US 20060253913A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2006/0253913 A1 Huang et al. (43) Pub. Date: Nov. 9, 2006
(54) PRODUCTION OF HSA-LINKED (60) Provisional application No. 60/344.295, filed on Dec. BUTYRYLCHOLINESTERASES IN 21, 2001. TRANSGENIC MAMMALS Publication Classification (76) (51) Int. Cl. Inventors: Yue-Jin Huang, Montreal (CA); Costas AOIK 67/027 (2006.01) N. Karatzas, Beaconsfield (CA); C7H 2L/04 (2006.01) Anthoula Lazaris, Beaconsfield (CA) CI2P 2/06 (2006.01) CI2N 9/18 (2006.01) Correspondence Address: CI2N 5/06 (2006.01) Alan J. Grant, Esq. (52) U.S. Cl...... 800/14: 800/18: 435/69.1; c/o Carella, Byrne, Bain, Gilfillan, Cecchi, 435/197; 435/354; 435/455; Stewart & Olstein 536/23.2 5 Becker Farm Road Roseland, NJ 07068 (US) (57) ABSTRACT Appl. No.: 11/401,390 The present invention provides methods for the large-scale (21) production of recombinant butyrylcholinesterase fused to (22) Filed: Apr. 10, 2006 human serum albumin in cell culture, and in the milk and/or urine of transgenic mammals. The recombinant butyrylcho Related U.S. Application Data linesterase-albumin fusion protein of this invention can be used to treat and/or prevent organophosphate pesticide poi (63) Continuation-in-part of application No. 10/326,892, Soning, nerve gas poisoning, cocaine intoxication, and Suc filed on Dec. 20, 2002. cinylcholine-induced apnea. Patent Application Publication Nov. 9, 2006 Sheet 1 of 21 US 2006/0253913 A1
ATGCATAGCAAAGTCACAATCATATGCATCAGATTTCTCTTTTGGTTTCTTTTGCTCTGC M H S K W T I I C I R F L. F W F L L L C
5 ATGCTTATTGGGAAGTCACATACTGAAGATGACATCATAATTGCAACAAAGAATGGAAAA 21 M L G. K. S. H. T E D D A T K N G K
121 GTCAGAGGGATGAACTTGACAGTTTTTGGTGGCACGGTAACAGCCTTTCTTGGAATTCCC 4. W R G M N L T W F. G G T W T A F L G P
181 TATGCACAGCCACCTCTTGGTAGACTTCGATTCAAAAAGCCACAGTCTCTGACCAAGTGG 6. Y A Q. P P L G R L R F K K P Q S L T K W
241 TCTGATATTTCGAATGCCACAAAATATGCAAATTCTTGCTGTCAGAACATAGATCAAAGT 8. S D I W N A T K Y. A N S C C C N I D O S
3O TTTCCAGGCTTCCATGGATCAGAGATGTGGAACCCAAACACTGACCTCAGTGAAGACTGT O F P G F H G S E M W N P N T D L S E D C
36 TTATATCTAAATGTATGGATTCCAGCACCTAAACCAAAAAATGCCACTGTATTGATATGG 12 L. Y. L. N. W. W. I P A P K P K N A T W L I W
421 ATTTAGGTGGTGGTTTTCAAACTGGAACATCATCTTTACATGTTTATGATGGCAAGTTT 141 I Y G G G F C T G T S S L H V Y D G K . F
48 CTGGCTCGGGTTGAAAGAGTTATTGTAGTGTCAATGAACTATAGGGTGGGTGCCCTAGGA 16 L. A R V E R v I V V S M N Y R v G A L G 541 TTCTTAGCTTGCCAGGAAATCCTGAGGCTCCAGGGAACATGGGTTTATTTGACAACAG 8. F L. A. L. P G N P E A P G. N. M. G. L. F D O O.
6 Ol TTGGCTCTTCAGTGGGTTCAAAAAAATATAGCAGCCTTTGGTGGAAATCCTAAAAGTGTA 2O L. A. L. O. W. W. O. K. N. A A F G G N P K S W
661 ACTCTCTTTGGAGAAAGTGCAGGAGCAGCTTCAGTTAGCCTGCATTTGCTTTCTCCTGGA 221 T L. F. G E S A G A A S W S H L E S P G
72 AGCCATTCATTGTTCACCAGAGCCATTCTGCAAAGTGGTTCCTTTAATGCTCCTTGGGCG 24. S H S L. F T R A I L Q S G S F N A P W A
78. GTAACATCTCTTTATGAAGCTAGGAACAGAACGTTGAACTTAGCTAAATTGACTGGTTGC 26 W T S Y E A R N R T L N A K L T G C
84 TCTAGAGAGAATGAGACTGAAATAACAAGTGTCTAGAAATAAAGATCCCCAAGAAATT 28 S R E N E T E I I K C L R N K D P O E I
FIGURE 1A Patent Application Publication Nov. 9, 2006 Sheet 2 of 21 US 2006/0253913 A1
90 CTTCTGAATGAAGCATTTGTTGTCCCCTATGGGACTCCTTTGTCAGTAAACTTTGGTCCG 30 L. L N E A F W V P Y G T P L S. V N F G P
96. ACCGTGGATGGTGATTTTCTCACTGACATGCCAGACATATTACTTGAACTTGGACAATTT 321 T W D G D F L T D M P D . L. L. E L G O F
1021 AAAAAAACCCAGATTTTGGTGGGTGTTAATAAAGATGAAGGGACAGCTTTTTTAGTCTAT 34 K K T Q I L W G V N K D E G T A F L V Y
O8. GGTGCTCCTGGCTTCAGCAAAGATAACAATAGTATCATAACTAGAAAAGAATTTCAGGAA 361 G A P G F S K D N N S I I T R K E F Q E
ll 4l GGTTTAAAAATATTTTTTCCAGGAGTGAGTGAGTTTGGAAAGGAATCCATCCTTTTTCAT 381 G. L. K. I. F. F. P G W S E F. G K E S F. H.
20 TACACAGACTGGGTAGATGATCAGAGACCTGAAAACTACCGTGAGGCCTTGGGTGATGTT 4 Ol Y T D W W D D C R P E N Y R E A L G D V
126l GTTGGGGATTATAATTTCATATGCCCTGCCTTGGAGTTCACCAAGAAGTTCTCAGAATGG 421 V G D Y N F C P A L E F T K K F. S. E. W.
1321 GGAAATAATGCCTTTTTCTACTATTTTGAACACCGATCCTCCAAACTTCCGTGGCCAGAA 441 G N N A F F Y Y F E H R S S K L P W P E
138 TGGATGGGAGTGATGCATGGCTATGAAATTGAATTTGTCTTTGGTTTACCTCEGGAAAGA 4 61 W M G W M H G Y E E. F. W. F. G P L E R
1441 AGAGATAATTACACAAAAGCCGAGGAAATTTTGAGTAGATCCATAGTGAAACGGTGGGCA 481 R D N Y T K A E E I L S R S I v K R W A SO1 AATTTTGCAAAATATGGGAATCCAAATGAGACTCAGAACAATAGCACAAGCTGGCCTGTC 50 N F A K Y G N P N E T O N N S T S W P V
1561. TTCAAAAGCACTGAACAAAAATATCTAACCTTGAATACAGAGTCAACAAGAATAATGACG 52. F K S T E O K. Y. L T L N T E S T R I. M T.
62 AAACTACGTGCTCAACAATGTCGATTCTGGACATCATTTTTTCCAAAAGTCTTGGAAATG 541 K L R A Q O C R F W T S F F P K V L E M
l68l ACAGGAAATATTGATGAAGCAGAATGGGAGTGGAAAGCAGGATTCCATCGCTGGAACAAT 56. T. G. N. D E A E W E W K. A. G. F. H. R. W. N. N.
1741 TACATGATGGACTGGAAAAATCAATTTAACGATTACACTAGCAAGAAAGAAAGTTGTGTG 581 Y M. M. D. W. K. N. Q F N D Y T S K K E S C W
80. GGTCTCTAA 601 G k
FIGURE 1B
Patent Application Publication Nov. 9, 2006 Sheet 4 of 21 US 2006/0253913 A1
1 2 3 4 5 6
Dimer BChE-hSA a Tetramer BChE
- Monomer BChE-hSA
FIGURE 3 Patent Application Publication Nov. 9, 2006 Sheet 5 of 21 US 2006/0253913 A1
naturt protein 214 ATG (lo) TAA (1938)
XXXXXXXXXXXX
Noti (16908) &
XhoI + 3-cascin SS Xh PCR 5' 8-casein HHR 1. Xhol digestion XhoI digestion 2. Cloning into pGEM-T
1. Ligation V 2. Transformation XhoI digestion
Not
insulator p3CNN/BChE
17399. a.
XhoI p (4647) (12404) 6-casein SS 1 BChE XhoI (10675) 5' 3-casein
FIGURE 4 Patent Application Publication Nov. 9, 2006 Sheet 6 of 21 US 2006/0253913 A1 BChE encoding sequence
5' UTR (47nt) ATG STOP Goat 3-casein genomic locus 1000bp
FIGURES Patent Application Publication Nov. 9, 2006 Sheet 7 of 21 US 2006/0253913 A1
Dimer rBChE < Endogenous BChE dimer
Monomer rBChE
FIGURE 6 Patent Application Publication Nov. 9, 2006 Sheet 8 of 21 US 2006/0253913 A1
1- Tetramer BChE
-- Dimer BChE
-- Monomer BChE
FIGURE 7 Patent Application Publication Nov. 9, 2006 Sheet 9 of 21 US 2006/0253913 A1
1.2
Monomer BChE
FIGURE 8 Patent Application Publication Nov. 9, 2006 Sheet 10 of 21 US 2006/0253913 A1 Noti (14920)
Not (2228)
WAP Coding insulator
pWAP/BChE 15583bp BamHt (466)
Pnie (10706)
Signal Sequence
FIGURE 9 Patent Application Publication Nov. 9, 2006 Sheet 11 of 21 US 2006/0253913 A1
vese T
8H - V
r O ,
& & r O A
: Patent Application Publication Nov. 9, 2006 Sheet 12 of 21 US 2006/0253913 A1
Not I
Fsel Sgfl insulator
pUM/SS13 HBChE PCR product (4647) -Digest with Fsel & Sgfl -Ligate
UM promoter
Not I
Insulator
FIGURE 11 Patent Application Publication Nov. 9, 2006 Sheet 13 of 21 US 2006/0253913 A1
Not
UM 3'
Insulator Asc Fsel pUM/BChEmod Asc Sgf Mouse UPll PCR product UPI Promoter BCE
UM promoter Digested with Asci-Fsel & ligation
Sgfl Notl Insulator III pUPII/BChE1nt Mouse UPI PCR product 4kb ASCI 3' genomic sequence Digested with Sgfl-Notl & ligation UPI promoter
Not I
UP 3
Insulator
Ascl Sgfi W8 BChE
Fse UPII promoter UPII SS FIGURE 12
Patent Application Publication Nov. 9, 2006 Sheet 16 of 21 US 2006/0253913 A1 Figure 13C
21 Oil CAACACAAAGATGACAACCCAAACCTCCCCCGATTGGTGAGACCAGAGGTTGATGTGATG 701 Q H K D D N P N L. P R L V R P E V D V M 2161 TGCACTGCTTTTCATGACAATGAAGAGACATTTTTGAAAAAATACTTATATGAAATTGCC 72 C T A F H D N E E T F. L. K. K. Y L. Y. E . A
2221 AGAAGACATCCTTACTTTTATGCCCCGGAACTCCTTTTCTTTGCTAAAAGGTATAAAGCT 741 R. R. H P Y F. Y. A P E L L. F. F. A K R Y K. A 2281 GCTTTTACAGAATGTTGCCAAGCTGCTGATAAAGCTGCCTGCCTGTTGCCAAAGCTCGAT 761. A F T E C C Q A A D K. A. A. C. L. L. P K L D 234 GAACTTCGGGATGAAGGGAAGGCTTCGTCTGCCAAACAGAGACTCAAGTGTGCCAGTCTC 781 E L R D E G K A S S A K Q R L. K. C. A. S. L. 24 O1 CAAAAATTTGGAGAAAGAGCTTTCAAAGCATGGGCAGTAGCTCGCCTGAGCCAGAGATTT 801 Q K F. G E R A F K. A. W. A. V. A R L S Q R F
2461 CCCAAAGCTGAGTTTGCAGAAGTTTCCAAGTTAGTGACAGATCTTACCAAAGTCCACACG 821 P. K. A. E. F. A E V S K L W T D L T K W H T
252 GAATGCTGCCATGGAGATCTGCTTGAATGTGCTGATGACAGGGCGGACCTTGCCAAGTAT 841 E. C. C. H. G D L L E C A D D R A D L. A. K. Y 2581 ATCTGTGAAAATCAAGATTCGATCTCCAGTAAACTGAAGGAATGCTGTGAAAAACCTCTG 861 I C E N Q D S I S S K L K E C C E K P L.
2641 TTGGAAAAATCCCACTGCATTGCCGAAGTGGAAAATGATGAGATGCCTGCTGACTTGCCT 881 E. K. S. H. C. I. A E V E N D E M P A D L. P
27 OL TCATTAGCTGCTGATTTTGTTGAAAGTAAGGATGTTTGCAAAAACTATGCTGAGGCAAAG 901 S L. A. A D F W E S K D V C. K. N. Y. A E A K.
276 GATGTCTTCCTGGGCATGTTTTTGTATGAATATGCAAGAAGGCATCCTGATTACTCTGTC 921 D V F L G M F. L. Y. E. Y. A R R H P D Y S V
2821 GTGCTGCTGCTGAGACTTGCCAAGACAATGAAACCACTCTAGAGAAGTGCTGTGCCGCT 941 W L L L R I, A K T Y. E. T. T. L. E. K. C. C. A. A
288 GCAGATCCTCATGAATGCTATGCCAAAGTGTTCGATGAATTTAAACCTCTTGTGGAAGAG 96. A D P H. E. C. Y. A K V F D E. F. K P L V E E 2941 CCTCAGAATTTAATCAAACAAAATTGTGAGCTTTTTGAGCAGCTTGGAGAGTACAAATTC 981 P O N L, I K Q N C E L F O L G E Y K F
3 OO1 CAGAATGCGCTATTAGTTCGTTACACCAAGAAAGTACCCCAAGTGTCAACTCCAACTCTT 1001 Q N A L L V R Y T K K V P Q V S T P T L. 3 O 6. GTAGAGGTCTCAAGAAACCTAGGAAAAGTGGGCAGCAAATGTTGTAAACATCCTGAAGCA 102 W E V S R N L G K W G S K C C K H P E A Patent Application Publication Nov. 9, 2006 Sheet 17 of 21 US 2006/0253913 A1 Figure 13D
3121 AAAAGAATGCCCTGTGCAGAAG ACTATCTATCCGTGGTCCTGAACCAGTTATGTGTGTTG 1041 K R M P C A E D Y L. S. V V L. N. O. L. C. V. L. 38 CATGAGAAAACGCCAGTAAGTGACAGAGTCACCAAATGCTGCACAGAATCCTTGGTGAAC O6 H. E. K. T P W S D R W T K C C T E S L W N
3241 AGGCGACCATGCTTTTCAGCTCTGGAAGTCGATGAAACAACGTCCCAAAGAGTTTAAT 1081 R R P C F S A L E W D E T Y V P K E F N 33 OL GCTGAAACATTCACCTTCCATGCAGATATATGCACACTTTCTGAGAAGGAGAGACAAATC 1.01 A. E. T. F. T. F. H. A D I C T L S E K E R O I 3361 AAGAAACAAACTGCACTTGTTGAGCTCGTGAAACACAAGCCCAAGGCAACAAAAGAGCAA 11.2 K K Q T A L V E L V K H K P K A T K E O
342. CTGAAAGCTGTTATGGATGATTTCGCAGCTTTTGTAGAGAAGTGCTGCAAGGCTGACGAT 1141. L. K. A. V. M D D F A A F W E K. C. C. K. A D D
348 AAGGAGACCTGCTTTGCCGAGGAGGGTAAAAAACTTGTTGCTGCAAGTCAAGCTGCCTTA 1161. K E T C F A E E G K K L V A A S Q A A L
3541 GGCTTATAA 1181 G Patent Application Publication Nov. 9, 2006 Sheet 18 of 21 US 2006/0253913 A1 Figure 14
1 2 3 4 5 6 789 10
Patent Application Publication Nov. 9, 2006 Sheet 19 of 21 US 2006/0253913 A1 Figure 15
1 2 3 4 5 6 7 8 9 10
Patent Application Publication Nov. 9, 2006 Sheet 20 of 21 US 2006/0253913 A1 Figure 16
Patent Application Publication Nov. 9, 2006 Sheet 21 of 21 US 2006/0253913 A1 Figure 17
A --Pig 827 -Pig 825
O O GO D O O C SS
O 1 2 3. 4. 5 6 7 8 24 48 72 96 120 44 Time (H)
B
1350 --Pig 821 --Pig 823 1100 O O 850 D O O C 600 SS 350
100 Es-ES 0 1 2 3 4 5 6 7 8 24 48 72 96 120144. Time (H) US 2006/0253913 A1 Nov. 9, 2006
PRODUCTION OF HSA-LINKED sifications of ChE’s are based on charge, hydrophobicity, BUTYRYLCHOLINESTERASES IN TRANSGENIC interaction with membrane or extracellular structures, and MAMMALS Subunit composition. 0001. This application is a continuation-in-part of U.S. 0006 Acetylcholinesterase (AChE), also known as true, application Ser. No. 10/326,892, filed 20 Dec. 2002, which specific, genuine, erythrocyte, red cell, or Type I ChE, is a claimed priority of U.S. Provisional Aopplication 60/344, membrane-bound glycoprotein and exists in several molecu 295, filed 21 Dec. 2001, the disclosure of which is hereby lar forms. It is found in erythrocytes, nerve endings, lungs, incorporated by reference in its entirety. spleen, and the gray matter of the brain. Butyrylcholinest erase (BChE), also known as plasma, serum, benzoyl, false, FIELD OF THE INVENTION or Type II ChE, has more than eleven isoenzyme variants and preferentially uses butyrylcholine and benzoylcholine as 0002 The present invention provides methods for the in vitro substrates. BChE is found in mammalian blood large-scale production of recombinant butyrylcholinesterase plasma, liver, pancreas, intestinal mucosa, the white matter fused to human serum albumin in cell culture, and in the of the central nervous system, Smooth muscle, and heart. milk and/or urine of transgenic mammals. The recombinant BChE is sometimes referred to as serum cholinesterase as butyrylcholinesterases of this invention can be used to treat opposed to red cell cholinesterase (AChE). and/or prevent organophosphate pesticide poisoning, nerve gas poisoning, cocaine intoxication, and Succinylcholine 0007 AChE and BChE exist in parallel arrays of multiple induced apnea. molecular forms composed of different numbers of catalytic and non-catalytic Subunits. Both enzymes are composed of subunits of about 600 amino acids each, and both are BACKGROUND OF THE INVENTION glycosylated. AChE may be distinguished from the closely 0003. The general term cholinesterase (ChE) refers to a related BChE by its high specificity for the acetylcholine family of enzymes involved in nerve impulse transmission substrate and sensitivity to selective inhibitors. While AChE and whose major function is to catalyze the hydrolysis of the is primarily used in the body to hydrolyze acetylcholine, the chemical compound acetylcholine at the cholinergic Syn specific function of BChE is not as clear. BChE has no apses found throughout the nervous systems of humans, known specific natural Substrate, although it also hydrolyzes other vertebrates and insects. Stimulating signals are carried acetylcholine. by the neurotransmitter acetylcholine, and discontinued by 0008 Poisoning with organophosphate agents is a severe the action of ChE enzymes, which cause hydrolytic break problem facing military personnel who may encounter lethal down of acetylcholine. The action of ChE allows the muscle, doses of these compounds in chemical warfare situations. gland, or nerve to return to its resting state, ready to receive The use of organophosphate compounds in war and as another nerve impulse if need be. pesticides has resulted over the past 40 years in a rising 0004 Cholinesterase-inhibiting substances such as orga number of cases of acute and delayed intoxication, resulting nophosphate compounds or carbamate insecticides or drugs in damage to the peripheral and central nervous systems, prevent the breakdown of acetylcholine, resulting in a myopathy, psychosis, general paralysis, and death. buildup of acetylcholine, thereby causing hyperactivity of the nervous system. Acetylcholine continues to stimulate the 0009 Nerve agents are the most toxic chemical warfare muscarinic receptor sites (exocrine glands and Smooth agents. These compounds are related to organophosphorus muscles) and the nicotinic receptor sites (skeletal muscles). insecticides, in that they are both esters of phosphoric acid. Exposure to cholinesterase-inhibiting Substances can cause The major nerve agents are GA (tabun), GB (sarin), GD symptoms ranging from mild (twitching, trembling) to (soman), GF, and VX. VX is a persistent substance which severe (paralyzed breathing, convulsions), and in extreme can remain on material, equipment, and terrain for long cases, death, depending on the type and amount of cho periods. Under temperate conditions, nerve agents are clear linesterase-inhibiting Substances involved. This makes them colorless liquids. very effective as pesticides for controlling insects and other 0010 Nerve agents exert their biological activity by pests. When humans breathe or are otherwise exposed to inhibiting the cholinesterase enzymes. In cases of moderate these compounds, they are Subjected to the same negative to severe organophospate poisoning, the levels of both effects, which has led to the development of these com AChE and BChE activity are reduced. Mild poisoning pounds as “nerve gases” or chemical warfare agents. occurs when cholinesterase activity is 20-50% of normal; moderate poisoning occurs when activity is 10-20% of 0005 Cholinesterases are classified into two broad normal; severe poisoning is characterized by activity of less groups, depending on their substrate preference and sensi than 10% of normal. Severe neuromuscular effects are tivity to selective inhibitors. Those enzymes which prefer entially hydrolyze acetyl esters such as acetylcholine, and observed when ChE activity levels drop below 20% of whose enzymatic activity is sensitive to the chemical inhibi normal, while levels near Zero are generally fatal. tor BW 284C51, are called acetylcholinesterases (AChE), or 0011 Present treatment of organophosphate poisoning acetylcholine acetylhydrolase, (EC 3.1.1.7). Those enzymes consists of post-exposure intravenous or intramuscular which preferentially hydrolyze other types of esters such as administration of various combinations of drugs, including butyrylcholine, and whose enzymatic acticity is sensitive to carbamates (e.g., pyridostigmine), anti-muscarinics (e.g., the chemical inhibitor tetraisopropylpyrophosphoramide atropine), and ChE-reactivators such as pralidoxime chlo (also known as iso-OMPA), are called butyrylcholinest ride (2-PAM, Protopam). A diazopan compound may also be erases (BChE, EC 3.1.1.8). BChE is also known as pseudo administered. Although this drug regimen is effective in cholinesterase or non-specific cholinesterase. Further clas preventing death from organophosphate poisoning, it is not US 2006/0253913 A1 Nov. 9, 2006 effective in preventing convulsions, performance deficits, or major detoxifying enzyme of cocaine Xie, et al. Molec. permanent brain damage. In addition, a post-exposure drug Pharmacol. (1999) 55:83-91). Cocaine is metabolized by regimen is often useless because even a small dose of an three major routes: hydrolysis by BChE to form ecgonine organophosphate chemical warfare agent can cause instant methyl ester, N-demethylation from norcocaine, and nonen death. These drawbacks have led to the investigation of Zymatic hydrolysis to form benzoylcholine. Studies have cholinesterase enzymes for the treatment of organophos shown a direct correlation between low BChE levels and phate exposure. Post-exposure symptoms can be prevented episodes of life-threatening cocaine toxicity. A recent study by pretreatment with cholinesterases, which act to sequester has confirmed that a decrease of cocaine half-life in vitro the toxic organophosphates before they reach their physi correlated with the addition of purified human BChE. ological targets. 0016. In view of the significant pharmaceutical potential 0012. The use of cholinesterases as pre-treatment drugs of ChE enzymes, research has focused on development of has been Successfully demonstrated in animals, including recombinant methods to produce them. Recombinant non-human primates. For example, pretreatment of rhesus enzymes, as opposed to those derived from plasma, have a monkeys with fetal bovine serum-derived AChE or horse much lower risk of transmission of infectious agents, includ serum-derived BChE protected them against a challenge of ing viruses such as hepatitis C and HIV. two to five times the LD50 of pinacolyl methylphosphonof luoridate (Soman), a highly toxic organophophate compound 0017. The cDNA sequences have been cloned for both used as a war-gas Broomfield, et al. J. Pharmacol. Exp. human AChE (see U.S. Pat. No. 5,595,903) and human Ther. (1991) 259:633-638; Wolfe, et al. Toxicol Appl Phar BChE see U.S. Pat. No. 5.215,909 to Soreq; Prody, et al. macol (1992) 117(2): 189-193). In addition to preventing Proc. Natl. Acad. Sci. USA (1987) 84:3555-3559; McTier lethality, the pretreatment prevented behavioral incapacita nan, et al. Proc. Natl. Acad. Sci USA (1987) 84:6682-6686). tion after the Soman challenge, as measured by the serial The amino acid sequence of wildtype human BChE, as well probe recognition task or the equilibrium platform perfor as of several BChE variants with single amino acid changes, mance task. Administration of Sufficient exogenous human is set forth in U.S. Pat. No. 6,001,625 to Broomfield, et al. BChE can protect mice, rats, and monkeys from multiple Recombinant expression of BChE has been reported in E. lethal-dose organophosphate intoxication see for example coli Masson, P., “Expression and Refolding of Functional Raveh, et al. Biochemical Pharmacology (1993) 45:2465 Human BChE from E. coli. Multiple Approaches to Cho 2474; Raveh, 10 et al. Toxicol. Appl. Pharmacol. (1997) linesterase Functions (Eds. Shaferaman, A and Velan, B.), 145:43-53: Allon, et al. Toxicol. Sci. (1998) 43:121-128). Plenum, New York, 1990, pp. 49-52); microinjected Xeno Purified human BChE has been used to treat organophos pus laevis oocytes U.S. Pat. No. 5.215,909 to Soreq; Soreq, phate poisoning in humans, with no significant adverse H. et al., J. Biol. Chem. 264:10608-10613 (1989); Soreq H immunological or psychological effects (Cascio, et al. Min et al. EMBO Journal 3(6):1371-1375 (1984); insect cell lines in vitro and larvae in vivo Platteborze and Broomfield erva Anestesiol (1998). 54:337). Biotechnol Appl Biochem 31:225-229 (2000); the silk 0013 Titration of organophosphates both in vitro and in worm Borbyx mori Wei W. L., et al. Biochem Pharmacol Vivo demonstrates a 1:1 stoichiometry between organophos 60(1):121-126 (2000); and in mammalian COS cells Plat phate-inhibited enzymes and the cumulative dose of the teborze and Broomfield Biotechnol Appl Biochem 31:225 toxic nerve agent. The inhibition of ChE by an organophos 229 (2000) and CHO cells Masson, P. et al. J. Biol Chem phate agent is due to the formation of a stable stoichiometric 268(19): 14329-41 (1993); Lockridge, O. et al., Biochemistry (1:1) covalent conjugate of the organophosphate with the 36(4):786-795 (1997): Blong, R. et al. Biochem.J. 327:747 ChE active site serine. Covalent conjugation is followed by 757 (1997); and Altamirano, C. V. et al. J. Neurochemistry a parallel competing reaction, termed “aging, wherein the 74:869-877 (2000). However, many of these reported inhibited ChE is transformed into a form that cannot be recombinantly produced BChE preparations have thus far regenerated by the commonly used reactivators. These reac showed little or no in vivo enzyme activity. tivators, such as active-site directed nucleophiles (e.g., qua 0018 Notably, none of the recombinant expression sys ternary Oximes), normally detach the phosphoryl moiety tems reported to date have the ability to produce BChE in from the hydroxyl group of the active site serine. The aging quantities sufficient to allow development of the enzyme as process is believed to involve dealkylation of the covalently a drug to treat such conditions as organophosphate poison bound organophosphate group, and renders therapy of ing, post-Surgical apnea, or cocaine intoxication. However, intoxication by certain organophosphates Such as Sarin, an additional problem is longevity. Thus, the longer the soman, and DFP exceedingly difficult. BChE remains in the system of a person treated, the longer 0014 Despite the promise of cholinesterases as drugs to it is available for detoxification. Such lifespan is referred to protect against organophosphate poisoning, their widespread as the “mean residence time' in the system and the present use is not currently possible due to the limited supply of invention solves the problem of short lifespan by Supplying these enzymes. Because of the 1:1 stoichiometry required to a fusion protein comprising BChE and an additional protein provide protection, large quantities of cholinesterase and that promotes lifespan in the system as well as promot enzymes are needed for effective treatment. The only prac ing full activity of the BChE portion of the fusion protein. tical source of these enzymes at present is by extraction from human plasma (see, e.g., U.S. Pat. No. 5.272,080 to Lynch). BRIEF SUMMARY OF THE INVENTION It is estimated that the number of doses needed for military 0019. The present inventors have discovered methods for purposes alone far exceeds the available Supplies. producing large quantities of recombinant butyrylcholinest 0015. In addition to its efficacy in hydrolyzing organo erase (BChE) fused to human serum albumin (hSA) in the phosphate toxins, there is strong evidence that BChE is the milk of lactating transgenic mammals, and in the urine of US 2006/0253913 A1 Nov. 9, 2006
transgenic mammals. The methods of the invention for the sequence encoding a BChE-hSA fusion protein with a first time allow sufficient quantities of the BChE-hSA fusion mammary gland-specific promoter that directs expression of protein to be produced so as to permit practical development the BChE-hSA fusion protein and at least one signal of this protein for prevention and/or treatment for organo sequence that provides secretion of the expressed BChE phosphorus poisoning, cocaine intoxication, and Succinyl hSA fusion protein. choline-induced apnea. 0024. In another aspect the present invention is directed 0020. The present invention is directed to non-human to a genetically-engineered DNA sequence, which com transgenic mammals that upon lactation, express a BChE prises: (i) a sequence encoding a BChE-hSA fusion protein; hSA fusion protein in their milk, where the genomes of the (ii) a urinary endothelium-specific promoter that directs mammals comprise a DNA sequence encoding a BChE expression of the BChE-hSA fusion protein; and (iii) at least enzyme and a hSA protein, linked through a DNA linker that one signal sequence that provides secretion of the expressed encodes at least 7 amino acid residues, preferably composed BChE-hSA fusion protein. In preferred embodiments, the of 6 glycines and one serine in a sequential order, operably urinary endothelium-specific promoter is a uroplakin pro linked to a mammary gland-specific promoter, and a signal moter or a uromodulin promoter. The invention also con sequence that provides secretion of the BChE-hSA fusion templates a non-human mammalian embryo or mammalian protein into the milk of the mammal. The linker sequence is cell that comprises such a DNA sequence, especially where available to promote independent folding and activity of said the cell is a BHK (baby hamster kidney) cell, embryonic BChE as well as the hSA. In preferred embodiments, the stem cell, embryonal carcinoma cell, primordial germ cell, mammary gland-specific promoter is a casein promoter or a oocyte, or sperm. The present invention is also directed to a whey acidic protein (WAP) promoter. In preferred embodi method for making Such a genetically-engineered DNA ments, the transgenic mammals are goats or rodents. sequence, which method comprises joining a sequence encoding a BChE-hSA fusion protein with a urinary endot 0021. The present invention is also directed to non helium-specific promoter that directs expression of the human transgenic mammals that express a BChE-hSA BChE-hSA fusion protein and at least one signal sequence fusion protein in their urine, where the genomes of the that provides secretion of the expressed BChE-hSA fusion mammals comprise a DNA sequence encoding a BChE protein. enzyme and a hSA protein, linked through a DNA linker that encodes at least 7 amino acid residues, preferably composed 0025 The invention is also directed to a method for of 6 glycines and one serine in a sequential order, operably producing a transgenic mammal that upon lactation secretes linked to a urinary endothelium-specific promoter, and a a BChE-hSA fusion protein in its milk, which method signal sequence that provides secretion of the BChE-hSA comprises allowing an embryo, into which at least one fusion protein into the urine of the mammal. In preferred genetically-engineered DNA sequence, comprising (i) a embodiments, the urinary endothelium-specific promoter is sequence encoding a BChE-hSA fusion protein, linked a uroplakin promoter or a uromodulin promoter. In preferred through a DNA linker that encodes at least 7 amino acid embodiments, the transgenic mammals are goats or rodents. residues, preferably composed of 6 glycines and one serine in a sequential order; (ii) a mammary gland-specific pro 0022. In further embodiments, the invention is directed to moter, and (iii) at least one signal sequence that provides Such transgenic mammals, where the genomes of the mam secretion of the BChE-hSA fusion protein into the milk of mals further comprise a DNA sequence encoding a glyco the mammal, has been introduced, to grow when transferred Syltransferase, operably linked to a mammary gland-specific into a recipient female mammal, resulting in the recipient or a urinary endothelium-specific promoter, and a signal female mammal giving birth to the transgenic mammal. In sequence that provides secretion of the glycosyltransferase. one embodiment, this method further comprises introducing The BChE-hSA fusion protein and the glycosyltransferase the genetically-engineered DNA sequence into a cell of the may be encoded together in a single, bi-cistronic expression embryo, or into a cell that will form at least part of the construct. Alternatively, the BChE-hSA fusion protein and embryo. In specific embodiments, introducing the geneti the glycosyltransferase are encoded in separate expression cally-engineered DNA sequence comprises pronuclear or constructs, which are both introduced into the genome of the cytoplasmic microinjection of the DNA sequence; combin mammal. ing a mammalian cell stably transfected with the DNA 0023. In another aspect the present invention is directed sequence with a non-transgenic mammalian embryo; or to a genetically-engineered DNA sequence, which com introducing the DNA sequence into a non-human mamma prises: (i) a sequence encoding a BChE-hSA fusion protein; lian oocyte; and activating the oocyte to develop into an (ii) a mammary gland-specific promoter that directs expres embryo. sion of the BChE-hSA fusion protein; and (iii) at least one 0026. The invention is further directed to a method for signal sequence that provides secretion of the expressed producing a transgenic mammal that upon lactation secretes BChE-hSA fusion protein. In preferred embodiments, the a BChE-hSA fusion protein in its milk, which method mammary gland-specific promoter is a WAP (whey acidic comprises cloning or breeding of a transgenic mammal, the protein) promoter or a casein promoter. The invention also genome of which comprises a DNA sequence encoding a contemplates a non-human mammalian embryo or mamma BChE enzyme and a hSA protein, linked through a DNA lian cell that comprises such a DNA sequence, especially linker that encodes at least 7 amino acid residues, preferably where the cell is a MAC-T (mammary epithelial) cell, composed of 6 glycines and one serine in a sequential order, embryonic stem cell, embryonal carcinoma cell, primordial operably linked to a mammary gland-specific promoter, germ cell, oocyte, or sperm. The present invention is also wherein the sequence further comprises a signal sequence directed to a method for making Such a genetically-engi that provides secretion of the BChE-hSA fusion protein into neered DNA sequence, which method comprises joining a the milk of the mammal. US 2006/0253913 A1 Nov. 9, 2006
0027. The invention is also directed to a method for hSA fusion protein, and to urine comprising a BChE-hSA producing a transgenic mammal that secretes a BChE-hSA fusion protein produced by a transgenic mammal according fusion protein in its urine, which method comprises allowing to the methods of the invention. an embryo, into which at least one genetically-engineered DNA sequence, comprising (i) a sequence encoding a 0033. The invention is also direct to a method for pro BChE-hSA fusion protein; (ii) a urinary endothelium-spe ducing a BChE-hSA fusion protein in a culture of MAC-T cific promoter, and (iii) at least one signal sequence that or BHK cells, which method comprises: (a) culturing said provides secretion of the BChE-hSA fusion protein into the cells, into which a DNA sequence comprising (i) a DNA urine of the mammal, has been introduced, to grow when sequence encoding a BChE-hSA fusion protein, linked transferred into a recipient female mammal, resulting in the through a DNA linker that encodes at least 7 amino acid recipient female mammal giving birth to the transgenic residues, preferably composed of 6 glycines and one serine mammal. In one embodiment, this method further comprises in a sequential order, (ii) a promoter that provides expression introducing the genetically-engineered DNA sequence into a of the encoded BChE-hSA fusion protein within said cells, cell of the embryo, or into a cell that will form at least part and (iii) a signal sequence that provides secretion of the of the embryo. In specific embodiments, introducing the BChE-hSA fusion protein into the cell culture medium, has genetically-engineered DNA sequence comprises pro been introduced; (b) culturing the cells; and (c) collecting nuclear or cytoplasmic microinjection of the DNA sequence; the cell culture medium of the cell culture. In specific combining a mammalian cell stably transfected with the embodiments, this method may comprise the additional DNA sequence with a non-transgenic mammalian embryo; steps of isolating the BChE-hSA fusion protein, or isolating or introducing the DNA sequence into a non-human mam and purifying the BChE-hSA fusion protein. Accordingly, malian oocyte; and activating the oocyte to develop into an the invention also encompasses cell culture medium com embryo. prising a BChE-hSA fusion protein produced by cultured MAC-T or BHK cells according to this method. 0028. The invention is further directed to a method for producing a transgenic mammal that secretes a BChE-hSA 0034. The invention also encompasses cell culture fusion protein in its urine, which method comprises cloning medium from a culture of mammalian cells, which medium or breeding of a transgenic mammal, the genome of which comprises a BChE-hSA fusion protein. comprises a DNA sequence encoding a BChE-hSA fusion 0035. The invention also provides a method for produc protein, operably linked to a urinary endothelium-specific ing a pharmaceutical composition, which comprises com promoter, wherein the sequence further comprises a signal bining a BChE-hSA fusion protein produced by a transgenic sequence that provides secretion of the BChE-hSA fusion mammal or cultured MAC-T or BHK cells with a pharma protein into the urine of the mammal. ceutically acceptable carrier or excipient. Accordingly, the 0029. The invention is directed to a method for producing invention is further directed to methods for the treatment of a BChE-hSA fusion protein, which method comprises: (a) organophosphate poisoning, post-Surgical Succinyl choline inducing or maintaining lactation of a transgenic mammal, induced apnea, and cocaine intoxication, which methods the genome of which comprises a DNA sequence encoding comprise administering to a subject in need thereof a thera a BChE-hSA fusion protein, linked through a DNA linker peutically effective amount of a pharmaceutical composition that encodes at least 7 amino acid residues, preferably produced by the methods of the invention. composed of 6 glycines and one serine in a sequential order, 0036). The invention also encompasses a transgenic non operably linked to a mammary gland-specific promoter, human mammal capable of expressing BChE-hSA fusion where the sequence further comprises a signal sequence that protein in both its milk and its urine. The genome of said provides secretion of the BChE enzyme into the milk of the transgenic mammal comprises (a) a DNA sequence encod mammal; and (b) extracting milk from the lactating mam ing a BChE-hSA fusion protein, linked through a DNA mal. In a specific embodiments, this method may comprise linker that encodes at least 7 amino acid residues, preferably the additional steps of isolating the BChE-hSA fusion pro composed of 6 glycines and one serine in a sequential order, tein. operably linked to a mammary gland-specific promoter, and 0030. Accordingly, the invention is also directed to the further comprising a signal sequence that provides secretion milk of a non-human mammal comprising a human BChE of the BChE-hSA fusion protein into the milk of the mam hSA fusion protein, and to milk comprising a BChE-hSA mal; and (b) a DNA sequence encoding a BChE-hSA fusion fusion protein produced by a transgenic mammal according protein, linked through a DNA linker that encodes at least 7 to the methods of the invention. amino acid residues, preferably composed of 6 glycines and 0031. The invention is also directed to a method for one serine in a sequential order, operably linked to a urinary producing a BChE-hSA fusion protein, which method com endothelium-specific promoter, and further comprising a prises, extracting urine from a transgenic mammal, the signal sequence that provides secretion of the BChE-hSA genome of which comprises a DNA sequence encoding a fusion protein into the urine of the mammal. These DNA BChE-hSA fusion protein, operably linked to a urinary sequences may be encoded in a single, bi-cistronic expres endothelium-specific promoter, where the sequence further sion construct, or in independent expression constructs. comprises a signal sequence that provides secretion of the 0037. In a further aspect, the present invention relates to BChE enzyme into the urine of the mammal. In specific a method for producing a recombinant enzymatically active embodiments, this method may comprise the additional butyrylcholinesterase (BChE) polypeptide fused to a steps of isolating the BChE-hSA fusion protein, or isolating polypeptide sequence that confers additional stability to said and purifying the BChE-hSA fusion protein. BChE when the latter is administered to an animal, such as 0032. Accordingly, the invention is also directed to the a human being. Preferably, the BChE is fused to a serum urine of a non-human mammal comprising a human BChE albumin, especially human serum albumin (HSA). To facili US 2006/0253913 A1 Nov. 9, 2006
