 55/22304 nucleosome organization 4.19E-03 8/618 55/22304 anatomical structure development 4.88E-03 62/618 1392/22304 chromatin assembly 5.06E-03 8/618 57/22304 chromatin assembly or disassembly 5.38E-03 9/618 73/22304 protein-DNA complex assembly 5.39E-03 8/618 58/22304 multicellular organismal process 6.00E-03 73/618 1732/22304 cell cycle phase 6.05E-03 9/618 75/22304 M phase 7.91E-03 8/618 62/22304 cytokinetic process 8.59E-03 4/618 13/22304 developmental process 8.59E-03 75/618 1820/22304 shoot morphogenesis 1.08E-02 13/618 157/22304 chromatin organization 1.26E-02 13/618 160/22304
Tetraspanin1/tornado2 and tornado1 transcriptomic and proteomic networks 145
nucleic acid metabolic process 1.48E-02 41/618 866/22304 cellularization 1.54E-02 3/618 7/22304 stomatal complex development 1.72E-02 5/618 27/22304 reciprocal meiotic recombination 1.75E-02 4/618 16/22304 regionalization 2.32E-02 9/618 93/22304 regulation of biological process 2.54E-02 103/618 2783/22304 anatomical structure morphogenesis 2.54E-02 27/618 515/22304 meiosis I 2.54E-02 5/618 30/22304 organ morphogenesis 2.74E-02 13/618 178/22304 meiotic cell cycle 2.74E-02 7/618 61/22304 cytoskeleton organization 2.76E-02 9/618 97/22304 regulation of development, heterochronic 3.65E-02 5/618 33/22304 shoot formation 3.82E-02 3/618 10/22304 secondary shoot formation 3.82E-02 3/618 10/22304 chromosome condensation 3.82E-02 2/618 3/22304 spindle assembly 3.82E-02 2/618 3/22304 anther development 3.82E-02 5/618 34/22304 floral organ formation 3.92E-02 4/618 21/22304 a, total number of annotated genes in BiNGO. b, total number of genes in the process defined by BiNGO. c, number of down-regulated genes used by BiNGO to make the entire biological process. d, number of down-regulated genes in the process.
Supplemental Table 2. 74 GO categories in common up-regulated genes. Biological processes P-value Cluster Total frequency frequency response to stimulus 2.63E-21 182d/601c 3207b/22304a response to chemical stimulus 1.17E-20 121/601 1710/22304 response to organic substance 1.07E-16 83/601 1037/22304 response to endogenous stimulus 2.10E-14 69/601 835/22304 response to stress 1.79E-12 108/601 1853/22304 response to other organism 4.68E-09 44/601 528/22304 response to biotic stimulus 4.68E-09 45/601 550/22304 response to hormone stimulus 1.32E-08 54/601 767/22304 defense response 1.37E-08 48/601 637/22304 response to jasmonic acid stimulus 4.11E-08 21/601 148/22304 multi-organism process 5.46E-07 47/601 694/22304 response to fungus 1.50E-05 18/601 156/22304 response to water 2.27E-05 20/601 196/22304 oxylipin metabolic process 3.82E-05 8/601 29/22304 response to water deprivation 4.44E-05 19/601 188/22304 jasmonic acid metabolic process 8.12E-05 7/601 23/22304 response to auxin stimulus 4.16E-04 22/601 282/22304
146 Chapter 5
jasmonic acid biosynthetic process 4.51E-04 6/601 20/22304 response to abiotic stimulus 9.08E-04 56/601 1168/22304 response to cold 1.23E-03 19/601 241/22304 oxylipin biosynthetic process 1.23E-03 6/601 24/22304 response to wounding 2.27E-03 13/601 133/22304 defense response to fungus 2.59E-03 12/601 117/22304 response to chitin 3.71E-03 11/601 104/22304 response to osmotic stress 4.77E-03 24/601 388/22304 response to salt stress 1.01E-02 22/601 360/22304 cellular response to chemical stimulus 1.01E-02 22/601 361/22304 response to oxidative stress 1.14E-02 17/601 247/22304 response to abscisic acid stimulus 1.21E-02 18/601 272/22304 cellular amino acid derivative metabolic process 1.34E-02 16/601 231/22304 cellular response to endogenous stimulus 1.34E-02 17/601 254/22304 jasmonic acid mediated signaling pathway 1.34E-02 6/601 39/22304 cellular response to jasmonic acid stimulus 1.34E-02 6/601 39/22304 secondary metabolic process 1.54E-02 20/601 330/22304 cellular response to boron levels 1.54E-02 2/601 2/22304 response to boron 1.54E-02 2/601 2/22304 cellular response to stimulus 1.54E-02 35/601 729/22304 cellular amino acid derivative biosynthetic process 1.54E-02 13/601 171/22304 response to inorganic substance 1.54E-02 24/601 434/22304 cellular response to cold 1.91E-02 3/601 8/22304 aging 3.11E-02 8/601 82/22304 response to temperature stimulus 3.49E-02 20/601 359/22304 cytokinin biosynthetic process 3.65E-02 3/601 10/22304 response to herbivore 3.65E-02 2/601 3/22304 arsenite transport 3.65E-02 2/601 3/22304 cold acclimation 3.65E-02 4/601 21/22304 monocarboxylic acid metabolic process 3.91E-02 17/601 290/22304 cellular response to external stimulus 3.91E-02 10/601 128/22304 cellular response to extracellular stimulus 3.91E-02 10/601 128/22304 ethylene metabolic process 3.94E-02 4/601 22/22304 ethylene biosynthetic process 3.94E-02 4/601 22/22304 carboxylic acid metabolic process 4.10E-02 29/601 620/22304 oxoacid metabolic process 4.10E-02 29/601 620/22304 alkene biosynthetic process 4.10E-02 4/601 23/22304 cellular alkene metabolic process 4.10E-02 4/601 23/22304 cellular response to organic substance 4.10E-02 18/601 323/22304 organic acid metabolic process 4.10E-02 29/601 621/22304 response to carbohydrate stimulus 4.10E-02 12/601 177/22304 small molecule biosynthetic process 4.10E-02 29/601 622/22304 response to metal ion 4.10E-02 19/601 350/22304 response to cytokinin stimulus 4.10E-02 7/601 72/22304 response to salicylic acid stimulus 4.55E-02 10/601 135/22304 cytokinin mediated signaling pathway 4.56E-02 5/601 39/22304 cellular response to cytokinin stimulus 4.56E-02 5/601 39/22304
Tetraspanin1/tornado2 and tornado1 transcriptomic and proteomic networks 147
cellular ketone metabolic process 4.56E-02 29/601 630/22304 lipid transport 4.63E-02 10/601 137/22304 nicotianamine biosynthetic process 4.63E-02 2/601 4/22304 nicotianamine metabolic process 4.63E-02 2/601 4/22304 boron transport 4.63E-02 2/601 4/22304 glycolipid transport 4.63E-02 2/601 4/22304 lipid metabolic process 4.63E-02 27/601 578/22304 innate immune response 4.69E-02 15/601 257/22304 response to nematode 4.89E-02 6/601 58/22304 response to extracellular stimulus 4.93E-02 10/601 140/22304 a, total number of annotated genes in BiNGO. b, total number of genes in the process defined by BiNGO. c, number of up-regulated genes used by BiNGO to make the entire biological process. d, number of up-regulated genes in the process.
148 Chapter 5
Supplemental Table 3. Protein identification details. Obtained with the LTQ Orbitrap Velos (Thermo Fisher Scientific) and Mascot Distiller software (version 2.5, Matrix Science) combined with the Mascot search engine (version 2.4, Matrix Science) using the Mascot Daemon interface (Matrix Science) and database TAIR10plus. pep_exp_mr: experimental relative molecular mass; pep_calc_mr: calculated relative molecular mass; pep_delta: difference (error) between the experimental and calculated masses; pep_start: peptide start position in protein; pep_end: peptide end position in protein; pep_miss: number of missed enzyme cleavage sites; pep_score: peptide ions score; pep_expect: expectation value for the peptide match (The number of times we would expect to obtain an equal or higher score, purely by chance. The lower this value, the more significant the result); pep_seq: peptide sequence. Experiment 8, DDM pep_exp_mr pep_calc_mr pep_delta pep_start pep_end pep_miss pep_score pep_expect pep_seq 798.4976 798.4963 0.0013 217 224 0 49.56 0.00015 AGLLANIK
1093.5062 1093.5040 0.0022 254 262 0 62.97 0.000025 NAETEDIFR
rotein 1792.8424 1792.8448 -0.0024 136 150 0 101.59 3.8E-09 TCLSTTTICPELNQR p 1806.8606 1806.8604 0.0002 136 150 0 85.72 1.5E-07 TCLSTTTICPELNQR 1846.8890 1846.8890 0 108 122 0 86.45 1.3E-07 AYLEYSLQDFSGWLR 1846.8902 1846.8890 0.0012 108 122 0 104.77 1.9E-09 AYLEYSLQDFSGWLR score:447 2002.9886 2002.9901 -0.0015 108 123 1 46.26 0.0014 AYLEYSLQDFSGWLRR
2907.3671 2907.3684 -0.0013 151 175 1 87.68 7.2E-08 YTLAQDFFNAHLDPIQSGCCKPPTK TET1/TRN2, 2907.3684 2907.3684 0.0001 151 175 1 83.44 1.9E-07 YTLAQDFFNAHLDPIQSGCCKPPTK 1015.5669 1015.5662 0.0007 195 204 0 58.09 0.000092 TGLTLQNAAK
1049.5388 1049.5393 -0.0005 323 331 0 58.58 0.000078 QAEAVLYEK
1070.5025 1070.5033 -0.0008 340 349 0 74.18 1.1E-06 AQADAAFYSK 1173.5883 1173.5877 0.0006 275 284 0 62.91 0.000032 EAELQTQVEK 1377.6784 1377.6776 0.0008 71 82 0 108.58 9.2E-10 VDDDDALILYAR 1392.6671 1392.6673 -0.0003 310 320 0 76.59 1.4E-06 VQEANWELYNK 1468.7300 1468.7305 -0.0005 108 120 0 98.79 7.3E-09 VLAASMTMEEIFK 1484.7253 1484.7255 -0.0002 108 120 0 59.02 0.000067 VLAASMTMEEIFK
roteinscore: 1039 1525.9013 1525.9021 -0.0008 57 70 0 61.97 5.6E-06 LPFVLPAVFTIGPR p 1525.9021 1525.9021 0 57 70 0 80.06 8.3E-08 LPFVLPAVFTIGPR 1648.8673 1648.8672 0.0002 7 22 0 99.22 6.5E-09 ASQYLAITGAGIEDIK
FLOT1, 1666.7977 1666.7985 -0.0007 369 382 0 98.37 8.5E-09 TLLDAVQNDYSCLR 1747.9100 1747.9104 -0.0004 352 368 0 86.9 1.3E-07 EAEGLVALASAQGTYLR 1748.9137 1747.9104 1.0033 352 368 0 56.29 0.00013 EAEGLVALASAQGTYLR
Tetraspanin1/tornado2 and tornado1 transcriptomic and proteomic networks 149
1767.8857 1767.8865 -0.0008 383 397 0 121.6 4.4E-11 DFLMINNGIYQEIAK 1783.8801 1783.8814 -0.0013 383 397 0 111.5 4.4E-10 DFLMINNGIYQEIAK 1884.8553 1884.8537 0.0016 410 428 0 45.36 0.0011 ISVWNHGGEQGGGSGNAMK 1900.8486 1900.8486 0 410 428 0 85.47 9.6E-08 ISVWNHGGEQGGGSGNAMK 1900.8494 1900.8486 0.0007 410 428 0 71.32 2.4E-06 ISVWNHGGEQGGGSGNAMK 1978.9781 1978.9789 -0.0008 151 167 0 90.28 6E-08 QLVDVPGHEYFSYLGQK 2018.9630 2018.9657 -0.0027 90 107 0 92.34 3.3E-08 DSNHVHELVEGVIEGETR 1015.5669 1015.5662 0.0007 195 204 0 58.09 0.000092 TGLTLQNAAK 1049.5388 1049.5393 -0.0005 323 331 0 58.58 0.000078 QAEAVLYEK 1101.4973 1101.4978 -0.0005 340 349 0 53.39 0.000082 AEADATFYSK 1173.5883 1173.5877 0.0006 275 284 0 62.91 0.000032 EAELQTQVEK 1377.7169 1377.7140 0.0029 71 82 0 96.48 1.3E-08 VDDTEALILYAR 1392.6671 1392.6673 -0.0003 310 320 0 76.59 1.4E-06 VQEANWELYNK 1468.7300 1468.7305 -0.0005 108 120 0 98.79 7.3E-09 VLAASMTMEEIFK 1484.7253 1484.7255 -0.0002 108 120 0 59.02 0.000067 VLAASMTMEEIFK 1525.9013 1525.9021 -0.0008 57 70 0 61.97 5.6E-06 LPFVLPAVFTIGPR
1525.9021 1525.9021 0 57 70 0 80.06 8.3E-08 LPFVLPAVFTIGPR roteinscore: 747
p 1648.8673 1648.8672 0.0002 7 22 0 52.38 0.00031 ASQYLAITGGGIEDIK 1666.7977 1666.7985 -0.0007 369 382 0 98.37 8.5E-09 TLLDAVQNDYSCLR 1675.7905 1675.7916 -0.0011 35 48 0 54.4 0.00019 CTVFDVSPVNYTFK
FLOT2, 1747.9100 1747.9104 -0.0004 352 368 0 86.9 1.3E-07 EAEGLVALASAQGTYLR 1748.9137 1747.9104 1.0033 352 368 0 56.29 0.00013 EAEGLVALASAQGTYLR 1755.8486 1755.8501 -0.0015 383 397 0 95.61 1.7E-08 DFLMINNGTYQEIAK 1978.9781 1978.9789 -0.0008 151 167 0 90.28 6E-08 QLVDVPGHEYFSYLGQK 2008.9817 2008.9814 0.0003 90 107 0 71.9 0.000004 QSNHVNELVEGVIEGETR Experiment 9, DDM 798.4954 798.4963 -0.0009 217 224 0 53.52 0.00004 AGLLANIK 1093.5030 1093.5040 -0.001 254 262 0 63.68 0.000017 NAETEDIFR 1107.5187 1107.5196 -0.001 254 262 0 46.28 0.001 NAETEDIFR
1792.8451 1792.8448 0.0003 136 150 0 101.59 3.8E-09 TCLSTTTICPELNQR
roteinscore: 1806.8597 1806.8604 -0.0007 136 150 0 88.92 7.5E-08 TCLSTTTICPELNQR p
447 1807.8648 1806.8604 1.0044 136 150 0 82.89 3.3E-07 TCLSTTTICPELNQR 1846.8888 1846.8890 -0.0002 108 122 0 113.58 2.5E-10 AYLEYSLQDFSGWLR 1846.8890 1846.8890 0 108 122 0 72.53 3.1E-06 AYLEYSLQDFSGWLR 2907.3644 2907.3684 -0.0039 151 175 1 92.18 2.5E-08 YTLAQDFFNAHLDPIQSGCCKPPTK
TET1/TRN2, 2908.3679 2907.3684 0.9995 151 175 1 43.08 0.0021 YTLAQDFFNAHLDPIQSGCCKPPTK
150 Chapter 5
1015.5643 1015.5662 -0.0019 195 204 0 67.56 0.000014 TGLTLQNAAK 1049.5363 1049.5393 -0.003 323 331 0 54.42 0.00019 QAEAVLYEK 1070.5010 1070.5033 -0.0022 340 349 0 51.69 0.0002 AQADAAFYSK 1159.5698 1159.5721 -0.0022 259 269 0 67.6 8.8E-06 DAQVAEVEATK
1173.5855 1173.5877 -0.0022 275 284 0 62.7 0.000033 EAELQTQVEK
1173.5857 1173.5877 -0.002 275 284 0 60.58 0.000051 EAELQTQVEK 1377.6776 1377.6776 0 71 82 0 100.32 6.6E-09 VDDDDALILYAR 1392.6674 1392.6673 0.0001 310 320 0 68.79 8.6E-06 VQEANWELYNK 1468.7294 1468.7305 -0.0012 108 120 0 65.09 0.000017 VLAASMTMEEIFK 1525.9028 1525.9021 0.0007 57 70 0 85.67 2.3E-08 LPFVLPAVFTIGPR 1648.8667 1648.8672 -0.0005 7 22 0 76.96 1.1E-06 ASQYLAITGAGIEDIK
roteinscore: 1039 1666.7977 1666.7985 -0.0008 369 382 0 94.34 2.2E-08 TLLDAVQNDYSCLR p 1747.9091 1747.9104 -0.0014 352 368 0 55.78 0.00017 EAEGLVALASAQGTYLR 1747.9095 1747.9104 -0.0009 352 368 0 95.51 1.8E-08 EAEGLVALASAQGTYLR
FLOT1, 1767.8862 1767.8865 -0.0003 383 397 0 121.47 4.5E-11 DFLMINNGIYQEIAK 1783.8784 1783.8814 -0.003 383 397 0 105.44 1.7E-09 DFLMINNGIYQEIAK 1978.9764 1978.9789 -0.0025 151 167 0 101.66 4.3E-09 QLVDVPGHEYFSYLGQK 1978.9779 1978.9789 -0.001 151 167 0 44.22 0.0024 QLVDVPGHEYFSYLGQK 2018.9634 2018.9657 -0.0023 90 107 0 61.91 0.000037 DSNHVHELVEGVIEGETR 2019.9631 2018.9657 0.9974 90 107 0 76.39 1.3E-06 DSNHVHELVEGVIEGETR 1015.5643 1015.5662 -0.0019 195 204 0 67.56 0.000014 TGLTLQNAAK 1049.5363 1049.5393 -0.003 323 331 0 54.42 0.00019 QAEAVLYEK
1173.5855 1173.5877 -0.0022 275 284 0 62.7 0.000033 EAELQTQVEK 1173.5857 1173.5877 -0.002 275 284 0 60.58 0.000051 EAELQTQVEK 1392.6674 1392.6673 0.0001 310 320 0 68.79 8.6E-06 VQEANWELYNK 1468.7294 1468.7305 -0.0012 108 120 0 65.09 0.000017 VLAASMTMEEIFK 1525.9028 1525.9021 0.0007 57 70 0 85.67 2.3E-08 LPFVLPAVFTIGPR 1648.8667 1648.8672 -0.0005 7 22 0 46.08 0.0013 ASQYLAITGGGIEDIK
roteinscore: 747 1666.7977 1666.7985 -0.0008 369 382 0 94.34 2.2E-08 TLLDAVQNDYSCLR p 1675.7919 1675.7916 0.0003 35 48 0 54.87 0.00018 CTVFDVSPVNYTFK 1747.9091 1747.9104 -0.0014 352 368 0 55.78 0.00017 EAEGLVALASAQGTYLR 1747.9095 1747.9104 -0.0009 352 368 0 95.51 1.8E-08 EAEGLVALASAQGTYLR FLOT2, 1755.8523 1755.8501 0.0022 383 397 0 74.97 1.9E-06 DFLMINNGTYQEIAK 1978.9764 1978.9789 -0.0025 151 167 0 101.66 4.3E-09 QLVDVPGHEYFSYLGQK 1978.9779 1978.9789 -0.001 151 167 0 44.22 0.0024 QLVDVPGHEYFSYLGQK
Tetraspanin1/tornado2 and tornado1 transcriptomic and proteomic networks 151
Supplemental Table 4. Primers used in the study. Primer Name Sequence (5'-3') Purpose trn1-5 LP GCAGGAAAGACAACACTCTGC genotyping PCR trn1-5 RP GAAGAGTCTGGACTGGAAGGG genotyping PCR trn2-7 LP CTTTTCCAGTTTTTGGTTCCC genotyping PCR trn2-7 RP TTACCCTAAATCCCATCAAACC genotyping PCR GABI_o8409 ATATTGACCATCATACTCATTGC genotyping PCR aos F AACATATGCTCAAGGGATGGAGCTAAAAG genotyping PCR aos R CGAACATGTAGAGCAGCAACTGATTATACA genotyping PCR aos T-DNA R CGGGCCTAACTTTTGGTGTGATGATGCT genotyping PCR coi1-1 F GGTTCTCTTTAGTCTTTAC COI1 fragment amplification coi1-1 R CAGACAACTATTTCGTTACC COI1 fragment amplification AOS_qPCR_F1 TCATCAAGTTCATAACCGATTAGC qRT-PCR AOS_qPCR_R1 TCTACCGTATTGAGCCGTAAC qRT-PCR COI1_qPCR_F1 ACTTCCGCCTTGTCTTACTC qRT-PCR COI1_qPCR_R1 GCCGCCTTGTCTCAGATAG qRT-PCR qPP2A_F TAACGTGGCCAAAATGATGC qRT-PCR qPP2A_R GTTCTCCACAACCGCTTGGT qRT-PCR qUBC_F CTGCGACTCAGGGAATCTTCTAA qRT-PCR qUBC_R TTGTGCCATTGAATTGAACCC qRT-PCR TRN1 attB1F GGGGACAAGTTTGTACAAAAAAGCAGGCTCT TRN1 cloning ATGGAGTCAGAGCCAGACCAAAG TRN1 attB2R GGGGACCACTTTGTACAAGAAAGCTGGGTCG TRN1 cloning AGAGGAACTTGGATCACTTCATG TRN1 attB2Rstop GGGGACCACTTTGTACAAGAAAGCTGGGTCT TRN1 cloning TAGAGAGGAACTTGGATCACTTCATG TRN1 attB2F GGGGACAGCTTTCTTGTACAAAGTGGGAATG TRN1 cloning GAGTCAGAGCCAGACCAAAG TRN1 attB3Rstop GGGGACAACTTTGTATAATAAAGTTGTTTAGA TRN1 cloning GAGGAACTTGGATCACTTCATG
General discussion and perspectives 153
CHAPTER 6 GENERAL DISCUSSION AND PERSPECTIVES
