DOCSLIB.ORG

(12) Patent Application Publication (10) Pub. No.: US 2006/0253913 A1 Huang Et Al

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
(12) Patent Application Publication (10) Pub. No.: US 2006/0253913 A1 Huang Et Al US 20060253913A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2006/0253913 A1 Huang et al. (43) Pub. Date: Nov. 9, 2006 (54) PRODUCTION OF HSA-LINKED (60) Provisional application No. 60/344.295, filed on Dec. BUTYRYLCHOLINESTERASES IN 21, 2001. TRANSGENIC MAMMALS Publication Classification (76) (51) Int. Cl. Inventors: Yue-Jin Huang, Montreal (CA); Costas AOIK 67/027 (2006.01) N. Karatzas, Beaconsfield (CA); C7H 2L/04 (2006.01) Anthoula Lazaris, Beaconsfield (CA) CI2P 2/06 (2006.01) CI2N 9/18 (2006.01) Correspondence Address: CI2N 5/06 (2006.01) Alan J. Grant, Esq. (52) U.S. Cl. ............................. 800/14: 800/18: 435/69.1; c/o Carella, Byrne, Bain, Gilfillan, Cecchi, 435/197; 435/354; 435/455; Stewart & Olstein 536/23.2 5 Becker Farm Road Roseland, NJ 07068 (US) (57) ABSTRACT Appl. No.: 11/401,390 The present invention provides methods for the large-scale (21) production of recombinant butyrylcholinesterase fused to (22) Filed: Apr. 10, 2006 human serum albumin in cell culture, and in the milk and/or urine of transgenic mammals. The recombinant butyrylcho Related U.S. Application Data linesterase-albumin fusion protein of this invention can be used to treat and/or prevent organophosphate pesticide poi (63) Continuation-in-part of application No. 10/326,892, Soning, nerve gas poisoning, cocaine intoxication, and Suc filed on Dec. 20, 2002. cinylcholine-induced apnea. Patent Application Publication Nov. 9, 2006 Sheet 1 of 21 US 2006/0253913 A1 ATGCATAGCAAAGTCACAATCATATGCATCAGATTTCTCTTTTGGTTTCTTTTGCTCTGC M H S K W T I I C I R F L. F W F L L L C 5 ATGCTTATTGGGAAGTCACATACTGAAGATGACATCATAATTGCAACAAAGAATGGAAAA 21 M L G. K. S. H. T E D D A T K N G K 121 GTCAGAGGGATGAACTTGACAGTTTTTGGTGGCACGGTAACAGCCTTTCTTGGAATTCCC 4. W R G M N L T W F. G G T W T A F L G P 181 TATGCACAGCCACCTCTTGGTAGACTTCGATTCAAAAAGCCACAGTCTCTGACCAAGTGG 6. Y A Q. P P L G R L R F K K P Q S L T K W 241 TCTGATATTTCGAATGCCACAAAATATGCAAATTCTTGCTGTCAGAACATAGATCAAAGT 8. S D I W N A T K Y. A N S C C C N I D O S 3O TTTCCAGGCTTCCATGGATCAGAGATGTGGAACCCAAACACTGACCTCAGTGAAGACTGT O F P G F H G S E M W N P N T D L S E D C 36 TTATATCTAAATGTATGGATTCCAGCACCTAAACCAAAAAATGCCACTGTATTGATATGG 12 L. Y. L. N. W. W. I P A P K P K N A T W L I W 421 ATTTAGGTGGTGGTTTTCAAACTGGAACATCATCTTTACATGTTTATGATGGCAAGTTT 141 I Y G G G F C T G T S S L H V Y D G K . F 48 CTGGCTCGGGTTGAAAGAGTTATTGTAGTGTCAATGAACTATAGGGTGGGTGCCCTAGGA 16 L. A R V E R v I V V S M N Y R v G A L G 541 TTCTTAGCTTGCCAGGAAATCCTGAGGCTCCAGGGAACATGGGTTTATTTGACAACAG 8. F L. A. L. P G N P E A P G. N. M. G. L. F D O O. 6 Ol TTGGCTCTTCAGTGGGTTCAAAAAAATATAGCAGCCTTTGGTGGAAATCCTAAAAGTGTA 2O