tate the formation of native, active conformations of the 0045. Such methods further comprise introducing the BChE, and possibly the HSA, the BChE and fused polypep polynucleotide of the invention into a cell of the embryo, or tide are separated by a linker, such as an amino acid into a cell that will form at least part of the embryo, sequence, preferaqbly one of at least about 7 amino acids. In including where the method comprises pronuclear or cyto accordance with the present invention, Such a fusion protein plasmic microinjection of the polynucleotide. is produced in vitro. Such as in a cell culture, or is synthe sized directly as a polypeptide sequence, or is prepared by 0046) The present invention also relates to methods of chemically linking said BChE polypeptide to said fused producing Such fusion proteins by extraction from milk or polypeptide. Such as HSA. Such fusion protein may also be urine of the transgenic animals of the invention as well as to prepared in Vivo, using a transgenic animal, especially a the milk or urine produced. mouse or goat, whereby the fusion protein is secreted into 0047 The present invention also relates to a cell culture the milk or urine, or both, of said animal. In the latter case, medium comprising a fusion protein, said fusion protein the fusion protein is then prepared as a purified product comprising a BChE enzyme and an hSA protein, produced using methods well known in the art for protein isolation and by cultured MAC-T or BHK cells according to any of the purification. methods of the invention. 0038. The present invention also relates to an isolated 0048. In a further aspect, the present invention relates to fusion protein, comprising an enzymatically active BChE a method for the treatment of organophosphate poisoning, enzyme and a mean residence time enhancing protein that which comprises administering to a subject in need thereof increases the mean residence time of said fusion protein a therapeutically effective amount of a pharmaceutical com relative to said BChE when intravenously administered to a position comprising a fusion protein of the invention. Such mammal. Preferably, the mean residence time enhancing methods include the treatment of post-Surgical. Succinyl protein is human serum albumin (hSA). Said protein will choline-induced apnea, which comprises administering to a also commonly possess a signal sequence that directs secre subject in need thereof a therapeutically effective amount of tion of the protein from a cell. Such as for producing the a pharmaceutical composition produced by the methods of fusion protein in the milk or urine of an animal. The linker the invention. The invention also includes a method for the sequence is available to promote independent folding and treatment of cocaine intoxication, which comprises admin activity of said BChE as well as the hSA. istering to a Subject in need thereof a therapeutically effec 0039. In another aspect, the present invention relates to tive amount of a pharmaceutical composition produced by an isolated polynucleotide encoding such fusion proteins. the methods of the invention. These polynucleotides may incorporate sequences that encode signal sequences as well as tissue-specific promoter Definitions sequences for directing expression of the fusion protein in milk or urine, especially in mice and goats. 0049. Unless expressly stated otherwise, each of the indicated terms has the following meaning: 0040. In another aspect, the present invention relates to a non-human transgenic mammal that upon lactation, 0050. The term “butyrylcholinesterase enzyme” or expresses in its milk a fusion protein of the invention. “BChE enzyme” means a polypeptide capable of hydroliz ing acetylcholine and butyrylcholine, and whose catalytic 0041. In another aspect, the present invention relates to a activity is inhibited by the chemical inhibitor iso-OMPA. non-human transgenic mammal as above, wherein the Preferred BChE enzymes to be produced by the present genome of the mammal comprises a polynucleotide of the invention are mammalian BChE enzymes. Preferred mam invention. Such animals will commonly produce the fusion malian BChE enzymes include human BChE enzymes. Most protein of the invention in their milk or urine. preferrably, the primary amino acid sequence of the BChE 0.042 Most preferred for such fusion protein is one in enzyme is subtantially identical to that of the native mature which the BChE is human BChE has an amino acid human BChE protein (for example, SEQID NO: 2). Such a sequence as depicted in SEQ ID NO: 2. BChE enzyme may be encoded by a nucleic acid sequence 0043. In an additional aspect, the present invention that is substantially identical to that of the native human relates to a method for producing a transgenic mammal that BChE cDNA sequence (for example, SEQ ID NO: 1). The secretes a fusion protein of the invention, Such as in its milk term “BChE enzyme” also encompasses pharmaceutically or urine. Preferably, this method further comprises introduc acceptable salts of Such a polypeptide. ing a polynucleotide of the invention into a cell of the 0051) The term “BChE-hSA fusion protein’ means a embryo, or into a cell that will form at least part of the fused polypeptide capable of hydrolizing acetylcholine and embryo, especially where introducing the genetically-engi butyrylcholine, and whose catalytic activity is inhibited by neered DNA sequence comprises pronuclear or cytoplasmic the chemical inhibitor iso-OMPA. Preferred BChE-hSA microinjection of the DNA sequence. fusion protein to be produced by the present invention are 0044) In one such embodiment, the method comprises mammalian BChE-hSA fusion proteins. Preferred mamma introducing the polynucleotide of the invention by combin lian BChE-hSA fusion proteins include human BChE-hSA ing a mammalian cell stably transfected with the DNA fusion proteins. Most preferably, the primary amino acid sequence with a non-transgenic mammalian embryo. In sequence of the BChE-hSA fusion protein is substantially another embodiment, the method comprises introducing the identical to that of the native mature human BChE protein genetically-engineered DNA sequence comprises the steps (for example, SEQ ID NO: 2) and that of the native mature of (a) introducing the DNA sequence into a non-human human serum albumin, linked through an oligopolypeptide, mammalian oocyte; and (b) activating the oocyte to develop preferably composed of at least 7 amino acid residues into an embryo. including 6 glycines and one serine in a sequential order (for US 2006/0253913 A1 Nov. 9, 2006
example, SEQID NO: 50). Such a BChE-hSA fusion protein translated products. These two products may be translated may be encoded by two nucleic acid sequences that are from a single mRNA encoded by the bi-cistronic construct substantially identical to that of the native human BChE or from two independent mRNAs where each of the mRNAs cDNA sequence (for example, SEQ ID NO: 1) and that of is encoded within the same bi-cistronic construct. The term the native human serum albumin cDNA sequence, linked "poly-cistronic construct” means any construct that provides through a DNA linker that encodes at least 7 amino acid for the expression of more than two independent translated residues, preferably composed of 6 glycines and one serine products. in a sequential order (for example, SEQ ID NO: 49). The 0058. The term “operably linked' means that a target term “BChE-hSA fusion protein’ also encompasses phar nucleic acid sequence and one or more regulatory sequences maceutically acceptable salts of Such a fused polypeptide. (e.g., promoters) are physically linked so as to permit 0.052 The term “substantially identical' means a expression of the polypeptide encoded by the target nucleic polypeptide or nucleic acid exhibiting at least 75%, prefer acid sequence within a host cell. ably at least 85%, more preferably at least 90%, and most preferably at least 95% identity in comparison to a reference 0059. The term “signal sequence” means a nucleic acid amino acid or nucleic acid sequence. For polypeptides, the sequence which, when incorporated into a nucleic acid length of sequence comparison will generally be at least 20 sequence encoding a polypeptide, directs secretion of the amino acids, preferably at least 30 amino acids, more translated polypeptide (e.g., a BChE enzyme and/or a preferably at least 40 amino acids, and most preferably at BChE-hSA fusion protein and/or a glycosyltransferase) least 50 amino acids. For nucleic acids, the length of from cells which express said polypeptide. The signal sequence comparison will generally be at least 60 nucle sequence is preferably located at the 5' end of the nucleic otides, preferably at least 90 nucleotides, and more prefer acid sequence encoding the polypetide, Such that the ably at least 120 nucleotides. polypeptide sequence encoded by the signal sequence is located at the N-terminus of the translated polypeptide. The 0053) The term “recombinant butyrylcholinesterase” or term 'signal peptide' means the peptide sequence resulting “recombinant BChE’ means a BChE enzyme produced by a from translation of a signal sequence. transiently transfected, stably transfected, or transgenic host cell or animal as directed by one of the expression constructs 0060. The term “mammary gland-specific promoter” of the invention. The term “recombinant BChE’ also encom means a promoter that drives expression of a polypedtide passes pharmaceutically acceptable salts of Such a polypep encoded by a nucleic acid sequence to which the promoter tide. is operably linked, where said expression occurs primarily in the mammary cells of the mammal, wherefrom the 0054) The term “recombinant BChE-hSA fusion protein' expressed polypeptide may be secreted into the milk. Pre means a fused polypeptide produced by a transiently trans ferred mammary gland-specific promoters include the fected, stably transfected, or transgenic host cell or animal as B-casein promoter and the whey acidic protein (WAP) directed by one of the expression constructs of the invention. promoter The term “recombinant BChE-hSA fusion protein’ also encompasses pharmaceutically acceptable salts of Such a 0061 The term “urinary endothelium-specific promoter” polypeptide. means a promoter that drives expression of a polypedtide 0.055 The term “genetically-engineered DNA sequence' encoded by a nucleic acid sequence to which the promoter means a DNA sequence wherein the component sequence is operably linked, where said expression occurs primarily in elements of the DNA sequence are organized within the the endothelial cells of the kidney, ureter, bladder, and/or DNA sequence in a manner not found in nature. Such a urethra, wherefrom the expressed polypeptide may be genetically-engineered DNA sequence may be found, for secreted into the urine. The term “urothelium' or “urothelial example, ex vivo as isolated DNA, in vivo as extra-chro cells' refers to the endothelial cells forming the epithelial mosomal DNA, or in vivo as part of the genomic DNA. lining of the ureter, bladder, and urethra. 0056. The term “expression construct” or “construct” 0062) The term “host cell' means a cell which has been means a nucleic acid sequence comprising a target nucleic transfected with one or more expression constructs of the acid sequence or sequences whose expression is desired, invention. Such host cells include mammalian cells in in operably linked to sequence elements which provide for the vitro culture and cells found in vivo in an animal. Preferred proper transcription and translation of the target nucleic acid in vitro cultured mammalian host cells include MAC-T cells sequence(s) within the chosen host cells. Such sequence and BHK cells. elements may include a promoter, a signal sequence for 0063. The term “transfection” means the process of intro secretion, a polyadenylation signal, intronic sequences, insu ducing one or more of the expression constructs of the lator sequences, and other elements described in the inven invention into a host cell by any of the methods well tion. The “expression construct” or “construct” may further established in the art, including (but not limited to) micro comprise “vector sequences”. The term “vector sequences injection, electroporation, liposome-mediated transfection, means any of several nucleic acid sequences established in calcium phosphate-mediated transfection, or virus-mediated the art which have utility in the recombinant DNA technolo transfection. A host cell into which an expression construct gies of the invention to facilitate the cloning and propagation of the invention has been introduced by transfection is of the expression constructs including (but not limited to) “transfected’. The term “transiently transfected cell' means plasmids, cosmids, phage vectors, viral vectors, and yeast a host cell wherein the introduced expression construct is not artificial chromosomes. permanently integrated into the genome of the host cell or its 0057 The term “bi-cistronic construct” means any con progeny, and therefore may be eliminated from the host cell struct that provides for the expression of two independent or its progeny over time. The term “stably transfected cell US 2006/0253913 A1 Nov. 9, 2006
means a host cell wherein the introduced expression con 1) purified human serum BChE, positive control; Lane 2) struct has integrated into the genome of the host cell and its milk from a non-transgenic goat, negative control; and progeny. Lanes 3-5) three independent milk samples collected from 0064. The term “transgene' means any segment of an the same female transgenic goat. expression construct of the invention which has become 0072 FIG. 8 depicts silver staining of a denaturing integrated into the genome of a transfected host cell. Host SDS-PAGE gel of recombinant BChE purified from milk cells containing Such transgenes are “transgenic'. Animals collected from a BCNN-BChE transgenic goat. Samples composed partially or entirely of Such transgenic host cells were reduced in the presence of DTT prior to loading onto are “transgenic animals'. Preferably, the transgenic animals the gel. Samples were as follows: Lane 1) 0.2 ug of BChE are transgenic mammals (e.g., rodents or ruminants). Ani purified from the milk of a BCNN-BChE transgenic goat; mals composed partially, but not entirely, of Such transgenic and Lane 2) 0.2 g of purified human serum BChE, positive host cells are "chimeras' or "chimeric animals'. control. 0073 FIG. 9 is a schematic depicting the generation of DESCRIPTION OF THE DRAWINGS the pWAP/BChE construct. This expression construct pro 0065 FIGS. 1A and 1B depict the cDNA and translated vides for expression of recombinant BChE in the mammary amino acid sequence of wild-type human BChE. The signal gland of a transgenic mammal, and for the secretion of the sequence is in bold. The signal peptide, which is cleaved recombinant BChE into the milk of a lactating transgenic during processing to produce the mature BChE protein, is mammal underlined. Amino acids are represented by the standard 0074 FIG. 10 is a shematic depicting the linear NotI one-letter code. * indicates the STOP codon. fragment of pWAP/BChE. 0.066 FIG. 2 depicts the locations of altered residues in 0075 FIG. 11 is a schematic depicting the strategy for Some naturally occuring human BChE variants (See also generating the expression construct puM/BChE. UM=uro Table 1). Amino acids are represented by the standard modulin. SS=signal sequence. This expression construct will one-letter code. One letter codes shown above the amino provide for expression of recombinant BChE in the kidney acid sequence represent the type of variant as follows: of a transgenic mammal, and for the Secretion of the A=atypical: F=fluoride resistant; H, J, and K=H, J, and K recombinant BChE into the urine of a transgenic mammal. variants; N=unstable variant; and S=Silent (no or very low 0076 FIG. 12 is a schematic depicting the strategy for activity) variants. Asterisks (*) shown below the amino acid generating the expression construct puP11/BChE. UPII= sequence mark the residues of the catalytic triad. uroplakin II. SS=signal sequence. This expression construct 0067 FIG. 3 depicts a non-reducing BChE-activity gel will provide for expression of recombinant BChE in the of condition serum-free cell culture media from stably urothelium of a transgenic mammal, and for the Secretion of transfected cell lines expressing recombinant BChE. Con the recombinant BChE into the urine of a transgenic mam ditioned, serum free media was from: Lane 1) MAC-T cells, mal. untransfected control; Lane 2) MAC-T cells stably trans 0.077 FIGS. 13 depicts the cDNA and translated amino fected with pCMV/IgKBChE; Lane 3) MAC-T cells stably acid sequence of the BChE-hSA. The signal sequence is in transfected with pCMV/BChE-hSA: Lane 4) BHK cells, bold. The signal peptide, which is cleaved during processing untransfected control; Lane 5) BHK cells stably transfected to produce the mature BChE protein, is underlined. Amino with pCMV/BChE-hSA. Lane 6) was purified human serum acids are represented by the standard one-letter code. The BChE, positive control. DNA linker between BChE and hSA is italic and in bold whereas the oligopeptide linker between BChE and hSA is 0068 FIG. 4 is a schematic depicting the generation of italic and underlined. Nine single-nucleotide-mutations the pBCNN/BChE expression construct. SS=signal (boxed) were found in the hSA cDNA when compared with sequence. This expression construct provides for expression a published hSA sequence (GenBank accession No of recombinant BChE in the mammary gland of a transgenic #V00495). However, only one mutation at nucleotide 2977 mammal, and for the secretion of the recombinant BChE (a->g, boxed) causes a change of an amino acid residue into the milk of a lactating transgenic mammal. (K->E, in bold and boxed). * indicates the STOP codon. 0069 FIG. 5 is a schematic depicting the exons and 0078 FIG. 14 demonstrates BChE activity of the BChE introns of the goat B-casein locus that are contained in the hSA fusion protein produced in vitro and in vivo. Samples NotI linearized fragment of pBCNN/BChE. This BCNN (15 Jul) were loaded on a 4-20% Tris-glycine non-denaturing BChE fragment contains a BChE encoding sequence in gel in the following order: lane 1, purified plasma huBChE place of goat B-casein locus sequences from the end of exon (10 U/ml, courtesy of Dr. O. Lockridge); lane 2, Harvest 8 2 through the majority of exon 7. of conditioned media from the hollow fiber system (10 0070 FIG. 6 depicts a non-reducing BChE-activity gel U/ml); lane 3, control conditioned media; lane 4, diluted milk sample from a F1 transgenic mouse (10 u/ml); lane 5, of the whey phase of milk collected from BCNN-BChE diluted milk sample from a F2 transgenic mouse (10 u/ml); transgenic mice. Whey phase samples were as follows: Lane lane 6, diluted milk sample from a non-transgenic FVB 1) milk collected from BCNN-BChE transgenic mice; and mouse (1:30); lane 7, diluted milk sample from a transgenic Lanes 2 and 3) milk collected from non-trangenic mice goat (10 u/ml); lane 8, diluted milk samples from another (negative control) rBChE=recombinant BChE. transgenic goat (10 u/ml); lane 9, purified BChE-hSA 0071 FIG. 7 depicts a non-reducing BChE-activity gel sample from the milk of the same transgenic goat as shown of the whey phase of milk collected from BCNN-BChE in lane 8; lane 10, diluted milk sample from a non-transgenic transgenic goats. Whey phase samples were as follows: Lane goat (1:30). US 2006/0253913 A1 Nov. 9, 2006
0079 FIG. 15 depicts Western blot analysis under dena 0085. The BChE produced according to the present turing and reducing conditions. Immunodetection was per invention is preferably in tetrameric form. It is believed that formed with a polyclonal anti-huBChE antibody from rabbit the tetrameric form of BChE is more stable and has a longer (Dako. 1: 1000) and a secondary HRP-conjugated anti half-life in the plasma, thereby increasing its therapeutic rabbit AB (Promega, 1:5000). 15 ul samples were loaded in effectiveness. BChE expressed recombinantly in CHO (Chi the following order: lane 1, Biotinylated molecular markers nese hamster ovary) cells was found not to be in the more (Molecular Probes); lane 2, purified plasma huBChE (10 stable tetrameric form, but rather consisted of approximately U/ml, courtesy of Dr. O. Lockridge); lane 3, Harvest 8 of 55% dimers, 10-30% tetramers and 15-40% monomers conditioned media from the hollow fiber system (10 U/ml); Blong, et al. Biochem. J. (1997) 327:747-757). Recent lane 4, control conditioned media; lane 5, diluted milk studies have shown that a proline-rich amino acid sequence sample from a F1 transgenic mouse (307-1A7F. 10 u/ml); from the N-terminus of the collagen-tail protein caused lane 6, diluted milk sample from a non-transgenic FVB acetylcholinesterase to assemble into the tetrameric form mouse (1:30); lane 7, diluted milk sample from a transgenic Bon, et al. J. Biol. Chem. (1997) 272(5):3016-3021 and goat (2237, BBLA goat, 10 u/ml); lane 8, diluted milk Krejci, et al. J. Biol. Chem. (1997) 272:2284.0-22847). Thus, sample from another transgenic goat (2177. 10 u/ml); lane 9, to increase the amount of tetrameric BChE enzyme formed purified BChE-hSA sample from the milk of the same according to the invention, the DNA sequence encoding the transgenic goat as shown in lane 8; lane 10, diluted milk BChE enzyme of the invention may comprise a proline-rich sample from a non-transgenic goat (1:30). attachment domain (PRAD), which recruits recombinant BChE subunits (e.g., monomers, dimers and trimers) to form 0080 FIG. 16 depicts Silver-stained SDS-PAGE. tetrameric associations. The PRAD preferably comprises at Samples were loaded onto a pre-cast 4-20% Tris-Glycine least six amino acid residues followed by a string of at least polyacrylamide gel under denaturing and reducing condi 10 proline residues. An example of a PRAD useful in the tions in the following order: lane 1, molecular weight marker invention comprises the sequence (Glu-Ser-Thr-Gly-Pro) (Bio-Rad); lane 2, purified BChE-hSA from milk of the (SEQ ID NO: 40). The PRAD may be included in a transgenic goat, 2177. bi-cistronic expression construct which encodes both the 0081 FIG. 17 depicts the in vivo clearance of the BChE PRAD and the BChE enzyme, or the PRAD and the BChE hSA fusion protein produced in vitro (A) and a transgeni enzyme may be encoded in separate constructs. Alterna cally produced BChE preparation containing >70% tetramer tively, encoded PRAD may be attached directed to the (B) in juvenile pigs. The pigs were i.v. injected with the encoded BChE enzyme. The invention also contemplates proteins and residual BChE activity (%) was plotted versus addition of a PRAD, which can be synthetic (e.g., polypro time (hours) for each animal. line) or naturally occurring, to a mixture comprising recom binant BChE, to induce rearrangement of the BChE enzyme DETAILED DESCRIPTION OF THE into tetramers. INVENTION 0.086 Although it is believed that tetrameric BChE will be the most therapeutically effective form of BChE for the Selection of BChE Enzymes treatment and/or prevention of organophosphate poisoning, 0082) Butyrylcholinesterase derived from human serum other forms of the enzyme (e.g., monomers, dimers and is a globular, tetrameric molecule with a molecular mass of trimers) have demonstrated Substrate activity and are also approximately 340 kDa. Nine Asn-linked carbohydrate encompassed by the invention. However, the observation chains are found on each 574-amino acid subunit. The that non-tetrameric forms of BChE are less stable in vivo tetrameric form of BChE is the most stable and is preferred does not rule out their usefulness in in vivo applications. for therapeutic purposes. Wildtype, variant, and artificial Higher doses or more frequent in vivo administration of the BChE enzymes can be produced by transgenic mammals non-tetrameric forms of BChE can result in satisfactory according to the invention. BChE enzymes produced therapeutic activity. according to the instant invention have the ability to bind and/or hydrolyze organophosphate pesticides, war gases, 0087. The non-tetrameric forms of BChE are also useful Succinylcholine, or cocaine. in applications which do not require in vivo administration, Such as the clean-up of lands used to store organophosphate 0.083 Preferably, the BChE enzyme produced according compounds, as well as decontamination of military equip to the invention comprises an amino acid sequence that is ment exposed to organophosphates. For ex vivo use, these Substantially identical to a sequence found in a mammalian non-tetrameric forms of BChE may be incorporated into BChE, more preferably, human BChE, and may be produced sponges, sprays, cleaning solutions or other materials useful as a tetramer, a trimer, a dimer, or a monomer. In a preferred for the topical application of the enzyme to equipment and embodiment, the BChE of the invention has a glycosylation personnel. These forms of the enzyme may also be applied profile that is substantially similar to that of native human externally to the skin and clothes of human patients who BChE. have been exposed to organophosphate compounds. The non-tetrameric forms of the enzyme may also find applica Fusion of BChE to hSA tions as barriers and sealants applied to the seams and 0084. In another preferred embodiment, the BChE closures of military clothing and gas masks used in chemical enzyme produced according to the invention is fused to a warfare situations. human serum albumin (hSA) moiety. This fusion to hSA is expected to exhibit high plasma stability, and is expected to Fusion of BChE to Human Serum Albumin be either weakly or non-immunogenic for the organism in 0088 BChE has been shown to be an effective treatment which it is used. against multiple LD50s of organophosphates. A prerequisite US 2006/0253913 A1 Nov. 9, 2006 for such use of BChE is a prolonged circulatory half-life. A ther comprises a signal sequence that directs secretion of means of achieving plasma stability and longer half-life of said fusion protein by the cell. Also preferred is where the recombinant BChE produced according to the invention is to BChE enzyme comprises the amino acid sequence of SEQ provide a recombinantly produced BChE fused to hSA. This ID NO: 2 and the polynucleotide comprises the nucleotide fusion protein is believed to exhibit high plasma stability sequence of SEQ ID NO: 1. Commonly, the cell will also and an advantageous distribution in the body, and is comprise a polynucleotide sequence that encodes a glyco expected to be either weakly or non-immunogenic for the Syltransferase, said polynucleotide being operably linked to organism in which it is used. a promoter, so that following expression said glycosyltrans 0089. The BChE enzyme amino acid sequences and the ferase will glycosylate the BChE portion of the fusion hSA amino acid sequences of the fusion protein may or may protein. In one embodiment, the polynucleotide encoding not be separated by linker amino acid sequences (e.g., a the fusion protein is part of a plasmid. poly-glycine linker). Such linker amino acid sequences are 0094. The present invention is also drawn to an isolated often included to promote proper folding of the different fusion protein, comprising an enzymatically active BChE domains of a fusion protein (e.g., hSA domain and BChE enzyme and an hSA and where the fusion protein further enzyme domain). By promoting proper folding of the BChE comprises a linker located between said BChE enzyme and enzyme domain, Such linker sequences may promote main said hSA protein and wherein said linker promotes indepen tenace of catalytic activity. dent folding and activity of said BChE, and comprises an amino acid sequence, preferably at least 7 amino acid 0090. For example, hSA may be fused to either the residues in length, most preferably glycine and serine resi N-terminus or the C-terminus of BChE. In preferred embo dues. Also preferred is where said BChE is a human BChE siments, the hSA moiety is fused to the C-terminal end of the and said hSA is a human serum albumin, such as the amino BChE enzyme. This fusion is expected to provide a fusion acid sequence of SEQ ID NO: 50 and further comprising a protein that maintains BChE catalytic activity. In one signal sequence that directs secretion of said fusion protein embodiment for fusion of hSA to the N-terminal end of from a cell and wherein said signal sequence directs secre BChE, the plasmid pYG404 can be used, as described in EP tion into milk or into urine. 361,991. This plasmid contains a restriction fragment encod ing the prepro-hSA gene. The BChE-encoding nucleic acid 0095 The present invention is further drawn to an iso sequence can be amplified by PCR using primers that are lated polynucleotide, comprising: (i) a nucleotide sequence exclusive of the termination codon and signal sequence. This encoding the BChE-hSA fusion protein, where the fusion BChE-encoding PCR product may be introduced at the 3' protein further comprises a linker located between said end of the pYG404 prepro-hSA sequence, in the same BChE enzyme and said hSA protein and wherein said linker translational frame. In one embodiment for fusion of hSA to promotes independent folding and activity of said BChE, the C-terminal end of BChE, the hSA-encoding nucleic acid and comprises an amino acid sequence, preferably at least 7 sequence, without its signal sequence, is fused in transla amino acid residues in length, most preferably glycine and serine residues. (ii) a promoter that directs expression of the tional frame to the 3' end of the BChE-encoding nucleic acid fusion protein, and (iii) at least one signal sequence that Sequence. provides secretion of the expressed fusion protein from a 0091. In another embodiment, purified recombinant cell, preferably wherein said amino acid sequence comprises BChE may be conjugated in vitro to a hSA polypeptide. at least 6 amino acid residues. Preferably, the BChE is a Conjugation may be achieved by any appropriate chemical human BChE and said hSA is a human serum albumin, such or affinity ligand method. Particularly useful are hSA and as the amino acid sequence of SEQ ID NO: 50 and/or BChE polypeptides with monovalent affinity ligand modi wherein the polynucleotide comprises the nucleotide fications. For in vitro conjugation, each protein to be con sequence of SEQ ID NO: 49. jugated (e.g. hSA) can be separately produced by recombi 0096. In preferred embodiments, the signal sequence nant methods and isolated to the necessary purity, followed directs secretion into milk or into urine. In preferred embodi by in vitro conjugation, prior to administration. ments thereof, the promoter is a mammary gland-specific 0092. In accordance with the foregoing, the present promoter selected from the group consisting of a WAP invention relates to a method for producing a fusion protein (whey acidic protein) promoter and a casein promoter (for that comprises an enzymatically active butyrylcholinest secretion into milk) or the promoter is a urinary endothe erase (BChE) enzyme and a human serum albumin (hSA) lium-specific promoter selected from the group consisting of (which increases the mean residence time of said fusion a uroplakin promoter or a uromodulin promoter (for secre protein relative to said BChE when intravenously adminis tion into urine). tered to a mammal, comprising expressing said fusion 0097. The present invention also relates to a recombinant protein in a recombinant cell that comprises a polynucle cell that comprises the isolated polynucleotide of the inven otide encoding said fusion protein. In specific embodiments, tion, such as where the the cell is a MAC-T (mammary Such mammal is a Swine, a mouse or a human being. epithelial) cell or a BHK (baby hamster kidney) cell. In other 0093. In a preferred embodiment, the BChE and the hSA embodiments, the cell is selected from the group of embry are separated by an oligopeptide linker that promotes inde onic stem cells, embryonal carcinoma cells, primordial germ pendent folding and activity of said BChE. Preferably, said cells, oocytes, or sperm. oligopeptide linker is at least 7 amino acids in length, Such 0098. The present invention also encompasses a non as where the oligopeptide linker is preferably composed of human mammalian embryo that comprises a polynucleotide glycine and/or serine residues. In other preferred embodi of the invention. ments, the cell is a BHK cell. Also preferred is where the 0099. The present invention is also drawn to a non BChE is human BChE. Preferably, the polynucleotide fur human transgenic mammal that upon lactation, expresses in US 2006/0253913 A1 Nov. 9, 2006