Animal and plant tetraspanins: differences and similarities Primary structure The degree of the overall primary structure identities is low between animal and plant tetraspanins and vary a lot even between paralogs. In human, closely related tetraspanins, i.e. Tspan5 and Tspan17, share up to 78% amino acid identity, distantly related ones as low as 6% (Berditchevski and Rubinstein, 2013). In Arabidopsis, the identities vary from 14% (TET10 and TET16) to 80% (TET3 and TET4) (Boavida et al., 2013). But some sequence features are similar between animal and plant tetraspanins. For instance, the transmembrane domains and the constant region of the large extracellular loop have higher identities in animal and plant tetraspanins, respectively. In the transmembrane domains, some polar residues that are involved in the packing of the transmembrane domains are conserved in animals (Stipp et al., 2003). Plant tetraspanins also have some conserved polar residues in the transmembrane domains (Figure 1). A typical different-in-sequence but similar-in- function feature is the very conserved CCG motif in the large extracellular loop of animal tetraspanins and the conserved GCCK/RP motif in plant tetraspanins (Figure 1) (Cnops et al., 2006). The CCG motif forms two disulfide bridges with the other two conserved cysteines to stabilize the structure of the large extracellular loop and subsequently the interactions with the other proteins (Kitadokoro et al., 2001; Seigneuret et al., 2001). In plants, the GCCK/RP is considered to take over the function to mediate the formation of the disulfide bridges. Plant tetraspanins have an extra conserved cysteine in the small extracellular loop, suggesting it might be involved in the crosslinking to the cysteine in the large extracellular loop (Figure 1) (DeSalle et al., 2001). Tetraspanins have not been identified from Chlorophyte algae (Chlamydomonas rheinhartii, Volvox carteri, Micromonas, Ostreococcus lucimarinus and Ostreococcus tauri) in this study (Chapter 1) neither in other studies (Boavida et al., 2013). It is hypothesized that tetraspanins might have been lost or become divergent in the distinct lineages as eukaryotes diverged because they are present in protozoan
154 Chapter 6
amoeba, fungi and plants but are absent from those unicellular chlorophyte algae (Boavida et al., 2013). Secondary & tertiary structure Despite the low identities in primary structure, they are very conserved in secondary structures, namely four transmembrane domains, cytoplasmic C- and N-terminal tails, an intracellular loop, a small extracellular loop and a large extracellular loop which consists of a constant region and a variable region (Figure 1). These hallmarks distinguish tetraspanins from the other four-transmembrane proteins such as the tight junction protein claudins. Post-translational modifications in those domains are important for tetraspanins interaction and localization, such as the cysteine palmitoylation sites in the juxtamembrane regions and N-linked glycosylation sites in the large extracellular loop (Baldwin et al., 2008; Delandre et al., 2009). Plant tetraspanins are predicted to have these palmitoylation sites and glycosylation sites as well (Figure 1) (Boavida et al., 2013). In conclusion, animal and plant tetraspanins represent a conserved gene family, they are low in primary structure identities, but conserved in the features (motif, polar residues, post-translational modifications), secondary and tertiary structures.
Figure 1. Schematic representation of animal (left) and plant (right) tetraspanin topologies. Adapted from Boavida et al., 2013. Numbers in blue indicate the range
General discussion and perspectives 155
of the amino acids. PM, plasma membrane. ICL, intracellular loop. EC1, small extracellular loop. EC2, large extracellular loop. The constant and variable region in the large extracellular loop are shown in yellow and light blue shade, respectively. The CCG, GCCK/RP motif and conserved cysteines are highlighted, the yellow ones are 100% conserved and the gray one is 90% conserved. The (predicted) disulfide bridges are indicated in (dashed) blue lines. The conserved polar residues in the transmembrane domains are indicated. The palmitoylation sites in the transmembrane domains are indicated with red zigzag lines. The glycosylation sites are indicated with black pins.
Interactions Tetraspanins are known for their interactions with each other and other proteins within the tetraspanin-enriched microdomains (TEMs). It has been shown that Arabidopsis tetraspanins can form homo- and heterodimers when expressed in yeast (Boavida et al., 2013). A major class of the interacting proteins of animal tetraspanins are integrins. However, integrins have not been identified in plants. Arabidopsis Membrane-based Interactome Network Database (MIND) (Jones et al., 2014) shows a diversity and a large number of interacting proteins for some tetraspanins, although they are not exactly the same as animal tetraspanins interacting proteins, they are similar types of proteins, such as transporters, receptors (i.e. G protein–coupled receptors) and membrane-anchored enzymes. This is consistent with the existence of TEMs in plants as well. Morever, these TEMs might be on different organelles with distinct and specialized functions because of their widespread subcellular localization as is shown in our study (Chapter 3). FLOT1 and FLOT2 are identified as TET1/TRN2 interacting proteins (Chapter 5). They are conserved proteins that are present in bacteria, fungi, plants and metazoans but absent from yeast and green algae (Chlamydomonas rheinhartii, Volvox carteri, Micromonas, Ostreococcus lucimarinus and Ostreococcus tauri). These ubiquitous expressed proteins are involved in various cellular processes, including cell adhesion, signal transduction, cellular trafficking and regulation of the cortical cytoskeleton (Morrow & Parton, 2005; Otto & Nichols, 2011). So far, interactions between tetraspanins and FLOTs have not been identified in animals. One of the reasons might be that they define their own distinct microdomains on the membrane. FLOTs are identified from lipid raft called
156 Chapter 6
detergent-resistant membranes (DRMs). TEMs are considered to be different from lipid rafts for several reasons (Hemler, 2005): TEMs are mostly soluble in non-ionic detergent (i.e. Triton X-100), whereas lipid rafts are insoluble in non-ionic detergents, the components that are often found in lipid rafts, such as glycosylphosphatidylinositol (GPI)-linked proteins, caveolin and Src-family kinases have not been found in TEMs. An unbiased proteomic approach identified more than 200 important lipid raft proteins from human HeLa cells, in which FLOTs but not any of the tetraspanins were included (Foster et al., 2003). Other differences include sensitivity to temperature, cholesterol depletion and palmitoylation (Hemler, 2005). Arabidopsis FLOTs are initially identified from DRMs as well (Borner et al., 2005). It is not clear how would TRN2 interact with FLOTs. There is an indication that tetraspanins associate with DRMs because of their partition into the light density fractions of sucrose gradients, where DRMs are typically found (Claas et al., 2001). In aminals, it is generally considered that TEMs and FLOTs mediate their own cellular trafficking pathways that are different from clathrin- and caveolin-dependent trafficking. But recently it is hypothesized that FLOT1 might itself be a cargo molecule that is recognized by a clathrin-independent pathways (Glebov et al., 2006). Furthermore, TEMs and FLOTs share some common membranous compartments, such as plasma membrane, early, late and recycling endosomes as well as exosomes (Escola et al., 1998). The common location and function i.e. intracellular trafficking and protein sorting provide opportunity for interaction of Arabidopsis tetraspanin TRN2 and FLOTs, and might reveal a new mechanism in cellular trafficking. Optimized super resolution microscopy, such as photo-activated localization microscopy and stochastic optical reconstruction microscopy is recently applied in tetraspanin research and will allow to estimate the number of molecules per tetraspanin-enriched microdomain, their stoichiometry, spatial organization and movement along the plasma membrane (Betzig et al., 2006; Rust et al., 2006).
Tetraspanins, the more the better? Essential or unessential? Tetraspanins comprise large gene families in many species, such as 33 in human and mouse, 36 in Drosophila melanogaster and 17 in Arabidopsis thaliana. They are also present in some protozoans and fungi. The large size of tetraspanin superfamily and conservation across kingdoms suggest fundamental roles in cellular function.
General discussion and perspectives 157
However, relatively few severe phenotypes have been observed upon knocking out a single tetraspanin, i.e. mutations in both human and mouse peripherin/RDS (Retinal Degeneration Slow) resulted in blindness (Goldberg et al., 1998; Goldberg, 2006), fungal pls1 (punchless1) mutants failed to penetrate into host plant leaves (Clergeot et al., 2001), Arabidopsis tet1/trn2 mutants had dramatic leaf and root patterning defects (Cnops et al., 2000; Cnops et al., 2006). It suggested that tetraspanins compensate one another and are redundant in function which would imply overlapping gene expression patterns, or tetraspanins are non-essential proteins and have an accessory role, facilitators of function of other complexes. Overlapping expression was observed in animal tetraspanins (Hemler, 2003). Functional redundancy resulted in mild or undetectable phenotypes in many single mutants, and phenotypes only became apparent in double mutants, i.e. mice cd9 and cd81 single mutant have reduced fertility because of a defective sperm-egg fusion, overexpression of CD81 can rescue the cd9 phenotype, while the double mutant is completely infertile (Kaji et al., 2000; Kaji et al., 2002; Rubinstein et al., 2006). The Drosophila melanogaster LBM (LATE BLOOMER) and two additional tetraspanin genes, were expressed in embryonic motoneurons. Deleting these three tetraspanins simultaneously enhanced significantly the synapse defect phenotype of the single lbm mutant (Kopczynski et al., 1996; Fradkin et al., 2002). In our study, no phenotypes were observed in the single mutants of TET5 and TET6 genes with redundant gene expression patterns in the vascular tissue, but the tet5tet6 double mutant had significantly increased organ size (Chapter 2). In Drosophila, about half of the tetraspanins are clustered on the second chromosome, including three motoneurons expressed tetraspanins. But phylogenetic studies do not support for their monophyly (Todres et al., 2000; Fradkin et al., 2002). Arabidopsis tetraspanins are evenly dispersed throughout the genome (Table 1), the duplicated genes are located on different chromosomes. The ones with overlapping expressions are rarely located on the same chromosome, TET16 and TET11 are the only tetraspanins adjacent to each other, both of which are very specifically expressed in the pollen. TET4, TET5 and TET9 are located on chromosome 4 with overlapping expression in the vascular tissue. TET1 and TET15 are located on chromosome 5 with overlapping expression in the lateral root cap and columella. Hence, in Arabidopsis tetraspanin gene duplication originated from genome duplication and subsequently divergence in expression patterns might have predominantly originated by neofunctionalization
158 Chapter 6
through promoter sequence diversification (Moore & Purugganan, 2005). Indeed, our promoter element analysis (Chapter 4) showed different putative regulatory elements in promoters of the duplicated genes even in TET5 & TET6 with a similar expression pattern. In animals, some tetraspanins are widely expressed, such as the ubiquitous CD81 in almost every cell type (Hemler, 2005), CD9 in nearly all tissues (Rubinstein, 2013), whereas some are more restricted, i.e. peripherin/RDS on the outer segments of rod and cone photoreceptors (Arikawa et al., 1992), UPIa (Uroplakins Ia) and UPIb in the urothelium (Yu et al., 1994). In Arabidopsis, we showed that each individual tetraspanin is more tissue and cell type specific within organs rather than generally expressed. For example, TET5 and TET6 are vascular tissue specific, TET7 and TET11 are pollen specific (Chapter 2). Most duplicated Arabidopsis tetraspanins had divergent expression patterns but nearly all cell and tissue types expressed multiple tetraspanins indicating overlapping expression domains regardless of their phylogenetic distance. Indeed, Arabidopsis tetraspanin expressions are largely overlapping in progenitor cells during embryogenesis, including shoot apical meristem (TET3, TET4, TET10), vascular tissue (TET1, TET4, TET5, TET10, TET14) and QC (TET4, TET10, TET13, TET15). After germination, two more tetraspanins are expressed in the vascular tissue (TET6 and TET9). TET13 is specifically expressed in the QC and stem cells, but no phenotype is observed, which might be due to the overlapping expression with TET4, TET10 and TET15. TET13 is also specifically expressed in the lateral root primordia, only a mild phenotype is observed. A few other tetraspanins are expressed in the pericycle as well, including TET4, TET5, TET6, TET9. Yet, cross sections will be necessary for TET4 and TET9 to distinguish whether they are specific in xylem pool pericycle or general in the pericycle. TET4 and TET10 have very similar expression pattern in the root meristem. TET1 and TET15 are overlapping in the lateral root cap and the columella. In the rosette leaves, five tetraspanins are expressed in the vascular tissue (TET1, TET5, TET6, TET9, TET14). TET1, TET3 and TET9 have overlapping domain in the shoot apical meristem. TET2 and TET4 are expressed in the mature stomatal guard cells. The most redundant expression is in the pollen, in which thirteen tetraspanins are expressed (Chapter 2). A study aimed at investigating tetraspanins functions in reproductive process did not manage to find any phenotype in the single knock-out mutants (Boavida et al., 2013). Taking these results together, it indicates that double
General discussion and perspectives 159
mutant or the combination of multiple mutants are essential for functional analysis, and the combination should be amongst the ones with overlapping expressions rather than duplicated genes because most of them have diverged expressions. In addition, some knock-out mutants are not available for some tetraspanins, or the mutants are in different ecotype background, amiRNA or RNAi could be alternative approaches. Mutants collected and studied in this study are summarized in Table 1. Phenotypes were scored in homozygous mutants with altered gene transcript level according to the expression patterns in the primary root, stomata, trichome, leaf morphology and flowering time. Phenotypes were only identified in tet2-1 with increased stomatal density, tet5tet6 double mutant with increased organ size, tet13-1 with reduced primary root length and lateral root density. Generally, they have mild or undetecable phenotypes, for some of them it is because the knock-out mutants are not available (i.e. TET9), but most importantly, they have overlapping expression domains as described above that might cause functional redundancy and phenotype compensation (i.e. tet13-1). However, the mutant analysis is still ongoing and not completed yet. Tetraspanins interact with each other and other proteins within tetraspanin-enriched microdomain, some tetraspanins have been shown to share common interacting proteins (Yáñez-Mó et al., 2009), eliminating a single tetraspanin in a complex could impair but not abolish the signaling pathway (Fradkin et al., 2002). Therefore, tetraspanins are proposed as “molecular facilitators”, playing nonessential accessory roles (Maecker et al., 1997; Fradkin et al., 2002; Hemler, 2003). But from the view of the whole tetraspanin family, the redundant functions and compensatory mechanisms indicate tetraspanin family is essential. In the MIND database, a number of common proteins are identified as interactors of different Arabidopsis tetraspanins, i.e. pollen expressed TET2 and TET11 share eleven common interacting proteins, TET11 and TET15 share three, indicating that redundant functions can compensate the defect caused by disrupting only one or a few tetraspanins. One more aspect has to be taken into account is that, as is found in animal tetraspanins research, some phenotypes are only found when a physiological equilibrium is disrupted (Rubinstein, 2011). We hypothesize that tetraspanins in cellular function are essential and might act in dose- and/or condition-dependent manner.