L. A. L. O. W. W. O. K. N. A A F G G N P K S W 661 ACTCTCTTTGGAGAAAGTGCAGGAGCAGCTTCAGTTAGCCTGCATTTGCTTTCTCCTGGA 221 T L. F. G E S A G A A S W S H L E S P G 72 AGCCATTCATTGTTCACCAGAGCCATTCTGCAAAGTGGTTCCTTTAATGCTCCTTGGGCG 24. S H S L. F T R A I L Q S G S F N A P W A 78. GTAACATCTCTTTATGAAGCTAGGAACAGAACGTTGAACTTAGCTAAATTGACTGGTTGC 26 W T S Y E A R N R T L N A K L T G C 84 TCTAGAGAGAATGAGACTGAAATAACAAGTGTCTAGAAATAAAGATCCCCAAGAAATT 28 S R E N E T E I I K C L R N K D P O E I FIGURE 1A Patent Application Publication Nov. 9, 2006 Sheet 2 of 21 US 2006/0253913 A1 90 CTTCTGAATGAAGCATTTGTTGTCCCCTATGGGACTCCTTTGTCAGTAAACTTTGGTCCG 30 L. L N E A F W V P Y G T P L S. V N F G P 96. ACCGTGGATGGTGATTTTCTCACTGACATGCCAGACATATTACTTGAACTTGGACAATTT 321 T W D G D F L T D M P D . L. L. E L G O F 1021 AAAAAAACCCAGATTTTGGTGGGTGTTAATAAAGATGAAGGGACAGCTTTTTTAGTCTAT 34 K K T Q I L W G V N K D E G T A F L V Y O8. GGTGCTCCTGGCTTCAGCAAAGATAACAATAGTATCATAACTAGAAAAGAATTTCAGGAA 361 G A P G F S K D N N S I I T R K E F Q E ll 4l GGTTTAAAAATATTTTTTCCAGGAGTGAGTGAGTTTGGAAAGGAATCCATCCTTTTTCAT 381 G. L. K. I. F. F. P G W S E F. G K E S F. H. 20 TACACAGACTGGGTAGATGATCAGAGACCTGAAAACTACCGTGAGGCCTTGGGTGATGTT 4 Ol Y T D W W D D C R P E N Y R E A L G D V 126l GTTGGGGATTATAATTTCATATGCCCTGCCTTGGAGTTCACCAAGAAGTTCTCAGAATGG 421 V G D Y N F C P A L E F T K K F. S. E. W. 1321 GGAAATAATGCCTTTTTCTACTATTTTGAACACCGATCCTCCAAACTTCCGTGGCCAGAA 441 G N N A F F Y Y F E H R S S K L P W P E 138 TGGATGGGAGTGATGCATGGCTATGAAATTGAATTTGTCTTTGGTTTACCTCEGGAAAGA 4 61 W M G W M H G Y E E. F. W. F. G P L E R 1441 AGAGATAATTACACAAAAGCCGAGGAAATTTTGAGTAGATCCATAGTGAAACGGTGGGCA 481 R D N Y T K A E E I L S R S I v K R W A SO1 AATTTTGCAAAATATGGGAATCCAAATGAGACTCAGAACAATAGCACAAGCTGGCCTGTC 50 N F A K Y G N P N E T O N N S T S W P V 1561. TTCAAAAGCACTGAACAAAAATATCTAACCTTGAATACAGAGTCAACAAGAATAATGACG 52. F K S T E O K. Y. L T L N T E S T R I. M T. 62 AAACTACGTGCTCAACAATGTCGATTCTGGACATCATTTTTTCCAAAAGTCTTGGAAATG 541 K L R A Q O C R F W T S F F P K V L E M l68l ACAGGAAATATTGATGAAGCAGAATGGGAGTGGAAAGCAGGATTCCATCGCTGGAACAAT 56. T. G. N. D E A E W E W K. A. G. F. H. R. W. N. N. 1741 TACATGATGGACTGGAAAAATCAATTTAACGATTACACTAGCAAGAAAGAAAGTTGTGTG 581 Y M. M. D. W. K. N. Q F N D Y T S K K E S C W 80. GGTCTCTAA 601 G k FIGURE 1B Patent Application Publication Nov. 9, 2006 Sheet 4 of 21 US 2006/0253913 A1 1 2 3 4 5 6 Dimer BChE-hSA a Tetramer BChE - Monomer BChE-hSA FIGURE 3 Patent Application Publication Nov. 9, 2006 Sheet 5 of 21 US 2006/0253913 A1 naturt protein 214 ATG (lo) TAA (1938) XXXXXXXXXXXX Noti (16908) & XhoI + 3-cascin SS Xh PCR 5' 8-casein HHR 1. Xhol digestion XhoI digestion 2. Cloning into pGEM-T 1. Ligation V 2. Transformation XhoI digestion Not insulator p3CNN/BChE 17399. a. XhoI p (4647) (12404) 6-casein SS 1 BChE XhoI (10675) 5' 3-casein FIGURE 4 Patent Application Publication Nov. 9, 2006 Sheet 6 of 21 US 