its milk or urine the fusion protein of the invention, prefer (a) inducing or maintaining lactation or urination of a ably wherein the BChE is fused to hSA. The mammal is transgenic mammal, the genome of which comprises a DNA preferably a mouse or a goat. The genome of said non sequence encoding said fusion protein, operably linked to a human transgenic mammal preferably comprises a poly mammary gland-specific promoter or urinary specific pro nucleotide of the invention. In preferred embodiments of moter, wherein the sequence further comprises a signal Such mammal the promoter is a mammary gland-specific sequence that provides secretion of the fusion protein into promoter selected from the group consisting of a WAP the milk or urine of the mammal; and (b) extracting milk (whey acidic protein) promoter and a casein promoter (for from the lactating mammal or urine from the urinating secretion into milk) or is a urinary endothelium-specific mammal. In a preferred embodiment thereof, such method promoter selected from the group consisting of a uroplakin comprises the additional step of isolating the fusion protein promoter or a uromodulin promoter. from the extracted milk or urine. In further preferred steps, 0100. In other preferred embodiments of such mammal, the method comprises purifying the fusion protein. The the genome of the mammal further comprises a DNA present invention also encompasses the milk or urine of said sequence encoding a glycosyltransferase, operably linked to non-human mammal comprising the fusion protein of the a mammary gland-specific promoter, and a signal sequence invention, including where the milk is whole milk or is that provides secretion of the glycosyltransferase. Preferred defatted milk. is where the mammary gland-specific promoter is a casein 0105 The present invention further relates to a compo promoter or a whey acidic protein (WAP) promoter. Also sition comprising a fusion protein of the invention, prefer preferred is where the genome of the mammal further ably where the BChE is linked to hSA, in a pharmaceutically comprises a DNA sequence encoding a glycosyltransferase, acceptable carrier. operably linked to a urinary gland-specific promoter, and a signal sequence that provides secretion of the glycosyltrans 0106 The present invention also encompasses a method ferase. Preferably, the promoter is a urinary endothelium for treating organophosphate poisoning, comprising admin specific promoter selected from the group consisting of a istering to a Subject in need thereof a therapeutically effec uroplakin promoter or a uromodulin promoter. Preferably, tive amount of a pharmaceutical composition of the inven said mammal is a mouse or a goat. tion. The present invention further relates to a method for the 0101 The present invention is also drawn to a method for treatment of post-Surgical. Succinyl choline-induced apnea, producing a transgenic mammal that upon lactation secretes which comprises administering to a subject in need thereof the fusion protein of claim 16 in its milk, which method a therapeutically effective amount of a pharmaceutical com comprises allowing an embryo, into which at least one position of the invention. The present invention further genetically-engineered DNA sequence, comprising (i) a relates to a method for the treatment of cocaine intoxication, sequence encoding said fusion protein; (ii) a mammary which comprises administering to a subject in need thereof gland-specific promoter, and (iii) a signal sequence that a therapeutically effective amount of a pharmaceutical com provides secretion of the fusion protein into the milk of the position of the invention. mammal, has been introduced, to grow when transferred into BChE-hSA Fusion Protein Glycosylation Profile a recipient female mammal, resulting in the recipient female 0.107 Naturally occurring human serum BChE and hSA mammal giving birth to the transgenic mammal. are highly glycosylated. For example, the carbohydrate 0102 Preferably, such method further comprises intro content of cholinesterases, including human BChE, gener ducing the genetically-engineered DNA sequence into a cell ally comprises about 33-40% N-acetylglucosamine, 21-31% of the embryo, or into a cell that will form at least part of the embryo. A preferred such procedure is wherein introducing mannose, 18-21% galactose, and 15-18% sialic acid. It has the genetically-engineered DNA sequence comprises pro been suggested that the relatively high stability of the nuclear or cytoplasmic microinjection of the DNA sequence globular tetrameric form of human plasma BChE may be or wherein introducing the genetically-engineered DNA associated with the capping of the terminal carbohydrate sequence comprises combining a mammalian cell stably residues with sialic acid. transfected with the DNA sequence with a non-transgenic 0.108 Mammalian cells used in recombinant protein syn mammalian embryo. Also preferred is the method wherein thesis have glycosylation capabilities, but if BChE is not introducing the genetically-engineered DNA sequence com normally expressed by these host cells, the glycosylation prises the steps of (a) introducing the DNA sequence into a pattern of the recombinantly produced BChE may differ non-human mammalian oocyte; and (b) activating the from that of the natural glycoprotein. Since BChE is a oocyte to develop into an embryo. heavily glycosylated molecule, it is difficult for a recombi 0103) In accordance with the foregoing, the present nant host cell to modify it faithfully. Indeed, it has been invention also relates to a method for producing a transgenic shown that BChE produced in CHO cells had a lower sugar mammal that upon lactation secretes a fusion protein of the content than that found in the native human protein Yuan, invention, in its milk or urine, which method comprises et al. Acta Pharmacologica Sinica, (1999), 20:74-80). cloning or breeding of a transgenic mammal, the genome of 0.109 As a means of producing recombinant BChE-hSA which comprises a DNA sequence encoding said fusion fusion protein with a glycosylation profile that more closely protein, operably linked to a mammary gland-specific pro resembles that of the native enzyme, the present invention is moter or a urinary specific promoter, wherein the sequence directed to transgenic animals that express both a BChE further comprises a signal sequence that provides secretion hSA fusion protein and one or more glycosyltransferases in of the fusion protein into the milk or urine of the mammal. their mammary glands and/or urinary endothelium, as well 0104. The present invention further relates to a method as cultured mammalian cells that express both a BChE-hSA for producing a fusion protein of the invention, comprising: fusion protein and one or more glycosyltransferases. The US 2006/0253913 A1 Nov. 9, 2006 presence of the glycosyltransferases in the intracellular secrete a BChE-hSA fusion protein only with transgenic secretory pathway of cells that are also expressing a secreted mammals of the same species that secrete the desired form of BChE-hSA fusion protein catalyzes the transfer of glycosyltransferases, to produce transgenic mammals that glycan moieties to said BChE-hSA fusion proteins. The secrete these enzymes. invention also encompasses addition of one or more glyco syltransferases to an in vitro reaction for the transfer of 0.112. The preferred glycosyltransferase enzymes for use glycan moieties to a recombinant BChE-hSA fusion protein in accordance with the present invention are sialyltrans produced by the transgenic animals or transfected mamma ferases. Other enzymes that alter the glycosylation machin lian cell lines of the invention. For example, recombinant ery whose production within a host cell may be desirable BChE-hSA fusion protein may be sialylated using the in include fucosyltransferases, mannosyltransferases, acety vitro reaction conditions described in Chitlaru, et al. Bio lases, glucoronyltransferases, glucosylepimerases, galacto chem. J. (1998) 336:647-658. Thus, the glycosyltransferase Syltransferases, B-acetylgalactosaminyltransferases, which catalyzes transfer of glycans to the BChE-hSA fusion N-acetylglucosaminyltransferases, and Sulfotransferases. protein may be expressed by the same cell that expresses the For a description of Such transferases see, for example: fusion protein, or the glycosyltransferase may be obtained Hennet. Cell Mol. Life Sci. (2002) 59:1081-1095; Harduin from an external source and added to the recombinant Lepers, et al. Biochimie (2001) 83:727-737; and Takashima, BChE-hSA fusion protein. et al. J. Biol. Chem. (2002) 277:45719-45728. Please refer to Sequences that encode any one or more of Such glyco 0110 Most bioactive terminal sugars are attached to Syltransferases may be introduced into host cells according common core structures by “terminal’ glycosyltransferases. to the invention. These glycosyltransferases may be encoded When two terminal enzymes compete with each other, the in separate expression constructs, or included in any one or ultimate carbohydrate structure is determined by the speci more bi-cistronic or poly-cistronic constructs. Thus, it ficity of the enzyme that acts first. According to the present should be noted that the invention allows for simultaneous invention, a terminal or branching glycosyltransferase, expression in the milk and/or urine of a mammal of a which is not normally produced by the host cell, is intro BChE-hSA fusion protein and one or more glycsoyltrans duced and "over-expressed in the cell according to the ferases. The glycosyltransferases to be expressed are methods described herein. The recombinantly produced gly selected so as to effect transfer of one or more of the desired cosyltransferase will Successfully compete with the endog carbohydrate moieties to the BChE-hSA fusion protein. enous enzymes, producing a recombinant BChE-hSA fusion protein which has a glycosylation profile which more closely 0113. In the event that independent transcripts to encode resembles that of the native enzymes. The methods of the the BChE-hSA fusion protein and the respective glycosyl invention alter the glycosylation capabilities of mammary, transferses, it is preferred that different promoters are used bladder, or kidney epithelial cells in order to control carbo to express the different transcripts. For example, if the hydrate attachment on the secreted BChE-hSA fusion pro nucleic acid sequence encoding the BChE-hSA fusion pro tein. Carbohydrate moieties are commonly attached to tein is operably linked to a mammary gland-specific casein asparagine, serine, or threonine residues. promoter, it is preferred that nucleic acid sequence encoding 0111. The basic procedure involves introduction of an the glycosyltransferase is operably linked to a different expression construct comprising a nucleic acid sequence mammary gland-specific promoter, Such as a WAP promoter. encoding a glycosyltransferase enzyme operably linked to Although it is preferred to use different promoters in this elements that allow expression of the glycosyltransferase instance, the invention also encompasses use of the same enzyme in the tissue of interest. A second expression con promoter. struct, one of the BChE-hSA fusion protein-encoding 0114. In accordance with the foregoing, the present expression constructs described herein, is also introduced. invention relates to a method for producing a fusion protein Alternatively, the BChE-hSA fusion protein and the glyco that comprises an enzymatically active butyrylcholinest Syltransferase may be encoded in a single bi-cistronic con erase (BChE) enzyme and a human serum albumin (hSA) struct. An example of a bi-cistronic construct of the inven (which increases the mean residence time of said fusion tion would be a construct which comprises a WAP promoter; protein relative to said BChE when intravenously adminis a nucleic acid sequence which encodes both a BChE-hSA tered to a mammal), comprising expressing said fusion fusion protein and a glycosyltransferase, in which an IRES protein in a recombinant cell that comprises a polynucle (internal ribosomal entry site) is included between the otide encoding said fusion protein. In specific embodiments, sequence encoding the BChE-hSA fusion protein and the sequence encoding the glycosyltransferase; and signal Such mammal is a Swine, a mouse or a human being. sequences to provide secretion of the BChE-hSA fusion 0115) In a preferred embodiment, the BChE and the hSA protein and the glycosyltransferase. This construct may be are separated by an oligopeptide linker that promotes inde introduced into the genome of a mammalian host cell by pendent folding and activity of said BChE. Preferably, said techniques well known in the art including microinjection, oligopeptide linker is at least 6 amino acids in length, Such electroporation, and liposome-mediated transfection, cal as where the oligopeptide linker is preferably composed of cium phosphate-mediated transfection, virus-mediated glycine residues. In other preferred embodiments, the cell is transfection, and nuclear transfer techniques. Accordingly, a BHK cell. Also preferred is where the BChE is human the recombinant BChE-hSA fusion protein that is ultimately BChE. Preferably, the polynucleotide further comprises a secreted by the host cell will have a more predictable signal sequence that directs secretion of said fusion protein glycosylation pattern. The invention also encompasses the by the cell. Also preferred is where the BChE enzyme generation of transgenic mammals that secrete a BChE-hSA comprises the amino acid sequence of SEQID NO: 2 and the fusion protein and a glycosyltransferase in their milk and/or polynucleotide comprises the nucleotide sequence of SEQ urine through cross-breeding of transgenic mammals that ID NO: 1. Commonly, the cell will also comprise a poly US 2006/0253913 A1 Nov. 9, 2006 nucleotide sequence that encodes a glycosyltransferase, said 0122) In other preferred embodiments of such mammal, polynucleotide being operably linked to a promoter, so that the genome of the mammal further comprises a DNA following expression said glycosyltransferase will glycosy sequence encoding a glycosyltransferase, operably linked to late the BChE portion of the fusion protein. In one embodi a mammary gland-specific promoter, and a signal sequence ment, the polynucleotide encoding the fusion protein is part that provides secretion of the glycosyltransferase. Preferred of a plasmid. is where the mammary gland-specific promoter is a casein 0116. The present invention is also drawn to an isolated promoter or a whey acidic protein (WAP) promoter. Also fusion protein, comprising an enzymatically active BChE preferred is where the genome of the mammal further enzyme and an hSA and where the fusion protein further comprises a DNA sequence encoding a glycosyltransferase, comprises a linker located between said BChE enzyme and operably linked to a urinary gland-specific promoter, and a said hSA protein and wherein said linker promotes indepen signal sequence that provides secretion of the glycosyltrans dent folding and activity of said BChE, including a linker ferase. Preferably, the promoter is a urinary endothelium comprising an amino acid sequence, preferably at least 6 specific promoter selected from the group consisting of a amino acid residues in length, most preferably glycine uroplakin promoter or a uromodulin promoter. Preferably, residues. Also preferred is where said BChE is a human said mammal is a mouse or a goat. BChE, such as the amino acid sequence of SEQ ID NO: 2 0123 The present invention is also drawn to a method for and further comprising a signal sequence that directs secre producing a transgenic mammal that upon lactation secretes tion of said fusion protein from a cell and wherein said the fusion protein of claim 16 in its milk, which method signal sequence directs secretion into milk or into urine. comprises allowing an embryo, into which at least one 0117 The present invention is further drawn to an iso genetically-engineered DNA sequence, comprising (i) a lated polynucleotide, comprising: (i) a nucleotide sequence sequence encoding said fusion protein; (ii) a mammary encoding the fusion protein of claim 16, (ii) a promoter that gland-specific promoter, and (iii) a signal sequence that directs expression of the fusion protein, and (iii) at least one provides secretion of the fusion protein into the milk of the signal sequence that provides secretion of the expressed mammal, has been introduced, to grow when transferred into fusion protein from a cell, preferably wherein said amino a recipient female mammal, resulting in the recipient female acid sequence comprises at least 6 amino acid residues. mammal giving birth to the transgenic mammal. Preferably, the BChE is a human BChE, including the amino 0.124 Preferably, such method further comprises intro acid sequence of SEQ ID NO: 2 and/or wherein the poly ducing the genetically-engineered DNA sequence into a cell nucleotide comprises the nucleotide sequence of SEQ ID of the embryo, or into a cell that will form at least part of the NO: 1. embryo. A preferred such procedure is wherein introducing 0118. In preferred embodiments, the signal sequence the genetically-engineered DNA sequence comprises pro directs secretion into milk or into urine. In preferred embodi nuclear or cytoplasmic microinjection of the DNA sequence ments thereof, the promoter is a mammary gland-specific or wherein introducing the genetically-engineered DNA promoter selected from the group consisting of a WAP sequence comprises combining a mammalian cell stably (whey acidic protein) promoter and a casein promoter (for transfected with the DNA sequence with a non-transgenic secretion into milk) or the promoter is a urinary endothe mammalian embryo. Also preferred is the method wherein lium-specific promoter selected from the group consisting of introducing the genetically-engineered DNA sequence com a uroplakin promoter or a uromodulin promoter (for secre prises the steps of (a) introducing the DNA sequence into a tion into urine). non-human mammalian oocyte; and (b) activating the 0119) The present invention also relates to a recombinant oocyte to develop into an embryo. cell that comprises the isolated polynucleotide of the inven 0.125. In accordance with the foregoing, the present tion, such as where the the cell is a MAC-T (mammary invention also relates to a method for producing a transgenic epithelial) cell or a BHK (baby hamster kidney) cell. In other mammal that upon lactation secretes a fusion protein of the embodiments, the cell is selected from the group of embry invention, in its milk or urine, which method comprises onic stem cells, embryonal carcinoma cells, primordial germ cloning or breeding of a transgenic mammal, the genome of cells, oocytes, or sperm. which comprises a DNA sequence encoding said fusion 0120) The present invention also encompasses a non protein, operably linked to a mammary gland-specific pro human mammalian embryo that comprises a polynucleotide moter or a urinary specific promoter, wherein the sequence of the invention. further comprises a signal sequence that provides secretion 0121 The present invention is also drawn to a non of the fusion protein into the milk or urine of the mammal. human transgenic mammal that upon lactation, expresses in 0.126 The present invention further relates to a method its milk or urine the fusion protein of the invention, prefer for producing a fusion protein of the invention, comprising: ably wherein the BChE is fused to hSA. The mammal is (a) inducing or maintaining lactation or urination of a preferably a mouse or a goat. The genome of said non transgenic mammal, the genome of which comprises a DNA human transgenic mammal preferably comprises a poly sequence encoding said fusion protein, operably linked to a nucleotide of the invention. In preferred embodiments of mammary gland-specific promoter or urinary specific pro Such mammalm, the promoter is a mammary gland-specific moter, wherein the sequence further comprises a signal promoter selected from the group consisting of a WAP sequence that provides secretion of the fusion protein into (whey acidic protein) promoter and a casein promoter (for the milk or urine of the mammal; and (b) extracting milk secretion into milk) or is a urinary endothelium-specific from the lactating mammal or urine from the urinating promoter selected from the group consisting of a uroplakin mammal. In a preferred embodiment thereof, such method promoter or a uromodulin promoter. comprises the additional step of isolating the fusion protein US 2006/0253913 A1 Nov. 9, 2006 from the extracted milk or urine. In further preferred steps, 0132) Mutations can be introduced within a target nucleic the method comprises purifying the fusion protein. The acid sequence by many different standard techniques known present invention also encompasses the milk or urine of said in the art. Site-directed in vitro mutagenesis techniques non-human mammal comprising the fusion protein of the include linker-insertion, nested deletion, linker-Scanning, invention, including where the milk is whole milk or is and oligonucleotide-mediated mutagenesis (as described, defatted milk. for example, in “Molecular Cloning: A Laboratory Manual.” 0127. The present invention further relates to a compo 2nd Edition' Sambrook, et al. Cold Spring Harbor Labora sition comprising a fusion protein of the invention, prefer tory:1989 and “Current Protocols in Molecular Biology” ably where the BChE is linked to hSA, in a pharmaceutically Ausubel, et al., eds. John Wiley & Sons: 1989). Error-prone acceptable carrier. polymerase chain reaction (PCR) can be used to generate libraries of mutated nucleic acid sequences (“Current Pro 0128. The present invention also encompasses a method tocols in Molecular Biology’ Ausubel, et al., eds. John for treating organophosphate poisoning, comprising admin Wiley & Sons: 1989 and Cadwell, et al. PCR Methods and istering to a subject in need thereof a therapeutically effec Applications 1992 2:28-33). Altered BChE-encoding tive amount of a pharmaceutical composition of the inven nucleic acid sequences can also be produced according to tion. The present invention further relates to a method for the the methods of U.S. Pat. No. 5,248,604 to Fischer. Cassette treatment of post-Surgical. Succinyl choline-induced apnea, mutagenesis, in which the specific region to be altered is which comprises administering to a subject in need thereof replaced with a synthetically mutagenized oligonucleotide, a therapeutically effective amount of a pharmaceutical com may also be used Arkin, et al. Proc. Natl. Acad. Sci. USA position of the invention. The present invention further (1992) 89:7811-7815; Oliphant, et al. Gene (1986) 44:177 relates to a method for the treatment of cocaine intoxication, 183; Hermes, et al. Proc. Natl. Acad. Sci. USA (1990) which comprises administering to a subject in need thereof 87:696-700). Alternatively, mutator strains of host cells can a therapeutically effective amount of a pharmaceutical com be employed to increase the mutation frequency of an position of the invention. introduced BChE encoding nucleic acid sequence (Greener, Production of Nucleic Acid Sequences which Encode et al. Strategies in Mol. Biol. (1995) 7:32). Mutant BChE Enzymes Fused to hSA 0.133 Another preferred method for generating and iden 0129. The amino acid sequence of wildtype human BChE tifying mutant nucleic acid sequences encoding mutant is set forth in U.S. Pat. No. 6,001,625 to Broomfield, et al., BChE enzymes relies upon sequence or DNA “shuffling to which is hereby incorporated herein in its entirety. This generate libraries of recombinant nucleic acid sequences patent also discloses a mutant human BChE enzyme in encoding mutant BChE enzymes. The resultant libraries are which the glycine residue at the 117 position has been expressed in a suitable host cell lines and screened for replaced by histidine (identified as G117H). This mutant production of BChE enzymes with desired characteristics. BChE has been shown to be particularly resistant to inacti For example, if a DNA fragment which encodes for a protein Vation by organophosphate compounds Lockridge, et al. with increased binding efficiency to a ligand is desired, the Biochemistry (1997) 36:786-795). Accordingly, this particu BChE enzymes encoded by each of the sequence fragments lar form of the BChE enzyme is especially useful for of library may be tested for their ability to bind to the ligand treatment of pesticide or war gas poisoning. Additional by methods known in the art (i.e. panning, affinity). variants and mutants of BChE enzymes which may be 0.134. According to the “shuffling technique, libraries of produced according the methods of the present invention are recombinant BChE-encoding nucleic acid sequences are disclosed in the U.S. Pat. No. 6,001,625. generated from a population of related-nucleic acid 0130 Several methods are known in the art for introduc sequences that comprise sequence regions having Substan ing mutations within target nucleic acid sequences which tial sequence identity, and which can therefore be homolo may be applied to generate and identify mutant nucleic acid gously recombined in vitro or in vivo. At least two species sequences encoding mutant BChE enzymes. Such mutant of BChE encoding nucleic acid sequences (for example, two BChE enzymes may have altered catalytic properties, tem nucleic acid sequence variants of human BChE) are com perature profile, stability, circulation time, and affinity for bined in a recombination system Suitable for generating a cocaine or other Substrates and/or certain organophosphate sequence-recombined library, where each nucleic acid compounds; increased or decreased formation of BChE sequence insert of the library comprises a combination of a tetramers, dimers or monomers; or other desired features. portion of the first species of BChE-encoding nucleic acid The mutant nucleic acid sequences encoding Such mutant sequence with at least one adjacent portion of another BChE enzymes may be used according to the present species of BChE-encoding nucleic acid sequence. invention. 0.135 The DNA shuffling process for recombination and 0131 The template nucleic acid sequences to be used in mutation is based upon random fragmentation of a pool of any of the described mutagenesis protocols may be obtained related nucleic acid sequences, followed by recombination by amplification using the PCR reaction (U.S. Pat. Nos. of the fragments by primeness PCR in vitro or homologous 4,683.202 and 4,683,195) or other amplification or cloning recombination in vivo. The recombined products preferably methods. The described techniques can be used to generate contain a portion of each of the related nucleic acid a wide variatey of nucleic acid sequence alterations includ sequences. The variant nucleic acid sequence species used ing point mutations, deletions, insertions, inversions, and are fragmented by nuclease digestion, partial extension PCR recombination of sequences not linked in nature. Note that amplification, PCR Stuttering, or other Suitable fragmenting in all cases sequential cycles of mutation and selection may means. The resultant fragment may be recombined by PCR be performed to further alter a mutant BChE enzyme in vitro. Alternatively, the variant nucleic acid sequence encoded by a mutant nucleic acid sequence. species may be recombined in vivo. Preferably, combina US 2006/0253913 A1 Nov. 9, 2006 tions of in vitro and in vivo shuffling are performed. In one apnea following Surgery in which Succinyl choline is admin embodiment, the first plurality of selected library members istered. High frequency of atypical and silent BChE genes is generated by a) in vitro fragmentation of variant nucleic has been reported among Iraqui and Iranian Jews (11.3% for acids sequence species, b) introduction of the resultant heterozygotes and 0.08% for homozygotes). This could fragments into a host cell or organism, and c) in vivo explain the high frequency of reports of prolonged apnea homologous recombination of the fragments to form following Surgery in Israel and apparently in many other “shuffled” library members. other countries. Accordingly, a recombinant BChE may 0136. According to the invention, the variant nucleic acid administered to patients harboring these, or similar muta sequences which may be "shuffled to create and identify tions, to alleviate or prevent prolonged post-Surgical apnea. advantageous novel BChE-encoding nucleic acid sequences 0140 FIG. 2 depicts the amino acid sequence of the include, but are not limited to, nucleic acid sequences which mature wild-type human BChE enzyme and locations of encode taxonomically-related, structurally-related, and/or altered residues in some BChE variants. functionally-related enzymes and/or mutated variants thereof. The taxonomically-related sequences may comprise Assembly of Expression Constructs naturally occuring homologous nucleic acid sequences rep 0.141. The recombinant DNA methods employed in prac resenting homologous genes from different species, homolo ticing the present invention are standard procedures, well gous genes from the same species, or allelic variants of the known to those skilled in the art (as described, for example, same gene within a species. In this aspect, at least two in “Molecular Cloning: A Laboratory Manual. 2nd Edition. naturally-occurring genes and/or allelic variants which com Sambrook, et al. Cold Spring Harbor Laboratory: 1989, “A prise regions of at least 50 consecutive nucleotides which Practical Guide to Molecular Cloning Perbal: 1984, and have at least 70 percent sequence identity, preferably at least “Current Protocols in Molecular Biology’ Ausubel, et al., 90 percent sequence identity, are selected from a pool of eds. John Wiley & Sons: 1989). These standard molecular gene sequences, such as by hybrid selection or via comput biology techniques can be used to prepare the expression erized sequence analysis using sequence data from a data constructs of the invention. base. The selected sequences are obtained as isolated nucleic acid sequences, either by cloning or via DNA synthesis, and TABLE 1. shuffled by any of the various embodiments of the invention. Structural Basis of Phenotype of Human BChE Variants Naturally Occuring Variants of BChE 0137 The BChE gene has four predominant allelic forms Variant Effect of Mutation Phenotype Alteration in humans, although 25 other forms responsible for various Atypical D70G. Resistance to dibucaine inhibition BChE genetic deficiencies are known (See Table 1 below, Fluoride-resistant T243M Resistance to fluoride reproduced from the website of the American Society of inhibition Anesthesiologists, and FIG. 2). The four predominant allelic Fluoride-resistant G390V. Resistance to fluoride forms are designated Eu, Ea, Ef, and Es. Eu is the wildtype, inhibition K-variant AS39T Activity reduced by 30% fully functional allele and carries the phenotype designation J-variant E497V Activity reduced by 70% EuEu or UU. The Ea allele is referred to as atypical BChE. H-variant W142M Activity reduced by 90% Phenotypically, the Sera of persons homozygous for this Sc-variant A184V decreased affinity for gene (EaEa=AA) are only weakly active towards most Succinylcholine Silent-1 Frameshift at codon 117 No activity substrates for ChE and show increased resistance to inhibi Silent-2 Frameshift at codon 6 No activity tion of enzyme activity by dibucaine. The Efallele also gives Silent-3 Stop codon at codon 500 No activity rise to a weakly active enzyme, but exhibits increased Silent-4 P37S No activity Silent-5 G36SR Trace activity resistance to fluoride inhibition. The Es gene (s for silent) is Silent-6 Frameshift at codon 315 No activity associated with absence of enzyme. Silent-8 W471R Trace activity Silent-9 D17OE No activity 0138. The mutations in the Ea and Ef gene products cause Silent-10 Q518L Trace activity structural alterations in the active, site of the BChE enzyme Silent-11 S198G No activity resulting in less effective catalysis compared to the native Silent-12 insertion of Alu element No activity (Eu) allele. Experimentally, these mutations result in the at codon 355 Silent-13 Altered splicing of intron 2 No activity reduction in the binding affinity (increased Kim) of competi Silent-14 L125F Trace activity tive substrates. Clinically, the phenotypes that are most Silent-16 A201T No activity Susceptible to prolonged Succinylcholine-induced apnea are Silent-17 Y33C No activity M, SS, FF, FS, AS, AF, and UA. Silent-18 Stop codon at codon 271 No activity Silent-19 F418S Trace activity 0139 Certain individuals carry an atypical BChE gene Silent-20 R515C Trace activity which functions normally to hydrolyze acetylcholine, but is Silent-21 Stop codon at codon 465 No activity unable to hydrolyze Succinylcholine, a commonly used Unstable G115D Low, unstable activity anesthetic. The most common variant with this problem is *Numbers represent residue position in the mature wild-type human BChE the atypical variant Es, for which 3-6% of the Caucasian enzyme, once the signal peptide has been cleaved. population is heterozygous and about 0.05% is homozygous. Another variant, E1, causes the complete absence of cata 0.142 Expression constructs comprise elements neces lytically active serum BChE in homozygotes. This type of sary for proper transcription and translation of a target “silent enzyme cannot hydrolyze any ChE substrate, nor nucleic acid sequence within the chosen host cells, including can it bind organophosphate compounds. Individuals carry a promoter, a signal sequence to provide secretion of the ing atypical or silent BChE genes are Subject to prolonged translated product, and a polyadenylation signal. Such US 2006/0253913 A1 Nov. 9, 2006 expression constructs may also contain intronic sequences or 489; Lee, et al. Nucleic Acids Res. (1988) 16:1027-1041). untranslated cDNA sequences intended to improve tran kappa.-casein Baranyi, et al. Gene (1996) 174(1):27-34; scription efficiency, translation efficiency, and/or mRNA Gutierrez, et al. Transgenic Research (1996) 5(4): 271-279). stability. The nucleic acid sequence intended for expression B-lactoglobin McClenaghan, et al. Biochem J (1995) may possess its endogenous 3' untranslated sequence and/or 310(Pt2):637-641), and C-lactalbumin Vilotte, et al. Eur. J. polyadenylation signal or contain an exogenous 3' untrans Biochem. (1989) 186: 43–48; PCT publication No. WO88/ lated sequence and/or polyadenylation signal. For example 01648). the promoter, signal sequence, and 3' intranslated sequence and polyandenylation signal of casein may be used to 0.148. For specific expression in the urinary endothelium mediate expression of a nucleic acid sequence encoding of transgenic animals, the promoter sequences may be BChE-hSA fusion protein within mammary host cells. derived from a mammalian urinary endothelium-specific Codon selection, where the target nucleic acid sequence of gene. Examples of Suitable urinary endothelium-specific the construct is engineered or chosen so as to contain codons promoters include the uroplakin II promoter Kerr, et al. preferentially used within the desired host cell, may be used Nature Biotechnology (1998) 16(1):75-79), and the uro to minimize premature translation termination and thereby modulin promoter Zbikowska, et al. Biochem J. (2002) maximize expression. 365(Ptl):7-1 1: Zbikowska, et al. Transgenic Res 2002 11(4):425-435). 0143. The inserted nucleic acid sequence may also encode an epitope tag for easy identification and purification B. Intron Inclusion of the encoded polypeptide. Preferred epitope tags include 0.149 Nucleic acid sequences containing an intronic myc, His, and FLAG epitope tags. The encoded epitope tag sequences (e.g., genomic sequences) may be expressed at may include recognition sites for site-specific proteolysis or higher levels than intron-less sequences. Hence, inclusion of chemical agent cleavage to faciliate removal of the epitope intronic sequences between the transcription initiation site tag following protein purification. For example a thrombin and the translational start codon, 3' to the translational stop cleavage site could be incorporated between the recombi codon, or inside the coding region of the BChE-hSA fusion nant BChE-hSA fusion protein and its epitope tag. Epitope protein-encoding nucleic acid sequence may result in a tags may fused to the N-terminal end or the C-terminal end higher level of expression. of a recombinant BChE-hSA fusion protein. Preferrably, the 0150. Such intronic sequences include a 5' splice site epitope tag is fused to the C-terminal end of a recombinant (donor site) and a 3' splice site (acceptor site), separated by BChE: such C-terminal fusion proteins are expected to at least 100 base pairs of non-coding sequence. These maintain cataytic activity and to retain the ability to oligo intronic sequences may be derived from the genomic merize. sequence of the gene whose promoter is being used to drive 0144. The expression constructs of the invention which BChE expression, from a native BChE gene, or another provide expression of a BChE-hSA fusion protein in the Suitable gene. Such intronic sequences should be chosen So desired host cells may include one or more of the following as to minimize the presence of repetitive sequences within basic components: the expression construct, as such repetitive sequences may encourage recombination and thereby promote instability of A. Promoter the construct. Preferrably, these introns can be positioned 0145 These sequences may be endogenous or heterolo within the BChE-encoding nucleic acid sequence so as to gous to the host cell to be modified, and may provide approximate the intron/exon structure of the native human ubiquitous (i.e., expression occurs in the absence of an BChE gene. apparent external stimulus and is not cell-type specific) or C. Signal Sequences tissue-specific (also known as cell-type specific) expression. 0151 Each expression construct will additionally com 0146 Promoter sequences for ubiquitous expression may prise a signal sequence to provide secretion of the translated include synthetic and natural viral sequences e.g., human recombinant BChE from the host cells of interest (e.g., cytomegalovirus immediate early promoter (CMV); simian mammary or uroepithelial cells, or mammalian cell culture). virus 40 early promoter (SV40); Rous sarcoma virus (RSV): Such signal sequences are naturally present in genes whose or adenovirus major late promoter which confer a strong protein products are normally secreted secreted. The signal level of transcription of the nucleic acid molecule to which sequences to be employed in the invention may be derived they are operably linked. The promoter can also be modified from a BChE gene, from a gene specifically expressed in the by the deletion and/or addition of sequences, such as host cell of interest (e.g., casein or uroplakin gene), or from enhancers (e.g., a CMV, SV40, or RSV enhancer), or tandem another gene whose protein product is known to be secreted repeats of Such sequences. The addition of strong enhancer (e.g., from hSA, alkaline phosphatase, mellitin, the immu elements may increase transcription by 10-100 fold. noglobulin light chain protein Ig.kappa., and CD33); or may 0147 For specific expression in the mammary tissue of be synthetically derived. transgenic animals, the promoter sequences may be derived from a mammalian mammary-specific gene. Examples of D. Termination Region Suitable mammary-specific promoters include: the whey 0152 Each expression construct will additionally com acidic protein (WAP) promoter U.S. Pat. Nos. 5,831,141 prise a nucleic acid sequence which contains a transcription and 6,268,545, Andres, et al. Proc Natl AcadSci USA (1987) termination and polyandenylation sequence. Such sequences 84(5):1299-1303), C-S1-casein U.S. Pat. Nos. 5,750,172 will be linked to the 3' end of the BChE-hSA fusion and 6,013,857, PCT publication Nos. WO91/08216 and protein-encoding nucleic acid sequence. These sequences WO93/25567), CS2-casein, B-casein U.S. Pat. No. 5,304, may comprise the 3'-end and polyadenylation signal from US 2006/0253913 A1 Nov. 9, 2006