160 Chapter 6
Arabidopsis tetraspanins: wrapping up for the future A few approaches have been widely used in studying large gene families, such as gene expression analysis, mutational analysis and protein localization but rarely combining them with regulatory element identification and transcription factor-target gene regulatory network. Our study established new strategies for investigating gene family functions by combining the approaches mentioned above. In this part, the results from each chapter, especially Chapter 2, 3 and 4, will be integrated for each tetraspanin in order to have a comprehensive view for putative function or future research in a particular direction. TET1/TRN2 is expressed in the cotyledon vascular tissue, which fits with its function in venation patterning (Cnops et al., 2006). TET1/TRN2 is inducible upon
brassinolide & H3BO3 treatment but not by BL treatment alone (data not shown). Boron is taken up by the roots and transported via the xylem to other parts of the plant. It is assumed that boron is involved in the lignification of the cell wall and differentiation of the xylem. Brassinosteroids have been found to promote xylogenesis (Clouse & Sasse, 1998). Brassinosteroids are necessary for inducing entry into the final stage of tracheary element differentiation in cultured Zinnia elegans cells (Yamamoto et al., 1997). TET1 is expressed in the vascular tissues, this suggests it might have a function in tracheary element formation, which involves xylem differentiation, cell wall synthesis, lignification and programmed cell death. In the TFs-TETs regulatory network, TET1/TRN2 is targeted by the recent discovered ERF115, which is expressed in the mitotically active QC cells and the expression is regulated by brassinosteroids (Heyman et al., 2013). Overexpressing ERF115 alters QC cells division and root stem cells organization. In the tet1/trn2 mutants, root stem cells organization is altered (Cnops et al., 2000). Microarray data shows a number of biological processes are down-regulated in the tet1/trn2 mutant, such as leaf development, microtubule-based movement, cell cycle and floral organ formation. This nicely fits with tet1/trn2 phenotypes: asymmetric and helical leaf patterning, reduced cell number in leaf and sterile homozygotes. A question concerning these down-regulated processes is: which one is the direct effect of knocking out TET1/TRN2? Because the seedlings harvested for microarray were at growth stage 1.03, with leaf 3 and 4 visible, a lot of secondary processes could have been affected. TET1/TRN2 and FLOTs interaction and protein localization
General discussion and perspectives 161
dynamics during endocytosis could be a starting point to identify the direct signaling pathway controlled by TET1/TRN2. TET2 is expressed in the stomatal meristemoids, guard mother cells and mature guard cells. It is up-regulated upon ABA, cold and drought treatment, which is consistent with the presence of stress response regulatory elements in the promoter and intron. In the tet2-1 mutant, only stomatal density is significantly increased but not the stomatal index, indicating that asymmetric division and cell spacing is not altered. Cell size is significantly reduced, therefore more stomata are observed in a given area and causing the increase of stomatal density. ABA, cold and drought can cause stomatal closure and subsequently affect CO2 and water vapour exchange and plant growth, therefore, TET2 might have a role in stomatal guard cell function, i.e. stomatal closure. The stomatal density phenotype is an indirect effect of stomatal closure. Moreover, TFs-TETs regulatory network shows TET2 is predicted to be a target gene of the transcription factor ATAF2 (NAC domain containing protein81), which is specifically expressed in the stomatal guard cells and negatively regulates response to drought and wounding (Delessert et al., 2005). Future research should verify TET2 in stomatal function. Whether the early expression of TET2 in meristemoid is related to a function in differentiated guard cells is doubtful, it would rather indicate an early function in stomatal development which might be investigated in the future. TET3 is expressed in the SAM organizing center progenitor cells during embryogenesis and remained after germination. TET3 localized at the plasmodesmata (driven by 35S promoter and visualized in cotyledon but not SAM organizing center), suggesting a function in transport and cell communication. TET3 is up-regulated by ABA, cold and drought treatment and in the CBF3 (CRT/DRE binding factor 3) overexpression background. Cold and dehydration response elements are enriched in the TET3 promoter. TET3 is targeted by flowering response transcription factors PRR5 (Pseudo-Response Regulator 5), AGL15 (AGAMOUS- Like 15) and PIF4 (PHYTOCHROME INTERACTING FACTOR 4). Ambient temperature influences flowering time. Taken together, TET3 might have a function in temperature-dependent flowering response. Flowering time is not altered in the knock-out tet3 mutants growing under 21°C, 16h light condition (data not shown). Future experiment would be interesting to test tet3 flowering response under lower temperature.
162 Chapter 6
TET4 is expressed in the radicle of the mature embryo, the root apical meristem and the root vascular tissue after germination, up-regulated by ABA, cold, drought and in the CBF3 overexpression background. Its promoter is enriched with ABA response regulatory elements, radicle specific, vascular specific and stress response regulatory elements. It is targeted by FUS3 (FUSCA3, a B3 domain-containing transcription factor), which is involved in gene regulation during late embryogenesis. Loss-of- function mutations in FUS3 results in premature activation of apical and root embryonic meristems and decrease of seed ABA levels, fus3 seeds have defects in seed coloration, dormancy and desiccation tolerance (Tsuchiya et al., 2004), processes that should be studied in tet4 mutants. TET4 and TET10 expressions are largely overlapping during embryogenesis, although TET10 function cannot be inferred from regulatory elements or TFs-TETs regulatory network, it might suggest TET4 and TET10 act in TEMs during embryogenesis. TET5 and TET6 are the only duplicated genes that have redundant expression patterns and functions. Double mutants have increased organ size, although TET6 transcript level in tet6-2 is not severely reduced. It would be interesting to generate new double mutants with a stronger tet6 allele to see whether a stronger phenotype can be observed. It should be noticed that three more tetraspanins (TET4, TET10, TET14) have overlapping expression with TET5 in vascular tissue progenitor cells during embryogenesis. After germination additional five (TET1, TET4, TET8, TET9, TET12) and three (TET1, TET9, TET14) are overlapping with TET5 & TET6 in the root and rosette leaf vascular tissue, respectively. Regulatory elements in TET5 and TET6 are related to sugar sensing. Sucrose promotes growth by increasing cell number, it also promotes cell division in the apical meristem (Tognetti et al., 2013). It has been shown that sucrose induces Cyclin D expression (Riou-Khamlichi et al., 2000). Indeed, rosette leaf cell number is significantly increased in tet5tet6. TFs- TETs regulatory network shows TET5 and TET6 are targeted by AGL15, which is not relevant in supporting their roles in sugar sensing. It would be still necessary to check whether the vascular tissue morphology is altered or not in a stronger tet5tet6 allele to clarify whether TET5 and TET6 function in controlling organ growth is related to developmental or physiological function, or both. TET6 shows polar localization at the basal and apical part of root epidermal cells, but there is no clue about its meaning. TET8 and TET9 have functions in defense response, which is supported by their response to pathogen infection, elicitor treatment and the enrichment of defense
General discussion and perspectives 163
response regulatory elements. Furthermore, TET8 is targeted by three defense response transcription factors, its increased transcript level upon elicitor treatment and pathogen infection is proved both in our study by qRT-PCR and another study (Lucioli et al., 2014). It is not clear yet whether their functions in defense response is positive or negative. But according to the transcript level between the transcription factors and TET8, TET8 should have a positive role because its transcript level is positively correlated with ETHYLENE-INSENSITIVE3 (a positive regulator) and negatively correlated with SIGNAL RESPONSIVE 1 (a negative regulator). Still, a direct susceptibility test is necessary to be carried out, especially in the tet8tet9 double mutant because of the potential functional redundancy. Remarkably, overexpressing TET8 results in seedling lethality, an inducible system can overcome the problem in case overexpression is necessary in the future study. TET9 is the only one that is expressed in the trichome progenitor cells and trichome. It is targeted by GL3 (GLABRA 3), which regulates trichome development, however no trichome phenotype was observed in tet9 mutants (so far only tet9-1 is checked). It suggests that the trichome-specific TET9 might be related to defense as well. TET13 is expressed in the hypophysis during embryogenesis, in the QC, stem cells, lateral root founder cells and lateral root primordia after germination. Its expression in the lateral root primordia is inducible by IAA. Emerged lateral root density and stage I lateral root primordia are significantly reduced while stage II-VII lateral root primordia are increased in the knock-out mutant tet13-1, indicating TET13 has a function in both lateral root initiation and emergence. Auxin accumulation, as visualized by the DR5:: GUS at the root basal meristem is affected but not abolished. These phenotypes are statistically significantly, but still mild, which could be caused by the redundant function between TET13 and the other tetraspanins that have overlapping expression in the pericycle, including TET3, TET4, TET5, TET6, TET8, TET9, TET10 and TET12 (tet5tet6 has increased emerged lateral root density, data not show). TET13 is more likely being a downstream target of auxin signaling or involved in auxin local distribution rather than a component in long distance signaling such as auxin transport between organs. TET13 stronger expression in the tip cells of lateral root primordium outer layers might be related to a function in auxin-dependent signaling pathway that results in cell wall remodelling in the adjacent endodermal, cortical and epidermal cells overlaying the primordium (Swarup et al., 2008). proTET13:: TET13: GFP analysis would be definitely necessary and informative.
164 Chapter 6
Primary root length and root meristem size are significantly reduced. No phenotype is found in the QC or stem cells identities, which could be due to the overlapping expression with TET4, TET10 and TET15 during embryogenesis and after germination. RNA-Seq of FACS sorted synchronized tet13-1 lateral root founder cells is ongoing, in order to identify lateral root initiation pathways linked to TET13. For the other tetraspanins (TET7, TET10, TET11, TET12, TET14-TET17), there is not enough clue to make clear inferences about their functions by combining expression patterns, mutational analysis, protein localization, regulatory elements and TFs-TETs regulatory network. They have overlapping expressions with the other tetraspanins as discussed above except for TET17 which is negative in our study and in the Genevestigator and eFP meta-analysis, but it was shown to be expressed in the mature pollen (Boavida et al., 2013). It is intriguing that tetraspanins are expressed in the progenitor cells during embryogenesis or in the progenitor cells of a certain cell type during vegetative growth which remains after germination or differentiation. The expression in the progenitor cells suggests they might be required in progenitor cell identity establishment or maintenance, or in lateral inhibition of neighboring cells. The expression in the differentiated cells suggests they might have a function in physiology or biochemistry rather than development. In animals, the same tetraspanin can interact with different partner proteins in different cell types (Levy & Shoham, 2005a). In addition, the same tetraspanin can express in all the cell lineage and is required for the expression of the partner protein while the partner protein is more stage-specific expressed (Shoham et al., 2003; Shapiro-Shelef & Calame, 2004). Hence, the expression of certain TETRASPANIN genes in plants very early in a cell lineage until differentiated state might indicate dynamic interactions in time with partner proteins that are components of different molecular pathways.
General discussion and perspectives 165
Table 1. T-DNA and transposon insertion mutants collected in this study. Only GT and SM lines of TET13 are transposon insertion mutants, the rest are T-DNA insertion. SALK, GABI and SAIL lines are in Columbia (Col) background and ordered from NASC (http://arabidopsis.info/), FLAG lines are in Wassilewskija (Ws) background and ordered from INRC (http://publiclines.versailles.inra.fr/), GT and SM lines are in Landsberg erecta (Ler) background and ordered from CSHL (http://genetrap.cshl.edu/TrHome.html). S, sensitive to plant selective antibiotics, SALK, GT and SM: kanamycin 50 mg/L, GABI: Sulfadiazin 7.5 mg/ml, FLAG and SAIL: DL-Phosphinothricin 50 µM/L. Heterozygous are due to genotyping PCR rather than embryo or seedling lethal. Generally, SAIL lines have the most problems in genotyping PCR. GABI lines second insertion information is obtained according to the segregation analysis from GABI website (http://www.gabi-kat.de/). Plant samples harvested for qRT-PCR in this study are 7 day-old seedlings growing vertically under 24h light condition except for tet13-2 which are inflorescences. Tetraspanins are re-ordered and grouped at the bottom of the table according to their AGI code. pro, promoter. HM, homozygous. HZ, heterozygous. S, sensitive. KO, knock-out. D, down-regulated. U, up-regulated. NC, not changed. B, results from Boavida et al., 2013. E, embryo. R, root. C, cotyledon. L, rosette leaf. F, flower. LR, lateral root. LRP, lateral root primordia. Expression patterns are in bold. Pedigree and allele Insertion qRT-PCR AGI Genes Stock Name NASC ID antibiotic Expression & phenotype name position result resistance E, R, C, L, F. Altered leaf patterning and GK-254G01.02 N308316 trn2-7 exon 1 symmetry TET1 AT5G46700 SALK_000925 N500925 exon 2 S
SALK_127323C N627323 intron S
C, L, F, meristemoid, stomatal guard cell. GK-967G02.01 N796371 tet2-1 intron 2 HM KO Increased stomatal density SALK_101340C N663493 tet2-2 intron 2 HM. S D No phenotype in stomatal density AT2G19580 TET2 SALK_048747C N675001 tet2-3 intron 2 HM
SALK_048867 N548867 tet2-4 intron 2 not checked
SALK_101346 N601346 intron 2 not checked NCB
166 Chapter 6
E, R, F, SAM organizing center. No phenotype in primary root length, flowering SALK_116766C N616766 tet3-1 intron HM. S D time or leaf morphology under normal condition No phenotype in primary root length, AT3G45600 TET3 GK-026G04.01 N309656 tet3-2 intron HM, 2nd insertion U flowering time or leaf morphology under normal condition B No phenotype in flowering time or leaf FLAG_306C01 tet3-3 exon 1 HM KO morphology under normal condition B No phenotype in flowering time or leaf FLAG_421H09 tet3-4 exon 1 HM KO morphology under normal condition SALK_076972 N576972 prom HZ. S E, R, C, F AT5G60220 TET4 SALK_076971C N668515 prom HM. S D No phenotype in primary root length
GK-290A02.01 N396177 tet5-1 prom HM D E, R, C, L, F. No phenotype in seedling SALK_148216 N648216 tet5-2 exon 1 HM KO No phenotype in seedling AT4G23410 TET5 SALK_020009C N678190 tet5-3 exon 2 HM KO No phenotype in seedling SALK_148217 N648217 exon 1 HZ
SALK_005482C N665161 tet6-1 prom HM U R, C, L, F AT3G12090 TET6 SALK_139305 N639305 tet6-2 prom HM D No phenotype in seedling SAIL_30_H02 N870343 prom not confirmed
AT4G28050 TET7 SALK_016638 N516638 prom HM. S D; NCB F
E, R, C, L, F. No phenotype in primary root AT2G23810 TET8 SALK_136039C N667419 tet8-1 exon 1 HM. S D; KOB length R, C, L, F, trichome precusors, trichome. GK-207H01.01 N313067 tet9-1 3' UTR HM U No trichome morphology phenotype SALK_142164 N642164 tet9-2 prom HM D AT4G30430 TET9 SALK_018161 N518161 tet9-3 prom HM D SAIL_408_F09 N818894 prom HM
SALK_115646 N615646 exon 2 HZ
GK_278H08.01 N310220 prom HZ, 2nd insertion
SALK_120966C N673337 prom HM U E, R, F. No phenotype in primary root length
SAIL_326_E05 N815116 intron5 not confirmed AT1G63260 TET10 SALK_205981C N695363 prom HM
General discussion and perspectives 167
FLAG_318F01 prom HM
SALK_109259 N609259 exon 1 HM. S NC; KOB F
SALK_029497C N665661 prom HM U
SALK_027008C N661937 prom HM U AT1G18520 TET11 SAIL_897_B02 N877832 exon 1 not confirmed
SALK_047242 N547242 prom HM UB
SAIL_1055_D09 N841693 prom HM
F, QC, LR founder cell, LRP. Reduced SALK_011012C N665253 tet13-1 exon 1 HM KOB primary root length, root apical meristem size and LR density GT8699 tet13-2 exon 1 HM U No root phenotype
AT2G03840 TET13 SM_3_38454 N125165 tet13-3 exon 1 wrong insertion
SM_3_38457 N125168 tet13-4 exon 1 wrong insertion
GT_5_6061 N102066 tet13-5 exon 1 not germinate
SAIL_566_H10 N824068 exon 1 HZ, 2nd insertionB DB
SALK_125616C N654876 intron HM KOB E, C, L, F
AT2G01960 TET14 SALK_074390C N662981 intron HZ KOB
GK-360E07.01 N794356 3' UTR HM, 2nd insertion
SAIL_147_C01 N807162 3' UTR HM E, R, F AT5G57810 TET15 GK-513E06.01 N794627 exon 2 HM U No phenotype in primary root length
AT1G18510 TET16 SALK_035445C N665760 prom HM. S KOB F
AT1G74045 TET17 GK-223H09.03 N399830 exon 1 HM, 2nd insertion KOB
AT1G18510 TET16 AT2G01960 TET14 AT3G12090 TET6 AT4G23410 TET5 AT5G23030 TET12 AT1G18520 TET11 AT2G03840 TET13 AT3G45600 TET3 AT4G28050 TET7 AT5G46700 TET1 AT1G63260 TET10 AT2G19580 TET2 AT4G30430 TET9 AT5G57810 TET15 AT1G74045 TET17 AT2G23810 TET8 AT5G60220 TET4
Summary 169
SUMMARY
Cell-to-cell communication is crucial for the proper development and growth of multicellular organisms, in which membrane proteins play important roles because they are upstream components in signaling pathways. Tetraspanins are a distinct class of integral membrane proteins that form tetraspanin-enriched microdomains by interacting with the other membrane proteins. In animals, they have important functions in cell adhesion, signal transduction and cellular trafficking, but in plants their functional analysis is very limited. In this study, we investigated Arabidopsis tetraspanin gene family function in plant development and growth. The major findings of the work are written into one introduction chapter, four research chapters and one general discussion & perspective chapter. Chapter 1 positioned tetraspanins within membrane proteins classification, introduces their typical structure and functional domain, and tetraspanin-enriched microdomains based on the work in animal fields. Phylogenetic analysis in 11 genomic sequenced plant species showed tetraspanins are duplicated through evolution. Tetraspanins are present in protozoan amoeba, fungi and plants but are absent from unicellular chlorophyte algae, suggesting they might have been lost or become divergent in the distinct lineages as eukaryotes diverged. TETRASPANINs expression patterns in different developmental stages and organs was carried out and described in Chapter 2. TETRASPANINs are expressed in the progenitor cells early during embryogenesis (i.e. vascular tissue progenitor cells, SAM organizing center progenitor cells, hypophysis) as well as in specific cell types after germination (i.e. meristemoids, lateral root founder cells, trichome progenitor cells), suggesting functions in cell fate specification. The duplicated genes have mainly divergent expression patterns, except for TET5 and TET6 that have redundant expression pattern in vascular tissues. TETRASPANINs have largely overlapping expression domains in different developmental stages and in different cell types and tissues. This suggests redundant functions within the family and could compensate the phenotypes. Phenotypic analysis according to the expression patterns revealed that TET2 might have a role in stomatal closure. TET13 has a function in promoting lateral root initiation and emergence, the expression is inducible by auxin. TET5 & TET6 have redundant functions in restricting organ growth. In Chapter 3, tetraspanins subcellular localization was analyzed. They were not only localized at
170 Summary
the plasma membrane, but also at specific organelles or specialized structures, such as the endoplasmic reticulum, plasmodesmata and vesicles. In Chapter 4, three bioinformatics related analyses were carried out. Regulatory elements at TETRASPANINs promoter regions were identified, which partially explained the divergent and tissue specific expression patterns. In addition, TETRASPANINs response to perturbations was analyzed by using Genevestigator. A transcription factor-TETRASPANINs regulatory network was generated. By combining the expression patterns and bioinformatics analysis, TETRASPANINs functions were inferred, i.e. TET3 in temperature-dependent flowering response, TET8 and TET9 in defense response. In Chapter 5, the mysterious mask of tornados dramatic and pleiotropic phenotypes was uncovered by transcriptome analysis. Phytohormone signaling and defense response processes were up-regulated while leaf development, cell cycle and microtubule-based movement processes were down- regulated in the mutants. FLOT1 and FLOT2 were identified as interacting proteins of TETRASPANIN1/TORNADO2. Finally in Chapter 6, differences and similarities between animal and plant tetraspanins in primary, secondary and tertiary structure and interactions with partner proteins were compared, concluding that animal and plant tetraspanins represent a conserved gene family. Their specific and overlapping expression patterns, functional redundancy and essential/nonessential functions were extensively discussed. The results from each chapter, especially Chapter 2, 3 and 4, were integrated for each tetraspanin in order to have a comprehensive view for putative function or future research in a particular direction.
References 171
REFERENCES
Adamczyk BJ, Lehti-Shiu MD, Fernandez DE. 2007. The MADS domain factors AGL15 and AGL18 act redundantly as repressors of the floral transition in Arabidopsis. Plant Journal 50: 1007-1019. Afoufa-Bastien D, Medici A, Jeauffre J, Coutos-Thevenot P, Lemoine R, Atanassova R, Laloi M. 2010. The Vitis vinifera sugar transporter gene family: phylogenetic overview and macroarray expression profiling. BMC Plant Biology 10. Ambrose C, Allard JF, Cytrynbaum EN, Wasteneys GO. 2011. A CLASP-modulated cell edge barrier mechanism drives cell-wide cortical microtubule organization in Arabidopsis. Nat Commun 2: 430. Arabidopsis Interactome Mapping Consortium. 2011. Evidence for network evolution in an Arabidopsis interactome map. Science 333: 601-607. Arikawa K, Molday LL, Molday RS, Williams DS. 1992. Localization of Peripherin/Rds in the Disk Membranes of Cone and Rod Photoreceptors - Relationship to Disk Membrane Morphogenesis and Retinal Degeneration. Journal of Cell Biology 116: 659-667. Asai T, Tena G, Plotnikova J, Willmann MR, Chiu WL, Gomez-Gomez L, Boller T, Ausubel FM, Sheen J. 2002. MAP kinase signalling cascade in Arabidopsis innate immunity. Nature 415: 977-983. Ausin I, Alonso-Blanco C, Martinez-Zapater JM. 2005. Environmental regulation of flowering. International Journal of Developmental Biology 49: 689-705. Babuke T, Tikkanen R. 2007. Dissecting the molecular function of reggie/flotillin proteins. Eur J Cell Biol 86: 525-532. Bailey RL, Herbert JM, Khan K, Heath VL, Bicknell R, Tomlinson MG. 2011. The emerging role of tetraspanin microdomains on endothelial cells. Biochemical Society Transactions 39: 1667-1673. Baker SS, Wilhelm KS, Thomashow MF. 1994. The 5'-Region of Arabidopsis-Thaliana Cor15a Has Cis-Acting Elements That Confer Cold-Regulated, Drought-Regulated and Aba-Regulated Gene-Expression. Plant Molecular Biology 24: 701-713. Baldwin G, Novitskaya V, Sadej R, Pochec E, Litynska A, Hartmann C, Williams J, Ashman L, Eble JA, Berditchevski F. 2008. Tetraspanin CD151 regulates glycosylation of α3β1 integrin. J Biol Chem 283: 35445-35454. Bargmann BO, Birnbaum KD. 2010. Fluorescence activated cell sorting of plant protoplasts. J Vis Exp 36: 1673. Barton MK, Poethig RS. 1993. Formation of the shoot apical meristem in Arabidopsis thaliana: an analysis of development in the wild type and in the shoot meristemless mutant. Development 119: 823-831. Belkhadir Y, Jaillais Y, Epple P, Balsemao-Pires E, Dangl JL, Chory J. 2012. Brassinosteroids modulate the efficiency of plant immune responses to microbe- associated molecular patterns. Proceedings of the National Academy of Sciences of the United States of America 109: 297-302. Bendtsen JD, Nielsen H, von Heijne G, Brunak S. 2004. Improved prediction of signal peptides: SignalP 3.0. Journal of Molecular Biology 340: 783-795. Benková E, Michniewicz M, Sauer M, Teichmann T, Seifertová D, Jürgens G, Friml J. 2003. Local, efflux-dependent auxin gradients as a common module for plant organ formation. Cell 115: 591-602. Berckmans B, De Veylder L. 2009. Transcriptional control of the cell cycle. Current Opinion in Plant Biology 12: 599-605. Berditchevski F. 2001. Complexes of tetraspanins with integrins: more than meets the eye.
172 References
Journal of Cell Science 114: 4143-4151. Berditchevski F, Odintsova E. 2007. Tetraspanins as regulators of protein trafficking. Traffic 8: 89-96. Berditchevski F, Odintsova E, Sawada S, Gilbert E. 2002. Expression of the palmitoylation-deficient CD151 weakens the association of α3β1 integrin with the tetraspanin-enriched microdomains and affects integrin-dependent signaling. Journal of Biological Chemistry 277: 36991-37000. Berger F, Hamamura Y, Ingouff M, Higashiyama T. 2008. Double fertilization - caught in the act. Trends in Plant Sciences 13: 437-443. Bergmann DC. 2004. Integrating signals in stomatal development. Current Opinion in Plant Biology 7: 26-32. Bergmann DC, Sack FD. 2007. Stomatal development. Annual Review of Plant Biology 58: 163-181. Betzig E, Patterson GH, Sougrat R, Lindwasser OW, Olenych S, Bonifacino JS, Davidson MW, Lippincott-Schwartz J, Hess HF. 2006. Imaging intracellular fluorescent proteins at nanometer resolution. Science 313: 1642-1645. Bickel PE, Scherer PE, Schnitzer JE, Oh P, Lisanti MP, Lodish HF. 1997. Flotillin and epidermal surface antigen define a new family of caveolae-associated integral membrane proteins. J Biol Chem 272: 13793-13802. Bilska A, Sowinski P. 2010. Closure of plasmodesmata in maize (Zea mays) at low temperature: a new mechanism for inhibition of photosynthesis. Annals of Botany 106: 675-686. Birnbaum K, Shasha DE, Wang JY, Jung JW, Lambert GM, Galbraith DW, Benfey PN. 2003. A gene expression map of the Arabidopsis root. Science 302: 1956-1960. Boavida LC, Qin P, Broz M, Becker JD, McCormick S. 2013. Arabidopsis tetraspanins are confined to discrete expression domains and cell types in reproductive tissues and form homo- and hetero-dimers when expressed in yeast. Plant Physiology 163: 696- 712. Borner GH, Sherrier DJ, Weimar T, Michaelson LV, Hawkins ND, Macaskill A, Napier JA, Beale MH, Lilley KS, Dupree P. 2005. Analysis of detergent-resistant membranes in Arabidopsis. Evidence for plasma membrane lipid rafts. Plant Physiol 137: 104-116. Boucheix C, Rubinstein E. 2001. Tetraspanins. Cellular and Molecular Life Sciences 58: 1189-1205. Boutrot F, Segonzac C, Chang KN, Qiao H, Ecker JR, Zipfel C, Rathjen JP. 2010. Direct transcriptional control of the Arabidopsis immune receptor FLS2 by the ethylene- dependent transcription factors EIN3 and EIL1. Proc Natl Acad Sci U S A 107: 14502- 14507. Boyes DC, Zayed AM, Ascenzi R, McCaskill AJ, Hoffman NE, Davis KR, Görlach J. 2001. Growth stage-based phenotypic analysis of Arabidopsis: a model for high throughput functional genomics in plants. Plant Cell 13: 1499-1510. Boyes DC, Zayed AM, Ascenzi R, McCaskill AJ, Hoffman NE, Davis KR, Görlach J. 2001. Growth stage-based phenotypic analysis of Arabidopsis: a model for high throughput functional genomics in plants. Plant Cell 13: 1499-1510. Boyle AP, Song L, Lee BK, London D, Keefe D, Birney E, Iyer VR, Crawford GE, Furey TS. 2011. High-resolution genome-wide in vivo footprinting of diverse transcription factors in human cells. Genome Res 21: 456-464. Brady SM, Orlando DA, Lee J-Y, Wang JY, Koch J, Dinneny JR, Mace D, Ohler U, Benfey PN. 2007. A high-resolution root spatiotemporal map reveals dominant expression patterns. Science 318: 801-806.
References 173
Bruno L, Muto A, Spadafora ND, Iaria D, Chiappetta A, Van Lijsebettens M, Bitonti MB. 2011. Multi-probe in situ hybridization to whole mount Arabidopsis seedlings. International Journal of Developmental Biology 55: 197-203. Buckley TN, Mott KA. 2013. Modelling stomatal conductance in response to environmental factors. Plant Cell Environ 36: 1691-1699. Bürckstümmer T, Bennett KL, Preradovic A, Schütze G, Hantschel O, Superti-Furga G, Bauch A. 2006. An efficient tandem affinity purification procedure for interaction proteomics in mammalian cells. Nature Methods 3: 1013-1019. Buschmann H, Lloyd CW. 2008. Arabidopsis mutants and the network of microtubule- associated functions. Mol Plant 1: 888-898. Byrne ME, Barley R, Curtis M, Arroyo JM, Dunham M, Hudson A, Martienssen RA. 2000. Asymmetric leaves1 mediates leaf patterning and stem cell function in Arabidopsis. Nature 408: 967-971. Byrne ME, Simorowski J, Martienssen RA. 2002. ASYMMETRIC LEAVES1 reveals knox gene redundancy in Arabidopsis. Development 129: 1957-1965. Cakir B, Olcay AC. 2013. Molecular cloning, phylogenetic analysis, and expression profiling of a grape CMP-sialic acid transporter-like gene induced by phytohormone and abiotic stress. Genes & Genomics 35: 225-238. Carlsbecker A, Helariutta Y. 2005. Phloem and xylem specification: pieces of the puzzle emerge. Current Opinion in Plant Biology 8: 512-517. Casamitjana-Martínez E, Hofhuis HF, Xu J, Liu C-M, Heidstra R, Scheres B. 2003. Root-specific CLE19 overexpression and the sol1/2 suppressors implicate a CLV-like pathway in the control of Arabidopsis root meristem maintenance. Current Biology 13: 1435-1441. Causier B, Ashworth M, Guo W, Davies B. 2012. The TOPLESS interactome: a framework for gene repression in Arabidopsis. Plant Physiology 158: 423-438. Chandrasekharan MB, Bishop KJ, Hall TC. 2003. Module-specific regulation of the - phaseolin promoter during embryogenesis. Plant Journal 33: 853-866. Charrin S, Jouannet S, Boucheix C, Rubinstein E. 2014. Tetraspanins at a glance. Journal of Cell Science 127: 3641-3648. Charrin S, le Naour F, Silvie O, Milhiet P-E, Boucheix C, Rubinstein E. 2009. Lateral organization of membrane proteins: tetraspanins spin their web. Biochemical Journal 420: 133-154. Charrin S, Manié S, Oualid M, Billard M, Boucheix C, Rubinstein E. 2002. Differential stability of tetraspanin/tetraspanin interactions: role of palmitoylation. FEBS Letters 516: 139-144. Cherukuri A, Shoham T, Sohn HW, Levy S, Brooks S, Carter R, Pierce SK. 2004. The tetraspanin CD81 is necessary for partitioning of coligated CD19/CD21-B cell antigen receptor complexes into signaling-active lipid rafts. Journal of Immunology 172: 370- 380. Chiu W-H, Chandler J, Cnops G, Van Lijsebettens M, Werr W. 2007. Mutations in the TORNADO2 gene affect cellular decisions in the peripheral zone of the shoot apical meristem of Arabidopsis thaliana. Plant Molecular Biology 63: 731-744. Choi HI, Hong JH, Ha JO, Kang JY, Kim SY. 2000. ABFs, a family of ABA-responsive element binding factors. Journal of Biological Chemistry 275: 1723-1730. Choo KH, Tan TW, Ranganathan S. 2009. A comprehensive assessment of N-terminal signal peptides prediction methods. BMC Bioinformatics 10 Suppl 15: S2. Chou KC, Shen HB. 2010. Plant-mPLoc: a top-down strategy to augment the power for predicting plant protein subcellular localization. PLoS ONE 5: e11335. Claas C, Stipp CS, Hemler ME. 2001. Evaluation of prototype transmembrane 4
174 References
superfamily protein complexes and their relation to lipid rafts. J Biol Chem 276: 7974- 7984. Clark SE. 2001. Meristems: start your signaling. Current Opinion in Plant Biology 4: 28-32. Clergeot P-H, Gourgues M, Cots J, Laurans F, Latorse M-P, Pépin R, Tharreau D, Notteghem J-L, Lebrun M-H. 2001. PLS1, a gene encoding a tetraspanin-like protein, is required for penetration of rice leaf by the fungal pathogen Magnaporthe grisea. Proceedings of the National Academy of Sciences of the United States of America 98: 6963-6968. Clouse SD, Sasse JM. 1998. Brassinosteroids: Essential regulators of plant growth and development. Annual Review of Plant Physiology and Plant Molecular Biology 49: 427-451. Cnops G, den Boer B, Gerats A, Van Montagu M, Van Lijsebettens M. 1996a. Chromosome landing at the Arabidopsis TORNADO1 locus using an AFLP-based strategy. Molecular & General Genetics 253: 32-41. Cnops G, den Boer B, Gerats A, Van Montagu M, Van Lijsebettens M. 1996b. Chromosome landing at the Arabidopsis TORNADO1 locus using an AFLP-based strategy. Molecular and General Genetics 253: 32-41. Cnops G, Neyt P, Raes J, Petrarulo M, Nelissen H, Malenica N, Luschnig C, Tietz O, Ditengou F, Palme K, et al. 2006. The TORNADO1 and TORNADO2 genes function in several patterning processes during early leaf development in Arabidopsis thaliana. Plant Cell 18: 852-866. Cnops G, Wang X, Linstead P, Van Montagu M, Van Lijsebettens M, Dolan L. 2000. TORNADO1 and TORNADO2 are required for the specification of radial and circumferential pattern in the Arabidopsis root. Development 127: 3385-3394. Conley SM, Stuck MW, Naash MI. 2011. Structural and functional relationships between photoreceptor tetraspanins and other superfamily members. Cellular and Molecular Life Sciences in press. Consortium AIM. 2011. Evidence for network evolution in an Arabidopsis interactome map. Science 333: 601-607. Contim LAS, Waclawovsky AJ, Delu N, Pirovani CP, Clarindo WR, Loureiro ME, Carvalho CR, Fontes EPB. 2003. The soybean sucrose binding protein gene family: genomic organization, gene copy number and tissue-specific expression of the SBP2 promoter. Journal of Experimental Botany 54: 2643-2653. Cools T, Iantcheva A, Weimer AK, Boens S, Takahashi N, Maes S, Van den Daele H, Van Isterdael G, Schnittger A, De Veylder L. 2011. The Arabidopsis thaliana checkpoint kinase WEE1 protects against premature vascular differentiation during replication stress. Plant Cell 23: 1435-1448. Corbesier L, Coupland G. 2006. The quest for florigen: a review of recent progress. Journal of Experimental Botany 57: 3395-3403. Coussens G, Aesaert S, Verelst W, Demeulenaere M, De Buck S, Njuguna E, Inzé D, Van Lijsebettens M. 2012. Brachypodium distachyon promoters as efficient building blocks for transgenic research in maize. Journal of Experimental Botany 63: 4263- 4273. De Bodt S, Carvajal D, Hollunder J, Van den Cruyce J, Movahedi S, Inzé D. 2010. CORNET: a user-friendly tool for data mining and integration. Plant Physiology 152: 1167-1179. De Bodt S, Hollunder J, Nelissen H, Meulemeester N, Inzé D. 2012. CORNET 2.0: integrating plant coexpression, protein-protein interactions, regulatory interactions, gene associations and functional annotations. New Phytologist 195: 707-720. De Rybel B, Breda AS, Weijers D. 2014. Prenatal plumbing-vascular tissue formation in the
References 175