the gene whose 5'-promoter region is driving BChE-hSA nucleic acid molecule encoding an antibiotic-resistance pro fusion protein expression (e.g., the 3' end of the goat tein (e.g., an amplicillin-resistance protein) used for selection B-casein gene). Alternatively, such sequences will be of transformed prokaryotic cells. derived from genes in which the sequences have been shown to regulate post-transcriptional mRNA stability (e.g., those 0157. In another variant of this method, the restriction derived from the bovine growth hormone gene, the B-globin digested expression construct fragment used to transfect a host cell will include a BChE-hSA fusion protein-encoding genes, or the SV40 early region). sequence, 5' and 3' regulatory sequences, and any flanking E) Other Features of the Expression Constructs insulators or MARS, linked to a nucleic acid sequence 0153. The BChE-hSA fusion protein-encoding nucleic encoding a protein capable of conferring resistance to a acid sequences of interest may be modified in their 5' or 3' antibiotic useful for selection of transfected eukaryotic cells untranslated regions (UTRS), and/or in regions coding for (e.g., neomycin or puromycin). the N-terminus of the BChE enzyme so as to preferentially Generation of Transfected Cell Lines. In Vitro improve expression. Sequences within the BChE-hSA fusion protein-encoding nucleic acid sequence may be 0158. The expression constructs of the invention may be deleted or mutated so as to increase secretion and/or avoid transfected into host cells in vitro. Preferred in vitro host retention of the BChE enzyme product within the cell, as cells are mammalian cell lines including BHK, MDCK, regulated, for example, by the presence of endoplasmic Hu609, MAC-T (U.S. Pat. No. 5,227,301), R1 embryonic reticulum retention signals or other sorting inhibitory sig stem cells, embryonal carcinoma cells, COS, or HeLa cells. nals. Protocols for in vitro culture of mammalian cells are well established in the art see for example, Animal Cell Culture: 0154) In addition, the expression constructs may contain A Practical Approach 3rd Edition. J. Masters, ed. Oxford appropriate sequences located 5' and/or 3' of the BChE-hSA University Press and Basic Cell Culture 2nd Edition. Davis, fusion protein-encoding nucleic acid sequences that will J. M. ed. Oxford University Press (2002). Techniques for provide enhanced integration rates in transduced host cells transfection are well established in the art and may include e.g., ITR sequences as per Lebkowski, et al. Mol. Cell. Biol. electroporation, microinjection, liposome-mediated trans (1988) 8:3988-3996). Furthermore, the expression construct fection, calcium phosphate-mediated transfection, or virus may contain nucleic acid sequences that possess chromatin mediated transfection see for example, Artificial self-as opening or insulator activity and thereby confer reproducible sembling systems for gene delivery. Feigner, et al., eds. activation of tissue-specific expression of a linked transgene. Oxford University Press (1996); Lebkowski, et al. Mol Cell Such sequences include Matrix Attachment Regions Biol 1988 8(10):3988-3996; “Molecular Cloning: A Labo (MARs) McKnight, et al. Mol Reprod Dev (1996) ratory Manual. 2nd edition. Sambrook, et al. Cold Spring 44(2): 179-184 and McKnight, et al. Proc Natl AcadSci USA Harbor Laboratory: 1989; and “Current Protocols in (1992) 89:6943-6947). See also Ellis, et al., PCT publication Molecular Biology’ Ausubel, et al., eds. John Wiley & Sons: No.: WO95/33841 and Chung and Felsenfield, PCT publi 1989). Where stable transfection of the host cell lines is cation No.: WO96/04390. desired, the introduced DNA preferably comprises linear 0155 The expression contructs further comprise vector expression construct DNA, free of vector sequences, as sequences which facilitate the cloning and propagation of prepared from the expression constructs of the invention. the expression constructs. Standard vectors useful in the Transfected in vitro cell lines may be screened for integra current invention are well known in the art and include (but tion and copy number of the expression construct. For Such are not limited to) plasmids, cosmids, phage vectors, viral screening, the genomic DNA of a cell line is prepared and vectors, and yeast artificial chromosomes. The vector analyzed by PCR and/or Southern blot. sequences may contain a replication origin for propagation in E. coli: the SV40 origin of replication; an ampicillin, 0159 Transiently and stably transfected cell lines may be used to evaluate the expression contructs of the invention as neomycin, or puromycin resistance gene for selection in host detailed below, and to isolate recombinant BChE-hSA cells; and/or genes (e.g., dihydrofolate reductase gene) that fusion protein and/or glysosyltransferase proteins. Where amplify the dominant selectable marker plus the gene of the expression construct comprises a ubiquitous promoter interest. Prolonged expression of the encoded BChE-hSA any of a number of established mammalian cell culture lines fusion protein in in vitro cell culture may be achieved by the may be transfected. Where the expression construct com use of vectors sequences that allow for autonomous repli prises a tissue-specific promoter, the host cell line should be cation of an extrachromosomal construct in mammalian host compatible with the tissue specific promoter (e.g., uromodu cells (e.g., EBNA-1 and oriP from the Epstein-Barr virus). lin promoter containing expression constructs may be trans 0156 The expression constructs used for the generation fected into baby hamster kidney BHK cells). of transgenic animals may be linearized by restriction endo nuclease digestion prior to introduction into a host cell. In a 0.160 Stably transfected cell lines may be also used to variant of this method, the vector sequences are removed generate transgenic animals. For this use, the recombinant prior to introduction into host cells, such that the introduced proteins need not be expressed in the in vitro cell line. linearized fragment is comprised solely of the BChE-hSA fusion protein-encoding sequence, 5'-end regulatory Evaluation of Expression Constructs sequences (e.g., the promoter), and 3'-end regulatory 0.161 Prior to the generation of transgenic animals using sequences (e.g., the 3' transcription termination and poly the expression constructs of the invention, expression con andenylation sequences), and any flanking insulators or struct functionality can be determined using transfected in MARs. A cell transformed with such a fragment will not vitro cell culture systems. Genetic stability of the expression contain, for example, an E. coli origin or replication or a constructs, degree of secretion of the recombinant protein(s), US 2006/0253913 A1 Nov. 9, 2006
and physical and functional attributes of the recombinant coelic cavity of a non-transgenic blastocyst-stage embryo. protein(s) can be evaluated prior to the generation of trans The aggregated or injected embryos are then transferred to genic animals. a pseudopregnant recipient female for gestation and birth of 0162. Where the expression construct comprises a ubiq chimeras. Chimeric animals in which the transgenic host uitous promoter any of a number of established mammalian cells have contibuted to the germ line may be used in cell culture lines may be transfected. Where the expression breeding schemes to generate non-chimeric offspring which construct(s) comprises mammary gland or urinary endothe are wholly transgenic. lium-specific promoters, mammary epithelium and bladder 0166 In an alternative protocol, such stably transfected cell lines can be transfected. For example, the hamster host cells may be used as nucleus donors for nuclear transfer kidney cell line BHK-21 (C-13) (ATCC #CC1-10) Sikri, et into recipient oocytes (as per Wilmut, et al. Nature (1997) al. Biochem. J. (1985) 225:481-486 and the dog kidney cell 385: 810-813). For nuclear transfer, the stably transfected line MDCK (ATCC #CCL-34) can be used to test the host cells need not be pluripotent or totipotent. Thus, for functionality of uromodulin promoter containing expression example, stably transfected fetal fibroblasts can be used constructs. The human urothelium cell line Hu609 Stacey, e.g., Cibelli, et al. Science (1998) 280: 1256-8 and Keefer, et al. Mol. Carcinog. (1990) 3:216-225 may used to test the et al. Biology of Reproduction (2001) 64:849-856). The functionality of uroplakin promoter containing expression recipient oocytes are preferrably enucleated prior to transfer. COnStructS. Following nuclear transfer, the oocyte is transferred to a pseudopregnant recipient female for gestation and birth. 0163 To determine if cell lines transfected with the BChE-hSA fusion protein-encoding expression constructs of Such offspring will be wholly transgenic (that is, not chi the invention are producing recombinant BChE-hSA fusion meric). protein, the media from transfected cell cultures can be 0.167 In another alternative protocol, transgenic animals tested directly for the presence of the secreted protein by are generated by direct introduction of expression construct Western blotting analysis using anti-BChE antibody (Mon DNA into a recipient oocyte, Zygote, or embryo. Such direct Santo, St. Louis, Mo.) or assessed using an activity assay introduction may be achieved by pronuclear microinjection Ellman, et al. Biochem. Pharmacol. (1.961) 7:88-95). Wang, et al. Molecular Reproduction and Development Where a cell lines is stably transfected and has been shown (2002) 63:437-443), cytoplasmic microinjection Page, et al. to produce catalytically active recombinant protein, the cell Transgenic Res (1995) 4(6):353-360), retroviral infection lines may be used for large scale culture and purification of e.g., Lebkowski, et al. Mol Cell Biol (1988) 8(10):3988 the recombinant protein. Such cell lines may also be used in 3.996, or electroporation (“Molecular Cloning: A Labora the generation of transgenic animals. tory Manual. Second Edition” by Sambrook, et al. Cold Spring Harbor Laboratory: 1989). Generation of Transgenic Mammals 0168 For microinjection and electroporation protocols, 0164 Protocols for the generation of non-human trans the introduced DNA should comprise linear expression genic mammals are well established in the art see, for construct DNA, free of vector sequences, as prepared from example, Transgenesis Techniques Murphy, et al., Eds. the expression constructs of the invention. Following DNA Human Press, Totowa, N.J. (1993); Genetic Engineering of introduction and any necessary in vitro culture, the oocyte, Animals A. Puhler, Ed. VCH Verlagsgesellschaft, Wein Zygote, or embryo is transferred to a pseudopregnant recipi heim, N.Y. (1993); and Transgenic Animals in Agriculture ent female for gestation and birth. Such offspring may or Murray, et al., eds. Oxford University Press. For example, may not be chimeric, depending on the timing and efficiency efficient protocols are available for the production of trans of transgene integration. For example, if a single cell of a genic mice Manipulating the Mouse Embryo 2nd Edition two-cell stage embryo is microinjected, the resultant animal Hogan, et al. Cold Spring Harbor Press (1994) and Mouse will most likely be chimeric. Genetics and Transgenics: A Practical Approach. Jackson and Abbott, eds. Oxford University Press (2000), transgenic 0169 Transgenic animals comprising two or more inde cows (U.S. Pat. No. 5,633,076), transgenic pigs (U.S. Pat. pendent transgenes can be made by introducing two or more No. 6,271.436), and transgenic goats (U.S. Pat. No. 5,907. different expression constructs into host cells using any of 080). Preferred examples of such protocols are summarized the above described methods. below. It will be appreciated that these examples are not 0170 The presence of the transgene in the genomic DNA intended to be limiting, and that transgenic non-human of an animal, tissue, or cell of interest, as well as transgene mammals comprising the expression constructs of the inven copy number, may be confirmed by techniques well known tion, as created by these or other protocols, necessarily fall in the art, including hybridization and PCR techniques. within the scope of the invention. 0171 Some of the transgensis protocols result in the 0.165 Transgenic animals may be generated using stably production of chimeric animals. Chimeric animals in which transfected host cells derived from in vitro transfection. the transgenic host cells have contributed to the tissue-type Where said host cells are pluripotent or totipotent, such cells wherein the promoter of the expression construct is active may be used in morula aggregation or blastocyst injection (e.g., mammary gland for WAP promoter) may be used to protocols to generate chimeric animals. Preferred pluripo characterize or isolate recombinant BChE-hSA fusion pro tent/totipotent stably transfected host cells include pri tein and/or glucosyltransferase enzymes. More preferably, moridal germ cells, embryonic stem cells, and embryonal where the transgenic host cells have contibuted to the germ carcinoma cells. In a morula aggregation protocol, stably line, chimeras may be used in breeding schemes to generate transfected host cells are aggregated with non-transgenic non-chimeric offspring which are wholly transgenic. morula-stage embryos. In a blastocyst injection protocol, 0172 Wholly transgenic offspring, whether generated stably transfected host cells are introduced into the blasto directly by a transgensis protocol or by breeding of a US 2006/0253913 A1 Nov. 9, 2006
chimeric animals, may be used for breeding purposes to Ellman (Ellman, et al. Biochem Pharmacol (1961) 7:88). maintain the transgenic line and to characterize or isolate Levels of BChE activity can be estimated by staining recombinant BChE-hSA fusion protein and/or glucosyl non-denaturing 4-30% polyacrylamide gradient gels with 2 transferase enzymes. Where transgene expression is driven mM echothiophate iodide as substrate (as described in by a urinary endothelium-specific promoter, urine of trans Lockridge, et al. Biochemistry (1997) 36:786-795), where genic animals may be collected for purification and charac this method is a modification of the same assays using 2 mM terization of recombinant enzymes. Where transgene expres butrylythiocholine as substrate (from Karnovsky and Roots, sion is driven by a mammary gland-specific promoter, J Histochem Cytochem (1964) 12:219). Using these meth lactation of the transgenic animals may be induced or ods, the catalytic properties of a BChE-hSA fusion protein, maintained, where the resultant milk may be collected for including Kim, Vmax, and kcat values, may be determined purification and characterization of recombinant enzymes. using butyrylthiocholine or acetylthiocholine as Substrate. For female transgenics, lactation may be induced by preg Other methodologies known in the art can also be used to nancy or by administration of hormones. For male trans assess ChE function, including electrometry, spectropho genics, lactation may be induced by administration of hor tometry, chromatography, and radiometric methodologies. mones (see for example Ebert, et al. Biotechnology (1994) 0177) Purified recombinant BChE-hSA fusion protein 12:699-702). Lactation is maintained by continued collec may be separated on Sephacryl S-300. Relative amounts of tion of milk from a lactating transgenic. BChE-hSA fusion protein can also be estimated by staining Purification of Recombinant BChE-hSA Fusion Protein non-denaturing 4-30% polyacrylamide gradient gels with 2 mM echothiophate iodide as substrate (as described in 0173 Recombinant BChE-hSA fusion protein may be Lockridge, et al. Biochemistry (1997) 36:786-795). A panel isolated from the culture medium of BChE-hSA fusion of monoclonal antibodies may be used to characterize the protein-secreting transfected cells in vitro, from the milk of functional domains of the recombinant BChE-hSA fusion transgenic animals expressing BChE-hSA fusion protein in protein. mammary gland, or from the urine of transgenic animals expressing BChE-hSA fusion protein in urinary endothelium 0.178 A competitive enzyme-linked immunosorbent using a procainamide affinity chromatography protocol (as assay (ELISA) may be used to quantitate the concentration described in Lockridge, et al. Biochemistry (1997) 36:786 of BChE-hSA fusion protein in a sample. This assay is based 795). For purification from culture medium, the medium is in a poly-clonal rabbit anti-human BChE antibody coupled centrifuged or filtered to remove cellular debris prior to to biotin, where binding of the biotinylated antibody to application to the procainamide column. The medium may immobilized BChE antigen is competitively inhibited by an also be concentrated by ultrafiltration. For purification from added standard or the test sample. The amount of label milk, tangential flow filtration clarification may be used to bound antibody is inversely related to the concentration of remove caseins and fat prior to application to the procaina BChE in the test sample. mide column. For purification from urine, the urine is first 0179 The recombinant BChE-hSA fusion protein may be centrifuged to remove cell debris. Then the urine is diluted further characterized by standard techniques well known in to reduce salt concentration, as measured by conductivity. the art, including N-terminal sequencing, determination of The resulting solution is then applied to the column. carbohydrate content (especially terminal sialic acid con 0174) To provide enhanced purity of recombinant BChE tent), tryptic and carbohydrate mapping, and determination hSA fusion protein, additional steps such as blue Sephasose of in vitro stability. For example, the composition, distribu CL-6B chromatography or ion exchange chromatography in tion, and structure of monosaccharide and oligosaccharide combination with ammonium Sulfate fractionation may be moieties of the recombinant BChE-hSA fusion protein may performed. Enzyme purity may be evaluated by reverse be analyzed as described in Saxena, et al. Biochemistry phase HPLC. Purified recombinant BChE-hSA fusion pro (1997) 36:7481-7489. tein may be further separated on Sephacryl S-300. 0180 Potential clinical effectiveness of a recombinant BChE-hSA fusion protein sample against organophosphate Assays to Characterize BChE-hSA Fusion Protein poisoning or cocaine toxicity can be assessed both in vitro 0175. The assays described here may be used to charac and in vivo. For example, in vitro OPAH activities of the terize variant BChE-hSA fusion proteins as produced by the potential Substrates Soman, Sarin and tabun can be measured described mutagenesis protocols prior to expression con in a pH stat using a solution of the test recombinant struct assembly, and/or to characterize recombinant BChE BChE-hSA fusion protein. The activity of recombinant hSA fusion protein collected from culture medium of trans BChE-hSA fusion protein against VX and echothiophate can fected cells or from the milk or urine of transgenic animals. be measured in a microtitre plate using a variation of the These assays allow for characterization of BChE-hSA fusion Ellman method, with the OP compound replacing the protein activity, stability, structural characteristics, and in butyrylthioline as substrate. Enzyme-catalyzed hydrolysis of vivo function. cocaine can be recorded on a temperature-equilibrated Gil 0176 Various methods for in vitro BChE enzymatic ford Spectrophotometer at 240 nm (Xie, et al. Mol. Phar activity assays are described in the art (for example, Lock macol. 1999 55:83-91). ridge and La Du, J Biol Chem (1978) 253:361-366: Lock 0181. The in vivo half life and protective effect versus ridge, et al. Biochemistry (1997) 36:786-795: Plattborze and organophosphate poisoning of a recombinant BChE-hSA Broomfield, Biotechnol. Appl. Biochem. (2000) 31:226 fusion protein sample may be assessed in animal models, 229; and Blong, et al. Biochem J (1997) 327:747-757). Such as rodents or primates (for example as in Raveh, et al. Samples can be tested for the presence of enzymatically Toxicol. Applied Pharm. (1997) 145:43-53; Broomfield, et active recombinant BChE by using the activity assay of al. J Pharmacol Exp Ther (1991) 259:633-638: Brandeis, et US 2006/0253913 A1 Nov. 9, 2006
al. Pharmacol Biochem Behav (1993) 46:889-896; Ashani, isofenfos (Oftanol, Amaze), malathion (Cythion), methami et al Biochem Pharmacol (1991) 41:37-41; and Rosenberg, dophos (Monitor), methidathion (Supracide), methyl par et al. Life Sciences (2002) 72:125-134). Peak blood BChE athion, mevinphos (Phosdrin), monocrotophos, naled level may be determined following intramuscular injection (Dibrom), oxydemeton-methyl (Meta systox-R), parathion of recombinant BChE-hSA fusion protein as described in (Niran, Phoskil), phorate (Thimet), phosalone (Zolonc), Raveh, et al. Biochem Pharmacol (1993) 45(12):2465. Simi phosmet (Irnidan, Prolate), phosphamidon (Dimecron), larly, the in vivo halflife and protective effect versus cocaine temephos (Abate), TEPP, terbufos (Counter), tetrachlorvin toxicity of a recombinant BChE-hSA fusion protein sample phos (Rabon, Ravap), and trichlorfon (Dylox, Neguvon). may be assessed in animal models (for example, as in 0185. Commonly used carbamate pesticides include aldi Hoffman, et al. J. Toxicol Clin Toxicol (1996) 34:259-266 carb (Temik), bendiocarb (Ficam), bufencarb, carbaryl and Lynch et al Toxicol Appl Pharmacol (1997) 145:363 (Sevin), carbofuran (Furadan), formetanate (Carzol), 371). methiocarb (Mesurol), methomyl (Lannate, Nudrin), 0182 Once the in vivo stability and efficacy of a recom oxamyl (Vydate), pirimicarb (pinmicarb, Pirimor) and pro binant BChE-hSA fusion protein preparation has been veri poXur (Baygon). fied in animal models, such preparations may be used for the 0186 The present invention encompasses a method for treatment of various conditions, including organophopSate the treatment of organophosphate poisoning comprising, poisoning, post-Surgical Succinyl-choline induced apnea, or administering to a subject in need thereof a therapeutically cocaine intoxication. effective amount of recombiant BChE-hSA fusion protein. Treatment of Organophosphate Poisoning and Other Con The invention includes treatment of and amelioration of the ditions symptoms resulting from exposure to organophosphate compounds, as well as methods of preventing symptoms of 0183 Exposure to organophosphate compounds can exposure to these compounds. Such methods involve admin result in a wide variety of symptoms depending on the istering to a subject an amount of recombinant BChE-hSA toxicity of the compound, the amount of compound involved fusion protein effective to protect against these symptoms, in the exposure, the route of exposure, and the duration of prior to exposure of the Subject to an organophosphate the exposure. In mild cases, symptoms such as tiredness, compound. weakness, dizziness, runny nose, bronchial Secretions, nau sea, and blurred vision may appear. In moderate cases, 0187. The invention is also directed to methods for symptoms may include tightness in the chest, headache, treating post-Surgical. Succinyl choline-induced apnea, and Sweating, tearing, drooling, excessive perspiration, vomit cocaine intoxication. These methods comprise administra ing, tunnel vision, and muscle twitching. In severe cases, tion to a Subject Suffering from post-Surgical. Succinyl symptoms include abdominal cramps, involuntary urination choline-induced apnea or cocaine intoxication an effective and diarrhea, muscular tremors, convulsions, staggering amount of recombinant BChE-hSA fusion protein. gait, pinpoint pupils, hypotension (abnormally low blood pressure), slow heartbeat, breathing difficulty, coma, and EXAMPLES possibly death. Severe cases of organophosphate poisoning Example 1 are observed after continued daily absorption of organo phosphate pesticides, or from exposure to the most toxic Production of Recombinant BChE in Cell Culture organophosphate compounds used as chemical warfare agents. When symptoms of organophosphate poisoning first 1.1 Assembly of Expression Constructs appear, it is generally not possible to tell whether a poison 0188 Standard recombinant DNA methods employed ing will be mild or severe. In many instances, when the skin herein have been described in detail (see, for example, in is contaminated, symptoms can quickly go from mild to “Molecular Cloning: A Laboratory Manual. 2nd Edition. severe even though the area is washed. Some of the most Sambrook, et al. Cold Spring Harbor Laboratory:1989, “A toxic organophosphate compounds are those used as war Practical Guide to Molecular Cloning Perbal: 1984, and gases. These compounds include tabun (GA), methyl par “Current Protocols in Molecular Biology’ Ausubel, et al., athion, sarin (GB). VX, soman (GD), diisopropylfluoro eds. John Wiley & Sons: 1989). All DNA cloning manipu phosphate, and PB. These compounds are easily absorbed lations were performed using E. coli STBII competent cells through the skin, and may be inhaled or ingested. The (Canadian Life Science, Burlington, Canada). Restriction symptoms of nerve gas poisoning are usually similar, and modifying enzymes were purchased from New England regardless of the route of introduction. BioLabs (Mississauga, ON, Canada). All chemicals used 0184 Some of the most commonly used organophos were reagent grade and purchased from Sigma Chemical Co phate pesticides include acephate (Orthene), Aspon, azin (St. Louis, Mo.), and all solutions were prepared with sterile phos-methyl (Guthion), carbofuran (Furadan, F formulal and nuclease-free WFI water (Hyclone, Tex.). Construct tion), carbophenothion (Trithion), chlorfenvinphos integrity was verified by DNA sequencing analysis provided (Birlane), chlorpyrifos (Dursban, Lorsban), coumaphos (Co by McMaster University (Hamilton, ON, Canada). Primers Ral), crotoxyphos (Ciodrin, Ciovap), crufomate (Ruelene), were synthesized by Sigma Genosys (Oakville, ON, demeton (Systox), diazinon (Spectracide), dichlorvos Canada). PCR was performed using Ready-To-Go PCR (DDVP. Vapona), dicrotophos (Bidrin), dimethoate (Cygon, beads (Pharmacia Biotech, Baie d'Urf, PQ. Canada) or the De-Fend), dioxathion (Delnav), disulfoton (Di-Syston), High Fidelity PCR kit (Roche Diagnostics Canada, Laval, EPN, ethion, ethoprop (Mocap), famphur, fenamiphos Canada). (Nemacur), fenitrothion (Sumithion), fensulfothion 0189 In the expression contructs for the expression of (Dasanit), fenthion (Baytex, Tiguvon), fonofos (Dyfonate), recombinant BChE in in vitro cell culture, a sequence US 2006/0253913 A1 Nov. 9, 2006 20 encoding human BChE was under the transcriptional control from the hSA cDNA 5' end (Genbank V00495, without the of a strong constitutive promoter and was linked to a signal signal sequence), and an antisense primer Acb855 (5' ATT sequence to provide secretion of the recombinant protein TAAGTTTAAACT CAT TATAAG CCTAAG GCA GCT from the cells. TGA CTT GC 3') (SEQ ID NO: 8) including a Pmel site (underlined) and partial sequence from the hSA cDNA 3’ pCMV/IgKBChE end. This PCR product was digested with BamHI and PmeI 0190. The human BChE cDNA was PCR amplified from and inserted into BamHI and PmeI digested pCMV/ a cDNA clone (ATCC #65726), with a sense primer Acb787 BChEmd to generate the final construct, pCMV/BChE/hSA. (5' AGAGAG. GGG GCC CAAGAAGAT GAC ATCATA This expression construct encodes a BChE-hSA fusion pro ATT G 3') (SEQ ID NO: 3) containing an Apal site (under tein. lined) and a partial immunoglobulin kappa (Igkappa.) signal sequence, and an antisense primer Acb786 (5' CTG CGA 1.2. Transfection and Selection of Stable Cell Lines. GTTTAAACTATTAATTAGAGACCCACAC3") (SEQ Preparation of Expression Constructs for Transfection: ID NO: 4) including a PmeI site (underlined) and partial 3' 0196) The constructs pCMV/IgKBChE and pCMV/ sequence of the human BChE cDNA. The PCR product was BChE/hSA were digested with FspI, and the resultant FspI digested with Apal and PmeI, purified using GFX matrix digested linear DNA, was prepared and used for transfec (Pharmacia Biotech, Baie d'Urf.PQ, Canada) and ligated tion. Briefly, circular expression construct DNA was purified into Apal and PmeI digested pSecTag/MaSpI to generate by the cesium chloride gradient technique. This purified pCMV/IgKBChE. DNA was restricted with FspI, precipitated, and resuspended 0191 The construction of pSecTag/MaSp1 is described in sterile deionized water. in Lazaris, et al. Science (2002) 295: 472-476. Briefly, this Stably Transfected MAC-T Cell Lines Expressing Recom plasmid contains the coding sequence of the spider silk binant BChE: protein gene MaSp1 cloned into the vector pSecTag (Invit rogen). Apal and PmeI digestion of pSecTag/MaSpI 0197) MAC-T cells (ATCC #CRL 10274, U.S. Pat. No. removes the MaSp1 sequences as well as the His epitope tag 5,227,301) were seeded at a density of 5x10 cells per 100 sequences of the pSecTag vector. The remaining pSecTag mm dish. On the following day, cells were transfected with vector sequences comprise the CMV promoter, the mouse Lipofectamine PLUS Reagent (Invitrogen) as per the manu IgK signal sequence, and bovine growth hormone termina facturer's recommendations with 4 ug of the linearized tion and polyadenylation sequence. pCMV/IgKBChE construct. Briefly, the DNA was diluted to a final volume of 750 uL with DMEM (Invitrogen) and 20 0.192 The final expression construct pCMV/IgKBChE uL of PLUS Reagent was added to the mixture. The Lipo contains the sequence encoding mature human BChE, linked fectamine was diluted to a final volume of 750 uL with to the mouse IgK signal sequence, under the transcriptional DMEM. After incubation at ambient temperature for 15 min, control of the cytomegalovirus promoter (CMV), as well as the Lipofectamine and DNA mixtures were combined and the bovine growth hormone termination and polyadenyla complexes allowed to form for 15 min at room temperature. tion sequences for efficient transcription termination and transcript stability. 0198 The lipid-DNA complex mixture was applied to the cells, and the cells allowed to incubate for 3 hrs at 37° C. pCMV/BChE under 5% CO. The cells were then cultured for another 24 0193 pCMV/IgKBChE was digested with NheI and the h in fresh medium containing 20% fetal bovine serum (FBS, ends were filled in using T4 DNA polymerase in the pres Invitrogen). Subsequently, stably transfected cells were ence of dNTPs. This linearized vector then was digested selected in DMEM containing 10% FBS, 5 g/ml insulin with Xbal. This Nhel (blunt-ended)-Xbal fragment was (Sigma), and 100 ug/ml hygromycin B (Invitrogen). Colo ligated to the BglII (blunt-ended)-Xbal fragment of the nies Surviving selection were picked 7 to 14 days following human BChE cDNA to generate pCMV/BChE, with BChE’s transfection and expanded further. own signal sequence retained. 0199 The level of BChE activity in cell culture media pCMV/BChE/hSA from pCMV/IgKBChE transfected MAC-T cells was evalu ated by measuring butyrylthiocholine iodidehydrolysis (see 0194 PCR was performed using pCMV/BChE as a tem Ellman, et al. Biochem Pharmacol (1961) 7:88) using a plate with a sense primer Acb710 (5' GTG TAA CTCTCT commercially available test (Sigma). The assay was per TTG GAGAAA G 3') (SEQID NO: 5) containing a portion formed according to the manufacturer's recommendations. of 5" BChE sequence and an antisense primer Acb853 (5' The resulting activity values in units/ml were converted to TATAAG TTT AAA CATATAATT GGA TCC TCC ACC mg of active BChE by using the relationship: 1 mg of active TCC GCCTCC GAG ACC CACACAACTTTC TTT CTT BChE=720 units. From over 100 clones tested, the one G 3') (SEQ ID NO: 6) containing a PmeI site (underlined), demonstrating the highest BChE activity, as tested by the a BamHI site (italic), a (Gly)6-Ser linker (bolded) followed Ellman activity assay was further evaluated in roller bottles by a portion of 3' BChE sequence. The PCR product was containing serum-free DMEM. The amount of BChE activ digested with Xbal and PEmel, and ligated to Xbal and ity under these conditions was estimated at 0.56 units per PmeI digested pCMV/BChE to generate pCMV/BChEmd. million cells (U/106) per 24 hours. 0.195 PCR was performed using Marathon-ready human 0200. A master cell bank was generated and used to liver cDNA pool (Clontech) as a template with a sense initiate a hollow fiber bioreactor production run (Biovest, primer Acb854 (5' ATA TAAGGA TCC GAT GCA CAC CP2500 model). Hollow fibre production of stable transfec AAG AGT GAG GTT GCT CAT C') (SEQ ID NO: 7) tants was established for large-scale production of recom containing a BamHI site (underlined) and partial sequence binant BChE. US 2006/0253913 A1 Nov. 9, 2006
Stably Transfected MAC-T Cell Lines Expressing a Recom were then transferred by electroblotting onto nitrocellulose binant BChE-hSA Fusion: membranes (Bio-Rad). Recombinant BChE on the mem 0201 MAC-T cells were seeded at a density of branes was detected using rabbit polyclonal antibodies 2.5.times. 10 cells per 100 mm dish. On the following day, raised against BChE (DAKO) at a dilution of 1:1000 and cells were transfected with Lipofectamine Reagent (Invit goat anti-rabbit horseradish peroxidase conjugated second rogen) with 10 ug of the linearized pCMV/BChE-hSA antibody. Detection was performed according to manufac construct. Briefly, the DNA was diluted to a final volume of turer's protocol for enhanced chemiluminescence (ECL) 500 uL with DMEM (Invitrogen) and 60 uL of Lipo detection (Amersham Pharmacia). fectamine was diluted to a final volume of 500 uL with 0207. In such analyses, the anti-BChE antibodies specifi DMEM. The two solutions were combined, Vortexed for 10 cally detected a protein of the appropriate molecular weight sec and the complexes were allowed to form at room in cell culture media from transfected cells. These results temperature for 30 min. DMEM was added to the lipid-DNA confirmed the production of recombinant BChE, and of the mixture up to a final volume of 5 ml. The mixture was then recombinant BChE-hSA fusion protein, in transfected cell applied to the cells and allowed to incubate overnight at 37° lines in in vitro culture. C. under 5% CO. The cells were then cultured for another 24 h in DMEM containing 10% FBS, 5 lug/ml insulin 1.4 BChE Activity Gels (Sigma). 0208. 20 uL of samples of cell culture media from 0202) Stably transfected cells were selected in DMEM pCMV/IgKBChE transfected MAC-T cells, and pCMV/ containing 10% FBS, 5 lug/ml insulin (Sigma), and 100 BChE/hSA transfected MAC-T and BHK cells, was elec ug/ml hygromycin B (Invitrogen). Colonies Surviving selec trophoresed on native 4-20% pre-cast TRIS-glycine gels at tion were picked 7 to 14 days following transfection and 100-125 V overnight and at 4°C. The gels were then stained expanded further. for BChE activity with 2 mM of butyrylthiocholine iodide according to the Karnovsky and Roots method (Karnovsky 0203) The level of BChE activity in cell culture media and Roots. Histochem. Cytochem. (1964) 12:219-221). The from pCMV/BChE-hSA transfected MAC-T cells was staining procedure was performed at ambient temperature evaluated using a commercially available test (Sigma). From for two to six hours until the active protein bands were over 100 clones tested, the one demonstrating the highest revealed. BChE activity was further evaluated in roller bottles con taining serum-free DMEM. The amount of BChE activity 0209 Conditioned media from pCMV/IgKBChE trans under these conditions was estimated at 0.17 units per fected MAC-T cells showed an active protein, migrating at million cells (U/10) per 24 hours. Thus, it was successfully the molecular weight size of a tetramer (FIG. 3, lane 2). demonstrated that the recombinant BChE-hSA fusion pro Conditioned media from MAC-T cells transfected with tein is active. pCMV/BChE/hSA also showed expression of an active tetramer, as well as of active monomers and dimers (FIG. 3, Stably Transfected BHK Cell Lines Expressing a Recom lane 3). Conditioned media from BHK cells transfected with binant BChE-hSA Fusion: pCMV/BChE/hSA showed high level expression of both an 0204 These lines were generated using the same proce active monomer and an active dimer (FIG. 3, lane 5) dure for stable transfection of MAC-T cells with pCMV/ 0210. The finding that MAC-T cells produce recombi BChE-hSA, with the exception that the cells were BHK nant BChE predominantly in tetramer form is unexpected. In (Baby Hamster Kidney) cells (supplied by Dr. G. Matlesh prior reports of recombinant expression of BChE in in vitro ewski of McGill University, also available from the ATCC, cultured cells, the tetrameric form was the least abundant clone #CC1-10) and the selection media contained DMEM (e.g., Blong, et al. Biochem J. (1997) 327:747-757). Thus, with 10% FBS and 300 ug/ml hygromycin B (Invitrogen). the present invention provides for dramatically improved Colonies surviving selection were picked 7 to 14 days yields of tetrameric BChE enzyme (at least 50% of the following transfection and expanded further. produced BChE enzyme) using MAC-T cells transfected 0205 The level of BChE activity in cell culture media with the expression constructs of the invention. from pCMV/BChE-hSA transfected BHK cells was evalu ated using a commercially available test (Sigma). From over 0211 This result also confirms that the recombinant 100 clones tested, the one demonstrating the highest BChE BChE-hSA fusion protein is catalytically active, and may activity was further evaluated in roller bottles containing assemble into the dimeric form. serum-free DMEM. The amount of BChE activity under these conditions was estimated at 0.73 units per million cells Example 2 (U/10) per 24 hours. Production of Recombinant Human BChE in 1.3. Detection of Recombinant BChE in Culture Media of Transgenic Mice Transfected Cells. Expression Construct pBCNN/BChE 0206 Western blotting analysis of non-denaturing PAGE gels and denaturing SDS-PAGE gels was used to detect the 0212. In this expression construct, the BChE-encoding presence of recombinant BChE in cell culture media. Cell sequence is under the transcriptional control of a strong culture media from pCMV/IgKBChE transfected MAC-T B-casein promoter to direct expression of recombinant cells, and pCMV/BChE/hSA transfected MAC-T or BHK BChE in the mammary gland, and linked to a B-casein signal cells, was electrophoresed on non-denaturing and denaturing sequence to direct secretion of recombinant BChE into milk pre-cast 4-20% TRIS-glycine gels (Invitrogen). The samples produced by the mammary gland. US 2006/0253913 A1 Nov. 9, 2006 22 pUC18/BCNN 0218 pBCNN/BChE was digested with NotI, and the 0213 The goat f-casein promoter, including sequences resultant NotI-digested linear DNA, free of bacterial through exon 2, were reverse PCR amplified from a genomic sequences, was prepared and used to generate transgenic DNA library (SphI restriction digest) generated using goat mice. Briefly, circular expression construct DNA was puri blood (Clontech Genome Walking Library), using primers fied by the cesium chloride gradient technique. This purified ACB582 (5"CAG CTA GTA TTC ATG GAA GGG CAA DNA was restricted with NotI, electrophoresed, and the ATGAGG 3') (SEQID NO: 41) and ACB591 (5'TAGAGG linear DNA fragment was gel purified. The DNA fragment TCAGGG ATG CTG CTAAACATT CTG 3') (SEQID NO: was then mixed with cesium chloride and centrifuged at 20° 42). The 6.0 kb product was subcloned into the pUC18 C., 60,000 rpm for 16 to 20 hrs in a Beckman L7 ultracen vector (Promega) and designated puC18/5"bCN. trifuge using a Ti70.1 rotor (Beckman Instruments, Fuller ton, Calif., USA). The DNA band was removed, dialyzed 0214) A 4.5 kb DNA fragment spanning exon 7 and the against WFI water for 2-4 hrs, and precipitated in ethanol. 3' end of the goat f-casein gene was reverse PCR amplified The precipitated DNA was resuspended in injection buffer (5 from the same library (BglI restriction digest) using primers mM Tris pH 7.5, 0.1 mM EDTA, 10 mM NaCl) and dialyzed ACB583 (5' CCA CAG AATTGA CTG CGA CTG GAA against the same buffer at 4° C. for 8 hrs. Two additional ATA TGG 3') (SEQID NO: 43) and ACB601 (5' CTC CAT dialysis steps were performed, one for 16 hrs and the second GGG TAA GCC TAA ACA TTG. AGA TCT 3) (SEQ ID for at least 8 hrs. After dialysis the DNA was quantitated NO: 44). The fragment was subcloned in the puC18 vector using a fluorometer. Prior to use an aliquot was diluted to 2-3 as designated puC18/3'bCN. ng/ml in injection buffer. 0215. The 4.3 kb fragment encompassing exon 7 and the 0219. As a result of this preparation, the linear BCNN/ 3' end of the goat C.-casein gene was then PCR amplified BChE fragment used to generate transgenic animals con from puC18/3'bCN, using primer ACB620 (5'CTT TCT tained, in this order: CAG CCC AAA GTT CTG CCT GTTC) (SEQ ID NO: 45), which introduces NotI and XhoI sites and primer Dimerized Chicken B-Globin Gene Insulator ACB621 (5'CAA GTTCTCTCT CAT CTC CTG CTTCTC Goat Beta-Casein Promoter A 3') (SEQ ID NO: 46), which introduces SalI and Not I sites. This fragment was subcloned into the puC18 vector B-casein exon 1: and designated puC18bCNA. B-casein intron 1: 0216 A 4.9 kb fragment containing the 5' end of the Partial B-casein exon 2; B-casein promoter including sequences through exon 2 was PCR amplified from puC18/5"bCN using primer ACB618 XhoI cloning site; (5'CAGTGG ACA GAG GAA GAG TCAGAG GAA G3') f-casein signal sequence; (SEQ ID NO: 47), which introduces a BamHI and SacI site BChE-encoding sequence; at the 5'end and primer ACB619 (5' GTATTT ACC TCT CTT GCA AGG GCC AGAG 3') (SEQID NO: 48), which A STOP codon; is near the starting ATG codon and introduces a XhoI site. Partial B-casein exon 7; This fragment was then subcloned into the puC18bCNA expression vector by digesting with XhoI, which digests at B-casein intron 7; the 5' end of the 3' bON fragment and BamHI, which is B-casein exon 8; present in the puC18 vector just upstream of the XhoI site. This ligation generates the final puC18/BCNN construct, B-casein intron 8; which contains the B-casein promoter, including sequences B-casein exon 9; and upto exon 2, followed by an XhoI site, exon 7 and the 3' end Additional C-casein 3' genomic sequence. of the B-casein gene. 0220 A schematic depicting the exons and introns of the pBCNN/BChE goat B-casein locus that are contained in this fragment is 0217. The human BChE cDNA was PCR amplified from shown in FIG. 5. a cDNA clone (ATCC #65726) with a sense primer Acb719 2.2. Production of Founders and Subsequent Generations of (5' ATA TTC TCG. AGAGCC ATG AAG GTC CTC ATC Transgenic Mice. CTT GCC TGT CTG GTG GCT CTG GCC CTT GCA AGA GAA GAT GAC ATCAT3') (SEQID NO: 9) containing an 0221) The production and maintenance of transgenic XhoI restriction endonuclease site (underlined), goat mice were conducted at the Mcintyre Transgenic Core B-casein signal sequence (italic), and a partial human BChE Facility of McGill University. Transgenic mice were gener sequence; and an antisense primer, Acb718 (5'CTA TGA ated by pronuclear microinjection essentially as described in CTC GAG GCG ATC GCTATTAATTAGAGA CCCACA Hogan, et al. “Manipulating the Mouse Embryo: A Labora C) (SEQID NO: 10) containing an XhoI site (underlined) tory Manual.” Cold Spring Harbor Laboratory, 1986. The and partial 3' human BChE sequence. The BChE PCR BCNN/BChE linear fragment was microinjected into 414 product was XhoI digested and subcloned into pGEM-T fertilized eggs (strain FVB) and 22 pups were born. easy vector (Promega), to given the construct named p73. 0222. At 2-3 weeks of age tail biopsies were taken, under The BChE insert of p73 was excised by digestion with XhoI, anesthesia and DNA was prepared according to standard purified with GFX matrix (Pharmacia Biotech, Baie d'Urf, procedures well known to those skilled in the art, and PQ, Canada) and ligated with XhoI-digested pUC18/BCNN described in detail, for example, in “Molecular Cloning: A to generate pBCNN-BChE. The generation of pBCNN/ Laboratory Manual.” 2" Edition Sambrook, et al. Cold BChE is shown schematically in FIG. 4. Spring Harbor Laboratory:1989). The presence of the trans US 2006/0253913 A1 Nov. 9, 2006