plant embryo. Physiologia Plantarum in press. De Rybel B, Möller B, Yoshida S, Grabowicz I, de Reuille PB, Boeren S, Smith RS, Borst JW, Weijers D. 2013. A bHLH complex controls embryonic vascular tissue establishment and indeterminate growth in Arabidopsis. Developmental Cell 24: 426- 437. De Rybel B, Vassileva V, Parizot B, Demeulenaere M, Grunewald W, Audenaert D, Van Campenhout J, Overvoorde P, Jansen L, Vanneste S, et al. 2010. A novel aux/IAA28 signaling cascade activates GATA23-dependent specification of lateral root founder cell identity. Current Biology 20: 1697-1706. De Smet I, Chaerle P, Vanneste S, De Rycke R, Inzé D, BeeckMan T. 2004. An easy and versatile embedding method for transverse sections. Journal of Microscopy 213: 76- 80. De Smet I, Tetsumura T, De Rybel B, Frei dit Frey N, Laplaze L, Casimiro I, Swarup R, Naudts M, Vanneste S, Audenaert D, et al. 2007. Auxin-dependent regulation of lateral root positioning in the basal meristem of Arabidopsis. Development 134: 681- 690. De Smet I, Vassileva V, De Rybel B, Levesque MP, Grunewald W, Van Damme D, Van Noorden G, Naudts M, Van Isterdael G, De Clercq R, et al. 2008. Receptor-like kinase ACR4 restricts formative cell divisions in the Arabidopsis root. Science 322: 594-597. De Veylder L, Beeckman T, Beemster GT, Krols L, Terras F, Landrieu I, van der Schueren E, Maes S, Naudts M, Inzé D. 2001. Functional analysis of cyclin- dependent kinase inhibitors of Arabidopsis. Plant Cell 13: 1653-1668. Delandre C, Penabaz TR, Passarelli AL, Chapes SK, Clem RJ. 2009. Mutation of juxtamembrane cysteines in the tetraspanin CD81 affects palmitoylation and alters interaction with other proteins at the cell surface. Experimental Cell Research 315: 1953-1963. Delessert C, Kazan K, Wilson IW, Van Der Straeten D, Manners J, Dennis ES, Dolferus R. 2005. The transcription factor ATAF2 represses the expression of pathogenesis- related genes in Arabidopsis. Plant J 43: 745-757. Delker C, Stenzel I, Hause B, Miersch O, Feussner I, Wasternack C. 2006. Jasmonate biosynthesis in Arabidopsis thaliana - Enzymes, products, regulation. Plant Biology 8: 297-306. Denoux C, Galletti R, Mammarella N, Gopalan S, Werck D, De Lorenzo G, Ferrari S, Ausubel FM, Dewdney J. 2008. Activation of defense response pathways by OGs and Flg22 elicitors in Arabidopsis seedlings. Molecular Plant 1: 423-445. DeSalle R, Mares R, Garcia-España A. 2010. Evolution of cysteine patterns in the large extracellular loop of tetraspanins from animals, fungi, plants and single-celled eukaryotes. Molecular Phylogenetics and Evolution 56: 486-491. Dewitte W, Murray JAH. 2003. The plant cell cycle. Annual Review of Plant Biology 54: 235-264. Dewitte W, Riou-Khamlichi C, Scofield S, Healy JMS, Jacqmard A, Kilby NJ, Murray JAH. 2003. Altered cell cycle distribution, hyperplasia, and inhibited differentiation in Arabidopsis caused by the D-type cyclin CYCD3. Plant Cell 15: 79-92. Ding Z, Friml J. 2010. Auxin regulates distal stem cell differentiation in Arabidopsis roots. Proceedings of the National Academy of Sciences of the United States of America 107: 12046-12051. Dinneny JR, Yadegari R, Fischer RL, Yanofsky MF, Weigel D. 2004. The role of JAGGED in shaping lateral organs. Development 131: 1101-1110. Edgar RC. 2004. MUSCLE: multiple sequence alignment with high accuracy and high
176 References
throughput. Nucleic Acids Research 32: 1792-1797. Edrington TCt, Yeagle PL, Gretzula CL, Boesze-Battaglia K. 2007. Calcium-dependent association of calmodulin with the C-terminal domain of the tetraspanin protein peripherin/rds. Biochemistry 46: 3862-3871. Emanuelsson O, Nielsen H, Brunak S, von Heijne G. 2000. Predicting subcellular localization of proteins based on their N-terminal amino acid sequence. J Mol Biol 300: 1005-1016. Escola JM, Kleijmeer MJ, Stoorvogel W, Griffith JM, Yoshie O, Geuze HJ. 1998. Selective enrichment of tetraspan proteins on the internal vesicles of multivesicular endosomes and on exosomes secreted by human B-lymphocytes. Journal of Biological Chemistry 273: 20121-20127. Eulgem T, Rushton PJ, Schmelzer E, Hahlbrock K, Somssich IE. 1999. Early nuclear events in plant defence signalling: rapid gene activation by WRKY transcription factors. EMBO Journal 18: 4689-4699. Ezcurra I, Wycliffe P, Nehlin L, Ellerstrom M, Rask L. 2000. Transactivation of the Brassica napus napin promoter by ABI3 requires interaction of the conserved B2 and B3 domains of ABI3 with different cis-elements: B2 mediates activation through an ABRE, whereas B3 interacts with an RY/G-box. Plant Journal 24: 57-66. Fanaei M, Monk PN, Partridge LJ. 2011. The role of tetraspanins in fusion. Biochemical Society Transactions 39: 524-528. Fang YJ, You J, Xie KB, Xie WB, Xiong LZ. 2008. Systematic sequence analysis and identification of tissue-specific or stress-responsive genes of NAC transcription factor family in rice. Molecular Genetics and Genomics 280: 547-563. Fernandez-Calvino L, Faulkner C, Walshaw J, Saalbach G, Bayer E, Benitez-Alfonso Y, Maule A. 2011. Arabidopsis plasmodesmal proteome. PLoS ONE 6: e18880. Fletcher JC. 2002. Coordination of cell proliferation and cell fate decisions in the angiosperm shoot apical meristem. BioEssays 24: 27-37. Foster LJ, de Hoog CL, Mann M. 2003. Unbiased quantitative proteomics of lipid rafts reveals high specificity for signaling factors. Proceedings of the National Academy of Sciences of the United States of America 100: 5813-5818. Fradkin LG, Kamphorst JT, DiAntonio A, Goodman CS, Noordermeer JN. 2002. Genomewide analysis of the Drosophila tetraspanins reveals a subset with similar function in the formation of the embryonic synapse. Proceedings of the National Academy of Sciences of the United States of America 99: 13663-13668. Friml J. 2003. Auxin transport - shaping the plant. Current Opinion in Plant Biology 6: 7-12. Furutani I, Watanabe Y, Prieto R, Masukawa M, Suzuki K, Naoi K, Thitamadee S, Shikanai T, Hashimoto T. 2000. The SPIRAL genes are required for directional control of cell elongation in Aarabidopsis thaliana. Development 127: 4443-4453. Fusada N, Masuda T, Kuroda H, Shimada H, Ohta H, Takamiya K. 2005. Identification of a novel Cis-element exhibiting cytokinin-dependent protein binding in vitro in the 5 '-region of NADPH-protochlorophyllide oxidoreductase gene in cucumber. Plant Molecular Biology 59: 631-645. Garcia-España A, Chung P-J, Sarkar IN, Stiner E, Sun T-T, DeSalle R. 2008. Appearance of new tetraspanin genes during vertebrate evolution. Genomics 91: 326-334. Garcia-España A, Chung P-J, Zhao X, Lee A, Pellicer A, Yu J, Sun T-T, DeSalle R. 2006. Origin of the tetraspanin uroplakins and their co-evolution with associated proteins: implications for uroplakin structure and function. Molecular Phylogenetics and Evolution 41: 355-367. Garcia-Espana A, DeSalle R. 2009. Intron sliding in tetraspanins. Commun Integr Biol 2: 394-395.
References 177
Gibson SI. 2005. Control of plant development and gene expression by sugar signaling. Curr Opin Plant Biol 8: 93-102. Gilmour SJ, Sebolt AM, Salazar MP, Everard JD, Thomashow MF. 2000. Overexpression of the Arabidopsis CBF3 transcriptional activator mimics multiple biochemical changes associated with cold acclimation. Plant Physiology 124: 1854-1865. Giuliano G, Pichersky E, Malik VS, Timko MP, Scolnik PA, Cashmore AR. 1988. An evolutionarily conserved protein binding sequence upstream of a plant light-regulated gene. Proc Natl Acad Sci U S A 85: 7089-7093. Glebov OO, Bright NA, Nichols BJ. 2006. Flotillin-1 defines a clathrin-independent endocytic pathway in mammalian cells. Nature Cell Biology 8: 46-U16. Goldberg AFX. 2006. Role of peripherin/rds in vertebrate photoreceptor architecture and inherited retinal degenerations. International Review of Cytology 253: 131-175. Goldberg AFX, Loewen CJR, Molday RS. 1998. Cysteine residues of photoreceptor peripherin/rds: role in subunit assembly and autosomal dominant retinitis pigmentosa. Biochemistry 37: 680-685. Gourgues M, Brunet-Simon A, Lebrun M-H, Levis C. 2004. The tetraspanin BcPls1 is required for appressorium-mediated penetration of Botrytis cinerea into host plant leaves. Molecular Microbiology 51: 619-629. Grini PE, Jürgens G, Hülskamp M. 2002. Embryo and endosperm development is disrupted in the female gametophytic capulet mutants of Arabidopsis. Genetics 162: 1911-1925. Guindon S, Delsuc F, Dufayard J-F, Gascuel O. 2009. Estimating maximum likelihood phylogenies with PhyML. Methods in Molecular Biology 537: 113-137. Guo AY, He K, Liu D, Bai SN, Gu XC, Wei LP, Luo JC. 2005. DATF: a database of Arabidopsis transcription factors. Bioinformatics 21: 2568-2569. Guo L, Yu Y, Xia X, Yin W. 2010. Identification and functional characterisation of the promoter of the calcium sensor gene CBL1 from the xerophyte Ammopiptanthus mongolicus. BMC Plant Biol 10: 18. Guo LJ, Guo CM, Li M, Wang WJ, Luo CK, Zhang YX, Chen L. 2014. Suppression of expression of the putative receptor-like kinase gene NRRB enhances resistance to bacterial leaf streak in rice. Molecular Biology Reports 41: 2177-2187. Hara K, Yokoo T, Kajita R, Onishi T, Yahata S, Peterson KM, Torii KU, Kakimoto T. 2009. Epidermal cell density is autoregulated via a secretory peptide, EPIDERMAL PATTERNING FACTOR 2 in Arabidopsis leaves. Plant and Cell Physiology 50: 1019-1031. Hartley JL, Temple GF, Brasch MA. 2000. DNA cloning using in vitro site-specific recombination. Genome Research 10: 1788-1795. Heald R, Nogales E. 2002. Microtubule dynamics. J Cell Sci 115: 3-4. Hemler ME. 2003. Tetraspanin proteins mediate cellular penetration, invasion, and fusion events and define a novel type of membrane microdomain. Annual Review of Cell and Developmental Biology 19: 397-422. Hemler ME. 2005. Tetraspanin functions and associated microdomains. Nature Reviews Molecular Cell Biology 6: 801-811. Hermans C, Hammond JP, White PJ, Verbruggen N. 2006. How do plants respond to nutrient shortage by biomass allocation? Trends Plant Sci 11: 610-617. Heyman J, Cools T, Vandenbussche F, Heyndrickx KS, Van Leene J, Vercauteren I, Vanderauwera S, Vandepoele K, De Jaeger G, Van Der Straeten D, et al. 2013. ERF115 controls root quiescent center cell division and stem cell replenishment. Science 342: 860-863. Higo K, Ugawa Y, Iwamoto M, Korenaga T. 1999. Plant cis-acting regulatory DNA elements (PLACE) database: 1999. Nucleic Acids Research 27: 297-300.
178 References
Himanen K, Boucheron E, Vanneste S, de Almeida Engler J, Inzé D, Beeckman T. 2002. Auxin-mediated cell cycle activation during early lateral root initiation. Plant Cell 14: 2339-2351. Huang DQ, Jaradat MR, Wu WR, Ambrose SJ, Ross AR, Abrams SR, Cutler AJ. 2007. Structural analogs of ABA reveal novel features of ABA perception and signaling in Arabidopsis. Plant Journal 50: 414-428. Huang H, Tindall DJ. 2007. Dynamic FoxO transcription factors. J Cell Sci 120: 2479-2487. Huang S, Tian H, Chen Z, Yu T, Xu A. 2010. The evolution of vertebrate tetraspanins: gene loss, retention, and massive positive selection after whole genome duplications. BMC Evol Biol 10: 306. Huang S, Yuan S, Dong M, Su J, Yu C, Shen Y, Xie X, Yu Y, Yu X, Chen S, et al. 2005. The phylogenetic analysis of tetraspanins projects the evolution of cell-cell interactions from unicellular to multicellular organisms. Genomics 86: 674-684. Hughes JR, Cheng JF, Ventress N, Prabhakar S, Clark K, Anguita E, De Gobbi M, de Jong P, Rubin E, Higgs DR. 2005. Annotation of cis-regulatory elements by identification, subclassification, and functional assessment of multispecies conserved sequences. Proceedings of the National Academy of Sciences of the United States of America 102: 9830-9835. Inzé D, De Veylder L. 2006. Cell cycle regulation in plant development. Annual Review of Genetics 40: 77-105. Jégou A, Ziyyat A, Barraud-Lange V, Perez E, Wolf JP, Pincet F, Gourier C. 2011. CD9 tetraspanin generates fusion competent sites on the egg membrane for mammalian fertilization. Proceedings of the National Academy of Sciences of the United States of America 108: 10946-10951. Jiang C, Iu B, Singh J. 1996. Requirement of a CCGAC cis-acting element for cold induction of the BN115 gene from winter Brassica napus. Plant Molecular Biology 30: 679-684. Jin HL, Cominelli E, Bailey P, Parr A, Mehrtens F, Jones J, Tonelli C, Weisshaar B, Martin C. 2000. Transcriptional repression by AtMYB4 controls production of UV- protecting sunscreens in Arabidopsis. EMBO Journal 19: 6150-6161. Jones AM, Xuan Y, Xu M, Wang R-S, Ho C-H, Lalonde S, You CH, Sardi MI, Parsa SA, Smith-Valle E, et al. 2014a. Border control – a membrane-linked interactome of Arabidopsis. Science 344: 711-716. Jones AM, Xuan Y, Xu M, Wang RS, Ho CH, Lalonde S, You CH, Sardi MI, Parsa SA, Smith-Valle E, et al. 2014b. Border control--a membrane-linked interactome of Arabidopsis. Science 344: 711-716. Jones JDG, Dangl JL. 2006. The plant immune system. Nature 444: 323-329. Kaji K, Oda S, Miyazaki S, Kudo A. 2002. Infertility of CD9-deficient mouse eggs is reversed by mouse CD9, human CD9, or mouse CD81; polyadenylated mRNA injection developed for molecular analysis of sperm-egg fusion. Developmental Biology 247: 327-334. Kaji K, Oda S, Shikano T, Ohnuki T, Uematsu Y, Sakagami J, Tada N, Miyazaki S, Kudo A. 2000. The gamete fusion process is defective in eggs of Cd9-deficient mice. Nature Genetics 24: 279-282. Karimi M, Bleys A, Vanderhaeghen R, Hilson P. 2007. Building blocks for plant gene assembly. Plant Physiology 145: 1183-1191. Karp G. 2009. Cell and Molecular Biology: Concepts and Experiments: John Wiley & Sons. Kasahara RD, Portereiko MF, Sandaklie-Nikolova L, Rabiger DS, Drews GN. 2005. MYB98 is required for pollen tube guidance and synergid cell differentiation in Arabidopsis. Plant Cell 17: 2981-2992.