gene in genomic DNA was confirmed by PCR and/or by the CDP-StarTM substrate (Roche Diagnostics Canada) Southern analysis as described in Identification of transgenic and visualized by the Fluor ChemTM 8000 System (Alpha mice below. Out of 28 tail DNA samples, 2 dead pup and 4 Innotech Corporation). The size of the genomic DNA frag live founders (2 males and 2 females) were confirmed ment detected by this probe varies depending on the site of transgene positive. Southern analysis was also used to integration. estimate transgene copy number. 0229. The same membrane was stripped with stripping 0223 Transgenic founder mice were bred with wild-type buffer (Roche Diagnostics Canada) and re-hybridized with a mice of the same Strain for the generation of Subsequent DIG-labeled PCR probe hybridizing within the BChE transgenic generations. One founder female has been used to sequence. The probe was PCR amplified from the pBCNN/ establish a transgenic line with ~10 copies of the transgene. BChE construct using the primers Acb710 (5' GTG TAA The other female and one of the male founders have been CTCTCT TTG GAG AAA G 3') (SEQ ID NO: 5) and used to establish a trasgenic line with ~40 copies of the Acb819 (5'CCA GAG GTA AAC CAA AGAC) (SEQ ID transgene. As shown in Table 2, the transgene was stably NO: 19). This 725 bp BChE-encoding sequence probede transmitted for 2 generations. tects a 11.kb band of the transgene. 2.3. Identification of Transgenic Mice. 0230. Upon analysis, the expected size bands were detected for all transgenic offspring and copy number was PCR Analysis: estimated. Transgene copy number has been stable for at 0224 Genomic DNA purified from tail biopsies was least two generations (see Table 3). For example, the founder quantitated by fluorimetry and PCR screened using three transgenic male (FO) with ~40 copies of the transgene has different primer sets. PCR was performed with the Ready transmitted ~40 copies to all of his offspring (F1). To-GoTM PCR beads (Pharmacia Biotech). Upon amplifica tion the samples were analysed for the presence of the PCR 2.4. Analysis of Recombinant BChE in the Milk Transgenic product by electrophoresis on a 2% agarose gel. The quality Mice of the DNA used in these PCR reactions was confirmed by 0231 Lactating female mice were milked after induction the presence of the expected fragment of the endogenous with an intraperitoneal injection of 5 i.u. of oxytocin. mouse B-casein gene. 0232 The milking apparatus is described at www.invit 0225. Primer set A, ACB712 (5' CTT CCG TGG CCA rogen.co-m/ContentITech-online/molecular biology/manu GAA TGG AT 3) (SEQ ID NO: 11) and ACB244 (5' CAT als pps/pbc1 man.pdf. The amount of milk that was CAG AAG TTA AAC AGC ACA GTT AGT 3') (SEQ ID obtained varied from 50-100 ul. The milk was centrifuged at NO: 12), amplifies a 495 bp fragment from the 3' end of the 3000.times.g. for 30 minutes at 4°C., and the resultant whey transgene spanning the junction of the BChE and 3' genomic phase was separated from the fat phase and precipitates. The f-casein sequences. whey phase was stored at -20° C. until analysis. 0226) Primer set B, ACB268 (5' AGG AGC ACA GTG 0233 he milk was analyzed for BChE activity levels CTCATC CAG ATC3") (SEQ ID NO: 13) and ACB659 (5 using the Ellman Assay, and for oligomerization of recom GAC GCC CCATCC TCA CTG ACT 3) (SEQID NO: 14), binant BChE by analysis on non-denaturing activity gels. It amplifies a 893 bp fragment of the insulator sequence is important to note that mouse milk contains endogenous located at the 5' end of the transgene. levels of BChE activity that were controlled for in perform ing the activity assays. The non-denaturing activity gels 0227 Primer set C, ACB572 (5 TTC CTA GGA TGT GCT CCA GGC T3') (SEQ ID NO: 15) and ACB255 (5 showed a unique band for the endogenous mouse BChE that GAA ACG GAA TGT TGT GGA GTG G 3') (SEQID NO: did not co-migrate with the recombinant BChE. 16) amplifies a 510 bp portion of an endogenous mouse Levels BChE Activity Measured using the Ellman Assay B-casein gene. This primer set serves as in internal positive 0234. The Ellman BChE activity assay was performed on control to indicate that the extracted DNA can be amplified the whey phase of milk collected from transgenic mice. The by PCR. whey phase of milk from 2 wild type FVB mice served as Southern Blotting Analysis: negative controls, while a partially purified human plasma BChE sample served as a standard. Samples were added in 0228 Confirmation of transgene presence, and estima 100 ul of 0.1 M potassium phosphate buffer (pH 8.0) into tion of transgene copy number, was performed using South each well of duplicate 96-well plates. 50 ul of DTNB ern blotting analysis with Boehringer Mannheim's DIG reaction buffer were added into each well, and then mixed system. Genomic DNA (5 lug) extracted from tail biopsies well. The plate was incubated at room temperature for 10 was digested with Xmel and Apal I. This digestion was minutes. Absorbance of the plate at 405 nm was measured followed by gel electrophoresis and Southern transfer to with Vmax Kinetic Microplate Reader (Molecular Devices) nylon membranes (Roche Diagnostics Canada). The blot with SoftMaxTM software and used as baseline reading prior was hybridized in a DIG Easy Hyb buffer (Roche Diagnos to measuring product formation. 100 ul of S-butyrylthio tics Canada) at 42° C. overnight using an insulator probe choline iodide were pipetted into each well with a multiple labeled by the PCR DIG probe synthesis kit (Roche Diag pipette and mixed. Absorbance at a wavelenght of 405 nm. nostics Canada), which hybridizes at the 5' end of the was measured at 1 min, 5 min and 10 min. One unit was transgene. This insulator probe was PCR amplified from the defined as the amount of BChE that hydrolyzed 1 micromol pBCNN/BChE construct using the primers Acb266 (5' TGC of substrate/min. TCTTTGAGCCTG CAG ACACCT3') (SEQ ID NO: 17) and Acb267 (5' GGCTGTTCT GAA CGCTGTGACTTG 0235 A specific activity of 720 Units/mg, measured at 3') (SEQID NO: 18). The membrane was washed, detected 25° C. with 1 mM butyrylthiocholine in 0.1 M potassium US 2006/0253913 A1 Nov. 9, 2006 24 phosphate (pH 8.0), was the standard for purified human sequences, was prepared and used to generate transgenic BChE. The activity detected using the milk of two negative mice. Briefly, circular expression construct DNA was puri control mice (0.7 Units/ml, 0.97 mg/ml, 0.84 Unites/ml; fied by the cesium chloride gradient technique. This purified 1.16 mg/ml) was subtracted from the activity detected in the DNA was restricted with NotI, electrophoresed, and the milk of the transgenic mice. The results (see Table 3) clearly linear DNA fragment was gel purified. The DNA fragment show that BChE activity was detected in both founder was then mixed with cesium chloride and centrifuged at 20° trangenic mice (F0 generation) and in the milk of female C., 60,000 rpm for 16 to 20 hrs in a Beckman L7 ultracen offspring (F1 generation). trifuge using a Ti70.1 rotor (Beckman Instruments, Fuller Analysis of Non-Denaturing BChE Activity Gels ton, Calif., USA). The DNA band was removed, dialyzed 0236. The collected whey phase samples were also elec against WFI water for 2-4 hrs, and precipitated in ethanol. trophoresed on native 4-20% pre-cast TRIS-glycine gels The precipitated DNA was resuspended in injection buffer (5 (Invitrogen) at 100 V overnight and 4°C. The gels were then mM Tris pH 7.5, 0.1 mM EDTA, 10 mM NaCl) and dialyzed stained for BChE activity with 1 mM of butyrylthiocholine against the same buffer at 4° C. for 8 hrs. Two additional iodide according to the Kamovsky and Roots method (Kar dialysis steps were performed, one for 16 hrs and the second novsky and Roots Histochem. Cytochem. (1964) 12:219 for at least 8 hrs. After dialysis the DNA was quantitated 221). The staining procedure was performed at ambient using a fluorometer. Prior to use an aliquot was diluted to 2-3 temperature for two to six hours until the active protein ng/ml in injection buffer. bands were revealed. As can be seen from FIG. 6, the 3.2 Production of Founders and Subsequent Generations of endogenous mouse BChE present in milk (lanes 2 and 3) BChE/hSA Transgenic Mice migrates at a different size than the recombinant human BChE (lane 1). The recombinant human BChE is produced 0242 The production and maintenance of transgenic as a mixture of dimers and monomers, while the endogenous mice were conducted at McIntyre Transgenic Core Facility BChE is predominantly a dimer. of McGill University. Transgenic mice were generated by 0237) The above results demonstrate that recombinant pronuclear microinjection essentially as described in Hogan, human BChE can be produced and secreted by the mouse et al. “Manipulating the Mouse Embryo: A Laboratory mammary gland, with the resultant milk containing levels of Manual.''Cold Spring Harbor Laboratory, 1986. The BCNN/ up to greater than 1.5 g/L of recombinant human BChE (see BChE linear fragment was microinjected into 519 fertilized Female 4 in Table 3). The secretion of recombinant BChE eggs (strain FVB), and 27 pups were born (see Table 2 for has no adverse effects on lactation, as shown by the ability details). of transgenic females to nurse their pups. 0243 At 2-3 weeks of age tail biopsies were taken under anesthesia and DNA was prepared according to standard Example 3 procedures well known to those skilled in the art, and described in detail, for example, in “Molecular Cloning: Production of Recombinant BChE-hSA Fusion Laboratory Manual. 2nd Edition. Sambrook, et al. Cold Protein in Transgenic Mice Spring Harbor Laboratory: 1989. The presence of the trans gene in the genomic DNA was confirmed by PCR analysis 0238. The methods and protocols used for this example, as described in Identification of Transgenic Mice below. Out unless otherwise stated, were the same as those used for of 29 tail DNA samples, 1 female founder and one dead pup Example 2. were confirmed transgene positive. 3.1. Expression Construct pBCNN/BChE/hSA 3.3. Identification of Transgenic Mice. pBCNN/wtEChE/hSA 0244. The presence of the transgene in mice was con 0239). The vector pBCNN/BChE (see Example 2.1 and firmed by PCR as described in Example 2.3, except that PCR FIG. 4) was digested with XhoI to remove the BChE insert, primer set A was replaced with primer set 1, primers blunt-ended by filling in with Klenow polymerase in the ACB712 (5'CTT CCG TGG CCA GAA TGG AT 3') (SEQ presence of dNTPs, and CIP treated. Construct pCMV/ ID NO: 11) and ACB884 (5'CCT CACTCTTGT GTG CAT BChE/hSA (See Example 1.1) was partially digested with CG 3') (SEQID NO: 20), which amplifies a 462 bp fragment NcoI to remove the BChE-hSA encoding sequences, blunt from the 3' end of the transgene spanning the junction of the ended by filling in with Klenow polymerase in the presence BChE and albumin sequences. of dNTPs, and PmeI digested. The two blunt-ended frag ments were ligated to generate pBCNN/wtEBChE/hSA. In TABLE 2 this construct the signal sequence is the BChE signal Sequence. Transgenic mice produced via pronuclear microinjection pBCNN/BChE/hSA BCNN-BChE construct 0240. The BstaPI fragment (from 4976 nt to the middle Eggs microinjected 414 Eggs transferred to recipients 26S part of BChE) of pBCNN/wtBChE/hSA was replaced with Recipient mice (average 9 (25) the same BstaPI fragment from pBCNN/BChE (See embryos per recipient) Example 2.1) to generate pBCNN/BChE/hSA. In this con % Recipients pregnant 56% struct the signal sequence is from goat B-casein. Pups born 28 Pups transgenic (Male/Female; 6/28 (2/2, 2 dead; 21%) 0241 pBCNN/BChE/hSA was digested with NotI, and dead; % transgenic) the resultant Noti-digested linear DNA, free of bacterial US 2006/0253913 A1 Nov. 9, 2006 25
Schering, Canada) administered intramuscularly 36 hours TABLE 2-continued prior to sponge removal. In addition, for donor goats folli cular development was stimulated by a gonadotrophin treat Transgenic mice produced via pronuclear microinjection ment consisting of 70 mg NIH-FSH-P1 (Folltropin-VTM, pBCNN/BChE hSA Vetrepharm, Canada) and 300 IU eCG (Novormon 5000TM, Vetrepharm, Canada) administered intramuscularly 36 h Eggs microinjected S16 prior to Laparaoscopic Ovum Pick-Up (LOPU). Eggs transferred to recipients 294 Recipient mice (average embryos 13 (26) 4.2. Collection of Cumulus Oocyte Complexes (COCs) per recipient) % Recipients pregnant 61% From Donor Goats by Laparoscopic Ovum Pick-Up Pups born 32 (LOPU). Pups transgenic (Male/Female, 2/27 (0/1, 1; 7%) 0248 Cumulus oocyte complexes (COCs) from donor dead; % transgenic) goats were recovered by aspiration of follicle contents (puncture or folliculocentesis) under laparoscopic observa tion. The laparoscopy equipment used (Richard Wolf, Ger 0245) many) was composed of a 5 mm telescope, a light cable, a TABLE 3 light Source, a 5.5 mm trocar for the laparoscope, an atraumatic grasping forceps, and two 3.5 mm 'second Transgene copy number and analysis of BChE activity in milk of puncture' trocars. The follicle puncture set was composed of transgenic mice BCNN-BChE a puncture pipette, tubing, a collection tube, and a vacuum Founder Copy Ellman F1 Ellman pump. The aspiration pipette was made using an acrylic (FO) bred i (mg/L) transmission F1 bred Copy # (mg/L) pipette (3.2 mm external diameter, 1.6 mm internal diam eter), and a 20G short bevel hypodermic needle, which was Male A. ~40 NA. 1421 Male 1 ~40 NA (67%) Male 2 ~40 NA cut to a length of 5 mm and fixed into the tip of the pipette 6 Males Male 3 ~40 NA with instant glue. The connection tubing was made of clear 8 Females Male 4 ~40 NA plastic tubing with an internal diameter of 5 mm, and Male 5 ~40 NA connected the puncture pipette to the collection tube. The Male 6 ~40 NA Female 1 ~40 418 collection tube was a 50 ml centrifuge tube with an inlet and Female 2 ~40 151 an outlet available in the cap. The inlet was connected to the Female 3 ~40 3888 aspiration pipette, and the outlet was connected to a vacuum Female 4 ~40 1800 line. Vacuum was provided by a vacuum pump connected to Female A -10 3.S. ND ND ND ND Female B 40 390* S.19 Male 7 ~40 NA the collection tube by means of clear plastic 8 mm tubing. (26%) Male 8 ~40 NA The vacuum pressure was regulated with a flow valve and 4 Males Male 9 ND NA measured as drops of collection medium per minute entering 1 Female Male 10 ND NA the collection tube. The vacuum pressure was typically Female 5 ND 910 adjusted to 50 to 70 drops per minute. NA = not applicable. ND = not done. 0249. The complete puncture set was washed and rinsed *Value represents the average of three independent assays. 10 times with tissue culture quality distilled water before gas sterilization, and one time before use with collection medium, M199+25 mM HEPES (Gibco) supplemented with 3.4. Expression of the Recombinant BChE-hSA Fusion penicillin, streptomycin, kanamycin, bovine serum albumin Protein in Transgenic Mice. and heparin). Approximately 0.5 ml of this medium was Levels BChE Activity Measured using the Ellman Assay added to the collection tube to receive the oocytes. 0246 The Ellman BChE activity assay is performed on 0250) Donors were deprived of food for 24 hours and of the the whey phase of milk collected from the female water for 12 hours prior to surgery. The animals were founder mouse (as described in Example 2.4). The activity pre-anesthetized by injection of diazepam (0.35 mg/kg body detected using the milk of two negative control mice is weight) and ketamine (5 mg/kg body weight). Thereafter, subtracted from the activity detected in the milk of the anesthesia was maintained by administration of isofluorane transgenic mouse. This assay will be used to confirm that the via endotrachial intubation. Preventive antibiotics (e.g., recombinant BChE-hSA fusion is catalytically active. oxytetracycline) and analgesic/anti-inflammatorues (e.g., flunixine) were administered by intramuscular injection in Example 4 the hind limbs. The Surgical site was prepared by shaving the abdominal area, then scrubbing first with soap and water and Production of Recombinant Human BChE in then with a Hibitaine: water solution, followed by applica Transgenic Goats tion of iodine solution. 0251 A small incision/puncture was made with a scalpel 4.1. Hormonal Treatment of Oocyte Donor Goats: blade about 2 cm cranial from the udder and about 2 cm left 0247 Recipient and donor crossbreed goats (mainly Saa from the midline. The 5 mm trocar was inserted and the nen.times.Nubian) were estrus synchronized by means of an abdominal cavity was inflated with filtered air through the intravaginal sponge impregnated with 60 mg medroX trocar sleeve gas valve. The laparoscope was inserted into yprogesterone acetate (VeramixTM, Pharmacia Animal the trocar sleeve. A second incision was made about 2 cm Health, Ontario, Canada) for 10 days, together with a cranial from the udder and about 2 cm right from the luteolytic injection of 125 ug clorprostenol (EstrumateTM, midline, into which was inserted a 3.5 mm trocar. The trocar US 2006/0253913 A1 Nov. 9, 2006 26 was removed, and the forceps was inserted. A third incision Zona. The oocytes were washed with in vitro fertilization was made about 6 cm cranial to the udder and about 2 cm (IVF) medium, a modified Tyrode's albumin lactate pyru right from the midline. The second 3.5 mm trocar and trocar vate (TALP), and transferred to 40 ul droplets of the same sleeve was inserted into this incision. The trocar was medium (15-20 oocytes per 40 ul droplet) under mineral oil. removed and the aspiration pipette connected to the vacuum A 5ul aliquot of the capacitated sperm suspension (20x10' pump and the collection tube was inserted therein. sperm/ml), prepared as described in Example 4.4, was added 0252. After locating the reproductive tract below the to each 40 ul droplet. The inseminated oocytes were cultured bladder, the ovary was exposed by pulling the fimbria in at 38.5° C. in 5% CO, for 15-16 hours. different directions, and the number of follicles available for 4.6 Pronuclear Microiniection of Oocytes aspiration was determined. Generally, follicles greater than 0256 After culturing for 15-16 hours, the cumulus cells 2 cm were considered eligible for aspiration. The follicles were stripped from the inseminated oocytes (Zygotes) by were punctured one by one and the contents aspirated into repeated pipetting as described above. The Zygotes were the collection tube under vacuum. The needle was inserted then observed for pronuclear formation using an Olympus into the follicle and rotated gently to ensure that as much of Stereomicroscope. To improve pronucleus visualization, the the follicle contents as possible were aspirated. After >10 Zygotes were washed in EmCareTM (PETS, cat. # ECFS follicles were aspirated and/or before moving to the other 100) supplemented with 1% Fetal Bovine Serum (FBS), ovary, the pipette and tubing were rinsed using collection (Gibco BRL, Australian or New Zealand sourced, heat media from a sterile tube. inactivated at 56° C. for 30 minutes), then centrifuged at 4.3. In Vitro Maturation of Oocytes Collected by LOPU 10.400.times.g. for 3 minutes before observation. Zygotes 0253) To each collection tube containing cumulus oocyte with visible pronuclei were selected for microinjection and complexes (COCs) was added about 10 ml of searching transferred to 50 ul droplets of temporary culture medium medium, EmCareTM supplemented with 1% heat inactivated (INRA Menezo B2, Meditech cat. HCH-B 04001 supple Fetal Bovine Serum (FBS). The resulting solution was mented with 2.5% FBS) during manipulation. The Zygotes aspirated into a grid search plate and transferred to Petri were then transferred to 50 ul droplets of EmCareTM+1% dishes containing the same medium for the purpose of FBS (about 20 Zygotes per droplet) and microinjected with scoring each COC for amount and expansion of cumulus. the BCNN/BChE linear fragment from Example 2.1. (3 The COCs were then washed with in vitro maturation (IVM) ng/ml of the DNA in a buffer of 5 mM Tris, 0.1 mM EDTA, medium; (M199+25 mM HEPES supplemented with b|LH, 10 mM. NaCl buffer, pH 7.5). The injected Zygotes were bFSH, estradiol B-17, pyruvate, kanamycin and heat-inac washed and cultured in temporary culture medium to await tivated EGS) that had been equilibrated in an incubator transfer to recipients. under 5% CO, at 35.5° C. for at least 2 hours. The COCs 4.7 Transfer of Embrvos to Oviduct Recipient Goats and were pooled in groups of 15-25 per droplet of IVIM medium, Birth of Kids overlayed with mineral oil, and incubated in 5% CO.sub.2 at 0257 Adult goats of various breeds including the Boer, 35.5° C. for 26 hours. Saanen, and Nubian breeds were used as recipients. They 4.4. Preparation of Semen for In Vitro Fertilization were estrus synchronized by means of an intravaginal 0254 Fresh semen was collected from 2 adult Saanen sponge impregnated with 60 mg medroxyprogesterone males of known fertility. After collection, sperm capacitation acetate (VeramixTM, Pharmacia Animal Health, Ontario, was achieved as follows. A 5ul aliquot of fresh semen was Canada) left in place for 9 days, together with a luteolytic diluted in 500 ul warm modified Defined Medium (mDM) injection of 125 ug clorprostenol (EstrumateTM, Schering, comprising NaCl, KCl, NaH.sub.2POH, MgClFIO, Canada) and 500 IU eCG (Novormon 5000TM, Vetrepharm, CaCl2.H2O, glucose, 0.5% phenol red, Na-Pyruvate, NaH Canada) administered intramuscularly 36 hours prior to CO.sub.3, gentamicin and BSA. The solution was allowed to sponge removal. Sponges were inserted into the recipient stand at room temperature in the absence of light for 3 hours. goats on the same day as the donor goats but removed An additional 1 ml of mDM solution was added and 100 ul approximately 15 hours earlier. Each recipient was Subse of the resulting solution was overlaid on a 45%:90%. Percoll quently treated with an intramuscular injection of 100 g gradient Percoll (Sigma P1644) in modified Sperm Tyrodes GnRH (FactrelTM, 2.0 ml of 50 g/ml solution), 36 hours Lactate (SPTL) solution in a conical centrifuge tube. The after sponge removal. The recipients were tested for estrus Solution was centrifuged on the Percoll gradient at with a vasectomized buck at 12 hour intervals beginning 24 857.times.g. for 30 minutes. The pellet was resuspended in hours after sponge removal and ending 60-72 hours after mDM solution and centrifuged at the same speed for 10 sponge removal. minutes. The pellet was re-suspended in capacitation 0258 Recipient goats were fasted, anesthetized, and pre medium (mDM, supplemented with 8b-cAMP. lonomycin pared for Surgery following the same procedures previously and Heparin). The resuspended semen was cultured at 38.5° described for donor goats. They also received preventive C. under 5% CO for 15 minutes. The sperm concentration antibiotic therapy and analgesic/anti-inflammatory therapy, was then adjusted to final concentration of 20x10° sperm/ml as described for donors. Prior to Surgery, a laparoscopic by addition of mDM solution. exploration of each eligible recipient was performed to confirm that the recipient had one or more recent ovulations 4.5 In Vitro Fertilization of Oocytes (as determined by the presence of corpora lutea on the 0255 The expanded cumulus cells were partially ovary), and a normal oviduct and uterus. The laparoscopic removed from the matured COCs by pipetting repeatedly exploration was carried out to avoid performing a laparo through two fine-bore glass pipettes (200 and 250 um tomy on an animal which had not responded properly to the internal diameter), leaving one layer of cumulus cells on the hormonal synchronization protocol described above. Two US 2006/0253913 A1 Nov. 9, 2006 27 incisions were made (one 2 cm cranial to the udder and 2 cm positive controls (genomic DNA from non-transgenic ani left of the midline, and the other 2 cm cranial to the udder mals spiked with the microinjected BCNN/BChE linear and 2 cm right of the midline) and the laparoscope and fragment) were also included. Samples which exhibited a forceps were inserted as described above. The ovaries were band corresponding to the positive control were deemed exposed by pulling up the fimbria with the forceps, and the positive. Based on this PCR analysis, a total of 6 transgenic number of ovulations present as well as the number of goats were identified (5 females and 1 male). follicles larger than about 5 mm diameter was noted. Recipi ents with at least one ovulation present and having a normal 0264. The presence of the transgene was confirmed by uterus and oviduct were eligible for transfer. A mid-ventral Southern blotting as described in Example 2.3. The expected laparotomy incision of approximately 10 cm length was size bands were detected for all transgenic founders (FO established in eligible recipients, the reproductive tract was generation), and transgene copy number was estimated to be exteriorized, and the embryos were implanted into the between about 4-50 copies (see Table 5). Fluorescent in situ oviduct ipsilateral to the ovulation(s) by means of a Tom hybridization (FISH) was performed as described in Keefer, CatTM catheter threaded into the oviduct from the fimbria. et al. Biol. Reprod. (2001) 64:849-856 in order to determine The incisions were closed and the animal was allowed to the number of chromosomal integration sites (Table 5). recover in a post-op room for 3 days before being returned to the pens. Skin sutures were removed 7-10 days after TABLE 4 Surgery. Transgenic goats produced via nuclear proinjection 0259 Recipients were scanned by transrectal ultrasonog Donor goats aspirated 68 raphy using a 7.5 Mhz, linear array probe to diagnose Follicles aspirated (ave. per donor goat) 1410 (20.7) Oocytes recovered (ave. per donor goat, 1256 (18.5, 89%) pregnancy at 28 and 60 days after transfer. recovery rate) Zygotes microinjected (% of oocytes recovered) 724 (58%) 0260 Newborn kids were removed from does at birth to Zygotes transferred (% of microinjected) 635 (88%) prevent disease transmission from doe to kid by ingestion of Recipient goats (ave. embryos per recipient) 92 (6.9) does raw colostrum and/or milk, exposure to does fecal Recipients pregnant at 28 days (% pregnant) 48 (52%) matter or other potential sources of disease. Kids were fed Kids born (ave. per recipient) 61 (1.7) thermorized colstrum for the first 48 hours of life, and Kids transgenic (Male/Female: % of kids born) 6 (5/1; 10%) pasteurized doe milk thereafter until weaning. 4.8. Identification of Transgenic Goats 0265 0261 Blood and tissue samples were taken from putative transgenic kids at approximately 4 days after birth, and again TABLE 5 at approximately two weeks after birth. At each sampling Trausgene copy number and chromosomal integration sites of founder interval, about 2-7 ml blood sample was collected from each transgenic goats. kid into an EDTA vacutainer, and stored at 4°C. for up to Founder goat Transgene Integration sites 24 hours until use. Tissue samples were obtained by clipping (FO generation) copy number (by FISH) the ear tip of each kid, and stored at 20° C. until use. Male 1 ~5–10 3 Genomic DNA was isolated from the blood samples using a Female 1 -2-5 2 QIAamp DNA Blood Mini Kit (Qiagen, Cat. it 51106), and Female 2 -2-5 2-3 from the tissue samples using DNeasy Tissue Kit (Qiagen, Female 3 -20 1-2 cat #69506). For each sample, the DNA was eluted in Female 4 ~5–10 2-3 150-200 ul 0.1.times. buffer AE and stored at 4° C. until Female 5 ND 1 ready to use. ND = not done 0262 PCR screening was performed on each DNA sample to determine the presence of the BChE-encoding 4.9. Induction of Lactation transgene. Genomic DNA samples were diluted using 0266. Female founders were induced to lactate at 3-4 nuclease-free water to a concentration of 5 ng/ul. A 20 ul months of age in order to confirm the expression of recom portion of the diluted DNA was added to a 0.2 ml Ready binant BChE in milk. For such purpose they were hormon To-Go PCR tube containing a PCR bead, together with 5 ul ally stimulated with Estradiol cypionate (0.25 mg/KBW) 5xprimer mix containing dUPT (Amersham Bioscience, cat. and Progesterone (0.75 mg/KBW) every 48 h for two weeks, #272040) and UDG (Invitrogen, cat. #18054-015). The followed by treatment with dexamethasone (8 mg/goat/day) primer sets used were identical to the ones used in the PCR for 3 days. In general, milk production started during the analysis of Example 2.3, except for primer set C. In this dexamethasone treatment and the animals were milked twice case, primer set C was replaced with the primers Acb256 (5' per day for as long as necessary to produce enough material GAG GAA CAA CAG CAA ACA GAG 3') (SEQ ID NO: 21) and Acb312 (5' ACC CTACTG TCTTTCATCAGC 3') for further testing. (SEQ ID NO: 22), which amplify a 360 bp portion of the 4.10. Analysis of BChE-Activity in the Milk of Transgenic endogenous goat b-casein gene. This primer set serves as in Goats internal positive control to indicate that the extracted DNA 0267 The presence and activity of recombinant BChE in can be amplified by PCR. the milk of transgenic goats was analyzed by non-denaturing 0263. The sample was subjected to thermal cycling and BChE-activity gel as described in Example 2.4. Such analy then applied to a 1% agarose gel. Negative controls sis (see FIG. 7) showed that active recombinant BChE is (genomic DNA isolated from non-transgenic animals) and produced in the milk of transgenic goats. The recombinant US 2006/0253913 A1 Nov. 9, 2006 28
BChE is present in both a tetramer and dimer form, and to (compare band intensity of the 0.2 g sample versus that of a lesser extent in the monomer form. 0.2 Lug of the positive control). 4.11. Purification of Recombinant BChE from the Milk of Example 5 Transgenic Goats Clarification of Milk 0268 20 ml of milk containing recombinant BchE was Production of Recombinant BChE-hSA Fusion diluted to 60 ml with 20 mM phosphate buffer (pH7.4). Protein in Transgenic Goats Ammonium Sulfate (15 grams) was slowly added to the diluted milk, and the mixture was agitated until all ammo 0272 Trangenic goats expressing a recombinant BChE nium sulfate solids were dissolved. This liquid was incu hSA fusion protein may be generated by nuclear transfer. bated at 4° C. for one hour, and then phase separated by The nuclear donors are primary fetal goat cells stably centrifugation at 20,000.times.g. for 30 min. The liquid phase transfected with the BCNN/BChE/hSA linear fragment containing recombinant BChE was harvested and then dia (from Example 3.1). lyzed overnight against 20 mM phosphate buffer (pH7.4), 5.1. Generation of Stably Transfected Cell Lines 100 mM sodium chloride, and 1 mM EDTA. 75 ml of liquid containing recombinant BChE was recovered and further 0273 Primary fetal goat cells were derived from day 28 clarified by filtration using a 0.2 um filter. The recovery of kinder fetuses recovered from a pregnant Saanen breed BchE based on activity (Ellman reaction) was 50%. female goat, and cultured for 3 days prior to being cyropre served. Chromosome number (2n=60) and sex analysis was Affinity Chromatography with Procainamide performed prior to use of cells for transfection experiments. 0269. An affinity resin was prepared using standard pro Under the culture conditions used, all primary lines had a tocols with Procainamide (Sigma) and Activated CH normal chromosome count indicating the absence of gross Sepharose (Amersham). A column was packed with 20 ml chromosomal instability during culture. Procainamide affinity resin and equilibrated with 20 mM 0274 Transfections were performed as described in phosphate buffer (pH7.4), 100 mM sodium chloride, and 1 Keefer, et al. Biol. Reprod. (2001) 64:849-856, with the mM EDTA. The 75 ml of liquid containing recombinant following modifications: Female primary lines were thawed BChE was loaded onto the column at a linear flow rate of 50 and at passage 2, co-transfected with the linearized BCNN/ cm/hr. The column was washed with 20 mM phosphate BChE/hSA fragment and the linearized pSV40/Neo select buffer (pH7.4), 150 mM sodium chloride, and 1 mM EDTA. able marker construct (Invitrogen). The pSV40/Neo linear BChE was eluted with 20 mM phosphate buffer (pH7.4), fragment was generated by restriction of the vector with 500 mM sodium chloride, and 1 mM EDTA. The eluent Xbal and Nhel, followed by purification of the fragment as containing recombinant BChE was dialysed against 20 mM described in Example 2.1. Stably transfected cell lines were phosphate buffer (pH7.4), 50 mM sodium chloride, and 1 selected with G418 and frozen by day 21 (day 0=transfection mM EDTA. A total of 50 ml of liquid containing recombi date). nant BChE was recovered after dialysis. The recovery of BchE after this step was 90%. 0275 Four stably transfected cell lines have been derived by this procedure. In all cases the presence of the transgene Anion Exchange Chromatography has been confirmed by Southern Analysis and by Fluores 0270. A column was packed with 20 ml HQ50 resin cence In Situ Hybridization (FISH). Transfected cell lines (Applied Biosystems) and equilibrated with 20 mM phos for which integration of the transgene is confirmed will phate buffer (pH7.4), 50 mM sodium chloride, and 1 mM serve as donors for nuclear transfer. EDTA. The 50 ml of liquid containing recombinant BChE 5.2. Oocyte Donor and Recipient Goats was recovered after affinity chromatography was loaded onto the column at a linear flow rate of 100 cm/h. The 0276 Intravaginal sponges containing 60 mg of medroX column was washed with 20 mM phosphate buffer (pH7.4), yprogesterone acetate (Veramix) are inserted into the vagina 50 mM sodium chloride, and 1 mM EDTA. Purified recom of donor goats (Alpine, Saanen, and Boer cross bred goats) binant BChE was eluted with 20 mM phosphate buffer and left in place for 10 days. An injection of 125 ug (pH7.4), 250 mM sodium chloride, and 1 mM EDTA. This cloprostenol is given 36 h before sponge removal. Priming eluent was dialyzed against 20 mM phosphate buffer of the ovaries is achieved by the use of gonadotrophin (pH7.4), 100 mM sodium chloride, and 1 mM EDTA, and preparations, including FSH and eCG. One dose equivalent then further concentrated to a final purfied concentration of to 70 mg NIH-FSH-P1 of Ovagen is given together with 400 15 mg/ml of protein. The recovery of BChE after this step IU of eCG (Equinex) 36 h before LOPU (Laparoscopic was 90%. Oocyte Pick-Up). 0271 In order to estimate the purity of the purified 0277 Recipients are synchronized using intravaginal recombinant BChE, a 0.2 g sample was Subjected to sponges as described above for donor animals. Sponges are denaturing SDS-PAGE electrophoresis under reducing con removed on day 10 and an injection of 400 IU of eCG is ditions. The gel was then silver stained to show total protein given. Estrus is observed 24-48 h after sponge removal and of the sample (see FIG. 8). Note that all of the purified embryos are transferred 65-70 h after sponge removal. recombinant BChE migrates as a monomer on this gel, due 5.3. Laparoscopic Oocyte Pick-Up (LOPU) and Embryo to reduction of the protein samples with beta-mercaptoet Transfer hanol prior to loading on the gel, and to denaturation of the proteins during electrophoresis. This analysis was used to These procedures are performed essentially as described in estimate that the purified recombinant BchE is >80% pure Examples 4.2 and 4.7 US 2006/0253913 A1 Nov. 9, 2006 29
0278 Donor goats are fasted 24 hours prior to laparos 5.6. Oocyte Activation and Culture copy. Anesthesia is induced with intravenous administration of diazepam (0.35 mg/kg body weight) and ketamine (5 0283 Two to three hours after application of the first mg/kg body weight), and is maintained with isofluorane via fusion pulse, the fused couplets are activated using calcium endotrachial intubation. Cumulus-oocyte-complexes ionomycin and 6-dimethylaminopurine (DMAP) or using (COCs) are recovered by aspiration of follicular contents calcium ionomycin and cycloheximide/cytochalasin B treat under laparoscopic observation. ment. Briefly, couplets are incubated for 5 minutes in 0279 Recipient goats are fasted and anaesthetized in the EmCareTM containing calcium ionomycin, and then for 5 same manner as the donors. A laparoscopic exploration is minutes in EmCareTM containing BSA. The activated cou performed to confirm if the recipient has had one or more plets are cultured for 2.5 to 4hrs in DMAP, then washed in recent ovulations or corpora lutea present on the ovaries. An handling medium and placed into culture drops (25 Jul in average of 11 nuclear transfer-derived embryos (1-cell to volume) consisting of G1 medium supplemented with BSA 4-cell stage) are transferred by means of a TomCatTM under an oil overlay. Alternately, following calcium iono catheter threaded into the oviduct ipsilateral to ovulation(s). mycin treatment, the activated couplets are cultured for 5 hrs Donors and recipients are monitored following Surgical in cycloheximide and cytochalasin B, washed, and placed procedures and antibiotics and analgesics are administered into culture. Embryos are cultured 12 to 18 hr until embryo according to approved procedures. transfer. Nuclear transfer derived embryos are transfered on Day 1 (Day 0=day of fusion) into synchronized recipients on 5.4. Oocyte Maturation Day 1 of their cycle (D0=estrus). 0280 COCs are cultured in 50 ul drops of maturation medium covered with an overlay of mineral oil and incu 5.7. Identification of Stably Transfected Cell Lines and of bated at 38.5-39° C. in 5% CO2. The maturation medium Transgenic Goats consists of M199H (GIBCO) supplemented with b|LH, 0284. Following selection of transfected cell lines, bFSH, estradiol B-17, sodium pyruvate, kanamycin, cys genomic DNA is isolated from cell pellets using the DNeasy teamine, and heat inactivated goat serum. After 23 to 24 hrs Tissue Kit (Qiagen, cat #69506). For each sample, the DNA of maturation, the cumulus cells are removed from the matured oocytes by vortexing the COCs for 1-2 min in is eluted in 150-200 ul 0.1x buffer AE and stored at 4° C. EmCareTM containing hyaluronidase. The denuded oocytes until ready to use. are washed in handling medium (EmCareTM supplemented 0285 For confirmation of the presence of the transgene in with BSA) and returned to maturation medium. The enucle nuclear transfer derived offspring, genomic DNA is ation process is initiated within 2 hr of oocyte denuding. extracted from the blood and ear biopsy of 2 week old kids Prior to enucleation, the oocytes are incubated in Hoechst using standard molecular biology techniques. The genomic 33342 handling medium for 20-30 minutes at 30-33°C. in air atmosphere. DNA is isolated from the blood samples using a QIAamp DNA Blood Mini Kit (Qiagen, Cat. # 51106), and from the 5.5. Nuclear Transfer tissue samples using DNeasy Tissue Kit (Qiagen, cat 0281 Oocytes are placed into manipulation drops #69506). For each sample, the DNA is eluted in 150-200 ul (EmCareTM supplemented with FBS) covered with an over 0.1.times. buffer AE and stored at 4° C. until use. lay of mineral oil. Oocytes stained with Hoechst are enucle 0286 The presence of the transgene, in stably transfected ated during a brief exposure of the cytoplasm to UV light cells and in transgenic goats, is confirmed by PCR as (Zeiss Filter Set 01) to determine the location of the chro described in Example 2.3, except for the following modifi mosomes. Stage of nuclear maturation is observed and cations. PCR primer set A is replaced with primer set I: recorded during the enucleation process. Primers ACB712 (5'CTTCCGTGGCCA GAATGG AT3') 0282. The enucleated oocytes and dispersed donor cells (SEQ ID NO: 11) and ACB884 (5'CCT CAC TCT TGT are manipulated in handling medium. Transgenic donor cells GTG CAT CG 3') (SEQID NO: 20) which amplify a 462 bp are obtained following either in vitro transfection (see fragment from the 3' end of the transgene spanning the Example 5.1) or biopsy of a transgenic goat. Donor cells are junction of the BChE and albumin sequences. Primer set C prepared by serum starving for 4 days at confluency. Sub is replaced with the primers Acb256 (5' GAG GAA CAA sequently they are trypsinized, rinsed once, and resuspended CAG CAA ACA GAG 3') (SEQID NO: 21) and Acb312 (5' in EmcoreTM with serum. Small (<20 um) donor cells with ACC CTA CTG TCTTTC ATC AGC 3') (SEQID NO: 22), Smooth plasma membranes are picked up with a manipula which amplify a 360 bp portion of the endogenous goat tion pipette and slipped into perivitelline space of the B-casein gene. This primer set serves as in internal positive enucleated oocyte. Cell-cytoplast couplets are fused imme control to indicate that the extracted DNA can be amplified diately after cell transfer. Couplets are manually aligned by PCR. between the electrodes of a 500 um gap fusion chamber (BTX, San Diego, Calif.) overlaid with sorbitol fusion 0287. The presence of the transgene, in stably transfected medium. A brief fusion pulse is administered by a BTX cells and in transgenic goats, is also confirmed by Southern Electrocell Manipulator 200. After the couplets have been blotting as described in Example 2.3. Fluorescent in situ exposed to the fusion pulse, they are placed into 25ul drops hybridization (FISH) is performed as described in Keefer, et of medium overlaid with mineral oil. Fused couplets are al. Biol. Reprod. (2001) 64:849-856 in order to determine incubated at 38.5-39°C. After 1 hr., couplets are observed for the number of chromosomal integration sites. The FISH fusion. Couplets that have not fused are administered a probe contains only sequences from the insulator region of second fusion pulse. the transgene. US 2006/0253913 A1 Nov. 9, 2006 30
Example 6 0292. In one embodiment, the contruct comprises the WAP gene promoter, the WAP signal sequence, a BChE Pharmacokinentic Studies of Recombinant BChE Produced encoding sequence, and the coding and 3' genomic by Transgenic Mammals sequences of the WAP gene. This WAP signal sequence is 0288 Residence time of recombinant BChE in the cir added using a nucleic acid sequence encoding part of the 5' culation of guinea pigs is determined as described by Raveh, untranslated region and the 19 amino acid signal peptide of et al. Biochemical Pharmacolocy (1993) 42:2465-2474. A the murine WAP gene (position -949 to +89, Hennighausen, sample BchE enzyme, isolated from the milk of transgenic et al. Nucl. Acids Res. (1982) 10:3733-3744). The BChE mammal, is dialyzed against Sterile phosphate-buffered encoding fragment is generated by PCR of a BChE cDNA saline, pH 7.4. The dialyzed enzyme (50-500 units in a (e.g., ATCC #65726) using a 5" primer containing the 90 bp volume of about 250 ul) is administered intravenously into sequence signal sequence flanked by a Kipnl restriction the tail vein of guinea pigs. The injection doses are chosen endonuclease recognition site, and 3' primers containing a to be sufficient to provide a plasma concentration of recom KpnI restriction endonuclease recognition site and 3' BChE binant BChE well above the level of endogenous BChE, as cDNA sequences. The amplification is performed to main estimated by the Elman assay. At various time intervals, tain the correct reading frame. This PCR product is then heparinized blood samples (5-10 ul) are withdrawn from the inserted at the KpnI site at the first exon of WAP. The vector retro-orbital sinus or the toe of the animals and diluted 15 to is prepared for microinjection or transfection by digestion 20-fold in distilled water at 4 LLC. The BchE activity in the with NotI restriction endonuclease and purification of the blood sample is determined using butyrylthiocholine as the linear fragment. substrate for BChE using the assay of Ellman, et al. (1961). Endogenous ChE activity is subtracted from the result. The 7.2. Generation of the Expression Construct pWAP/BChE clearance of recombinant BchE from the circulation is The expression contruct pWAP/BChE (see FIG.9) may be calculated over time. prepared as follows: 0289. To test the efficacy of recombinant BChE in pre Step 1: PCR Amplification of WAP 3' Genomic Sequences vention of organophosphate poisoning, nerve agents 0293. The WAP 3' genomic sequence is PCR amplified (soman, VX or sarin or GF) are administered intravenously from mouse genomic DNA with the following primers: into the tail vein of guinea pigs in a volume of 100 ul PBS. WAP-p1 (5' MT TGG TAC CAG CGG CCG CTC TAG Animals are observed for 24 hours, and the degree of AGGAACTGAAGC AGAGAC CAT GC 3') (SEQID NO: organophosphate poisoning Symptomology recorded. Spe 23) and WAP-p2 (5 GCT GCT CGAGCT TGA TGT TTA cifically, percent Survival is calculated. Blood sampls are AACTGATAA CCCTTCAGT GAG CAG CCGATATAT also taken at 10-20 min post nerve agent injection and GTTTAAACATGC GTT GCC TCATCAGCCTTG TTC assayed for residual BchE activity. The level of BChE 3') (SEQ ID NO: 24). The PCR product is then restricted activity following administration of a nerve agent is a with XhoI and Not. measure of the potency of the recombinant BChE. Step 2: PCR Amplification of WAP Coding Genomic Example 7 Sequences BChE Expression Constructs Based on the WAP 0294 The WAP coding genomic sequence (2630 bp) is Promoter PCR amplified from mouse DNA with the primers WAP-p3 (5' ATA TAT GTT TAA ACA TGC GTT GCC TCA TCA 7.1. Introduction GCCTTGTTC3") (SEQ ID NO: 25) and WAP-p4 (5 ATG 0290 Whey acidic protein (WAP), the major whey pro TTC TCT CTG GAT CCA GGA GTGAAG G 3') (SEQ ID tein in mammals, is expressed at high levels exclusively in NO: 26). The PCR product is then restricted with PmeI and the mammary gland during late pregnancy and lactation. The BamHI. genomic locus of the murine WAP gene consists of 4.4 kb of Step 3: PCR Amplification of the BChE Encoding Sequence 5' flanking promoter sequence, 2.6 kb of coding genomic sequence, and 1.6 kb of 3' flanking genomic DNA. The WAP 0295) The BChE encoding sequence (2370 bp) is PCR promoter may be used to drive expression of heterologous amplified from a pBChE cDNA with the primers: BChE-p1 proteins in the mammary gland of transgenic mammals (5' ATTTCCCCGAAGTATTAC 3') (SEQ ID NO: 27) and Velander, et al. Proc. Natl. Acad. Sci. USA (1992) 89: BChE-p2 (5' TGA TTT TCT GTG GTT ATT 3') (SEQ ID 12003-12007). NO: 28). The PCR product is then blunt ended. 0291 An expression construct based on the whey acidic Step 4: Ligation of the WAP Coding and 3' Genomic protein (WAP) promoter, can be used to preferentially Sequences with the BChE Encoding Sequence express BChE in milk of transgenic animals. In one embodi 0296. The pBluescript vector is restricted with KpnI and ment, the construct is assembled by inserting a BChE Sac II. A linker formed by annealing of the primer sequences encoding sequence between the WAP promoter (position Linker-p1 (5' GGA CCG GTG TTA ACG ATA TCT CTA –949 to +33 nt) at the 5' end, and the WAP coding genomic GAG CGG CCG CT 3) (SEQ ID NO: 29) and Linker-p2 sequence (843 bp; the last 30 base of Exon 3, all of intron (5'CCG GAG CGG CCG CTC TAG AGA TAT CGT TAA 3, and exon 4 including 70 bp of 3' UTR) at the 3' end. The CAC CGG TCC GC 3') (SEQ ID NO: 30) is inserted to expression construct also includes two copies of an insulator generate additional restriction enzyme sites (KpnI, Not, element from the chicken globin locus. The BChE-encoding Xbal, EcoRV. HpaI, AgeI and SacI). The new vector is sequence may contain the BChE signal sequence or the WAP recircularized and then then restricted with EcoRV. The signal sequence. The BChE-encoding sequence may also BChE encoding PCR product of Step 3 is then blunt-ended, contain an epitope tag (e.g., myc and/or his). and ligated to this vector. US 2006/0253913 A1 Nov. 9, 2006
0297. This new construct is restricted with XhoI and distal convoluted tubule in the kidney, is the most abundant NotI, and the WAP 3' genomic sequence PCR product from protein in urine and is evolutionarily conserved in mammals Step 1 is inserted. This construct is then restricted with PmeI Badgett and Kumar, Urologia Internationalis (1998) 61:72 and BamHI and the 2.6 kb WAP coding genomic sequence 75). Thus, the uromodulin promoter is a good candidate for PCR product of Step 2 is inserted, to generate a construct driving the production of recombinant proteins in cells of the wherein the BChE-encoding sequence was linked at its 3' kidney, which will then secrete said proteins into the urine. end to the WAP coding and 3' genomic sequences. 0303 An expression construct comprising a uromodulin Step 5: PCR Amplification of the Chicken f3-Globin Insu promoter and encoding a spider silk protein, puM/5S13, lator Sequence may be used for the construction of a new expression 0298 The insulator fragment is derived from PCR ampli construct, puM/BChE, in which the expression of a BChE fication of chicken genomic DNA with the primers Insula encoding sequence is controlled by the uromodulin promoter tor-p1 (5' TTTTGC GGC CGCTCT AGA CTC GAGGGG (See FIG. 11). The parent puM/5S13 expression construct ACA GCC CCCCCC CAA AG 3') (SEQ ID NO: 31) and contains, in this order: Insulator-p2 (5' TTTTGG ATC CGT CGA CGC CCC ATC A 2.4 kb fragment of the chicken f3-globin insulator; CTC ACT GAC TCC GTC CTG GAG TTG 3') (SEQ ID NO:32). The PCR product is restricted in two independent A 3.4 kb fragment of the goat uromodulin promoter and reactions; one with Not and XhoI, and one with BamHI and signal sequence SalI. The two restricted fragments are then ligated together to generate a 2 kb dimerized insulator fragment with NotI A site for the restriction endonuclease F sel; and BamHI sites on either end. Sequences encoding a spider silk protein; Step 6: Ligation of the WAP Promoter Sequence with the Insulator Fragment A site for the restriction endonuclease Sgfl; and 0299. A pBluescript clone containing the 4.4 kb WAP A 2.8 kb fragment uromodulin 3' genomic DNA. promoter in the pBluescript plasmid clone 483, described in 0304) The puM/5S3 construct is digested with Fsel and Velander, et al. Proc. Natl. Acad. Sci. USA (1992) 89:12003 SgfI to remove the sequence encoding the spider silk pro 12007) is restricted with SaclI and Not I. A linker formed by tein. Please refer to PCT publication No. WO0/15772 (insu annealing of the primer sequences Linker-p3 (5' GGA CTA lator and uromodulin promoter and genomic DNA ele GTTGAT CAG CGG CCGCTATAG GATCC3) (SEQ ID ments), as well as Lazaris, et al. Science (2002) 295: NO: 33) and Linker-p4 (5'GGC CTG GAT CCTATA GCG 472-476 and PCT publication No. WO99/47661 (spider silk GCC GCT GAT CAACTA GTC CGC 3') (SEQ ID NO:34) protein constructs), for disclosure of methods to construct is inserted to generate a recircularized construct of the 4.4 kb pUM/5S13. WAP promoter containing additional restriction sites (SaclI. Spel, BclI. NotI and BamHI). This new construct is then 0305 PCR is performed on a BChE cDNA clone (ATCC, restricted with Not I and BamHI and ligated to the insulator #65726) with a sense primer (5'CAATCA GGC CGG CCA fragment from Step 5. GAA GAT GAC ATCATA ATT GC-3"), (SEQ ID NO: 35) containing an FSeI site (underlined) and an antisense primer Step 7: Generation of pWAP/BChE (5' CTA TGA CTC GAG GCG ATC GCT ATT MT TAG 0300. The BChE/WAP coding and 3' genomic sequence AGACCCA CAC-3) (SEQID NO: 10) including a Sgfl site construct from Step 4 is then restricted with SaclI and AgeI. (underlined) to amplify the sequence encoding the mature The 6.8 kb fragment containing the insulator and WAP human BChE protein. promoter is isolated from the construct of Step 6 by restric tion with Sacland AgeI. These two fragments are ligated to 0306 This PCR product is digested with Fsel and Sgfl, form pWAP/BChE. This final construct contains the dimer and ligated with the Fsel and SgfI fragment of puM/5S13 to ized chicken C-globin gene insulator followed by the WAP replace the spider silk encoding sequence with the BChE 4.4 kb promoter, the BChE gene, and the WAP 2.6 kb coding encoding sequence. This new construct is named puM/ and 1.6 kb 3' genomic sequences (See FIG. 9). BChE. 0301 For microinjection or transfection, pWAP/BChE is 0307 For microinjection or transfection, XhoI and NotI linearized by NotI digestion to remove the vector sequences. digestion of puM/BChE removes the vector backbone and This linearized fragment contains the dimerized insulator, generates a linear DNA fragment. This fragment consists of the WAP promoter and signal sequence, the BChE-encoding the insulator, the uromodulin promoter and signal sequence, sequence, and WAP coding and 3' genomic regions (See the BChE-encoding sequence, and a uromodulin 3' genomic FIG. 10). DNA fragment. Example 8 8.2. Uroplakin II Promoter 0308) A group of membrane proteins known as Expression Constructs for the Production of uroplakins are produced on the apical Surface of the urothe Recombinant BChE in the Urine of Transgenic lium. The term “urothelium” refers collectively to the epi Mammals thleial lining of the ureter, bladder, and urethra. These uroplakin proteins form two-dimensional crystals, known as 8.1. Uromodulin Promoter “urothelial plaques”, which cover over 80% of the apical 0302 Uromodulin, a 90 kD glycoprotein secreted from surface of urothelium (Sun, et al. Mol. Biol. Rep. (1996) the epithelial cells of the thick ascending limbs and the early 23:3-11; Yu, et al. J. Cell Biol. (1994) 125:171-182). These US 2006/0253913 A1 Nov. 9, 2006 32 proteins are urothelium-specific markers, and are conserved II promoter and signal sequence, a BChE-encoding during mammalian evolution (Wu, et al. J. Biol. Chem. sequence, and a uroplakin II 3' genomic fragment. (1994) 269:13716-13724). Example 9 0309 Transgenic mice that express human growth hor mone (hGH) under the control of the mouse uroplakin II Production of Recombinant BChE-hSA Fusion gene promoter have been generated. These mice express the Protein in Cell Culture recombinant hCH in the urothelium, and secrete the recom binant hCH into their urine at a concentration of 100-500 9.1 Assembly of Expression Constructs mg/l (Kerr, et al. Nat. Biotechnol. (1998) 16:75-79). This 0316 Standard recombinant DNA methods employed study is apparently the first report of using urothelium as a herein have been described in detail (see, for example, in bioreactor for the production and secretion of bio-active “Molecular Cloning: A Laboratory Manual. 2nd Edition. molecules. It has subsequently been shown that urothelial Sambrook, et al. Cold Spring Harbor Laboratory:1989, “A cells are involved in urinary protein secretion (Deng, et al. Practical Guide to Molecular Cloning Perbal: 1984, and Proc. Natl. Acad. Sci. USA (2001) 98:154-159). “Current Protocols in Molecular Biology’ Ausubel, et al., 0310. The expression construct puM/BChE, comprising eds. John Wiley & Sons: 1989). All DNA cloning manipu the uromodulin promoter and sequences encoding a BChE lations were performed using E. coli STBII competent cells enzyme (See Example 8.1), may be modified for the con (Canadian Life Science, Burlington, Canada). Restriction struction of the new expression construct pUPII/BChE (See and modifying enzymes were purchased from New England FIG. 12). The pUM/BChE expression construct contains, in BioLabs (Mississauga, ON, Canada). All chemicals used this order: an 2.4 kb fragment of the chicken f-globin were reagent grade and purchased from Sigma Chemical Co insulator, a 3.4 kb fragment of the goat uromodulin promoter (St. Louis, Mo.), and all solutions were prepared with sterile and signal sequence; a site for the restriction endonuclease and nuclease-free WFI water (Hyclone, Tex.). Construct FseI; a BChE-encoding sequence; a site for the restriction integrity was verified by DNA sequencing analysis provided endonuclease SgfI; and a 2.8 kb fragment of uromodulin 3' by McMaster University (Hamilton, ON, Canada). Primers genomic sequence. were synthesized by Sigma Genosys (Oakville, ON, Canada). PCR was performed using Ready-To-Go PCR 0311 Restriction endonuclease sites are introduced at the beads (Pharmacia Biotech, Baie d'Urf, PQ. Canada) or the 5' end (Pacd) and the 3' end (AscI) of the chicken f-globin High Fidelity PCR kit (Roche Diagnostics Canada, Laval, insulator sequence of puM/BChE by conventional PCR to Canada). yield puM/BChEmod. 0317. In the expression contructs for the expression of 0312 PCR is performed on mouse genomic DNA with a recombinant BChE-hSA fusion protein in in vitro cell cul sense primer (5'CAATCAGGC GCGCCCTCG AGG ATC ture, a sequence encoding human BChE-hSA fusion protein TCG GCC CTC TTT CTG 3') (SEQ ID NO:36) containing was under the transcriptional control of a strong constitutive an AscI site (underlined) and an antisense primer (5'CAA promoter and was linked to a signal sequence to provide TCA GGC CGG CCG CAA TAG AGA CCT GCA GTC secretion of the recombinant protein from the cells. CCC GGA G 3') (SEQ ID NO: 37) including a Fsel site (underlined) and partial sequence for the signal peptide of pCMV/BChE-hSA the uroplakin II protein. This PCR amplifies a DNA frag 0318. PCR was performed using pCMV/BChE as a tem ment containing the uroplakin II promoter plus the uroplakin plate with a sense primer Acb710 (5' GTG TAA CTCTCT signal sequence. TTG GAGAAA G 3') (SEQID NO: 5) containing a portion 0313 The uroplakin II PCR product is digested with AscI of 5" BChE sequence and an antisense primer Acb853 (5 and Fsel, and ligated with AscI and Fsel digested puM TATAAG TTT AAA CATATAATT GGA TCC TCC ACC BChE to replace the goat uromodulin promoter with the TCC GCCTCC GAG ACC CACACAACTTTC TTT CTT mouse uroplakin II promoter. This step generates the con G 3') (SEQ ID NO: 6) containing a Pme site (underlined), struct puPII/BChEInt. a BamHI site (italic), a (Gly)-Ser linker (bolded) followed by a portion of 3' BChE sequence. The PCR product was 0314. A PCR is performed on mouse genomic DNA with digested with Xbal and PEmeI, and ligated to Xbal and a sense primer (5'CAT CTG GCG ATC GCT ACC GAG Pmel digested pCMV/BChE to generate pCMV/BChEmd. TACAGA AGGGGA CG-3") (SEQID NO: 38) containing a SgfI site (underlined) and an antisense primer (5'CTAGCA 0319 PCR was performed using Marathon-ready human TGC GGC CGC GTG CTCTAGGACAGCCAGAGC-3') liver cDNA pool (Clontech) as a template with a sense (SEQ ID NO: 39) containing a NotI site (underlined) to primer Acb854 (5 ATA TAAGGA TCC GAT GCA CAC amplify a portion of the uroplakin II genomic sequence. This AAG AGT GAG GTT GCT CAT C.) (SEQ ID NO: 7) PCR product spans uroplakin II genomic sequence from containing a BamHI site (underlined) and partial sequence within exon 4 through the 3' end of the gene, including the from the hSA cDNA 5' end (GenBank #V00495, without the polyA sequence. This PCR product is digested with SgfI and signal sequence), and an antisense primer Acb855 (5' ATT NotI, and then ligated to SgfI and NotI digested puPII/ TAAGTTTAAACT CAT TATAAG CCTAAG GCA GCT TGA CTT GC 3') (SEQ ID NO: 8) including a Pmel site BChEInt. This step replaces the goat uromodulin3' genomic (underlined) and partial sequence from the hSA cDNA 3’ sequences with mouse UPII 3' genomic sequences to gen end. This PCR product was digested with BamHI and PmeI erate the final expression construct puPII/BChE. and inserted into BamHI and PmeI digested pCMV/ 0315 For microinjection or transfection, puPII/BChE is BChEmd to generate the final construct, pCMV/BChE-hSA. linearized by PacI and NotI to remove the vector backbone. This expression construct encodes a BChE-hSA fusion pro This linear fragment consists of the insulator, the uroplakin tein. US 2006/0253913 A1 Nov. 9, 2006
9.2. Transfection and Selection of Stable Cell Lines (Biovest, CP2500 model). Hollow fiber production of stable transfectants was established for large-scale production of Preparation of Expression Constructs for Transfection: recombinant BChE-hSA. Secretion level of the fusion pro 0320) The construct pCMV/BChE-hSA were digested tein in vitro was ~30 mg/L. with FspI, and the resultant FspI-digested linear DNA, was prepared and used for transfection. Briefly, circular expres 9.3. Detection of Recombinant BChE-hSA Fusion Protein in sion construct DNA was purified by the cesium chloride Culture Media of Transfected Cells. gradient technique. This purified DNA was restricted with 0326 Western blotting analysis of non-denaturing PAGE FspI, precipitated, and resuspended in sterile deionized gels and denaturing SDS-PAGE gels was used to detect the Water. presence of recombinant BChE in cell culture media. Cell culture media from pCMV/BChE-hSA transfected MAC-T Stably Transfected MAC-T Cell Lines Expressing a Recom or BHK cells, was electrophoresed on non-denaturing and binant BChE-hSA Fusion: denaturing pre-cast 4-20% TRIS-glycine gels (Invitrogen). 0321 MAC-T cells were seeded at a density of 2.5x10 The samples were then transferred by electroblotting onto cells per 100 mm dish. On the following day, cells were nitrocellulose membranes (Bio-Rad). Recombinant BChE transfected with Lipofectamine Reagent (Invitrogen) with hSA fusion protein on the membranes was detected using 10 ug of the linearized pCMV/BChE-hSA construct. Briefly, rabbit polyclonal antibodies raised against BChE (DAKO) at the DNA was diluted to a final volume of 500 uL with a dilution of 1:1000 and goat anti-rabbit horseradish per DMEM (Invitrogen) and 60 uL of Lipofectamine was oxidase conjugated second antibody. Detection was per diluted to a final volume of 500 uL with DMEM. The two formed according to manufacturer's protocol for enhanced solutions were combined, vortexed for 10 sec and the chemiluminescence (ECL) detection (Amersham Pharma complexes were allowed to form at room temperature for 30 cia). min. DMEM was added to the lipid-DNA mixture up to a final volume of 5 ml. The mixture was then applied to the 0327 In such analyses, the anti-BChE antibodies specifi cells and allowed to incubate overnight at 37° C. under 5% cally detected a protein of the appropriate molecular weight CO. The cells were then cultured for another 24 h in in cell culture media from transfected cells. These results DMEM containing 10% FBS, 5 ug/ml insulin (Sigma). confirmed the production of the recombinant BChE-hSA fusion protein, in transfected cell lines in in vitro culture. 0322 Stably transfected cells were selected in DMEM containing 10% FBS, 5 lug/ml insulin (Sigma), and 100 9.4. BChE-hSA Fusion Protein Activity Gels ug/ml hygromycin B (Invitrogen). Colonies Surviving selec 0328 20 uL of samples of cell culture media from tion were picked 7 to 14 days following transfection and pCMV/BChE-hSA transfected MAC-T and BHK cells, was expanded further. electrophoresed on native 4-20% pre-cast TRIS-glycine gels 0323) The level of BChE activity in cell culture media at 100-125 V overnight and at 4° C. The gels were then from pCMV/BChE-hSA transfected MAC-T cells was stained for BChE activity with 2 mM of butyrylthiocholine evaluated using a commercially available test (Sigma). From iodide according to the Karnovsky and Roots method (Kar over 100 clones tested, the one demonstrating the highest novsky and Roots. Histochem. Cytochem. (1964) 12:219 BChE activity was further evaluated in roller bottles con 221). The staining procedure was performed at ambient taining serum-free DMEM. The amount of BChE activity temperature for two to six hours until the active protein under these conditions was estimated at 0.17 units per bands were revealed. million cells (U/10) per 24 hours. Thus, it was successfully 0329 Conditioned media from MAC-T and BHK cells demonstrated that the recombinant BChE-hSA fusion pro transfected with pCMV/BChE-hSA showed revealed that tein is active. the fusion protein secreted in the cell media consisted of a Stably Transfected BHK Cell Lines Expressing a Recom predominant bioactive species (FIG. 3, lanes 3 and 5: FIG. binant BChE-hSA Fusion: 14, lane 3). This form was confirmed to have the expected molecular mass of approximately 150 kDa when analyzed 0324. These lines were generated using the same proce by Western blot (FIG. 15, lane 3). dure for stable transfection of MAC-T cells with pCMV/ BChE-hSA, with the exception that the cells were BHK 9.5. Purification of BChE-hSA (Baby Hamster Kidney) cells (supplied by Dr. G. Matlesh 0330 All the purification procedures were performed at ewski of McGill University, also available from the ATCC, 4° C. unless otherwise noticed. -30 L of BHK cell media clone #CC1-10) and the selection media contained DMEM were harvested from the hollow fiber system for purification with 10% FBS and 300 ug/ml hygromycin B (Invitrogen). (See Example 9.2). The media were mixed with 50%- Colonies surviving selection were picked 7 to 14 days saturated ammonium sulfate (AS) slowly until it dissolved, following transfection and expanded further. incubated for 1 h and centrifuged at 12,000 g for 30 min. 0325 The level of BChE activity in cell culture media Supernatant was collected, mixed with 80%-saturated AS from pCMV/BChE-hSA transfected BHK cells was evalu slowly until it dissolved and incubated for 1 h prior to ated using a commercially available test (Sigma). From over centrifugation at 12,000 g for 30 min. The pellet was 100 clones tested, the one demonstrating the highest BChE resuspended in buffer A (20 mM sodium phosphate, pH 7.4, activity was further evaluated in roller bottles containing 1 mM EDTA) and dialyzed overnight against buffer B serum-free DMEM. The amount of BChE activity under (buffer A+100 mM NaCl). The dialysate was loaded onto a these conditions was estimated at 0.73 units per million cells procainamide affinity column equilibrated in buffer B. The (U/10) per 24 hours. A master cell bank was generated and column was washed with 10 bed volumes of buffer C (buffer used to initiate a hollow fiber bioreactor production run A+150 mM NaCl), and eluted with buffer D (buffer A+300 US 2006/0253913 A1 Nov. 9, 2006 34 mM NaCl). Fractions were assayed for BChE activity and present in the puC18 vector just upstream of the XhoI site. pooled. The pool was dialyzed overnight against buffer A This ligation generates the final pUC18/BCNN construct, and stored at 4°C. For the BChE-hSA purification from the which contains the B-casein promoter, including sequences milk of transgenic goats, a methodology was developed upto exon 2, followed by an XhoI site, exon 7 and the 3' end based on precipitation of contaminating proteins with AS, of the B-casein gene. followed by anion exchange chromatography and affinity column chromatography (procainamide). The purity of the 0336. The human BChE cDNA was PCR amplified from material was assessed using PAGE stained with a silver a cDNA clone (ATCC #65726) with a sense primer Acb719 staining kit (Bio-Rad). (5' ATA TTC TCG AGAGCC ATG AAG GTC CTC ATC 9.6. Pharmaco-Kinetic Studies on BChE-hSA CTT GCC TGT CTG GTG GCT CTG GCC CTT GCA AGA GAA GAT GAC ATCAT 3') (SEQID NO: 9) containing an 0331 Purified BChE-hSA fusion protein produced from XhoI restriction endonuclease site (underlined), goat BHK cells was injected i.v. into juvenile swine for phar B-casein signal sequence (italic), and a partial human BChE maco-kinetic studies. Analysis of series blood samples using sequence; and an antisense primer, Acb718 (5'CTA TGA the Ellman assay revealed a Substantial enhancement of the CTC GAG GCG ATC GCTATTAATTAGAGA CCCACA mean residence time of the fusion protein (-32 h) when C3") (SEQID NO: 10) containing an XhoI site (underlined) compared with a transgenically produced ruminant huBChE and partial 3' human BChE sequence. The BChE PCR preparation containing >70% tetramer (-3 h) (FIG. 17). product was XhoI digested and subcloned into pGEM-T Example 10 easy vector (Promega), to given the construct named p73. The BChE insert of p73 was excised by digestion with XhoI, Production of Recombinant Human BChE-hSA purified with GFX matrix (Pharmacia Biotech, Baie d'Urf, Fusion Protein in Transgenic Mice PQ, Canada) and ligated with XhoI-digested puC18/BCNN to generate pBCNN-BChE. The generation of pBCNN/ 10. Expression Constructs BCNN/BChE-hSA and Neo BChE is shown schematically in FIG. 4. BCNNABChE-hSA 0332 The goat f-casein promoter, including sequences 0337 The vector puC18/BChE (FIG. 4) was digested through exon 2, were reverse PCR amplified from a genomic with XhoI to remove the BChE insert, blunt-ended by filling DNA library (SphI restriction digest) generated using goat in with Klenow polymerase in the presence of dNTPs, and blood (Clontech Genome Walking Library), using primers CIP treated. Construct pCMV/BChE-hSA (See Example ACB582 (5"CAG CTA GTA TTC ATG GAA GGG CAA 9.1) was partially digested with NcoI to remove the BChE ATGAGG 3') (SEQID NO: 41) and ACB591 (5'TAGAGG hSA encoding sequences, blunt-ended by filling in with TCAGGG ATG CTG CTAAACATT CTG 3') (SEQID NO: Klenow polymerase in the presence of dNTPs, and PmeI 42). The 6.0 kb product was subcloned into the pUC18 digested. The two blunt-ended fragments were ligated to vector (Promega) and designated puC18/5"bCN. generate BCNN/BChE-hSA. PCR cloning was performed to 0333. A 4.5 kb DNA fragment spanning exon 7 and the insert a neomycin resistance gene fragment between the 3' end of the goat f-casein gene was reverse PCR amplified insulators and the B-casein promoter in BCNN/BChE-hSA from the same library (BglII restriction digest) using primers to generate Neo-BCNN/BChE-hSA for nuclear transfer. In ACB583 (5'CCACAGMTTGACTG CGACTG GAAATA these two constructs the signal sequence is the goat B-casein TGG 3') (SEQ ID NO: 43) and ACB601 (5'CTC CAT GGG signal sequence. TAAGCC TAAACATTGAGATCT 3) (SEQID NO. 44). 0338 BCNN/BChE-hSA and Neo-BCNN/BChE-hSA The fragment was subcloned in the puC18 vector as des were digested with NotI, respectively, and the resultant ignated puC18/3'bCN. NotI-digested linear DNA, free of bacterial sequences, was 0334 The 4.3 kb fragment encompassing exon 7 and the prepared and used to generate transgenic mice. Briefly, 3' end of the goat B-casein gene was then PCR amplified circular expression construct DNA was purified by the from puC18/3'bCN, using primer ACB620 (5'CTT TCT cesium chloride gradient technique. This purified DNA was CAG CCC AAA GTT CTG CCT GTTC) (SEQ ID NO: restricted with NotI, electrophoresed, and the linear DNA 45), which introduces NotI and XhoI sites and primer fragment was gel purified. The DNA fragment was then ACB621 (5'CAA GTTCTCTCT CAT CTC CTG CTTCTC mixed with cesium chloride and centrifuged at 20° C. A 3') (SEQ ID NO: 46), which introduces SalI and Not I 60,000 rpm for 16 to 20 hrs in a Beckman L7 ultracentrifuge sites. This fragment was subcloned into the puC18 vector using a Ti70.1 rotor (Beckman Instruments, Fullerton, and designated puC18bCNA. Calif., USA). The DNA band was removed, dialyzed against WFI water for 2-4 hrs, and precipitated in ethanol. The 0335 A 4.9 kb fragment containing the 5' end of the precipitated DNA was resuspended in injection buffer (5 B-casein promoter including sequences through exon 2 was mM Tris pH 7.5, 0.1 mM EDTA, 10 mM NaCl) and dialyzed PCR amplified from puC18/5"bCN using primer ACB618 against the same buffer at 4° C. for 8 hrs. Two additional (5'CAGTGG ACA GAG GAA GAG TCAGAG GAA G3') dialysis steps were performed, one for 16 hrs and the second (SEQ ID NO: 47), which introduces a BamHI and SacI site for at least 8 hrs. After dialysis the DNA was quantitated at the 5' end and primer ACB619 (5' GTATTT ACC TCT using a fluorometer. Prior to use an aliquot was diluted to 2-3 CTT GCA AGG GCC AGAG 3') (SEQID NO: 48), which ng/ml in injection buffer. is near the starting ATG codon and introduces a XhoI site. This fragment was then subcloned into the puC18bCNA 0339. As a result of this preparation, the linear BCNN/ expression vector by digesting with XhoI, which digests at BChE-hSA fragment used to generate transgenic animals the 5' end of the 3' bON fragment and BamHI, which is contained, in this order: US 2006/0253913 A1 Nov. 9, 2006