References 179
Katsir L, Schilmiller AL, Staswick PE, He SY, Howe GA. 2008. COI1 is a critical component of a receptor for jasmonate and the bacterial virulence factor coronatine. Proceedings of the National Academy of Sciences of the United States of America 105: 7100-7105. Kaufmann K, Muino JM, Jauregui R, Airoldi CA, Smaczniak C, Krajewski P, Angenent GC. 2009. Target Genes of the MADS Transcription Factor SEPALLATA3: Integration of Developmental and Hormonal Pathways in the Arabidopsis Flower. PLoS Biology 7: 854-875. Kaufmann K, Wellmer F, Muino JM, Ferrier T, Wuest SE, Kumar V, Serrano-Mislata A, Madueno F, Krajewski P, Meyerowitz EM, et al. 2010. Orchestration of Floral Initiation by APETALA1. Science 328: 85-89. Kimura A, Baumann CA, Chiang SH, Saltiel AR. 2001. The sorbin homology domain: a motif for the targeting of proteins to lipid rafts. Proc Natl Acad Sci U S A 98: 9098- 9103. Kitadokoro K, Bordo D, Galli G, Petracca R, Falugi F, Abrignani S, Grandi G, Bolognesi M. 2001. CD81 extracellular domain 3D structure: insight into the tetraspanin superfamily structural motifs. EMBO Journal 20: 12-18. Kobayashi Y, Kaya H, Goto K, Iwabuchi M, Araki T. 1999. A pair of related genes with antagonistic roles in mediating flowering signals. Science 286: 1960-1962. Kost B, Bao YQ, Chua NH. 2002. Cytoskeleton and plant organogenesis. Philos Trans R Soc Lond B Biol Sci 357: 777-789. Koyama T, Furutani M, Tasaka M, Ohme-Takagi M. 2007. TCP transcription factors control the morphology of shoot lateral organs via negative regulation of the expression of boundary-specific genes in Arabidopsis. Plant Cell 19: 473-484. Krogh A, Larsson B, von Heijne G, Sonnhammer EL. 2001. Predicting transmembrane protein topology with a hidden Markov model: application to complete genomes. J Mol Biol 305: 567-580. Kumar SV, Lucyshyn D, Jaeger KE, Alos E, Alvey E, Harberd NP, Wigge PA. 2012. Transcription factor PIF4 controls the thermosensory activation of flowering. Nature 484: 242-245. Lambou K, Tharreau D, Kohler A, Sirven C, Marguerettaz M, Barbisan C, Sexton AC, Kellner EM, Martin F, Howlett BJ, et al. 2008. Fungi have three tetraspanin families with distinct functions. BMC Genomics 9: 63. Langhorst MF, Reuter A, Stuermer CA. 2005. Scaffolding microdomains and beyond: the function of reggie/flotillin proteins. Cell Mol Life Sci 62: 2228-2240. Laplaze L, Parizot B, Baker A, Ricaud L, Martinière A, Auguy F, Franche C, Nussaume L, Bogusz D, Haseloff J. 2005. GAL4-GFP enhancer trap lines for genetic manipulation of lateral root development in Arabidopsis thaliana. Journal of Experimental Botany 56: 2433-2442. Laude AJ, Prior IA. 2004. Plasma membrane microdomains: organization, function and trafficking. Molecular Membrane Biology 21: 193-205. Laux T, Mayer KFX, Berger J, Jürgens G. 1996. The WUSCHEL gene is required for shoot and floral meristem integrity in Arabidopsis. Development 122: 87-96. Lavenus J, Goh T, Roberts I, Guyomarc'h S, Lucas M, De Smet I, Fukaki H, Beeckman T, Bennett M, Laplaze L. 2013. Lateral root development in Arabidopsis: fifty shades of auxin. Trends in Plant Science 18: 450-458. Lee H, Chah O-K, Sheen J. 2011. Stem-cell-triggered immunity through CLV3p-FLS2 signalling. Nature 473: 376-379. Lee J, He K, Stolc V, Lee H, Figueroa P, Gao Y, Tongprasit W, Zhao HY, Lee I, Deng X. 2007. Analysis of transcription factor HY5 genomic binding sites revealed its
180 References
hierarchical role in light regulation of development. Plant Cell 19: 731-749. Levy S, Shoham T. 2005a. Protein-protein interactions in the tetraspanin web. Physiology 20: 218-224. Levy S, Shoham T. 2005b. The tetraspanin web modulates immune-signalling complexes. Nature Reviews Immunology 5: 136-148. Li C, Potuschak T, Colón-Carmona A, Gutiérrez RA, Doerner P. 2005. Arabidopsis TCP20 links regulation of growth and cell division control pathways. Proceedings of the National Academy of Sciences of the United States of America 102: 12978-12983. Li J, Brader G, Palva ET. 2004. The WRKY70 transcription factor: A node of convergence for jasmonate-mediated and salicylate-mediated signals in plant defense. Plant Cell 16: 319-331. Li R, Liu P, Wan Y, Chen T, Wang Q, Mettbach U, Baluška F, Šamaj J, Fang X, Lucas WJ, et al. 2012. A membrane microdomain-associated protein, Arabidopsis Flot1, is involved in a clathrin-independent endocytic pathway and is required for seedling development. Plant Cell 24: 2105-2122. Li Y, Shen Y, Cai C, Zhong C, Zhu L, Yuan M, Ren H. 2010. The type II Arabidopsis formin14 interacts with microtubules and microfilaments to regulate cell division. Plant Cell 22: 2710-2726. Li YH, Lee KK, Walsh S, Smith C, Hadingham S, Sorefan K, Cawley G, Bevan MW. 2006. Establishing glucose- and ABA-regulated transcription networks in Arabidopsis by microarray analysis and promoter classification using a Relevance Vector Machine. Genome Research 16: 414-427. Li Z, Bi J, Yang J, Pan J, Sun Z, Zhu X. 2012. Requirement of a Tsp2-type tetraspanin for laccase repression and stress resistance in the basidiomycete Cryptococcus neoformans. Appl Environ Microbiol 78: 21-27. Li ZY, Xu ZS, Chen Y, He GY, Yang GX, Chen M, Li LC, Ma YZ. 2013. A Novel Role for Arabidopsis CBL1 in Affecting Plant Responses to Glucose and Gibberellin during Germination and Seedling Development. PLoS ONE 8. Lieber D, Lora J, Schrempp S, Lenhard M, Laux T. 2011. Arabidopsis WIH1 and WIH2 genes act in the transition from somatic to reproductive cell fate. Current Biology 21: 1009-1017. Liechti R, Farmer EE. 2002. The jasmonate pathway. Science 296: 1649-1650. Lin C, Wu Z, Lin X, Yu C, Shi T, Zeng Y, Wang X, Li J, Song L. 2011. Knockdown of FLOT1 impairs cell proliferation and tumorigenicity in breast cancer through upregulation of FOXO3a. Clin Cancer Res 17: 3089-3099. Lindlof A, Brautigam M, Chawade A, Olsson O, Olsson B. 2009. In silico analysis of promoter regions from cold-induced genes in rice (Oryza sativa L.) and Arabidopsis thaliana reveals the importance of combinatorial control. Bioinformatics 25: 1345- 1348. Love AJ, Geri C, Laird J, Carr C, Yun BW, Loake GJ, Tada Y, Sadanandom A, Milner JJ. 2012. Cauliflower mosaic virus Protein P6 Inhibits Signaling Responses to Salicylic Acid and Regulates Innate Immunity. PLoS ONE 7(10): e47535. Lucas J, Shaw SL. 2008. Cortical microtubule arrays in the Arabidopsis seedling. Curr Opin Plant Biol 11: 94-98. Lucas WJ, Bouché-Pillon S, Jackson DP, Nguyen L, Baker L, Ding B, Hake S. 1995. Selective trafficking of KNOTTED1 homeodomain protein and its mRNA through plasmodesmata. Science 270: 1980-1983. Lucioli A, Berardi A, Gatti F, Tavazza R, Pizzichini D, Tavazza M. 2014. Tomato yellow leaf curl Sardinia virus-resistant tomato plants expressing the multifunctional N- terminal domain of the replication-associated protein show transcriptional changes
References 181
resembling stress-related responses. Molecular Plant Pathology 15: 31-43. Luo X-M, Lin W-H, Zhu S, Zhu J-Y, Sun Y, Fan X-Y, Cheng M, Hao Y, Oh E, Tian M, et al. 2010. Integration of light- and brassinosteroid-signaling pathways by a GATA transcription factor in Arabidopsis. Developmental Cell 19: 872-883. Maecker HT, Todd SC, Levy S. 1997. The tetraspanin superfamily: Molecular facilitators. FASEB Journal 11: 428-442. Maeo K, Tomiya T, Hayashi K, Akaike M, Morikami A, Ishiguro S, Nakamura K. 2001. Sugar-responsible elements in the promoter of a gene for beta-amylase of sweet potato. Plant Mol Biol 46: 627-637. Maere S, Heymans K, Kuiper M. 2005. BiNGO: a Cytoscape plugin to assess overrepresentation of Gene Ontology categories in biological networks. Bioinformatics 21: 3448-3449. Majoul IV, Bastiaens PIH, Soling HD. 1996. Transport of an external Lys-Asp-Glu-Leu (KDEL) protein from the plasma membrane to the endoplasmic reticulum: Studies with cholera toxin in Vero cells. Journal of Cell Biology 133: 777-789. Malamy JE, Benfey PN. 1997. Organization and cell differentiation in lateral roots of Arabidopsis thaliana. Development 124: 33-44. Malinsky J, Opekarova M, Grossmann G, Tanner W. 2013. Membrane Microdomains, Rafts, and Detergent-Resistant Membranes in Plants and Fungi. Annual Review of Plant Biology 64: 501-529. Marin I, van Egmond WN, van Haastert PJ. 2008. The Roco protein family: a functional perspective. FASEB J 22: 3103-3110. Marks MD, Gilding E, Wenger JP. 2007. Genetic interaction between glabra3-shapeshifter and siamese in Arabidopsis thaliana converts trichome precursors into cells with meristematic activity. Plant J 52: 352-361. Marks MD, Wenger JP, Gilding E, Jilk R, Dixon RA. 2009. Transcriptome analysis of Arabidopsis wild-type and gl3-sst sim trichomes identifies four additional genes required for trichome development. Mol Plant 2: 803-822. Matallana-Ramirez LP, Rauf M, Farage-Barhom S, Dortay H, Xue G-P, Dröge-Laser W, Lers A, Balazadeh S, Mueller-Roeber B. 2013. NAC transcription factor ORE1 and senescence-induced BIFUNCTIONAL NUCLEASE1 (BFN1) constitute a regulatory cascade in Arabidopsis. Molecular Plant 6: 1438-1452. Mazurov D, Heidecker G, Derse D. 2007. The inner loop of tetraspanins CD82 and CD81 mediates interactions with human T cell lymphotrophic virus type 1 Gag protein. Journal of Biological Chemistry 282: 3896-3903. Melotto M, Underwood W, Koczan J, Nomura K, He SY. 2006. Plant stomata function in innate immunity against bacterial invasion. Cell 126: 969-980. Menges M, Samland AK, Planchais S, Murray JA. 2006. The D-type cyclin CYCD3;1 is limiting for the G1-to-S-phase transition in Arabidopsis. Plant Cell 18: 893-906. Mercurio F, Karin M. 1989. Transcription Factors Ap-3 and Ap-2 Interact with the Sv40 Enhancer in a Mutually Exclusive Manner. EMBO Journal 8: 1455-1460. Min GW, Wang HB, Sun TT, Kong XP. 2006. Structural basis for tetraspanin functions as revealed by the cryo-EM structure of uroplakin complexes at 6-A resolution. Journal of Cell Biology 173: 975-983. Mitra K, Frank J, Driessen A. 2006. Co- and post-translational translocation through the protein-conducting channel: analogous mechanisms at work? Nature Structural & Molecular Biology 13: 957-964. Monk PN, Partridge LJ. 2011. Tetraspanins - Gateways for Infection. Infectious Disorders Drug Targets in press. Moore RC, Purugganan MD. 2005. The evolutionary dynamics of plant duplicate genes.
182 References
Current Opinion in Plant Biology 8: 122-128. Morceau F, Schnekenburger M, Dicato M, Diederich M. 2004. GATA-1: friends, brothers, and coworkers. Ann N Y Acad Sci 1030: 537-554. Morohashi K, Grotewold E. 2009. A Systems Approach Reveals Regulatory Circuitry for Arabidopsis Trichome Initiation by the GL3 and GL1 Selectors. PLoS Genetics 5. Morrow IC, Parton RG. 2005. Flotillins and the PHB domain protein family: Rafts, worms and anaesthetics. Traffic 6: 725-740. Morrow IC, Rea S, Martin S, Prior IA, Prohaska R, Hancock JF, James DE, Parton RG. 2002. Flotillin-1/reggie-2 traffics to surface raft domains via a novel golgi- independent pathway. Identification of a novel membrane targeting domain and a role for palmitoylation. J Biol Chem 277: 48834-48841. Nagano AJ, Fukao Y, Fujiwara M, Nishimura M, Hara-Nishimura I. 2008. Antagonistic jacalin-related lectins regulate the size of ER body-type beta-glucosidase complexes in Arabidopsis thaliana. Plant Cell Physiol 49: 969-980. Nakamichi N, Kita M, Niinuma K, Ito S, Yamashino T, Mizoguchi T, Mizuno T. 2007. Arabidopsis clock-associated pseudo-response regulators PRR9, PRR7 and PRR5 coordinately and positively regulate flowering time through the canonical CONSTANS-dependent photoperiodic pathway. Plant and Cell Physiology 48: 822- 832. Nakano RT, Matsushima R, Nagano AJ, Fukao Y, Fujiwara M, Kondo M, Nishimura M, Hara-Nishimura I. 2012. ERMO3/MVP1/GOLD36 Is Involved in a Cell Type- Specific Mechanism for Maintaining ER Morphology in Arabidopsis thaliana. PLoS ONE 7. Nakashita H, Yasuda M, Nitta T, Asami T, Fujioka S, Arai Y, Sekimata K, Takatsuto S, Yamaguchi I, Yoshida S. 2003. Brassinosteroid functions in a broad range of disease resistance in tobacco and rice. Plant Journal 33: 887-898. Narusaka Y, Nakashima K, Shinwari ZK, Sakuma Y, Furihata T, Abe H, Narusaka M, Shinozaki K, Yamaguchi-Shinozaki K. 2003. Interaction between two cis-acting elements, ABRE and DRE, in ABA-dependent expression of Arabidopsis rd29A gene in response to dehydration and high-salinity stresses. Plant Journal 34: 137-148. Nelissen H, De Groeve S, Fleury D, Neyt P, Bruno L, Bitonti MB, Vandenbussche F, Van Der Straeten D, Yamaguchi T, Tsukaya H, et al. 2010. Plant Elongator regulates auxin-related genes during RNA polymerase II transcription elongation. Proceedings of the National Academy of Sciences of the United States of America 107: 1678-1683. Neumann-Giesen C, Falkenbach B, Beicht P, Claasen S, Luers G, Stuermer CA, Herzog V, Tikkanen R. 2004. Membrane and raft association of reggie-1/flotillin-2: role of myristoylation, palmitoylation and oligomerization and induction of filopodia by overexpression. Biochem J 378: 509-518. Nie HZ, Zhao CZ, Wu GH, Wu YY, Chen YF, Tang DZ. 2012. SR1, a Calmodulin-Binding Transcription Factor, Modulates Plant Defense and Ethylene-Induced Senescence by Directly Regulating NDR1 and EIN3. Plant Physiology 158: 1847-1859. Ogawa M, Hanada A, Yamauchi Y, Kuwalhara A, Kamiya Y, Yamaguchi S. 2003. Gibberellin biosynthesis and response during Arabidopsis seed germination. Plant Cell 15: 1591-1604. Ogawa M, Shinohara H, Sakagami Y, Matsubayashi Y. 2008. Arabidopsis CLV3 peptide directly binds CLV1 ectodomain. Science 319: 294. Oh E, Kang H, Yamaguchi S, Park J, Lee D, Kamiya Y, Choi G. 2009. Genome-wide analysis of genes targeted by PHYTOCHROME INTERACTING FACTOR 3-LIKE5 during seed germination in Arabidopsis. Plant Cell 21: 403-419. Olmos E, Reiss B, Dekker K. 2003. The ekeko mutant demonstrates a role for tetraspanin-
References 183
like protein in plant development. Biochemical and Biophysical Research Communications 310: 1054-1061. Otto GP, Nichols BJ. 2011. The roles of flotillin microdomains - endocytosis and beyond. Journal of Cell Science 124: 3933-3940. Ouyang XH, Li JG, Li G, Li BS, Chen BB, Shen HS, Huang X, Mo XR, Wan XY, Lin RC, et al. 2011. Genome-Wide Binding Site Analysis of FAR-RED ELONGATED HYPOCOTYL3 Reveals Its Novel Function in Arabidopsis Development. Plant Cell 23: 2514-2535. Paponov IA, Teale WD, Trebar M, Blilou I, Palme K. 2005. The PIN auxin efflux facilitators: evolutionary and functional perspectives. Trends in Plant Sciences 10: 170-177. Park JH, Halitschke R, Kim HB, Baldwin IT, Feldmann KA, Feyereisen R. 2002. A knock-out mutation in allene oxide synthase results in male sterility and defective wound signal transduction in Arabidopsis due to a block in jasmonic acid biosynthesis. Plant J 31: 1-12. Pauwels L, Barbero GF, Geerinck J, Tilleman S, Grunewald W, Cuéllar Pérez A, Chico JM, Vanden Bossche R, Sewell J, Gil E, et al. 2010. NINJA connects the co- repressor TOPLESS to jasmonate signalling. Nature 464: 788-791. Penas PF, Garcia-Diez A, Sanchez-Madrid F, Yanez-Mo M. 2000. Tetraspanins are localized at motility-related structures and involved in normal human keratinocyte wound healing migration. Journal of Investigative Dermatology 114: 1126-1135. Petersen TN, Brunak S, von Heijne G, Nielsen H. 2011. SignalP 4.0: discriminating signal peptides from transmembrane regions. Nature Methods 8: 785-786. Petrášek J, Friml J. 2009. Auxin transport routes in plant development. Development 136: 2675-2688. Pietra S, Gustavsson A, Kiefer C, Kalmbach L, Horstedt P, Ikeda Y, Stepanova AN, Alonso JM, Grebe M. 2013. Arabidopsis SABRE and CLASP interact to stabilize cell division plane orientation and planar polarity. Nat Commun 4: 2779. Pillitteri LJ, Torii KU. 2012. Mechanisms of stomatal development. Annual Review of Plant Biology 63: 591-614. Pohlmann R, Boeker MW, von Figura K. 1995. The two mannose 6-phosphate receptors transport distinct complements of lysosomal proteins. J Biol Chem 270: 27311-27318. Powers T, Walter P. 1997. Co-translational protein targeting catalyzed by the Escherichia coli signal recognition particle and its receptor. EMBO J 16: 4880-4886. Powner D, Kopp PM, Monkley SJ, Critchley DR, Berditchevski F. 2011. Tetraspanin CD9 in cell migration. Biochemical Society Transactions 39: 563-567. Proost S, Van Bel M, Vaneechoutte D, Van de Peer Y, Inze D, Mueller-Roeber B, Vandepoele K. 2015. PLAZA 3.0: an access point for plant comparative genomics. Nucleic Acids Res 43: D974-981. Qin L-X, Perennes C, Richard L, Bouvier-Durand M, Tréhin C, Inzé D, Bergounioux C. 1996. G2-and early-M-specific expression of the NTCYC1 cyclin gene in Nicotiana tabacum cells. Plant Molecular Biology 32: 1093-1101. Rademacher EH, Möller B, Lokerse AS, Llavata-Peris CI, van den Berg W, Weijers D. 2011. A cellular expression map of the Arabidopsis AUXIN RESPONSE FACTOR gene family. Plant Journal 68: 597-606. Ramirez V, Agorio A, Coego A, Garcia-Andrade J, Hernandez MJ, Balaguer B, Ouwerkerk PBF, Zarra I, Vera P. 2011a. MYB46 Modulates Disease Susceptibility to Botrytis cinerea in Arabidopsis. Plant Physiology 155: 1920-1935. Ramirez V, Garcia-Andrade J, Vera P. 2011b. Enhanced disease resistance to Botrytis cinerea in myb46 Arabidopsis plants is associated to an early down-regulation of CesA
184 References
genes. Plant Signal Behav 6: 911-913. Rashid A, Hobson N, Deyholos MK. 2013. A Genomic Region Upstream of Arabidopsis thaliana PELPK1 Promotes Transcription in Aleurone Tissues and in Response to Pseudomonas syringae or Pythium irregulare. Plant Molecular Biology Reporter 31: 1025-1030. Raynaud C, Sozzani R, Glab N, Domenichini S, Perennes C, Cella R, Kondorosi E, Bergounioux C. 2006. Two cell-cycle regulated SET-domain proteins interact with proliferating cell nuclear antigen (PCNA) in Arabidopsis. Plant J 47: 395-407. Reeves WM, Lynch TJ, Mobin R, Finkelstein RR. 2011. Direct targets of the transcription factors ABA-Insensitive(ABI)4 and ABI5 reveal synergistic action by ABI4 and several bZIP ABA response factors. Plant Mol Biol 75: 347-363. Riou-Khamlichi C, Huntley R, Jacqmard A, Murray JA. 1999. Cytokinin activation of Arabidopsis cell division through a D-type cyclin. Science 283: 1541-1544. Riou-Khamlichi C, Menges M, Healy JMS, Murray JAH. 2000. Sugar control of the plant cell cycle: differential regulation of Arabidopsis D-type cyclin gene expression. Molecular and Cellular Biology 20: 4513-4521. Robert-Seilaniantz A, Grant M, Jones JDG. 2011. Hormone crosstalk in plant disease and defense: more than just JASMONATE-SALICYLATE antagonism. Annual Review of Phytopathology 49: 317-343. Roccasecca R, Ansuini H, Vitelli A, Meola A, Scarselli E, Acali S, Pezzanera M, Ercole BB, McKeating J, Yagnik A, et al. 2003. Binding of the hepatitis C virus E2 glycoprotein to CD81 is strain specific and is modulated by a complex interplay between hypervariable regions 1 and 2. Journal of Virology 77: 1856-1867. Rohila JS, Chen M, Chen S, Chen J, Cerny R, Dardick C, Canlas P, Xu X, Gribskov M, Kanrar S, et al. 2006. Protein-protein interactions of tandem affinity purification- tagged protein kinases in rice. Plant Journal 46: 1-13. Rose A, Meier I, Wienand U. 1999. The tomato I-box binding factor LeMYBI is a member of a novel class of myb-like proteins. Plant J 20: 641-652. Rubinstein E. 2011. The complexity of tetraspanins. Biochemical Society Transactions 39: 501-505. Berditchevski F, Rubinstein E. 2013. Tetraspanins. Springer Netherlands. Rubinstein E, Ziyyat A, Prenant M, Wrobel E, Wolf JP, Levy S, Le Naour F, Boucheix C. 2006. Reduced fertility of female mice lacking CD81. Developmental Biology 290: 351-358. Rushton PJ, Torres JT, Parniske M, Wernert P, Hahlbrock K, Somssich IE. 1996. Interaction of elicitor-induced DNA-binding proteins with elicitor response elements in the promoters of parsley PR1 genes. EMBO Journal 15: 5690-5700. Rust MJ, Bates M, Zhuang X. 2006. Sub-diffraction-limit imaging by stochastic optical reconstruction microscopy (STORM). Nat Methods 3: 793-795. Sachs JN, Engelman DM. 2006. Introduction to the membrane protein reviews: the interplay of structure, dynamics, and environment in membrane protein function. Annu Rev Biochem 75: 707-712. Saibo NJM, Vriezen WH, Beemster GTS, Van Der Straeten D. 2003. Growth and stomata development of Arabidopsis hypocotyls are controlled by gibberellins and modulated by ethylene and auxins. Plant Journal 33: 989-1000. Sala-Valdes M, Ursa A, Charrin S, Rubinstein E, Hemler ME, Sanchez-Madrid F, Yanez-Mo M. 2006. EWI-2 and EWI-F link the tetraspanin web to the actin cytoskeleton through their direct association with ezrin-radixin-moesin proteins. J Biol Chem 281: 19665-19675. Santner A, Estelle M. 2010. The ubiquitin-proteasome system regulates plant hormone
References 185
signaling. Plant Journal 61: 1029-1040. Santoni V, Molloy M, Rabilloud T. 2000. Membrane proteins and proteomics: un amour impossible? Electrophoresis 21: 1054-1070. Sarkar AK, Luijten M, Miyashima S, Lenhard M, Hashimoto T, Nakajima K, Scheres B, Heidstra R, Laux T. 2007. Conserved factors regulate signalling in Arabidopsis thaliana shoot and root stem cell organizers. Nature 446: 811-814. Schenke D, Bottcher C, Scheel D. 2011. Crosstalk between abiotic ultraviolet-B stress and biotic (flg22) stress signalling in Arabidopsis prevents flavonol accumulation in favor of pathogen defence compound production. Plant Cell and Environment 34: 1849- 1864. Schoof H, Lenhard M, Haecker A, Mayer KFX, Jürgens G, Laux T. 2000. The stem cell population of Arabidopsis shoot meristems in maintained by a regulatory loop between the CLAVATA and WUSCHEL genes. Cell 100: 635-644. Seigneuret M. 2006. Complete predicted three-dimensional structure of the facilitator transmembrane protein and hepatitis C virus receptor CD81: conserved and variable structural domains in the tetraspanin superfamily. Biophysical Journal 90: 212-227. Seigneuret M, Delaguillaumie A, Lagaudrière-Gesbert C, Conjeaud H. 2001. Structure of the tetraspanin main extracellular domain. A partially conserved fold with a structurally variable domain insertion. Journal of Biological Chemistry 276: 40055- 40064. Sessions A, Yanofsky MF, Weigel D. 2000. Cell-cell signaling and movement by the floral transcription factors LEAFY and APETALA1. Science 289: 779-781. Shapiro-Shelef M, Calame K. 2004. Plasma cell differentiation and multiple myeloma. Current Opinion in Immunology 16: 226-234. Shi J, An HL, Zhang LA, Gao Z, Guo XQ. 2010. GhMPK7, a novel multiple stress- responsive cotton group C MAPK gene, has a role in broad spectrum disease resistance and plant development. Plant Molecular Biology 74: 1-17. Shoham T, Rajapaksa R, Boucheix C, Rubinstein E, Poe JC, Tedder TF, Levy S. 2003. The tetraspanin CD81 regulates the expression of CD19 during B cell development in a postendoplasmic reticulum compartment. Journal of Immunology 171: 4062-4072. Simpson GG, Dean C. 2002. Arabidopsis, the Rosetta stone of flowering time? Science 296: 285-289. Small I, Peeters N, Legeai F, Lurin C. 2004. Predotar: A tool for rapidly screening proteomes for N-terminal targeting sequences. Proteomics 4: 1581-1590. Song L, Zhang Z, Grasfeder LL, Boyle AP, Giresi PG, Lee BK, Sheffield NC, Graf S, Huss M, Keefe D, et al. 2011. Open chromatin defined by DNaseI and FAIRE identifies regulatory elements that shape cell-type identity. Genome Res 21: 1757- 1767. Sparks E, Wachsman G, Benfey PN. 2013. Spatiotemporal signalling in plant development. Nature Reviews Genetics 14: 631-644. Sprunck S, Dresselhaus T. 2009. Gamete interactions during double fertilization in flowering plants. Zellbiologie Aktuell 35: 22-27. Stahl Y, Grabowski S, Bleckmann A, Kühnemuth R, Weidtkamp-Peters S, Pinto KG, Kirschner GK, Schmid JB, Wink RH, Hülsewede A, et al. 2013. Moderation of Arabidopsis root stemness by CLAVATA1 and ARABIDOPSIS CRINKLY4 receptor kinase complexes. Current Biology 23: 362-371. Steeves TA, Sussex IM. 1989. Patterns in Plant Development. (Cambridge, UK: Cambridge University Press). Stipp CS, Kolesnikova TV, Hemler ME. 2003. Functional domains in tetraspanin proteins. Trends in Biochemical Sciences 28: 106-112.