Dimerized chicken B-globin gene insulator 0344) Primer set A, primers ACB712 (5'CTT CCGTGG Neomycin resistance gene fragment (for Neo-BCNN/BChE CCA GAA TGG AT 3') (SEQ ID NO: 11) and ACB884 hSA only) (5'CCT CACTCTTGT GTG CAT CG 3') (SEQID NO:20), amplifies a 462 bp fragment from the 3' end of the transgene Goat beta-casein promoter spanning the junction of the BChE and albumin sequences. B-casein exon 1: 0345 Primer set B, ACB268 (5' AGG AGC ACA GTG B-casein intron 1: CTCATC CAG ATC3") (SEQ ID NO: 13) and ACB659 (5 GAC GCC CCATCC TCA CTG ACT 3) (SEQID NO: 14), Partial B-casein exon 2: amplifies an 893 bp fragment of the insulator sequence XhoI cloning site; located at the 5' end of the transgene. f-casein signal sequence; 0346 Primer set C, ACB572 (5' TTC CTA GGA TGT BChE-hSA fusion protein encoding sequence; GCT CCA GGCT 3) (SEQ ID NO: 15) and ACB255 (5' GAA ACG GAA TGT TGT GGA GTG G 3') (SEQID NO: A STOP codon; 16) amplifies a 510 bp portion of an endogenous mouse Partial B-casein exon 7; B-casein gene. This primer set serves as in internal positive control to indicate that the extracted DNA can be amplified B-casein intron 7; by PCR. B-casein exon 8; Southern Blotting Analysis: B-casein intron 8; 0347 Confirmation of transgene presence, and estima B-casein exon 9; and tion of transgene copy number, was performed using South Additional B-casein 3' genomic sequence. ern blotting analysis with Boehringer Mannheim's DIG 0340. A schematic depicting the exons and introns of the system. DNA (5ug) extracted from the tails of PCR positive goat B-casein locus that are contained in this fragment is transgenic mice were analysed by restriction enzyme diges shown in FIG. 5. tion (HindIII) and Southern blotting using a nylon mem brane (Roche Diagnostics). The membranes were hybridized 10.2 Production of Founders and Subsequent Generations of with DIG Easy Hyb buffer at 42°C. overnight using a probe Transgenic Mice labeled by the PCR DIG probe synthesis kit (Roche Diag 0341 The production and maintenance of transgenic nostics). The probe was a 780 bp fragment of the BChE mice were conducted at the McIntyre Transgenic Core cDNA, located in the middle of the transgene (probe: Facility of McGill University. Transgenic mice were gener ACB710/ACB819). The membranes were washed twice ated by pronuclear microinjection essentially as described in with 2xSSC 0.1% SDS at room temperature, 5 min each Hogan, et al. “Manipulating the Mouse Embryo: A Labora wash, and followed by two washes with 0.5xSSC 0.1% tory Manual.” Cold Spring Harbor Laboratory, 1986. The SDS at 65° C., 15 min each. Hybridization signals were BCNN/BChE linear fragment was microinjected into fertil detected using the CDP-StarTM substrate and visualized by ized eggs (strain FVB) and 31 pups were born. the Fluor ChemTM 8000 System (Alpha Innotech Corpora 0342. At 2-3 weeks of age tail biopsies were taken, under tion). anesthesia and DNA was prepared according to standard 10.4. Analysis of Recombinant BChE-hSA Fusion Protein in procedures well known to those skilled in the art, and described in detail, for example, in “Molecular Cloning: A the Milk of Transgenic Mice Laboratory Manual. 2nd Edition Sambrook, et al. Cold 0348 Lactating female mice were milked after induction Spring Harbor Laboratory:1989). The presence of the trans with an intraperitoneal injection of 5 i.u. of oxytocin. gene in genomic DNA was confirmed by PCR and/or Southern analysis as described in Identification of transgenic 0349 The milking apparatus is described online (www mice below. Out of 31 tail DNA samples, 3 founders (2 invitrogen.com/Content/Tech-online/molecular biology/ females and 1 male) were confirmed transgene positive. manuals pps/pbc1 man.pdf). The amount of milk that was Southern analysis was also used to estimate transgene copy obtained varied from 50-100 ul. The milk, collected from number. transgenic female mice, was analyzed using the Ellman 10.3. Identification of Transgenic Mice assay and by analysis on non-denaturing PAGE gels stained for BChE activity and Western blot. There were no detect PCR Analysis: able levels of BChE in the F1 females from the male line, 0343 Genomic DNA purified from tail biopsies was probably due to the low copy number of the transgene quantitated by fluorimetry and PCR screened using three integrated. However, the results from the female line clearly different primer sets. PCR was performed with the Ready indicated that BChE activity was present in the milk of the To-Go PCR beads (Pharmacia Biotech). Upon amplification founder and her offspring (Table 2). Non-denaturing PAGE the samples were analysed for the presence of the PCR gels stained for BChE activity revealed that the fusion product by electrophoresis on a 2% agarose gel. The quality protein consisted of a predominant bioactive species (FIG. of the DNA used in these PCR reactions was confirmed by 14, lanes 4 and 5). This form was confirmed to have the the presence of the expected fragment of the endogenous expected molecular mass of approximately 150 kD when mouse B-casein gene. analyzed by Western blotting (FIG. 15 lanes 4 and 5). US 2006/0253913 A1 Nov. 9, 2006 36
Example 11 recent ovulations or corpora lutea present on the ovaries. An average of 11 nuclear transfer-derived embryos (1-cell to Production of Recombinant BChE-hSA Fusion 4-cell stage) are transferred by means of a TomCat catheter Protein in Transgenic Goats threaded into the oviduct ipsilateral to ovulation(s). Donors and recipients are monitored following Surgical procedures 0350 Trangenic goats expressing a recombinant BChE and antibiotics and analgesics are administered according to hSA fusion protein may be generated by nuclear transfer. approved procedures. The nuclear donors are primary fetal goat cells stably transfected with the Neo-BCNN/BChE-hSA linear fragment 11.4. Oocyte Maturation (from Example 10.1). 0358 COCs are cultured in 50 ul drops of maturation 11.1. Generation of Stably Transfected Cell Lines medium covered with an overlay of mineral oil and incu bated at 38.5-39° C. in 5% CO. The maturation medium 0351) Primary fetal goat cells were derived from day 28 consists of M199H (GIBCO) supplemented with b|LH, kinder fetuses recovered from a pregnant Saanen breed bFSH, estradiol B-17, sodium pyruvate, kanamycin, cys female goat, and cultured for 3 days prior to being cyropre teamine, and heat inactivated goat serum. After 23 to 24 hrs served. Chromosome number (2n=60) and sex analysis was of maturation, the cumulus cells are removed from the performed prior to use of cells for transfection experiments. matured oocytes by vortexing the COCs for 1-2 min in Under the culture conditions used, all primary lines had a EmCare containing hyaluronidase. The denuded oocytes are normal chromosome count indicating the absence of gross washed in handling medium (EmCare Supplemented with chromosomal instability during culture. BSA) and returned to maturation medium. The enucleation 0352 Transfections were performed as described in process is initiated within 2 hr of oocyte denuding. Prior to Keefer, et al. Biol. Reprod. (2001) 64:849-856, with the enucleation, the oocytes are incubated in Hoechst 33342 following modifications: Female primary lines were thawed handling medium for 20-30 minutes at 30-33°C. in air and at passage 2, transfected with the linearized Neo-BCNN/ atmosphere. BChE-hSA fragment. Stably transfected cell lines were 11.5. Nuclear Transfer selected with G418 and frozen by day 21 (day 0=transfection date). 0359 Oocytes are placed into manipulation drops (EmCare supplemented with FBS) covered with an overlay 0353. Several stably transfected cell lines have been of mineral oil. Oocytes stained with Hoechst are enucleated derived by this procedure. In all cases the presence of the during a brief exposure of the cytoplasm to UV light (Zeiss transgene has been confirmed by Southern Analysis and by Fluorescence In Situ Hybridization (FISH). Transfected cell Filter Set 01) to determine the location of the chromosomes. lines for which integration of the transgene is confirmed will Stage of nuclear maturation is observed and recorded during serve as donors for nuclear transfer. the enucleation process. 0360 The enucleated oocytes and dispersed donor cells 11.2. Oocyte Donor and Recipient Goats are manipulated in handling medium. Transgenic donor cells 0354) Intravaginal sponges containing 60 mg of medroX are obtained following either in vitro transfection (see yprogesterone acetate (Veramix) are inserted into the vagina Example 3.1) or biopsy of a transgenic goat. Donor cells are of donor goats (Alpine, Saanen, and Boer cross bred goats) prepared by serum starving for 4 days at confluency. Sub and left in place for 10 days. An injection of 125 ug sequently they are trypsinized, rinsed once, and resuspended cloprostenol is given 36 h before sponge removal. Priming in Emcore with serum. Small (<20 um) donor cells with of the ovaries is achieved by the use of gonadotrophin Smooth plasma membranes are picked up with a manipula preparations, including FSH and eCG. One dose equivalent tion pipette and slipped into perivitelline space of the to 70 mg NIH-FSH-P1 of Ovagen is given together with 400 enucleated oocyte. Cell-cytoplast couplets are fused imme IU of eCG (Equinex) 36 h before LOPU (Laparoscopic diately after cell transfer. Couplets are manually aligned Oocyte Pick-Up). between the electrodes of a 500 um gap fusion chamber (BTX, San Diego, Calif.) overlaid with sorbitol fusion 0355 Recipients are synchronized using intravaginal medium. A brief fusion pulse is administered by a BTX sponges as described above for donor animals. Sponges are Electrocell Manipulator 200. After the couplets have been removed on day 10 and an injection of 400 IU of eCG is exposed to the fusion pulse, they are placed into 25ul drops given. Estrus is observed 24-48 h after sponge removal and of medium overlaid with mineral oil. Fused couplets are embryos are transferred 65-70 h after sponge removal. incubated at 38.5-39°C. After 1 hr., couplets are observed for 11.3. Laparoscopic Oocyte Pick-Up (LOPU) and Embryo fusion. Couplets that have not fused are administered a Transfer second fusion pulse. 0356. Donor goats are fasted 24 hours prior to laparos 11.6. Oocyte Activation and Culture copy. Anesthesia is induced with intravenous administration 0361. Two to three hours after application of the first of diazepam (0.35 mg/kg body weight) and ketamine (5 fusion pulse, the fused couplets are activated using calcium mg/kg body weight), and is maintained with isofluorane via ionomycin and 6-dimethylaminopurine (DMAP) or using endotrachial intubation. Cumulus-oocyte-complexes calcium ionomycin and cycloheximide/cytochalasin B treat (COCs) are recovered by aspiration of follicular contents ment. Briefly, couplets are incubated for 5 minutes in under laparoscopic observation. EmCare containing calcium ionomycin, and then for 5 0357 Recipient goats are fasted and anaesthetized in the minutes in EmCare containing BSA. The activated couplets same manner as the donors. A laparoscopic exploration is are cultured for 2.5 to 4 hrs in DMAP, then washed in performed to confirm if the recipient has had one or more handling medium and placed into culture drops (25 Jul in US 2006/0253913 A1 Nov. 9, 2006 37 volume) consisting of G1 medium supplemented with BSA Example 12 under an oil overlay. Alternately, following calcium iono mycin treatment, the activated couplets are cultured for 5 hrs BChE Expression Constructs Based on the WAP in cycloheximide and cytochalasin B, washed, and placed Promoter into culture. Embryos are cultured 12 to 18 hr until embryo transfer. Nuclear transfer derived embryos are transfered on 12.1. Introduction Day 1 (Day 0=day of fusion) into synchronized recipients on 0367. Whey acidic protein (WAP), the major whey pro Day 1 of their cycle (D0=estrus). tein in mammals, is expressed at high levels exclusively in 11.7. Identification of Stably Transfected Cell Lines and of the mammary gland during late pregnancy and lactation. The Transgenic Goats genomic locus of the murine WAP gene consists of 4.4 kb of 5' flanking promoter sequence, 2.6 kb of coding genomic 0362 Following selection of transfected cell lines, sequence, and 1.6 kb of 3' flanking genomic DNA. The WAP genomic DNA is isolated from cell pellets using the DNeasy promoter may be used to drive expression of heterologous Tissue Kit (Qiagen, cat #69506). For each sample, the DNA proteins in the mammary gland of transgenic mammals is eluted in 150-200 ul 0.1x buffer AE and stored at 4° C. Velander, et al. Proc. Natl. Acad. Sci. USA (1992) 89: until ready to use. 12003-12007). 0363 For confirmation of the presence of the transgene in 0368. An expression construct based on the whey acidic nuclear transfer derived offspring, genomic DNA is protein (WAP) promoter, can be used to preferentially extracted from the blood and ear biopsy of 2 week old kids express BChE-hSA fusion protein in milk of transgenic using standard molecular biology techniques. The genomic animals. In one embodiment, the construct is assembled by DNA is isolated from the blood samples using a QIAamp inserting a BChE-hSA fusion protein-encoding sequence DNA Blood Mini Kit (Qiagen, Cat. # 51106), and from the between the WAP promoter (position -949 to +33 nt) at the tissue samples using DNeasy Tissue Kit (Qiagen, cat 5' end, and the WAP coding genomic sequence (843 bp; the #69506). For each sample, the DNA is eluted in 150-200 ul last 30 base of Exon 3, all of intron 3, and exon 4 including 0.1x buffer AE and stored at 4° C. until use. 70 bp of 3' UTR) at the 3' end. The expression construct also 0364 The presence of the transgene, in stably transfected includes two copies of an insulator element from the chicken cells and in transgenic goats, is confirmed by PCR as globin locus. The BChE-hSA fusion protein-encoding described in Example 2.3, except for the following modifi sequence may contain the BChE signal sequence or the WAP cations. Primer set C is replaced with the primers Acb256 (5' signal sequence. The BChE-hSA fusion protein-encoding GAG GAA CAA CAG CAA ACA GAG 3') (SEQ ID NO: sequence may also contain an epitope tag (e.g., myc and/or 21) and Acb312 (5' ACC CTACTG TCTTTCATCAGC 3') his). (SEQ ID NO: 22), which amplify a 360 bp portion of the 0369. In one embodiment, the contruct comprises the endogenous goat B-casein gene. This primer set serves as in WAP gene promoter, the WAP signal sequence, a BChE-hSA internal positive control to indicate that the extracted DNA fusion protein-encoding sequence, and the coding and 3' can be amplified by PCR. genomic sequences of the WAP gene. This WAP signal 0365. The presence of the transgene, in stably transfected sequence is added using a nucleic acid sequence encoding cells and in transgenic goats, is also confirmed by Southern part of the 5' untranslated region and the 19 amino acid blotting as described in Example 2.3. Fluorescent in situ signal peptide of the murine WAP gene (position -949 to hybridization (FISH) is performed as described in Keefer, et +89, Hennighausen, et al. Nucl. Acids Res. (1982) 10:3733 al. Biol. Reprod. (2001) 64:849-856 in order to determine 3744). The BChE encoding fragment is generated by PCR of the number of chromosomal integration sites. The FISH a BChE cDNA (e.g., ATCC #65726) using a 5' primer probe contains only sequences from the insulator region of containing the 90 bp sequence signal sequence flanked by a the transgene. Kpnl restriction endonuclease recognition site, and 3' prim 0366 A total of 8 transgenic goats were generated using ers containing a Kipnl restriction endonuclease recognition NT and two cell lines with the expression vector, Neo site and 3' BChE clNA sequences. The amplification is BCNN/BChE-hSA, as determined by PCR, Southern blot performed to maintain the correct reading frame. This PCR and FISH analyses. These animals have 2-3 integration sites product is then inserted at the KpnI site at the first exon of and contain a variety of transgene copy numbers in their WAP. The vector is prepared for microinjection or transfec respective genome. Of the 8 cloned transgenic goats 3 were tion by digestion with NotI restriction endonuclease and induced hormonally into lactation. Goat 2217 expressed in purification of the linear fragment. average ~1.5 g/L whereas the other two expressed -0.1 g/L. 12.2. Generation of the Expression Construct DWAP/BChE as determined by the Ellman assay (Table 2). Furthermore, hSA goat 2217 was in natural lactation, producing 1 g/L of the fusion protein. ~7.5 g of bioactive BChE/hSA were purified The expression contruct pWAP/BChE-hSA may be prepared from approximately 8.7 L of milk. The purity as assessed by as follows: silver staining is estimated to be >90% (FIG. 16). Specific activity of the purified enzyme is ~400 U/mg. This activity Step 1: PCR Amplification of WAP 3' Genomic Sequences is as expected, approximately half of that of the BChE since 0370. The WAP 3' genomic sequence is PCR amplified the molecule is a hybrid of BChE and hSA. Non-denaturing from mouse genomic DNA with the following primers: PAGE gels stained for BChE activity and Western blot WAP-p1 (5' MT TGG TAC CAG CGG CCG CTC TAG revealed that the fusion protein consisted of a predominant AGGAACTGAAGC AGAGAC CAT GC 3') (SEQID NO: bioactive species with the expected molecular mass (FIG. 23) and WAP-p2 (5 GCT GCT CGAGCT TGA TGT TTA 14, lanes 7, 8, 9; FIG. 15, lanes 7, 8, 9). AACTGATAA CCCTTCAGT GAG CAG CCGATATAT US 2006/0253913 A1 Nov. 9, 2006
GTTTAAACATGC GTT GCC TCATCAGCCTTG TTC Velander, et al. Proc. Natl. Acad. Sci. USA (1992) 89:12003 3') (SEQ ID NO: 24). The PCR product is then restricted 12007 is restricted with SaclI and Not I. A linker formed by with XhoI and Not. annealing of the primer sequences Linker-p3 (5' GGA CTA Step 2: PCR Amplification of WAP Coding Genomic GTTGAT CAG CGG CCGCTATAG GAT CC3) (SEQ ID Sequences NO: 33) and Linker-p4 (5'GGC CTG GAT CCTATA GCG GCC GCT GAT CAACTA GTC CGC 3') (SEQ ID NO:34) 0371 The WAP coding genomic sequence (2630 bp) is is inserted to generate a recircularized construct of the 4.4 kb PCR amplified from mouse DNA with the primers WAP-p3 WAP promoter containing additional restriction sites (SaclI. (5' ATA TAT GTT TAA ACA TGC GTT GCC TCA TCA Spel, BclI. NotI and BamHI). This new construct is then GCCTTGTTC3") (SEQ ID NO:25) and WAP-p4 (5 ATG restricted with Not I and BamHI and ligated to the insulator TTC TCT CTG GAT CCA GGA GTGAAG G 3') (SEQ ID fragment from Step 5. NO: 26). The PCR product is then restricted with PmeI and BamHI. Step 7: Generation of pWAP/BChE-hSA 0377 The BChE-hSA/WAP coding and 3' genomic Step 3: PCR Amplification of the BChE-hSA Fusion Protein sequence construct from Step 4 is then restricted with SaclI Encoding Sequence and AgeI. The 6.8 kb fragment containing the insulator and 0372 The BChE-hSA encoding sequence is PCR ampli WAP promoter is isolated from the construct of Step 6 by fied from the pCMV/BChE-hSA (See Example 9.1) with the restriction with SaclI and AgeI. These two fragments are primers: a sense primer BChE-p1 (5' ATTTCC CCG AAG ligated to form pWAP/BChE-hSA. This final construct con TAT TAC 3') (SEQ ID NO: 27) and an antisense primer tains the dimerized chicken f-globin gene insulator followed Acb855 (5' ATT TAAGTTTAAACT CAT TATAAG CCT by the WAP 4.4 kb promoter, the BChE-hSA, and the WAP AAG GCA GCT TGA CTTGC 3') (SEQ ID NO: 8). The 2.6 kb coding and 1.6 kb 3' genomic sequences (See FIG. 9). PCR product is then blunt ended. 0378 For microinjection or transfection, pWAP/BChE Step 4: Ligation of the WAP Coding and 3' Genomic hSA is linearized by NotI digestion to remove the vector Sequences with the BChE-hSA Fusion Protein Encoding sequences. This linearized fragment contains the dimerized Sequence insulator, the WAP promoter and signal sequence, the BChE 0373) The pBluescript vector is restricted with KpnI and hSA-encoding sequence, and WAP coding and 3' genomic Sac II. A linker formed by annealing of the primer sequences regions (See FIG. 10). Linker-p1 (5' GGA CCG GTG TTA ACG ATA TCT CTA Example 13 GAG CGG CCG CT 3) (SEQ ID NO: 29) and Linker-p2 (5'CCG GAG CGG CCG CTC TAG AGA TAT CGT TAA CAC CGG TCC GC 3') (SEQ ID NO: 30) is inserted to Expression Constructs for the Production of generate additional restriction enzyme sites (KpnI, Not, BChE-hSA Fusion Protein in the Urine of Xbal, EcoRV. HpaI, AgeI and SaclI). The new vector is Transgenic Mammals recircularized and then then restricted with EcoRV. The 13.1. Uromodulin Promoter BChE-hSA fusion protein encoding PCR product of Step 3 0379 Uromodulin, a 90 kD glycoprotein secreted from is then blunt-ended, and ligated to this vector. the epithelial cells of the thick ascending limbs and the early 0374. This new construct is restricted with XhoI and distal convoluted tubule in the kidney, is the most abundant NotI, and the WAP 3' genomic sequence PCR product from protein in urine and is evolutionarily conserved in mammals Step 1 is inserted. This construct is then restricted with PmeI Badgett and Kumar, Urologia Internationalis (1998) 61:72 and BamHI and the 2.6 kb WAP coding genomic sequence 75). Thus, the uromodulin promoter is a good candidate for PCR product of Step 2 is inserted, to generate a construct driving the production of recombinant proteins in cells of the wherein the BChE-encoding sequence was linked at its 3' kidney, which will then secrete said proteins into the urine. end to the WAP coding and 3' genomic sequences. 0380. An expression construct comprising a uromodulin Step 5: PCR Amplification of the Chicken f3-Globin Insu promoter and encoding a spider silk protein, puM/5S13, lator Sequence may be used for the construction of a new expression 0375. The insulator fragment is derived from PCR ampli construct, puM/BChE-hSA, in which the expression of a fication of chicken genomic DNA with the primers Insula BChE-hSA fusion protein encoding sequence is controlled tor-p1 (5' TTTTGC GGC CGCTCT AGA CTC GAGGGG by the uromodulin promoter (See FIG. 11). The parent ACA GCC CCCCCC CAA AG 3') (SEQ ID NO: 31) and pUM/5ul 3 expression construct contains, in this order: Insulator-p2 (5' TTTTGG ATC CGT CGA CGC CCC ATC A 2.4 kb fragment of the chicken f3-globin insulator; CTC ACT GAC TCC GTC CTG GAG TTG 3') (SEQ ID NO:32). The PCR product is restricted in two independent A 3.4 kb fragment of the goat uromodulin promoter and reactions; one with Not and XhoI, and one with BamHI and signal sequence SalI. The two restricted fragments are then ligated together A site for the restriction endonuclease F sel; to generate a 2 kb dimerized insulator fragment with NotI and BamHI sites on either end. Sequences encoding a spider silk protein; Step 6: Ligation of the WAP Promoter Sequence with the A site for the restriction endonuclease Sgfl; and Insulator Fragment A 2.8 kb fragment uromodulin 3' genomic DNA. 0376 A pBluescript clone containing the 4.4 kb WAP 0381) The puM/5S13 construct is digested with Fsel and promoter in the pBluescript plasmid clone 483, described in SgfI to remove the sequence encoding the spider silk pro US 2006/0253913 A1 Nov. 9, 2006 39 tein. Please refer to PCT publication No. WO00/15772 0388 Restriction endonuclease sites are introduced at the (insulator and uromodulin promoter and genomic DNA 5' end (Pacd) and the 3' end (Ascl) of the chicken f3-globin elements), as well as Lazaris, et al. Science (2002) 295: insulator sequence of puM/BChE by conventional PCR to 472-476 and PCT publication No. WO99/47661 (spider silk yield puM/BChEmod. protein constructs), for disclosure of methods to construct pUM/5S13. 0389) PCR is performed on mouse genomic DNA with a sense primer (5'CAATCAGGC GCG CCC TCG AGG ATC 0382 PCR is performed on the pCMV/BChE-hSA (See TCG GCC CTCTTT CTG 3') (SEQ ID NO:36) containing Example 9.1) with a sense primer (5'CAATCA GGC CGG an AscI site (underlined) and an antisense primer (5'CAA CCA GAAGAT GAC ATCATAATT GC-3"), (SEQ ID NO: TCA GGC CGG CCG CAA TAG AGA CCT GCA GTC 35) containing an FseI site (underlined) and an antisense CCC GGA G 3') (SEQ ID NO: 37) including a Fsel site primer (5'CTATGA CTC GAG GCG ATC ACT CAT TAT (underlined) and partial sequence for the signal peptide of AAG CCT AAG GCA GCTTGACTT GC-3) (SEQ ID the uroplakin II protein. This PCR amplifies a DNA frag NO: 51) including a Sgfl site (underlined) to amplify the ment containing the uroplakin II promoter plus the uroplakin sequence encoding the BChE-hSA fusion protein. signal sequence. 0383) This PCR product is digested with Fsel and Sgfl, 0390 The uroplakin II PCR product is digested with AscI and ligated with the Fsel and SgfI fragment of puM/5S13 to and Fsel, and ligated with AscI and Fse digested puM replace the spider silk encoding sequence with the BChE BChE-hSA to replace the goat uromodulin promoter with hSA fusion protein encoding sequence. This new construct the mouse uroplakin II promoter and generate the construct is named puM/BChE-hSA. pUPII/BChE-hSAInt. 0384 For microinjection or transfection, XhoI and NotI 0391) A PCR is performed on mouse genomic DNA with digestion of puM/BChE-hSA removes the vector backbone a sense primer (5'CAT CTG GCG ATC GCT ACC GAG and generates a linear DNA fragment. This fragment con TACAGA AGGGGA CG-3") (SEQ ID NO: 38) containing sists of the insulator, the uromodulin promoter and signal a SgfI site (underlined) and an antisense primer (5'CTAGCA sequence, the BChE-hSA fusion protein-encoding sequence, TGC GGC CGC GTG CTCTAGGACAGCCAGAGC-3') (SEQ ID NO: 39) containing a NotI site (underlined) to and a uromodulin 3' genomic DNA fragment. amplify a portion of the uroplakin II genomic sequence. This 13.2. Uroplakin II Promoter PCR product spans uroplakin II genomic sequence from within exon 4 through the 3' end of the gene, including the 0385) A group of membrane proteins known as polyA sequence. This PCR product is digested with SgfI and uroplakins are produced on the apical Surface of the urothe NotI, and then ligated to SgfI and NotI digested puPII/ lium. The term “urothelium” refers collectively to the epi BChE-hSAInt. This step replaces the goat uromodulin 3' thleial lining of the ureter, bladder, and urethra. These genomic sequences with mouse UPII 3' genomic sequences uroplakin proteins form two-dimensional crystals, known as to generate the final expression construct puPII/BChE-hSA. “urothelial plaques”, which cover over 80% of the apical surface of urothelium (Sun, et al. Mol. Biol. Rep. (1996) TABLE 6 23:3-11; Yu, et al. J. Cell Biol. (1994) 125:171-182). These proteins are urothelium-specific markers, and are conserved Summary of transgenic animals producing during mammalian evolution (Wu, et al. J. Biol. Chem. the BChE/hSA fusion protein (1994) 269:13716-13724). Transgene Inte- Expression Transgenic Gen- copy gration in milk 0386 Transgenic mice that express human growth hor animal Animal ID eration number site (gL) mone (hGH) under the control of the mouse uroplakin 11 gene promoter have been generated. These mice express the Mice 307-1F FO 40 ND O.28 307-1A2F F1 1-2 ND O.34 recombinant hCH in the urothelium, and secrete the recom 307-1A7F F1 8-10 ND O.32 binant hCH into their urine at a concentration of 100-500 307-1A7A2F F2 8-10 ND O.24 mg/l (Kerr, et al. Nat. Biotechnol. (1998) 16:75-79). This 307-1A7A4F F2 1-2 ND 0.44 study is apparently the first report of using urothelium as a Goats 2176F FO 18-28 2 O.10 bioreactor for the production and secretion of bio-active 2177F FO 6-10 1-2 1...SO molecules. It has subsequently been shown that urothelial 2178F FO 18-28 2-3 O.10 cells are involved in urinary protein secretion (Deng, et al. ND, not determined. Proc. Natl. Acad. Sci. USA (2001) 98:154-159). 0392 For microinjection or transfection, puPII/BChE 0387. The expression construct puM/BChE-hSA, com hSA is linearized by PacI and NotI to remove the vector prising the uromodulin promoter and sequences encoding a backbone. This linear fragment consists of the insulator, the BChE-hSA fusion protein (See Example 5.1), may be modi uroplakin II promoter and signal sequence, a BChE-hSA fied for the construction of the new expression construct fusion protein-encoding sequence, and a uroplakin II 3' pUPII/BChE-hSA. The puM/BChE-hSA expression con genomic fragment. struct contains, in this order: a 2.4 kb fragment of the chicken f3-globin insulator, a 3.4 kb fragment of the goat 0393. The present invention is not to be limited in scope uromodulin promoter and signal sequence; a site for the by the specific embodiments described herein. Indeed, vari restriction endonuclease F sel; a BChE-hSA fusion protein ous modifications of the invention in addition to those encoding sequence; a site for the restriction endonuclease described herein will become apparent to those skilled in the Sgfl; and a 2.8 kb fragment of uromodulin 3' genomic art from the foregoing description and the accompanying Sequence. figures. Such modifications are intended to fall within the US 2006/0253913 A1 Nov. 9, 2006 40 scope of the appended claims. It is further to be understood 0421) Hermes, et al. Proc. Natl. Acad. Sci. USA (1990) that all values are approximate, and are provided for descrip 87:696-7OO. tion. 0422 Hoffman, et al. J. Toxicol Clin Toxicol (1996) 0394 Patents, patent applications, product descriptions, 34:259-266. publications, and protocols are cited throughout this appli 0423 Hogan, et al. eds. Manipulating the Mouse cation, the disclosures of which are incorporated herein by Embryo: A Laboratory Manual (1986). Cold Spring Har reference in their entireties for all purposes. bor Laboratory. CITED REFERENCES 0424 Jackson and Abbott, eds. Mouse Genetics and Transgenics: A Practical Approach (2000). Oxford Uni 0395 Allon, et al. Toxicol. Sci. (1998) 43:121-128. versity Press. 0396 Altamirano, et al. J Neurochemistry (2000) 74:869 877. 0425 Huston et al., PNAS (1988) 85:5879-5883. 0397 Andres, et al. Proc Natl Acad Sci USA (1987) 0426 Kamovsky and Roots. Histochem. Cytochem. 84(5):1299-1303. (1964) 12:219-221. 0398 Arkin, et al. Proc. Natl. Acad. Sci. USA (1992) 0427. Keefer, et al. Biol. Reprod. (2001) 64:849-856. 89:7811-7815 0428 Keefer, et al. Biol. Reprod. (2002) 66:199-203. 0399 Ashani, et al. Biochem Pharmacol (1991) 41:37 0429 Kerr, et al. Nat. Biotechnol. (1998) 16:75-79. 41. 0430. Lazaris, et al. Science (2002) 295: 472-476. 0400 Ausubel, et al., eds. Current Protocols in Molecular 0431 Krejci et al. J. Biol. Chem. (1997) 272:22840 Biology (1989) John Wiley & Sons. 22847. 0401 Badgeft and Kumar. Urologia Internationalis 0432 Lebkowski, et al. Mol Cell Biol (1988) 8(10):3988 (1998) 61:72-75. 3996. 0402 Baranyi, et al. Gene (1996) 174(1):27-34. 0433) Lee, et al. Nucleic Acids Res. (1988) 16:1027 0403 Blong, et al. Biochem J. (1997) 327:747-757. 1041. 0404 Bon, et al. J. Biol. Chem. (1997) 272(5):3016 0434 Lockridge and La Du, J Biol Chem (1978) 3O21. 253:361-366. 04.05 Brandeis, et al. Pharmacol Biochem Behav (1993) 0435 Lockridge, et al. Biochemistry (1997) 36:786-795. 46:889-896. 0436 Lockridge, et al. Biochemistry (1997) 36(4):786 0406 Broomfield, et al. J Pharmacol Exp Ther (1991) 795. 259:633-638. 0437. Lynch, et al Toxicol Appl Pharmacol (1997) 04.07 Cadwell, et al. PCR Methods and Applications 145:363-371. (1992) 2:28-33. 0438 Masson, et al. J. Biol Chem (1993) 268(19): 14329 0408 Cascio, et al. Minerva Anestesiol (1998). 54:337. 41. 04.09 Chitlaru, et al. Biochem. J. (1998) 336:647-658. 0439 Masters, ed. Animal Cell Culture: A Practical 0410 Cibelli, et al. Science (1998) 280: 1256-8. Approach 3rd Edition (2000). Oxford University Press. 0411 Davis, J. M. ed. Basic Cell Culture 2nd Edition 0440 McClenaghan, et al. Biochem J. (1995) 3 (2002). Oxford University Press. 10(Pt.2):637-641. 0412 Deng, et al. Proc. Natl. Acad. Sci. USA (2001) 0441. McKnight, et al. Proc Natl Acad Sci USA (1992) 98:154-159. 89:6943-6947. 0442. McKnight, et al. Mol Reprod Dev (1996) 44(2): 0413 Ebert, et al. Biotechnology (1994) 12:699-702. 179-184. 0414 Ellman et al. Biochem Pharmacol (1961) 7:88-95. 0443 McTiernan, et al. Proc. Natl. Acad. Sci USA (1987) 0415 Felgner, et al., eds. Artificial Self-assembling Sys 84:6682-6686. tems for Gene Delivery (1996). Oxford University Press. 0444 Murphy, et al., Eds. Transgenesis Techniques 0416) Greener, et al. Strategies in Mol. Biol. (1995) 7:32. (1993). Human Press, Totowa, N.J. 0417 Gutierrez, et al. Transgenic Research (1996) 0445) Murray, et al., eds. Transgenic Animals in Agricul 5(4):271-279. ture (1999). Oxford University Press. 0418) Harduin-Lepers, et al. Biochimie (2001) 83:727 0446. Oliphant, et al. Gene (1986) 44:177-183. 737. 0447 Page, et al. Transgenic Res (1995) 4(6):353–360. 0419) Hennet. Cell Mol. Life Sci. (2002) 59:1081-1095 0448 Perbal A Practical Guide to Molecular Cloning, 0420 Hennighausen, et al. Nucl. Acids Res. (1982) 2nd Edition (1988). Wiley. Platteborze and Broomfield. 10:3733-3744. Biotechnol Appl. Biochem (2000) 31:225-229. US 2006/0253913 A1 Nov. 9, 2006
0449) Prody, et al. Proc. Natl. Acad. Sci. USA (1987) 0462 Syed et al., Blood (1997) 89:3243-3252. 84:3555-3559. 0463 Takashima, et al. J. Biol. Chem. (2002) 277:45719 0450 Puhler, Ed. Genetic Engineering of Animals 45728. (1993). A.VCH Verlagsgesellschaft, Weinheim, N.Y. 0464 Velander, et al. Proc. Natl. Acad. Sci. USA (1992) 0451 Raveh, et al. Biochem Pharmacol (1993) 89:12OO3-1 2007. 45(12):2465-2474. 0465) Vilotte, et al. Eur. J. Biochem. (1989) 186: 43-48. 0452 Raveh, et al. Toxicol. Appl. Pharmacol. (1997) 0466 Wang, et al. Molecular Reproduction and Devel 145:43-53. opment (2002) 63:437-443. 0453 Rosenberg, et al. Life Sciences (2002) 72:125-134. 0467 Wei, et al. Biochem Pharmacol (2000) 60(1): 121 0454 Sambrook, et al. Molecular Cloning: A Laboratory 126. Manual 2nd Edition (1989). Cold Spring Harbor Labora tory. 0468 Wilmut, et al. Nature (1997) 385: 810-813. 0469 Wolfe, et al Toxicol Appl Pharmacol (1992) 0455 Saxena, et al. Biochemistry (1997) 36:7481-7489. 117(2):189-193. 0456 Saxena, et al. Molec. Pharmacol. (1998) 53:112 0470 Wu, et al. J. Biol. Chem. (1994) 269:13716-13724. 122. 0471) Xie, et al. Molec. Pharmacol. (1999) 55:83-91. 0457 Sikri, et al. Biochem. J. (1985) 225:481-486. 0472 Yu, et al. J. Cell Biol. (1994) 125:171-182. 0458 Soreq et al. EMBO Journal 1984 3(6): 1371-1375. 0473 Yuan, et al. Acta Pharmacologica Sinica, (1999) 0459 Soreq et al. J. Biol. Chem. (1989) 264:10608 20:74-80. 10613. 0474 Zbikowska, et al. Biochem J. (2002)365(Ptl):7-11. 0460 Stacey, et al. Mol. Carcinog. (1990) 3:216-225. 0475 Zbikowska, et al. Transgenic Res 2002 11 (4):425 0461 Sun, et al. Mol. Biol. Rep. (1996) 23:3-11. 435.