186 References
Sun Y, Fan XY, Cao DM, Tang WQ, He K, Zhu JY, He JX, Bai MY, Zhu SW, Oh E, et al. 2010. Integration of Brassinosteroid Signal Transduction with the Transcription Network for Plant Growth Regulation in Arabidopsis. Developmental Cell 19: 765- 777. Sundaresan V, Alandete-Saez M. 2010. Pattern formation in miniature: the female gametophyte of flowering plants. Development 137: 179-189. Swarup K, Benková E, Swarup R, Casimiro I, Péret B, Yang Y, Parry G, Nielsen E, De Smet I, Vanneste S, et al. 2008. The auxin influx carrier LAX3 promotes lateral root emergence. Nature Cell Biology 10: 946-954. Światek A, Lenjou M, Van Bockstaele D, Inzé D, Van Onckelen H. 2002. Differential effect of jasmonic acid and abscisic acid on cell cycle progression in tobacco BY-2 cells. Plant Physiology 128: 201-211. Szemenyei H, Hannon M, Long JA. 2008. TOPLESS mediates auxin-dependent transcriptional repression during Arabidopsis embryogenesis. Science 319: 1384-1386. Takino T, Miyamori H, Kawaguchi N, Uekita T, Seiki M, Sato H. 2003. Tetraspanin CD63 promotes targeting and lysosomal proteolysis of membrane-type 1 matrix metalloproteinase. Biochemical and Biophysical Research Communications 304: 160- 166. Thibaud-Nissen F, Wu H, Richmond T, Redman JC, Johnson C, Green R, Arias J, Town CD. 2006. Development of Arabidopsis whole-genome microarrays and their application to the discovery of binding sites for the TGA2 transcription factor in salicylic acid-treated plants. Plant Journal 47: 152-162. Thines B, Katsir L, Melotto M, Niu Y, Mandaokar A, Liu G, Nomura K, He SY, Howe GA, Browse J. 2007. JAZ repressor proteins are targets of the SCF(COI1) complex during jasmonate signalling. Nature 448: 661-665. Thomas MS, Flavell RB. 1990. Identification of an Enhancer Element for the Endosperm- Specific Expression of High-Molecular-Weight Glutenin. Plant Cell 2: 1171-1180. Thurman RE, Rynes E, Humbert R, Vierstra J, Maurano MT, Haugen E, Sheffield NC, Stergachis AB, Wang H, Vernot B, et al. 2012. The accessible chromatin landscape of the human genome. Nature 489: 75-82. Todres E, Nardi JB, Robertson HM. 2000. The tetraspanin superfamily in insects. Insect Mol Biol 9: 581-590. Tognetti JA, Pontis HG, Martinez-Noel GM. 2013. Sucrose signaling in plants: a world yet to be explored. Plant Signal Behav 8: e23316. Toyo-oka K, Yashiro-Ohtani Y, Park C-S, Tai X-G, Miyake K, Hamaoka T, Fujiwara H. 1999. Association of a tetraspanin CD9 with CD5 on the T cell surface: role of particular transmembrane domains in the association. International Immunology 11: 2043-2052. Trotochaud AE, Hao T, Wu G, Yang Z, Clark SE. 1999. The CLAVATA1 receptor-like kinase requires CLAVATA3 for its assembly into a signaling complex that includes KAPP and a Rho-related protein. Plant Cell 11: 393-406. Tsuchiya Y, Nambara E, Naito S, McCourt P. 2004. The FUS3 transcription factor functions through the epidermal regulator TTG1 during embryogenesis in Arabidopsis. Plant J 37: 73-81. Tsuda K, Katagiri F. 2010. Comparing signaling mechanisms engaged in pattern-triggered and effector-triggered immunity. Current Opinion in Plant Biology 13: 459-465. Tu L, Kong X-P, Sun T-T, Kreibich G. 2006. Integrity of all four transmembrane domains of the tetraspanin uroplakin Ib is required for its exit from the ER. Journal of Cell Science 119: 5077-5086. Tucker MR, Hinze A, Tucker EJ, Takada S, Jürgens G, Laux T. 2008. Vascular signalling
References 187
mediated by ZWILLE potentiates WUSCHEL function during shoot meristem stem cell development in the Arabidopsis embryo. Development 135: 2839-2843. Van Bel M, Proost S, Wischnitzki E, Movahedi S, Scheerlinck C, Van de Peer Y, Vandepoele K. 2012. Dissecting plant genomes with the PLAZA comparative genomics platform. Plant Physiology 158: 590-600. Van de Velde J, Heyndrickx KS, Vandepoele K. 2014. Inference of Transcriptional Networks in Arabidopsis through Conserved Noncoding Sequence Analysis. Plant Cell 26: 2729-2745. van den Berg C, Willemsen V, Hendriks G, Weisbeek P, Scheres B. 1997. Short-range control of cell differentiation in the Arabidopsis root meristem. Nature 390: 287-289. Van Leene J, Hollunder J, Eeckhout D, Persiau G, Van De Slijke E, Stals H, Van Isterdael G, Verkest A, Neirynck S, Buffel Y, et al. 2010. Targeted interactomics reveals a complex core cell cycle machinery in Arabidopsis thaliana. Molecular Systems Biology 6: 397. Van Leene J, Stals H, Eeckhout D, Persiau G, Van De Slijke E, Van Isterdael G, De Clercq A, Bonnet E, Laukens K, Remmerie N, et al. 2007a. A tandem affinity purification-based technology platform to study the cell cycle interactome in Arabidopsis thaliana. Molecular & Cellular Proteomics 6: 1226-1238. Van Leene J, Stals H, Eeckhout D, Persiau G, Van De Slijke E, Van Isterdael G, De Clercq A, Bonnet E, Laukens K, Remmerie N, et al. 2007b. A tandem affinity purification-based technology platform to study the cell cycle interactome in Arabidopsis thaliana. Molecular and Cellular Proteomics 6: 1226-1238. Van Leene J, Witters E, Inzé D, De Jaeger G. 2008. Boosting tandem affinity purification of plant protein complexes. Trends in Plant Science 13: 517-520. Van Lijsebettens M, Van Montagu M. 2005. Historical perspectives on plant developmental biology. International Journal of Developmental Biology 49: 453-465. Van Norman JM, Breakfield NW, Benfey PN. 2011. Intercellular communication during plant development. Plant Cell 23: 855-864. Van Spriel AB, Figdor CG. 2010. The role of tetraspanins in the pathogenesis of infectious diseases. Microbes and Infection 12: 106-112. Vanneste S, De Rybel B, Beemster GTS, Ljung K, De Smet I, Van Isterdael G, Naudts M, Iida R, Gruissem W, Tasaka M, et al. 2005. Cell cycle progression in the pericycle is not sufficient for SOLITARY ROOT/IAA14-mediated lateral root initiation in Arabidopsis thaliana. Plant Cell 17: 3035-3050. von Heijne G. 1990. The signal peptide. J Membr Biol 115: 195-201. Vos WL, Vaughan S, Lall PY, McCaffrey JG, Wysocka-Kapcinska M, Findlay JBC. 2010. Expression and structural characterization of peripherin/RDS, a membrane protein implicated in photoreceptor outer segment morphology. European Biophysics Journal 39: 679-688. Wacker I, Kaether C, Kromer A, Migala A, Almers W, Gerdes HH. 1997. Microtubule- dependent transport of secretory vesicles visualized in real time with a GFP-tagged secretory protein. J Cell Sci 110 ( Pt 13): 1453-1463. Waclawovsky AJ, Freitas RL, Rocha CS, Contim LAS, Fontes EPB. 2006. Combinatorial regulation modules on GmSBP2 promoter: A distal cis-regulatory domain confines the SBP2 promoter activity to the vascular tissue in vegetative organs. Biochimica Et Biophysica Acta-Gene Structure and Expression 1759: 89-98. Wakabayashi T, Craessaerts K, Bammens L, Bentahir M, Borgions F, Herdewijn P, Staes A, Timmerman E, Vandekerckhove J, Rubinstein E, et al. 2009. Analysis of the γ-secretase interactome and validation of its association with tetraspanin-enriched microdomains. Nature Cell Biology 11: 1340-1346.
188 References
Wang F, Perry SE. 2013. Identification of direct targets of FUSCA3, a key regulator of Arabidopsis seed development. Plant Physiol 161: 1251-1264. Wang F, Vandepoele K, Van Lijsebettens M. 2012. Tetraspanin genes in plants. Plant Science 190: 9-15. Wang H-X, Kolesnikova TV, Denison C, Gygi SP, Hemler ME. 2011. The C-terminal tail of tetraspanin protein CD9 contributes to its function and molecular organization. Journal of Cell Science 124: 2702-2710. Wang L, Gu X, Xu D, Wang W, Wang H, Zeng M, Chang Z, Huang H, Cui X. 2011. miR396-targeted AtGRF transcription factors are required for coordination of cell division and differentiation during leaf development in Arabidopsis. Journal of Experimental Botany 62: 761-773. Ward JM. 2001. Identification of novel families of membrane proteins from the model plant Arabidopsis thaliana. Bioinformatics 17: 560-563. Warden SM, Richardson C, O'Donnell J, Stepleton D, Kemp BE, Witters LA. 2001. Post- translational modifications of the beta-1 subunit of AMP-activated protein kinase affect enzyme activity and cellular localization. Biochemical Journal 354: 275-283. Weigel D, Jürgens G. 2002. Stem cells that make stems. Nature 415: 751-754. Whitford R, Fernandez A, Tejos R, Cuéllar Pérez A, Kleine-Vehn J, Vanneste S, Drozdzecki A, Leitner J, Abas L, Aerts M, et al. 2012. GOLVEN secretory peptides regulate auxin carrier turnover during plant gravitropic responses. Developmental Cell 22: 678-685. Wickstead B, Gull K. 2011. The evolution of the cytoskeleton. J Cell Biol 194: 513-525. Wimley WC. 2003. The versatile beta-barrel membrane protein. Curr Opin Struct Biol 13: 404-411. Winter D, Vinegar B, Nahal H, Ammar R, Wilson GV, Provart NJ. 2007. An "electronic Fluorescent Pictograph" browser for exploring and analyzing large-scale biological data sets. PLoS ONE 2: e718. Wu CY, Washida H, Onodera Y, Harada K, Takaiwa F. 2000. Quantitative nature of the Prolamin-box, ACGT and AACA motifs in a rice glutelin gene promoter: minimal cis- element requirements for endosperm-specific gene expression. Plant Journal 23: 415- 421. Xie D-X, Feys BF, James S, Nieto-Rostro M, Turner JG. 1998. COI1: an Arabidopsis gene required for jasmonate-regulated defense and fertility. Science 280: 1091-1094. Xiong Y, McCormack M, Li L, Hall Q, Xiang C, Sheen J. 2013. Glucose-TOR signalling reprograms the transcriptome and activates meristems. Nature 496: 181-186. Yadav RK, Perales M, Gruel J, Girke T, Jönsson H, Reddy GV. 2011. WUSCHEL protein movement mediates stem cell homeostasis in the Arabidopsis shoot apex. Genes & Development 25: 2025-2030. Yamamoto R, Demura T, Fukuda H. 1997. Brassinosteroids induce entry into the final stage of tracheary element differentiation in cultured Zinnia cells. Plant and Cell Physiology 38: 980-983. Yan JB, Li HO, Li SH, Yao RF, Deng HT, Xie Q, Xie DX. 2013. The Arabidopsis F-Box Protein CORONATINE INSENSITIVE1 Is Stabilized by SCFCOI1 and Degraded via the 26S Proteasome Pathway. Plant Cell 25: 486-498. Yáñez-Mó M, Barreiro O, Gordon-Alonso M, Sala-Valdés M, Sánchez-Madrid F. 2009. Tetraspanin-enriched microdomains: a functional unit in cell plasma membranes. Trends in Cell Biology 19: 434-446. Yang TB, Poovaiah BW. 2002. A calmodulin-binding/CGCG box DNA-binding protein family involved in multiple signaling pathways in plants. Journal of Biological Chemistry 277: 45049-45058.
References 189
Yang X, Claas C, Kraeft S-K, Chen LB, Wang Z, Kreidberg JA, Hemler ME. 2002. Palmitoylation of tetraspanin proteins: modulation of CD151 lateral interactions, subcellular distribution, and integrin-dependent cell morphology. Molecular Biology of the Cell 13: 767-781. Yang X, Kovalenko OV, Tang W, Claas C, Stipp CS, Hemler ME. 2004. Palmitoylation supports assembly and function of integrin-tetraspanin complexes. Journal of Cell Biology 167: 1231-1240. Yang Y, Yu Y, Cheng J, Liu Y, Liu DS, Wang J, Zhu MX, Wang R, Xu TL. 2012. Highly Conserved Salt Bridge Stabilizes Rigid Signal Patch at Extracellular Loop Critical for Surface Expression of Acid-sensing Ion Channels. Journal of Biological Chemistry 287: 14443-14455. Yant L, Mathieu J, Dinh TT, Ott F, Lanz C, Wollmann H, Chen XM, Schmid M. 2010. Orchestration of the Floral Transition and Floral Development in Arabidopsis by the Bifunctional Transcription Factor APETALA2. Plant Cell 22: 2156-2170. Yauch RL, Berditchevski F, Harler MB, Reichner J, Hemler ME. 1998. Highly stoichiometric, stable, and specific association of integrin α3β1 with CD151 provides a major link to phosphatidylinositol 4-kinase, and may regulate cell migration. Molecular Biology of the Cell 9: 2751-2765. Yi D, Alvim Kamei CL, Cools T, Vanderauwera S, Takahashi N, Okushima Y, Eekhout T, Yoshiyama KO, Larkin J, Van den Daele H, et al. 2014. The Arabidopsis SIAMESE-RELATED cyclin-dependent kinase inhibitors SMR5 and SMR7 regulate the DNA damage checkpoint in response to reactive oxygen species. Plant Cell 26: 296-309. Yildirim MA, Goh KI, Cusick ME, Barabasi AL, Vidal M. 2007. Drug-target network. Nat Biotechnol 25: 1119-1126. Yu J, Lin JH, Wu XR, Sun TT. 1994. Uroplakins Ia and Ib, two major differentiation products of bladder epithelium, belong to a family of four transmembrane domain (4TM) proteins. J Cell Biol 125: 171-182. Yu XF, Li L, Zola J, Aluru M, Ye HX, Foudree A, Guo HQ, Anderson S, Aluru S, Liu P, et al. 2011. A brassinosteroid transcriptional network revealed by genome-wide identification of BESI target genes in Arabidopsis thaliana. Plant Journal 65: 634-646. Zhang W, Zhang T, Wu Y, Jiang J. 2012. Genome-wide identification of regulatory DNA elements and protein-binding footprints using signatures of open chromatin in Arabidopsis. Plant Cell 24: 2719-2731. Zheng YM, Ren N, Wang H, Stromberg AJ, Perry SE. 2009. Global Identification of Targets of the Arabidopsis MADS Domain Protein AGAMOUS-Like15. Plant Cell 21: 2563-2577. Zimmermann P, Hirsch-Hoffmann M, Hennig L, Gruissem W. 2004. GENEVESTIGATOR. Arabidopsis microarray database and analysis toolbox. Plant Physiology 136: 2621-2632. Ziyyat A, Rubinstein E, Monier-Gavelle F, Barraud V, Kulski O, Prenant M, Boucheix C, Bomsel M, Wolf J-P. 2006. CD9 controls the formation of clusters that contain tetraspanins and the integrin α6β1, which are involved in human and mouse gamete fusion. Journal of Cell Science 119: 416-424.
Acknowledgements 191
ACKNOWLEDGEMENTS
To those whom I love and treasure. To those whom I can share my happiness as well as sadness with. To those who accompanied me and went through the difficulties with me these years. Thank you, dank u, danke, merci, dziękuję, spasibo, grazie, asante, gracias, kiitos, 감사합니다, 谢谢, obrigado…
So, is this it? The end of my thesis. Still cannot believe that I managed to reach this part. Of course, this would not be possible without the supports and encouragements from all of you: my promoter, co-promoter, Chromatin members, friends, colleagues and family. First of all, I would like to thank my jury members for their precious time to read the thesis, to write the evaluation report, to make all the efforts to come to PSB from external and most importantly, to give the comments which helped a lot to improve this thesis. Special thank goes to Gerda Cnops, who agreed at the very important moment and helped me out. The person that I want to thank most is my promoter Prof. Mieke Van Lijsebettens. I can still remember that four years ago when I showed your profile picture to my colleagues in China, the first question they asked me was: Feng, are you sure you want to contact her for a predoctoral position? I guess you know what they mean:). My answer was: yes, why not? Finally, it turns out that I can also make correct decisions! When I came here and made friends with the other students, they usually asked me a very common question: what does Mieke look like? Again and again I had to tell them how amazing you are, both in science as a promoter and in daily life as a friend. “She really concerns and thinks for the students. Whenever you want to discuss with her, she will always make time for you and provide you great idea, or make your work layout better. She never postpones correcting your manuscript and thesis. She likes laughing, making jokes with you. You will never feel the tension when talking to her”. To those who still want to ask me about this question: I am tired of answering it. To those who do not think my words are convincing or do not believe me: Ask the big GERMAN from our group:). Mieke, I would definitely give up if I was not working with you, especially in these last few months of writing. Some PIs choose to “suffer” only once or a few times from correcting thesis, but apparently you “enjoy”
192 Acknowledgements
it:). Some students complain that their PIs never correct their thesis or postpone it to the very end, but I never had chance to complain… Probably I had not told you how encouraging it was when I read your reply “Dear Feng, I think this part is very good, I like it very much, I only have a few corrections. Please go ahead with the other parts after correcting them”. I am not sure about whether the writing was really good or you were trying to be encouraging, nevertheless, that might be the art of supervising, guiding and teaching. I think I owe you some better results and manuscripts about tetraspanins and tornados. I liked and still like them, I know there is no “if”, but I am sure we can make them better if there is a “reboot” button. I do hope there will be someone that can continue the projects and have some mechanistic insights into tetraspanins and tornados. You and he/she have my best wishes. Pia, my magic lady and lab manager, “ni hao”:). I remember that when Steven had his public defense, he said he would have lost half of his seeds if without your help. I could not understand it at that moment, but now I think I understand it better than him… I want to thank you, not only for harvesting and taking care of my plants, but also for other helps, i.e. X-Gluc staining, RNA & DNA preparation, guiding students, taking care of me/us in the lab, sowing seeds, providing me with the information of festivals/parties/fun, being my Dutch-English translator et al., there are too many helps to be listed here. Speaking of sowing seeds, I will not buy Rolf a beer until he accomplishes the massage task:). Griet, best well organized lady:). It will never be wrong to turn to you for help with looking for those tiny tubes in the freezers, or looking for protocols from your collection. Thank you for MILLIONS of arasheet and organizing my THOUSANDS of seed stocks. Thank you for organizing our group activities. Thank you for sharing the lovely growing up stories of Marte, you do not know how much I like them! I wish you, Sam, Marte and of course the coming soon baby all the best! One more thing: if you have difficulty in choosing name for him/her from your list, maybe you can give some priority to the ones without the shivering “r~~~”:). Well, I will also try my best to make “r~~~” possible. Don’t forget to send me a card of him/her. Finally, all the best with house building and take care of your camera, you know:). Magdalena, cześć, dzień dobry:). I had never told you how much I like the way you carried out your experiment, step by step, especially the ones need to optimize the conditions; the way you make presentations, clear and easy to follow, especially the ones of brainstorm. Thank you for being such a good example and all the help of
Acknowledgements 193
data analysis and discussion. I am sure that the chance you have your cups/samples/ice box crashed at the door of our lab will be significantly reduced from April 2015 onwards. But before that, you still need to be cautious:). I guess this mysterious “phenotype” cannot be explained by science… In case it can, maybe we can publish the result on some special journal? I will be glad to come back for this kind of experiment:). Also my best wishes to Wiktor, growing up happy and healthy. Marina, my neighbor in the lab, privet:). Thank you for all the questions and discussion during my presentations, I am sure it will help me to prepare for the defense. Thank you for reminding me about seminars so that I did not miss so many of them. Thank you for watering my plants, maybe that is why they grow better in the lab than at home:). Spasibo. Kristiina, thank you for guiding me at the beginning of my PhD, because it was important for me to start my new life in the lab. I also appreciate that you agreed to come back to my defense without hesitating, this means a lot to me. My best wishes to the boys and Steven as well. Sabine, ca va? Our cookie provider, always brings homemade cookies to the lab. I just cannot resist to pick up a piece every time I pass them… Are you doing it on purpose to make me gain some weight? I am afraid I will let you down: I do not gain weight easily… But please keep it going, you know my favorite taste, right? Just to remind you: it’s the ones with butter:). I will never know there is a game called roller derby if it was not because of you. Take care of yourself when in the training and games, Captain Bionic Steam! Tell Thomas “OBACHT”:) Carina, thanks for THOUSANDS of plant transformation. Every time, when I see “[Plant Transformation] Your plants have been harvested” in my inbox, I know whom I should go to for my plants. Yes, it’s Carina! Next time I will try to split the requests and give them to you one by one instead of FIFTY in a package:) Leen, welcome back to the group!!:) And many thanks for showing me how to do the western blot, especially the first one that on the day after VIB 15 years party, a tough one for me:) Antonella and Olimpia, ciao, come stai? Thank you for not killing me with whatever, such as sweets, knife or FOCKS, but the threat “I will kill you” was really scary... What doesn’t kill you makes you stronger. “Dr. Antonella Muto, thank you for the X- Gluc staining and genetic analysis et al. The holiday in Italy was amazing, my best holiday ever, grazie~grazie~! Oli, I can still remember how to count in Italian, can you
194 Acknowledgements
still remember how to count in Chinese?? You’d better practice before we meet next time… Thank you for staying late in the lab with me, for teaching me how to make delicious pasta, my innovation will always drive you crazy:). I need to drink at least three coffee in the lab now… It’s all your fault:)! Oli, good luck with your job hunting as well! Rilassati! Liz, my born-on-the-same-day sister! Jambo! You are the one that who has a big heart and taught me “pay bad with good”. Thank you for bringing me positive emotion. Days are always full of sunshine with you around. May God bless you. Don’t worry about your PhD, you are doing quite well! Martin, knock knock, tach, mein Freund. Achtung!!!:) Thank you for the discussion and suggestion related to work. But more importantly, thank you for the German beer, BBQ, football matches, hang out. So nice to have you in the group. I wish you all the best with your PhD. PROSIT! Knock knock, tschuss. Stijn Stijn Stijn, never grown up…:) Luckily we can take care of you, especially Mrs. Sophie Aesaert. “Xie xie” for not “teasing” me:). Xie xie for all the help in the lab, HUNDREDS of high density plating; all kinds of antibiotics, solutions and buffers that I “borrowed” from you:) Your bachelor party & your wedding (the first bachelor party and wedding I have experienced in Belgium), your yummy yummy baby lambs, homemade cakes, our coffee break and holiday in Italy will always be my good memories. Sophie, thank you for taking care of Stijn:) Many thanks to the other new and former group members: Steven, Basel, Dai, Jackline, Janvier, Michael. Luiz, Yolaine and Sam, good luck with your master thesis, bachelorproef and scholarship application.
I would like to thank our very close collaborations: Geert De Jaeger and his TAP people, especially Michiel, Dominique, Eveline and Geert Persiau. These two tornados are as tough as their names, but finally we fished some interesting interactors and they became an important part of my thesis. All the discussions, plant materials, detergents and purifications are paid back! Thanks for all the efforts! Klaas and Jan, thanks for the regulatory elements, TFs-TETs network and all the discussions. I should come to you earlier, so that we could have more time to test the regulation, or I should concentrate on carrying out the experiments. I am as curious as you two about the results, so finger crossed! Tom and Davy, thanks for all the discussions, suggestion and carrying out the FACS.
Acknowledgements 195
I don’t want to blow all of my “ChIA” members cover, but somehow I must: Chen Xu & Zhu Qiang, Zhang Jing, Li Hongjiang, Li Zhen, Hu Zhubing, Xia Xiaojian, Huang Jingjing, Deng Lei, Fang Tao, Jiang Lingxiang, Han Chao, He Huaming, Bai Yuechen, Zhang Zaichao, Yaoyao, Li Bing. Thank you for your company in the department and all the get-together. Kun (xiao yue yue), looking back to our four years in PSB, I cannot imagine what a PhD study would look like without you or without your company. It’s so nice to know you. All the travelings, hang out, movie nights, dinner, parties, swimming, coffee break, talks and encouragement. They are definitely the most important and precious parts of these four years! I am happy for both of us that we managed to finish our PhD. Niu (He Ying), thank you for taking care of me:) It’s also nice to know you in PSB and I am happy that we are still keeping in touch! I miss the time we spent together in watching movies, having spit burger, in Irish pub, going to the supermarket, cooking, riding to the lab/home, swimming, traveling in Nederland with Kun and that special cake took me down. I will see you in Shanghai! Xiaohuan and Gao Zhen, it was nice to live together for a short while. Good luck with your PhD! Zhubing, Chen Qian, Xuan Wei and Dalong, thank you for all the help in work! Youn-Jeong, my social glu, thank you for bring me to the other friends. I will always remember our hang out, cooking, dinner, swimming, party, movie. All the best with your PhD! Matthias Van Durme, Ik wil mijn ezel terug!!! Thanks for all the help with confocal. Anas, what’s up? Also thank you for the help with confocal and all the chat. Compadre Wilson, cómo estás? Thank you for all the sequencing, parties, dinner and BBQ. Welcome to China:) Alex, Vanessa, Lisa VDB, Jorge, Dorien, Paula, Nubia, Ward, Igor, Livia, Brecht, Luiz, thank you for all the lovely hang out. Many sincere thanks to those who never miss a single warm hello/big smile in the corridor, it makes the empty corridor full of joy! To those who played badminton games with/against me, to those who helped me with some experiment, to those who made the journey together to Canada, to those who organized Kubb game together, to those who made my life outside of the department better: Toon, Stefanie, Jefri, Balkan, Thomas, Ilse, Hilde VDD, Hilde N, Nathalie G (Merelbeke neighbour:)), Jolien DB, Tom VH, Jonas, Hannes V, Alexandra B, Judith VD, Kirin D, Liesbeth DM,
196 Acknowledgements
Rafael, Hironori, Jonah, Vikram, Joanna, Andres O, Camilla, Rahul K, Kiril M, Anaxi, Wim D, Daniel VD, Lorin, Barbara DS, Jordi, Moritz, Matyas, Yadira, Robert K, Anna D, Marlies H, Tom V, Justine, Alan, Cedrick, Steffen V, Barbara M, Ana F, Boris, Ellie, Ianto, Maria, Rudy, Sabrina, Jonas, Philipp, Janine, Bartel V, Ruben V, Wannes, Sander, Lisa S, Jelle, Michiel B, Nienke, Nancy DW, Pierre R, Evangelia, Eva M, Hanka, Anouk, Kenny, Francis, An Verwulgen. Special thanks go to the administrative support, general support team and IT: Annick, Diane, Sophie, Christine, Bernard V, Nathalie VH, Christa, Delphine, An, Agnieszka, Thomas F, Nancy, Miguel, Nico, Karel, Jackie, Kristof, Dany, Tim, Frederik. Work and life in the lab are easier with your help. Thanks!
爸，妈，这么多年儿子没能陪在你们身边，独自在外，让你们担心了。谢谢你们一直 以来的理解和支持。小姨，小姨夫，舅舅，舅妈及其他家人，谢谢你们的帮助和关心。 尤其是这些年来我不在我爸妈身边时对他们的照顾。有你们当家人让我感觉很踏实。 我那些散布在国内和国外的朋友们，谢谢你们的关心和支持。时差什么的都弱爆了，
什么也不能阻止我们沟通！
Finally, I want to thank everyone that I know again, I would not finish my work without your help, my life would be as grey as the weather if it’s without you, you painted my colourful life. I will always remember these lovely and good moments.
Last but not least, Tom Verwulgen, “zao”. Are you looking for your name throughout the acknowledgements if you have chance to read this part of the thesis? Disappointed and you thought I forgot you??? Don’t you dare to think about that and how would I forget you?! I put you at the end because I want you to have ALL the rest of my thankfulness, share it with Anne-Sophie! My better friends! The two that I trust most! The two that I feel most comfortable and relaxed to stay with! Tom, You know how grateful I am to you. What other titles do you have? Oh, right: my taxi driver, my translator, my party buddy, my “r~~” teacher. I wish you and Anne- Sophie all the best and a gorgeous future! I will miss you two.
I love all of you! My friends and family.
198 Curriculum vita
CURRICULUM VITA
Personal Information: First Name: Feng Last Name: WANG Date of Birth: 11 April 1984 Place of Birth: Dalian, China Email: [email protected]; [email protected]
Education: 2010.10 – PhD in Plant Biochemistry and Biotechnology VIB Department of Plant Systems Biology, University of Ghent, Belgium 2007.9 – 2010.7 MSc in Biochemistry and Molecular Biology Sichuan Agricultural University, China 2003.9 – 2007.7 BSc in Agronomy Sichuan Agricultural University, China
Research Experience: 2010-2014: PhD research on Plant Biochemistry and Biotechnology, in VIB Department of Plant Systems Biology, University of Ghent, Belgium. Research focused on understanding the function of TETRASPANIN genes in Arabidopsis thaliana. Supervised by Prof. Mieke Van Lijsebettens. 2007-2010: Research project on molecular cloning and sequences analysis of voltage-gated K+ channel β subunit genes in wheat and barley in Triticeae Research Institute of Sichuan Agricultural University, China. Supervised by Prof. Youliang Zheng. 2006-2007: Research project on identification and molecular cloning of Ay-type HMW-GS expressional genes from Einkorn Wheat in Triticeae Research Institute of Sichuan Agricultural University, China. Supervised by Prof. Youliang Zheng.
Curriculum vita 199
Conferences, Trainings & Courses: July 2014 25th International Conference on Arabidopsis Research, Vancouver, Canada (poster presentation) June 2014 6th European Conference on Tetraspanins, Lille, France (oral presentation) April 2014 VIB Seminar, Blankenberge, Belgium August 2013 16th European Plant Endomembrane Meeting, Gent, Beglium (poster presentation) February 2013 VIB Seminar, Blankenberge, Belgium (poster presentation) July 2012 23rd International Conference on Arabidopsis Research, Vienna, Austria (poster presentation) February 2012 VIB Seminar, Blankenberge, Belgium (poster presentation) April 2011 Genevestigator training: exploring transcriptomes, Gent, Belgium
Publications: Wang F, Vandepoele K, Van Lijsebettens M. 2012. Tetraspanin genes in plants. Plant Science 190: 9-15. Jiang QT, Wei YM, Wang F, Wang JR, Yan ZH, Zheng YL. 2009. Characterization and comparative analysis of HMW glutenin 1Ay alleles with differential expressions. BMC Plant Biology 9.
In preparation: Wang F, Muto A, Van de Velde J, Neyt P, Opdenacker D, Himanen K, Vandepoele K, Beeckman T, Van Lijsebettens M. (2015). Embryonic and vegetative TETRASPANIN gene expression patterns identify functions in specific tissues, domains and cell types
Thesis: Wang F. (2010) Molecular cloning and sequences analysis of voltage-gated K+ channel β subunit genes in wheat and barley. Master thesis in Triticeae Research Institute of Sichuan Agricultural University, China. Wang F. (2007) Identification and molecular cloning of Ay-type HMW-GS expressional genes from Einkorn Wheat. Bachelor thesis in Triticeae Research Institute of Sichuan Agricultural University, China.