SEQUENCE LISTING
<160> NUMBER OF SEQ ID NOS : 51 <210> SEQ ID NO 1 &2 11s LENGTH 1725 &212> TYPE DNA <213> ORGANISM: Homo sapiens <400 SEQUENCE: 1 gaagatgaca toataattgc aacaaagaat ggaaaagttca gagggatgaa cittgacagtt 60 tttggtggca cqgta acago citttcttgga attcccitat g cacagocacc tottggtaga 120 citt.cgattoa aaaag.ccaca gttctotgacc aagtggtotg at atttggaa toccacaaaa 18O tatgcaaatt cittgctgtca galacatagat caaagttitt C caggct tcca to gatcagag 240 atgtggalacc caaac actoga cctoagtgaa gactgttitat atctaaatgt atggattcca 3OO gcaccitaaac caaaaaatgc cactgtattg atatggattt atggtggtgg ttittcaaact 360 ggalacatcat citttacatgt titatgatggc aagtttctgg citcgggttga aagagittatt 420 gtagtgtcaa togaactatag ggtgggtgcc ctaggattct tagctttgcc aggaaatcct 480 gaggctc.cag ggaac atggg tittatttgat caa.cagttgg citcttcagt g g gttcaaaaa 540 aatatagoag cctttggtgg aaatcctaaa agtgtaactic totttggaga aagtgcagga 600 gcagottcag ttagcctgca tttgctttct cotggaagcc attcattgtt caccagagcc 660
attctgcaaa gtggttccitt taatgct cot toggg.cggtaa catctottta toaa.gctagg 720
aacagaacgt togaacttagc taaattgact ggttgcticta gaga gaatga gactgaaata 78O
atcaagtgtc. ttagaaataa agatc.cccala galaattcttic togaatgaagc atttgttgtc 840
cccitatggga citcctttgtc. agtaaactitt ggtocq accg to gatggtga ttittct cact 9 OO US 2006/0253913 A1 Nov. 9, 2006 42
-continued gacatgccag acatattact toga acttgga caatttaaaa aaa.cccagat tittggtgggit 96.O gttaataaag atgaagggiac agcttttitta gtctatogto citcctggctt cagoaaagat O20 aacaatagta toatalactag aaaagaattt caggaaggitt taaaaatatt tttitcCagga O8O gtgagtgagt ttggaaagga atc catcc tt titt cattaca cag actoggt agatgat cag 14 O agacctgaaa act accgtga ggc cittgggit gatgttgttg gggattataa titt catatgc 200 cctgccttgg agttcaccala gaagttctica gaatggggaa ataatgc citt tttctacitat 260 tittgaacacc gatcct coaa actitc.cgtgg cca gaatgga tigggagtgat gcatggctat 320 gaaattgaat ttgtc.tttgg tttacctotg gaaagaagag ataattacac aaaag.ccgag 38O gaaattittga gtag atcc at agtgaaacgg toggcaaatt ttgcaaaata toggaatcca 4 40 aatgagacitc agaacaatag cacaagctgg cct gtc.ttca aaag cactga acaaaaatat 5 OO citaaccttga atacagagtc. aacaagaata atgacgaaac tacgtgctoa acaatgtc.ga 560 ttctggacat cattttittco aaaagtc.ttg gaaatgacag gaaatattga tigaag cagaa 62O tgggagtgga aag caggatt coatcgctgg aacaattaca tatggact g gaaaaatcaa 680 tittaac gatt acactago aa gaaagaaagt totgtggg to tctaa 725
<210> SEQ ID NO 2 &2 11s LENGTH 574 &212> TYPE PRT <213> ORGANISM: Homo sapiens <400 SEQUENCE: 2 Glu Asp Asp Ile Ile Ile Ala Thr Lys Asn Gly Lys Val Arg Gly Met 1 5 10 15 Asn Leu Thr Val Phe Gly Gly. Thr Val Thr Ala Phe Leu Gly Ile Pro 2O 25 30 Tyr Ala Glin Pro Pro Leu Gly Arg Lieu Arg Phe Lys Lys Pro Glin Ser 35 40 45 Lieu. Thir Lys Trp Ser Asp Ile Trp Asn Ala Thr Lys Tyr Ala Asn. Ser 50 55 60 Cys Cys Glin Asn Ile Asp Gln Ser Phe Pro Gly Phe His Gly Ser Glu 65 70 75 8O Met Trp Asn Pro Asn. Thir Asp Leu Ser Glu Asp Cys Lieu. Tyr Lieu. Asn 85 90 95 Val Trp Ile Pro Ala Pro Lys Pro Lys Asn Ala Thr Val Leu Ile Trp 1 OO 105 110 Ile Tyr Gly Gly Gly Phe Gln Thr Gly. Thir Ser Ser Leu. His Val Tyr 115 120 125 Asp Gly Lys Phe Leu Ala Arg Val Glu Arg Val Ile Val Val Ser Met 130 135 1 4 0 Asn Tyr Arg Val Gly Ala Leu Gly Phe Leu Ala Lieu Pro Gly Asn Pro 145 15 O 155 160 Glu Ala Pro Gly Asn Met Gly Lieu Phe Asp Glin Glin Lieu Ala Leu Glin 1.65 170 175 Trp Val Glin Lys Asn. Ile Ala Ala Phe Gly Gly Asn Pro Lys Ser Val 18O 185 19 O Thr Lieu Phe Gly Glu Ser Ala Gly Ala Ala Ser Val Ser Lieu. His Lieu 195 200 2O5 US 2006/0253913 A1 Nov. 9, 2006 43
-continued Leu Ser Pro Gly Ser His Ser Leu Phe Thr Arg Ala Ile Leu Glin Ser 210 215 220 Gly Ser Phe Asn Ala Pro Trp Ala Val Thr Ser Leu Tyr Glu Ala Arg 225 230 235 240 Asn Arg Thr Lieu. Asn Lieu Ala Lys Lieu. Thr Gly Cys Ser Arg Glu Asn 245 250 255 Glu Thr Glu Ile Ile Lys Cys Lieu Arg Asn Lys Asp Pro Glin Glu Ile 260 265 27 O Leu Leu Asn Glu Ala Phe Val Val Pro Tyr Gly Thr Pro Leu Ser Val 275 280 285 Asn Phe Gly Pro Thr Val Asp Gly Asp Phe Leu Thr Asp Met Pro Asp 29 O 295 3OO Ile Leu Lieu Glu Lieu Gly Glin Phe Lys Lys Thr Glin Ile Leu Val Gly 305 310 315 320 Val Asn Lys Asp Glu Gly Thr Ala Phe Lieu Val Tyr Gly Ala Pro Gly 325 330 335 Phe Ser Lys Asp Asn. Asn. Ser Ile Ile Thr Arg Lys Glu Phe Glin Glu 340 345 35 O Gly Leu Lys Ile Phe Phe Pro Gly Val Ser Glu Phe Gly Lys Glu Ser 355 360 365 Ile Leu Phe His Tyr Thr Asp Trp Val Asp Asp Glin Arg Pro Glu Asn 370 375 38O Tyr Arg Glu Ala Leu Gly Asp Val Val Gly Asp Tyr Asn. Phe Ile Cys 385 390 395 400 Pro Ala Lieu Glu Phe Thr Lys Llys Phe Ser Glu Trp Gly Asn. Asn Ala 405 410 415 Phe Phe Tyr Tyr Phe Glu His Arg Ser Ser Lys Leu Pro Trp Pro Glu 420 425 43 O Trp Met Gly Val Met His Gly Tyr Glu Ile Glu Phe Val Phe Gly Leu 435 4 40 4 45 Pro Leu Glu Arg Arg Asp Asn Tyr Thr Lys Ala Glu Glu Ile Leu Ser 450 455 460 Arg Ser Ile Val Lys Arg Trp Ala Asn. Phe Ala Lys Tyr Gly Asn Pro 465 470 475 480 Asn Glu Thr Glin Asn Asn Ser Thr Ser Trp Pro Val Phe Lys Ser Thr 485 490 495 Glu Gln Lys Tyr Leu Thir Leu Asn Thr Glu Ser Thr Arg Ile Met Thr 5 OO 505 51O. Lys Leu Arg Ala Glin Glin Cys Arg Phe Trp Thir Ser Phe Phe Pro Lys 515 52O 525 Val Lieu Glu Met Thr Gly Asn. Ile Asp Glu Ala Glu Trp Glu Trp Lys 530 535 540 Ala Gly Phe His Arg Trp Asn. Asn Tyr Met Met Asp Trp Lys Asn Glin 545 550 555 560 Phe Asn Asp Tyr Thr Ser Lys Lys Glu Ser Cys Val Gly Lieu 565 570
<210> SEQ ID NO 3 &2 11s LENGTH 34 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: PCR primer Ach787 US 2006/0253913 A1 Nov. 9, 2006 44
-continued
<400 SEQUENCE: 3 agagaggggg cccaagaaga tigacatcata attg 34
<210> SEQ ID NO 4 &2 11s LENGTH 34 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: PCR primer Ach786 <400 SEQUENCE: 4 citgc gagttt aaactattaa ttagaga.ccc acac 34
<210 SEQ ID NO 5 <211& LENGTH 22 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: PCR primer Ach710 <400 SEQUENCE: 5 gtgtaactict citttggagaa ag 22
<210> SEQ ID NO 6 &2 11s LENGTH 67 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: PCR primer Ach853 <400 SEQUENCE: 6 tataagttta aacatataat tigg atcctcc accitcc.gcct cog agaccoa cacaacttitc 60 tittcttg 67
<210 SEQ ID NO 7 <211& LENGTH: 40 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: PCR primer Ach854 <400 SEQUENCE: 7 atataaggat cogatgcaca caagagtgag gttgcto atc 40
<210 SEQ ID NO 8 <211& LENGTH 44 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: PCR primer Ach855 <400 SEQUENCE: 8 atttaagttt aaactcatta taagcctaag goagcttgac ttgc 44
<210 SEQ ID NO 9 &2 11s LENGTH 77 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: PCR primer Ach719 <400 SEQUENCE: 9 US 2006/0253913 A1 Nov. 9, 2006 45
-continued atattotoga gagccatgaa gotcc tocatc cittgcctgtc. togtogctot goc cottgca 60 agagaagatg a catcat 77
<210> SEQ ID NO 10 <211& LENGTH: 40 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: PCR primer Ach718 <400 SEQUENCE: 10 citatgacitcg aggcgatcgc tattaattag aga.cccacac 40
<210> SEQ ID NO 11 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: PCR primer ACB712 <400 SEQUENCE: 11 cittc.cgtggc cagaatggat 2O
<210> SEQ ID NO 12 &2 11s LENGTH 27 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: PCR primer ACB244 <400 SEQUENCE: 12 catcagaagt taalacago ac agittagt 27
<210> SEQ ID NO 13 <211& LENGTH 24 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: PCR primer ACB268 <400 SEQUENCE: 13 aggagcacag togctdatcca gatc 24
<210> SEQ ID NO 14 <211& LENGTH 21 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: PCR primer ACB659 <400 SEQUENCE: 14 gacgc.cccat cotcactgac t 21
<210 SEQ ID NO 15 <211& LENGTH 22 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: PCR primer ACB572 <400 SEQUENCE: 15 titcc taggat gtgcto cagg ct 22 US 2006/0253913 A1 Nov. 9, 2006 46
-continued
<210> SEQ ID NO 16 <211& LENGTH 22 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: PCR primer ACB255 <400 SEQUENCE: 16 gaaacggaat gttgttggagt gg 22
<210 SEQ ID NO 17 <211& LENGTH 24 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: PCR primer Ach266 <400 SEQUENCE: 17 tgct citttga gcc toc agaic acct 24
<210> SEQ ID NO 18 <211& LENGTH 24 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: PCR primer Ach267 <400 SEQUENCE: 18 ggctgttctgaacgctgtga cittg 24
<210 SEQ ID NO 19 &2 11s LENGTH 19 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: PCR primer Ach819 <400 SEQUENCE: 19 ccagaggtaa accaaagac 19
<210> SEQ ID NO 20 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: PCR primer ACB884 <400 SEQUENCE: 20 cctdactcitt gtgtgcatcg 20
<210> SEQ ID NO 21 <211& LENGTH 21 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: PCR primer Ach256 <400 SEQUENCE: 21 gaggaacaac agcaaacaga g 21
<210> SEQ ID NO 22 <211& LENGTH 21 US 2006/0253913 A1 Nov. 9, 2006 47
-continued
&212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: PCR primer Ach312 <400 SEQUENCE: 22 accotact.gt citttcatcag c 21
<210> SEQ ID NO 23 &2 11s LENGTH 47 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OOTHER INFORMATION: PCR primer WAP-pl <400 SEQUENCE: 23 aattggtacc agcggcc.gct citagaggaac talag cagag accatgc 47
<210> SEQ ID NO 24 &2 11s LENGTH 87 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OOTHER INFORMATION: PCR primer WAP-p2 <400 SEQUENCE: 24 gctgctcqag cittgatgttt aaactgataa cccittcagtg agcagoc gat atatgtttaa 60 acatg.cgttg cctoatcago cittgttc 87
<210> SEQ ID NO 25 &2 11s LENGTH 39 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: PCR primer WAP-p3 <400 SEQUENCE: 25 atatatgttt aaacatgcgt togcctcatca gccttgttc 39
<210> SEQ ID NO 26 &2 11s LENGTH 2.8 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: PCR primer WAP-p4 <400 SEQUENCE: 26 atgttctotc toggatcCagg agtgaagg 28
<210 SEQ ID NO 27 &2 11s LENGTH 18 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: PCR primer BChE-pl <400 SEQUENCE: 27 attitcc.ccga agtattac 18
<210> SEQ ID NO 28 &2 11s LENGTH 18 &212> TYPE DNA <213> ORGANISM: Artificial Sequence US 2006/0253913 A1 Nov. 9, 2006 48
-continued
&220s FEATURE <223> OTHER INFORMATION: PCR primer BChE-p2 <400 SEQUENCE: 28 tgattittctg tdgittatt 18
<210 SEQ ID NO 29 &2 11s LENGTH 35 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: PCR primer Linker-pl <400 SEQUENCE: 29 ggaccggtgt taacgatato tctagagcgg cc.gct 35
<210 SEQ ID NO 30 <211& LENGTH: 41 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: PCR primer Linker-p2 <400 SEQUENCE: 30 cc.ggag cqgc cqc totagag atato gttaa caccggtocg c 41
<210> SEQ ID NO 31 <211& LENGTH 44 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: PCR primer Insulator-pl <400 SEQUENCE: 31 ttittgcggcc gctictagact c gaggggaca gcc.cccc.ccc aaag 44
<210> SEQ ID NO 32 &2 11s LENGTH 48 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: PCR primer Insulator-p2 <400 SEQUENCE: 32 ttittggatcc gtcgacgc.cc catcc to act gacitc.cgtoc toggagttg 48
<210 SEQ ID NO 33 &2 11s LENGTH 32 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: PCR primer Linker-p3 <400 SEQUENCE: 33 ggacitagttg atcagoggcc gctataggat co 32
<210> SEQ ID NO 34 &2 11s LENGTH 39 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: PCR primer Linker-p4 <400 SEQUENCE: 34 US 2006/0253913 A1 Nov. 9, 2006 49
-continued ggcctggatc ctatagoggc cqctgatcaa citagt cogc 39
<210 SEQ ID NO 35 &2 11s LENGTH 35 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: PCR sense primer <400 SEQUENCE: 35 caatcaggcc ggccagaaga tigacatcata attgc 35
<210 SEQ ID NO 36 &2 11s LENGTH 39 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: PCR sense primer <400 SEQUENCE: 36 caatcaggcg cqc cotcgag gatctoggcc citctttctg 39
<210 SEQ ID NO 37 <211& LENGTH: 40 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: PCR antisense primer <400 SEQUENCE: 37 caatcaggcc ggcc.gcaata gag acctgca gtc.ccc.ggag 40
<210 SEQ ID NO 38 &2 11s LENGTH 35 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: PCR sense primer <400 SEQUENCE: 38 catctggcga togctaccga gtacagaagg ggacg 35
<210 SEQ ID NO 39 &2 11s LENGTH 36 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: PCR antisense primer <400 SEQUENCE: 39 citagcatgcg gcc.gc.gtgct citaggacago cagagc 36
<210> SEQ ID NO 40 &2 11s LENGTH 16 &212> TYPE PRT <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: synthetic peptide <400 SEQUENCE: 40 Glu Ser Thr Gly Gly Gly Pro Pro Pro Pro Pro Pro Pro Pro Pro Pro 1 5 10 15 US 2006/0253913 A1 Nov. 9, 2006 50
-continued
SEQ ID NO 41 LENGTH 30 TYPE DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: PCR primer ACB582 <400 SEQUENCE: 41 cago tagt at tdatggaagg gcaaatgagg 30
SEQ ID NO 42 LENGTH 30 TYPE DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: PCR primer ACB591 <400 SEQUENCE: 42 tagaggtoag ggatgctgct aaa.cattctg 30
SEQ ID NO 43 LENGTH 30 TYPE DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: PCR primer ACB583 <400 SEQUENCE: 43 ccacagaatt gactg.cgact ggaaatatgg 30
SEQ ID NO 44 LENGTH 30 TYPE DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: PCR primer ACB601 <400 SEQUENCE: 44 citccatgggit aagcctaaac attgagatct 30
SEQ ID NO 45 LENGTH 2.8 TYPE DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: PCR primer ACB620 <400 SEQUENCE: 45 citttctdagc ccaaagttct gcctgttc 28
SEQ ID NO 46 LENGTH 2.8 TYPE DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: PCR primer ACB621 <400 SEQUENCE: 46 caagttctdt citcatctoct gcttctda 28
SEQ ID NO 47 LENGTH 2.8 TYPE DNA US 2006/0253913 A1 Nov. 9, 2006 51
-continued <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: PCR primer ACB618 <400 SEQUENCE: 47 Cagtggacag aggalaga.gtc. agaggaag 28
<210> SEQ ID NO 48 &2 11s LENGTH 2.8 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: PCR primer ACB619 <400 SEQUENCE: 48 gtatttacct citcttgcaag ggccagag 28
<210 SEQ ID NO 49 &2 11s LENGTH 35O1 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: DNA sequence encoding BChE-HSA fusion protein <400 SEQUENCE: 49 gaagatgaca toataattgc aacaaagaat ggaaaagttca gagggatgaa cittgacagtt 60 tittggtggca C ggtaacago Ctttcttgga attcCctatog Cacagccacc tottggtaga 120 cittcgattica aaaag.ccaca gtc.tctgacc aagtggtotg atatttggaa toccacaaaa 18O tatgcaaatt cittgctgtca galacatagat caaagtttitc caggctt.cca toggat.ca.gag 240 atgtggalacc caaacactga cct cagtgaa gactgttitat atctaaatgt atggatticca 3OO gcaccitaaac caaaaaatgc cactgtattg atatggattt atggtggtgg ttittcaaact 360 ggaacatcat citttacatgt titatgatggc aagtttctgg citcgg gttga aagagittatt 420 gtag totcaa togalactatag g g toggtgcc citaggattct tagctittgcc aggaaatcct 480 gaggcticcag g galacatggg tittatttgat caa.cagttgg citcttcagt g g gttcaaaaa 540 aatatagoag cctittggtgg aaatcctaaa agtgtaacto tctittggaga aagtgcagga 600 gcagottcag ttagcctgca tttgctttct cotggaagcc attcattgtt caccagagcc 660 attctgcaaa gtggttccitt taatgcto ct toggcggtaa catctottta toaa.gctagg 720 aacagaacgt togaacttago taaattgact g gttgcticta gagagaatga gactgaaata 78O atcaagtgtc. ttagaaataa agatc.cccaa gaa attcttctgaatgaagc atttgttgtc. 840 cccitatggga citcctttgtc. agtaaactitt gotcc gaccg toggatggtga ttittcto act 9 OO gacatgccag acatattact toga acttgga caatttaaaa aaa.cccagat tittggtgggit 96.O gttaataaag atgaagggiac agcttttitta gtctatogto citcctggctt cagoaaagat 1020 aacaatagta toatalactag aaaagaattt caggaaggitt taaaaatatt tttitcCagga 1080 gtgagtgagt ttggaaagga atc catcc tt titt cattaca cag actoggt agatgat cag 1140 agacctgaaa act accgtga ggc cittgggit gatgttgttg gggattataa titt catatgc 1200 cctgccttgg agttcaccala gaagttctica gaatggggaa ataatgc citt tttctacitat 1260 tittgaacacc gatcct coaa actitc.cgtgg cca gaatgga tigggagtgat gcatggctat 1320 gaaattgaat ttgtc.tttgg tttacctotg gaaagaagag ataattacac aaaag.ccgag 1380
US 2006/0253913 A1 Nov. 9, 2006 53
-continued <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: BChE-HSA fusion protein containing Gly/Ser linker
<400 SEQUENCE: 50 Glu Asp Asp Ile Ile Ile Ala Thr Lys Asn Gly Lys Val Arg Gly Met 1 5 10 15 Asn Leu Thr Val Phe Gly Gly. Thr Val Thr Ala Phe Leu Gly Ile Pro 2O 25 30 Tyr Ala Glin Pro Pro Leu Gly Arg Lieu Arg Phe Lys Lys Pro Glin Ser 35 40 45 Lieu. Thir Lys Trp Ser Asp Ile Trp Asn Ala Thr Lys Tyr Ala Asn. Ser 50 55 60 Cys Cys Glin Asn Ile Asp Gln Ser Phe Pro Gly Phe His Gly Ser Glu 65 70 75 8O Met Trp Asn Pro Asn. Thir Asp Leu Ser Glu Asp Cys Lieu. Tyr Lieu. Asn 85 90 95 Val Trp Ile Pro Ala Pro Lys Pro Lys Asn Ala Thr Val Leu Ile Trp 1 OO 105 110 Ile Tyr Gly Gly Gly Phe Gln Thr Gly. Thir Ser Ser Leu. His Val Tyr 115 120 125 Asp Gly Lys Phe Leu Ala Arg Val Glu Arg Val Ile Val Val Ser Met 130 135 1 4 0 Asn Tyr Arg Val Gly Ala Leu Gly Phe Leu Ala Lieu Pro Gly Asn Pro 145 15 O 155 160 Glu Ala Pro Gly Asn Met Gly Lieu Phe Asp Glin Glin Lieu Ala Leu Glin 1.65 170 175 Trp Val Glin Lys Asn. Ile Ala Ala Phe Gly Gly Asn Pro Lys Ser Val 18O 185 19 O Thr Lieu Phe Gly Glu Ser Ala Gly Ala Ala Ser Val Ser Lieu. His Lieu 195 200 2O5 Leu Ser Pro Gly Ser His Ser Leu Phe Thr Arg Ala Ile Leu Glin Ser 210 215 220 Gly Ser Phe Asn Ala Pro Trp Ala Val Thr Ser Leu Tyr Glu Ala Arg 225 230 235 240 Asn Arg Thr Lieu. Asn Lieu Ala Lys Lieu. Thr Gly Cys Ser Arg Glu Asn 245 250 255 Glu Thr Glu Ile Ile Lys Cys Lieu Arg Asn Lys Asp Pro Glin Glu Ile 260 265 27 O Leu Leu Asn Glu Ala Phe Val Val Pro Tyr Gly Thr Pro Leu Ser Val 275 280 285 Asn Phe Gly Pro Thr Val Asp Gly Asp Phe Leu Thr Asp Met Pro Asp 29 O 295 3OO Ile Leu Lieu Glu Lieu Gly Glin Phe Lys Lys Thr Glin Ile Leu Val Gly 305 310 315 320 Val Asn Lys Asp Glu Gly Thr Ala Phe Lieu Val Tyr Gly Ala Pro Gly 325 330 335 Phe Ser Lys Asp Asn. Asn. Ser Ile Ile Thr Arg Lys Glu Phe Glin Glu 340 345 35 O Gly Leu Lys Ile Phe Phe Pro Gly Val Ser Glu Phe Gly Lys Glu Ser 355 360 365 US 2006/0253913 A1 Nov. 9, 2006 54
-continued Ile Leu Phe His Tyr Thr Asp Trp Val Asp Asp Glin Arg Pro Glu Asn 370 375 38O Tyr Arg Glu Ala Leu Gly Asp Val Val Gly Asp Tyr Asn. Phe Ile Cys 385 390 395 400 Pro Ala Lieu Glu Phe Thr Lys Llys Phe Ser Glu Trp Gly Asn. Asn Ala 405 410 415 Phe Phe Tyr Tyr Phe Glu His Arg Ser Ser Lys Leu Pro Trp Pro Glu 420 425 43 O Trp Met Gly Val Met His Gly Tyr Glu Ile Glu Phe Val Phe Gly Leu 435 4 40 4 45 Pro Leu Glu Arg Arg Asp Asn Tyr Thr Lys Ala Glu Glu Ile Leu Ser 450 455 460 Arg Ser Ile Val Lys Arg Trp Ala Asn. Phe Ala Lys Tyr Gly Asn Pro 465 470 475 480 Asn Glu Thr Glin Asn Asn Ser Thr Ser Trp Pro Val Phe Lys Ser Thr 485 490 495 Glu Gln Lys Tyr Leu Thir Leu Asn Thr Glu Ser Thr Arg Ile Met Thr 5 OO 505 51O. Lys Leu Arg Ala Glin Glin Cys Arg Phe Trp Thir Ser Phe Phe Pro Lys 515 52O 525 Val Lieu Glu Met Thr Gly Asn. Ile Asp Glu Ala Glu Trp Glu Trp Lys 530 535 540 Ala Gly Phe His Arg Trp Asn. Asn Tyr Met Met Asp Trp Lys Asn Glin 545 550 555 560 Phe Asn Asp Tyr Thr Ser Lys Lys Glu Ser Cys Val Gly Lieu Gly Gly 565 570 575 Gly Gly Gly Gly Ser Asp Ala His Lys Ser Glu Val Ala His Arg Phe 58O 585 59 O Lys Asp Leu Gly Glu Glu Asn. Phe Lys Ala Lieu Val Lieu. Ile Ala Phe 595 600 605 Ala Glin Tyr Lieu Glin Glin Cys Pro Phe Glu Asp His Wall Lys Lieu Val 610 615 62O Asn Glu Val Thr Glu Phe Ala Lys Thr Cys Val Ala Asp Glu Ser Ala 625 630 635 640 Glu Asn. Cys Asp Lys Ser Lieu. His Thr Lieu Phe Gly Asp Llys Lieu. Cys 645 650 655 Thr Val Ala Thr Leu Arg Glu Thr Tyr Gly Glu MET Ala Asp Cys Cys 660 665 67 O Ala Lys Glin Glu Pro Glu Arg Asn. Glu Cys Phe Leu Gln His Lys Asp 675 680 685 Asp Asn Pro Asn Lieu Pro Arg Lieu Val Arg Pro Glu Val Asp Wal MET 69 O. 695 7 OO Cys Thr Ala Phe His Asp Asn. Glu Glu Thir Phe Leu Lys Lys Tyr Lieu 705 710 715 720 Tyr Glu Ile Ala Arg Arg His Pro Tyr Phe Tyr Ala Pro Glu Leu Leu 725 730 735 Phe Phe Ala Lys Arg Tyr Lys Ala Ala Phe Thr Glu Cys Cys Glin Ala 740 745 750 Ala Asp Lys Ala Ala Cys Lieu Lleu Pro Llys Lieu. Asp Glu Lieu Arg Asp 755 760 765 Glu Gly Lys Ala Ser Ser Ala Lys Glin Arg Lieu Lys Cys Ala Ser Lieu US 2006/0253913 A1 Nov. 9, 2006 55
-continued
770 775 78O Glin Lys Phe Gly Glu Arg Ala Phe Lys Ala Trp Ala Val Ala Arg Lieu 785 790 795 8OO Ser Glin Arg Phe Pro Lys Ala Glu Phe Ala Glu Val Ser Lys Lieu Val 805 810 815 Thr Asp Lieu. Thir Lys Wal His Thr Glu Cys Cys His Gly Asp Leu Lieu 820 825 83O Glu Cys Ala Asp Asp Arg Ala Asp Leu Ala Lys Tyr Ile Cys Glu Asn 835 840 845 Glin Asp Ser Ile Ser Ser Lys Lieu Lys Glu Cys Cys Glu Lys Pro Leu 85 O 855 860 Leu Glu Lys Ser His Cys Ile Ala Glu Val Glu Asn Asp Glu MET Pro 865 870 875 88O Ala Asp Leu Pro Ser Lieu Ala Ala Asp Phe Val Glu Ser Lys Asp Val 885 890 895 Cys Lys Asn Tyr Ala Glu Ala Lys Asp Val Phe Leu Gly MET Phe Lieu 9 OO 905 910 Tyr Glu Tyr Ala Arg Arg His Pro Asp Tyr Ser Val Val Lieu Lleu Lieu 915 920 925 Arg Lieu Ala Lys Thr Tyr Glu Thir Thr Lieu Glu Lys Cys Cys Ala Ala 930 935 940 Ala Asp Pro His Glu Cys Tyr Ala Lys Val Phe Asp Glu Phe Lys Pro 945 950 955 96.O Leu Val Glu Glu Pro Glin Asn Lieu. Ile Lys Glin Asn. Cys Glu Lieu Phe 965 970 975 Glu Gln Leu Gly Glu Tyr Lys Phe Glin Asn Ala Leu Lieu Val Arg Tyr 98O 985 99 O Thr Lys Llys Val Pro Glin Val Ser Thr Pro Thr Leu Val Glu Val Ser 995 10 OO 1005 Arg Asn Lieu Gly Lys Val Gly Ser Lys Cys Cys Lys His Pro Glu Ala 1010 1015 1020 Lys Arg MET Pro Cys Ala Glu Asp Tyr Lieu Ser Val Val Lieu. Asn Glin 1025 1030 1035 1040 Lieu. Cys Val Lieu. His Glu Lys Thr Pro Wal Ser Asp Arg Val Thr Lys 1045 105 O 1055 Cys Cys Thr Glu Ser Lieu Val Asn Arg Arg Pro Cys Phe Ser Ala Lieu 1060 1065 1 OFO Glu Val Asp Glu Thr Tyr Val Pro Lys Glu Phe Asn Ala Glu Thr Phe 1075 1080 1085 Thr Phe His Ala Asp Ile Cys Thr Lieu Ser Glu Lys Glu Arg Glin Ile 1090 1095 1100 Lys Lys Glin Thr Ala Lieu Val Glu Lieu Val Lys His Lys Pro Lys Ala 1105 1110 1115 1120 Thr Lys Glu Glin Leu Lys Ala Wal MET Asp Asp Phe Ala Ala Phe Val 1125 1130 1135 Glu Lys Cys Cys Lys Ala Asp Asp Lys Glu Thr Cys Phe Ala Glu Glu 1140 1145 1150 Gly Lys Lys Lieu Val Ala Ala Ser Glin Ala Ala Leu Gly Lieu 1155 1160 1165
<210 SEQ ID NO 51 US 2006/0253913 A1 Nov. 9, 2006 56
-continued
&2 11s LENGTH 50 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: PCR antisense primer <400 SEQUENCE: 51 citatgacitcg aggcgatcac to attataag cctaagg cag cittgacittgc 5 O
What is claimed is: 20. The isolated fusion protein of claim 19, wherein said 1. A method for producing a fusion protein that comprises human BChE-hSA fusion protein comprises the amino acid an enzymatically active butyrylcholinesterase (BChE) sequence of SEQ ID NO: 50. enzyme and a human serum albumin (hSA), comprising 21. The isolated fusion protein of claim 13, wherein the expressing said fusion protein in a recombinant cell that BChE portion of said fusion protein comprises one or more comprises a polynucleotide encoding said fusion protein glycosyl residues. operably linked to a promoter sequence. 22. The isolated fusion protein of claim 14, wherein said 2. The method of claim 1, wherein said promoter signal sequence directs secretion into milk. sequence is the cytomegalovirus (CMV) promoter. 23. The isolated fusion protein of claim 14, wherein said 3. The method of claim 1, wherein said polynucleotide signal sequence directs secretion into urine. and operably linked promoter are part of a plasmid. 24. An isolated polynucleotide, comprising: (i) a nucle 4. The method of claim 1, wherein said BChE and said otide sequence encoding the fusion protein of claim 13, (ii) hSA are separated by an oligopeptide linker that permits a promoter that directs expression of the fusion protein, and independent folding and activity of said BChE. (iii) at least one signal sequence that directs secretion of the 5. The method of claim 4, wherein said oligopeptide expressed fusion protein from a cell. linker is a polyglycine and serine linker. 25. The isolated polynucleotide of claim 24, wherein the 6. The method of claim 1, wherein said cell is a BHK cell. encoded fusion protein further comprises an oligopeptide 7. The method of claim 1, wherein said BChE is human linker. BChE. 26. The isolated polynucleotide of claim 25, wherein said 8. The method of claim 1, wherein said polynucleotide oligopeptide linker comprises a polyglycine and a serine further comprises a signal sequence that directs secretion of Sequence. said fusion protein by the cell. 27. The isolated polynucleotide of claim 24, wherein the 9. The method of claim 1, wherein said BChE-hSA fusion BChE portion of said fusion protein is a human BChE. protein comprises the amino acid sequence of SEQID NO: 28. The isolated polynucleotide of claim 27, wherein said 50. human BChE-hSA fusion protein comprises the amino acid 10. The method of claim 1, wherein said polynucleotide sequence of SEQ ID NO: 50. comprises the nucleotide sequence of SEQ ID NO: 49 29. The isolated polynucleotide of claim 24, wherein said 11. The method of claim 1, wherein said cell further polynucleotide comprises the nucleotide sequence of SEQ comprises a DNA sequence encoding a glycosyltransferase, ID NO: 49. operably linked to a promoter. 30. The isolated polynucleotide of claim 24 wherein said 12. The method of claim 11, wherein said glycosyltrans signal sequence directs secretion into milk. ferase is expressed by said cell and glycosylates the BChE 31. The isolated polynucleotide of claim 24, wherein said portion of the fusion protein. signal sequence directs secretion into urine. 13. An isolated fusion protein, comprising an enzymati 32. The isolated polynucleotide of claim 24, wherein the cally active BChE enzyme and a human serum albumin. promoter is a mammary gland-specific promoter selected 14. The isolated fusion protein of claim 13, wherein said from the group consisting of a WAP (whey acidic protein) fusion protein further comprises a signal sequence that promoter and a casein promoter. directs secretion of said fusion protein from a cell. 33. The isolated polynucleotide of claim 24, wherein the 15. The isolated fusion protein of claim 13, wherein said promoter is a urinary endothelium-specific promoter fusion protein further comprises a linker located between selected from the group consisting of a uroplakin promoter said BChE enzyme and said hSA protein and wherein said or a uromodulin promoter. linker permits independent folding and activity of said 34. A recombinant cell that comprises the isolated poly BChE. nucleotide of claim 24. 16. The isolated fusion protein of claim 13, wherein said 35. The recombinant cell of claim 34, wherein the cell is linker comprises an amino acid sequence. a MAC-T (mammary epithelial) cell. 17. The isolated fusion protein of claim 16, wherein said 36. The recombinant cell of claim 24, wherein the cell is amino acid sequence comprises at least 7 amino acid resi a BHK (baby hamster kidney) cell. dues. 37. The recombinant cell of claim 24, wherein the cell is 18. The isolated fusion protein of claim 17, wherein said selected from the group of embryonic stem cells, embryonal amino acid residues are glycine and serine residues. carcinoma cells, primordial germ cells, oocytes, or sperm. 19. The isolated fusion protein of claim 13, wherein said 38. A non-human mammalian embryo that comprises the BChE is a human BChE. isolated polynucleotide of claim 24 as part of its genome. US 2006/0253913 A1 Nov. 9, 2006 57
39. A non-human mammalian embryo which comprises a mammary gland-specific promoter, and (iii) a signal the polynucleotide of claim 32 as part of its genome. sequence that provides secretion of the fusion protein into 40. A non-human mammalian embryo which comprises the milk of the mammal, has been introduced, to grow when the polynucleotide of claim 33. transferred into a recipient female mammal, resulting in the 41. A non-human transgenic mammal that upon lactation, recipient female mammal giving birth to the transgenic expresses in its milk the fusion protein of claim 13. mammal. 42. The non-human transgenic mammal of claim 41, 61. The method of claim 60, further comprising introduc wherein the linker portion of said fusion protein comprises ing the genetically-engineered DNA sequence into a cell of at least 7 amino acid residues. the embryo, or into a cell that will form at least part of the 43. The non-human transgenic mammal of claim 42, embryo. wherein said amino acid residues are glycine and serine 62. The method of claim 61, wherein introducing the residues. genetically-engineered DNA sequence comprises pro 44. The non-human transgenic mammal of claim 41, nuclear or cytoplasmic microinjection of the DNA sequence. wherein said mammal is a mouse. 63. The method of claim 61, wherein introducing the 45. The non-human transgenic mammal of claim 41, genetically-engineered DNA sequence comprises combin wherein said mammal is a goat. ing a mammalian cell stably transfected with the DNA 46. A non-human transgenic mammal that upon urination, sequence with a non-transgenic mammalian embryo. expresses in its urine the fusion protein of claim 13. 64. The method of claim 61, wherein introducing the 47. The non-human transgenic mammal of claim 46, genetically-engineered DNA sequence comprises the steps wherein the linker portion of said fusion protein comprises of (a) introducing the DNA sequence into a non-human at least 7 amino acid residues. mammalian oocyte; and (b) activating the oocyte to develop 48. The non-human transgenic mammal of claim 47. into an embryo. wherein said amino acid residues are glycine and serine 65. A method for producing a transgenic mammal that residues. upon lactation secretes the fusion protein of claim 13, in its 49. The non-human transgenic mammal of claim 46, milk, which method comprises cloning or breeding of a wherein said mammal is a mouse. transgenic mammal, the genome of which comprises a DNA 50. The non-human transgenic mammal of claim 46, sequence encoding said fusion protein, operably linked to a wherein said mammal is a goat. mammary gland-specific promoter, wherein the sequence 51. A non-human transgenic mammal whose genome further comprises a signal sequence that provides secretion comprises the polynucleotide of claim 24. of the fusion protein into the milk of the mammal. 52. The non-human transgenic mammal of claim 51, 66. A method for producing a transgenic mammal that wherein the promoter is a mammary gland-specific promoter secretes the fusion protein of claim 13, in its urine, which selected from the group consisting of a WAP (whey acidic method comprises allowing an embryo, into which at least protein) promoter and a casein promoter. one genetically-engineered DNA sequence, comprising (i) a 53. The non-human transgenic mammal of claim 51, sequence encoding said fusion protein; (ii) a urinary endot wherein the genome of the mammal further comprises a helium-specific promoter; and (iii) a signal sequence that DNA sequence encoding a glycosyltransferase, operably provides secretion of the fusion protein into the urine of the linked to a mammary gland-specific promoter, and a signal mammal, has been introduced, to grow when transferred into sequence that provides secretion of the glycosyltransferase. a recipient female mammal, resulting in the recipient female 54. The non-human transgenic mammal of claim 53, mammal giving birth to the transgenic mammal. wherein the mammary gland-specific promoter is a casein 67. The method of claim 66, which further comprises promoter or a whey acidic protein (WAP) promoter. introducing the genetically-engineered DNA sequence into a 55. The non-human transgenic mammal of claim 51, cell of the embryo, or into a cell that will form at least part wherein the promoter is a urinary endothelium-specific of the embryo. promoter selected from the group consisting of a uroplakin 68. The method of claim 67, wherein introducing the promoter or a uromodulin promoter. genetically-engineered DNA sequence comprises pro 56. The non-human transgenic mammal of claim 51, nuclear or cytoplasmic microinjection of the DNA sequence. wherein the genome of the mammal further comprises a 69. The method of claim 67, wherein introducing the DNA sequence encoding a glycosyltransferase, operably genetically-engineered DNA sequence comprises combin linked to a urinary gland-specific promoter, and a signal ing a mammalian cell stably transfected with the DNA sequence that provides secretion of the glycosyltransferase. sequence with a non-transgenic mammalian embryo. 57. The isolated polynucleotide of claim 56, wherein the 70. The method of claim 67 wherein introducing the promoter is a urinary endothelium-specific promoter genetically-engineered DNA sequence comprises the steps selected from the group consisting of a uroplakin promoter of (a) introducing the DNA sequence into a non-human or a uromodulin promoter. mammalian oocyte; and (b) activating the oocyte to develop 58. The non-human transgenic mammal of claim 51, into an embryo. wherein said mammal is a mouse. 71. A method for producing a transgenic mammal that 59. The non-human transgenic mammal of claim 51, secretes the fusion protein of claim 13, in its urine, which wherein said mammal is a goat. method comprises cloning or breeding of a transgenic mam 60. A method for producing a transgenic mammal that mal, the genome of which comprises a DNA sequence upon lactation secretes the fusion protein of claim 13 in its encoding said fusion protein, operably linked to a urinary milk, which method comprises allowing an embryo, into endothelium-specific promoter, wherein the sequence fur which at least one genetically-engineered DNA sequence, ther comprises a signal sequence that provides secretion of comprising (i) a sequence encoding said fusion protein; (ii) the fusion protein into the urine of the mammal. US 2006/0253913 A1 Nov. 9, 2006
72. A method for producing the fusion protein of claim 13, 79. The method according to claim 78, comprising the comprising: (a) inducing or maintaining lactation of a trans additional step of isolating the fusion protein from the genic mammal, the genome of which comprises a DNA extracted urine. sequence encoding said fusion protein, operably linked to a 80. The method according to claim 79, further comprising mammary gland-specific promoter, wherein the sequence purifying the fusion protein. further comprises a signal sequence that provides secretion 81. Urine of a non-human mammal comprising the fusion of the fusion protein into the milk of the mammal; and (b) protein of claim 13. extracting milk from the lactating mammal. 82. A composition comprising the fusion protein of claim 73. The method according to claim 72, which comprises 13 in a pharmaceutically acceptable carrier. the additional step of isolating the fusion protein from the extracted milk. 83. A method for treating organophosphate poisoning, 74. The method according to claim 73, further comprising comprising administering to a Subject in need thereof a purifying the fusion protein. therapeutically effective amount of a pharmaceutical com 75. The milk of a non-human mammal comprising the position of claim 82. fusion protein of claim 13. 84. A method for the treatment of post-Surgical. Succinyl 76. The milk of claim 76, where the milk is whole milk. choline-induced apnea, which comprises administering to a 77. The milk of claim 76, where the milk is defatted milk. subject in need thereof a therapeutically effective amount of 78. A method for producing the fusion protein of claim 13, a pharmaceutical composition of claim 82. comprising extracting urine from a transgenic mammal, the 85. A method for the treatment of cocaine intoxication, genome of which comprises a DNA sequence encoding said which comprises administering to a subject in need thereof fusion protein, operably linked to a urinary endothelium a therapeutically effective amount of a pharmaceutical com specific promoter, where the sequence further comprises a position of claim 82. signal sequence that provides secretion of said fusion protein into the urine of the mammal.