2006/0253913 A1 BChE encoding sequence 5' UTR (47nt) ATG STOP Goat 3-casein genomic locus 1000bp FIGURES Patent Application Publication Nov. 9, 2006 Sheet 7 of 21 US 2006/0253913 A1 Dimer rBChE < Endogenous BChE dimer Monomer rBChE FIGURE 6 Patent Application Publication Nov. 9, 2006 Sheet 8 of 21 US 2006/0253913 A1 1- Tetramer BChE -- Dimer BChE -- Monomer BChE FIGURE 7 Patent Application Publication Nov. 9, 2006 Sheet 9 of 21 US 2006/0253913 A1 1.2 Monomer BChE FIGURE 8 Patent Application Publication Nov. 9, 2006 Sheet 10 of 21 US 2006/0253913 A1 Noti (14920) Not (2228) WAP Coding insulator pWAP/BChE 15583bp BamHt (466) Pnie (10706) Signal Sequence FIGURE 9 Patent Application Publication Nov. 9, 2006 Sheet 11 of 21 US 2006/0253913 A1 seve T 8H - V r O , & & r O A : Patent Application Publication Nov. 9, 2006 Sheet 12 of 21 US 2006/0253913 A1 Not I Fsel Sgfl insulator pUM/SS13 HBChE PCR product (4647) -Digest with Fsel & Sgfl -Ligate UM promoter Not I Insulator FIGURE 11 Patent Application Publication Nov. 9, 2006 Sheet 13 of 21 US 2006/0253913 A1 Not UM 3' Insulator Asc Fsel pUM/BChEmod Asc Sgf Mouse UPll PCR product UPI Promoter BCE UM promoter Digested with Asci-Fsel & ligation Sgfl Notl Insulator III pUPII/BChE1nt Mouse UPI PCR product 4kb ASCI 3' genomic sequence Digested with Sgfl-Notl & ligation UPI promoter Not I UP 3 Insulator Ascl Sgfi W8 BChE Fse UPII promoter UPII SS FIGURE 12 Patent Application Publication Nov. 9, 2006 Sheet 16 of 21 US 2006/0253913 A1 Figure 13C 21 Oil CAACACAAAGATGACAACCCAAACCTCCCCCGATTGGTGAGACCAGAGGTTGATGTGATG 701 Q H K D D N P N L. P R L V R P E V D V M 2161 TGCACTGCTTTTCATGACAATGAAGAGACATTTTTGAAAAAATACTTATATGAAATTGCC 72 C T A F H D N E E T F. L. K. K. Y L. Y. E . A 2221 AGAAGACATCCTTACTTTTATGCCCCGGAACTCCTTTTCTTTGCTAAAAGGTATAAAGCT 741 R. R. H P Y F. Y. A P E L L. F. F. A K R Y K. A 2281 GCTTTTACAGAATGTTGCCAAGCTGCTGATAAAGCTGCCTGCCTGTTGCCAAAGCTCGAT 761. A F T E C C Q A A D K. A. A. C. L. L. P K L D 234 GAACTTCGGGATGAAGGGAAGGCTTCGTCTGCCAAACAGAGACTCAAGTGTGCCAGTCTC 781 E L R D E G K A S S A K Q R L. K. C. A. S. L. 24 O1 CAAAAATTTGGAGAAAGAGCTTTCAAAGCATGGGCAGTAGCTCGCCTGAGCCAGAGATTT 801 Q K F. G E R A F K. A. W. A. V. A R L S Q R F 2461 CCCAAAGCTGAGTTTGCAGAAGTTTCCAAGTTAGTGACAGATCTTACCAAAGTCCACACG 821 P. K. A. E. F. A E V S K L W T D L T K W H T 252 GAATGCTGCCATGGAGATCTGCTTGAATGTGCTGATGACAGGGCGGACCTTGCCAAGTAT 841 E. C. C. H. G D L L E C A D D R A D L. A. K. Y 2581 ATCTGTGAAAATCAAGATTCGATCTCCAGTAAACTGAAGGAATGCTGTGAAAAACCTCTG 861 I C E N Q D S I S S K L K E C C E K P L. 2641 TTGGAAAAATCCCACTGCATTGCCGAAGTGGAAAATGATGAGATGCCTGCTGACTTGCCT 881 E. K. S. H. C. I. A E V E N D E M P A D L. P 27 OL TCATTAGCTGCTGATTTTGTTGAAAGTAAGGATGTTTGCAAAAACTATGCTGAGGCAAAG 901 S L. A. A D F W E S K D V C. K. N. Y. A E A K. 276 GATGTCTTCCTGGGCATGTTTTTGTATGAATATGCAAGAAGGCATCCTGATTACTCTGTC 921 D V F L G M F. L. Y. E. Y. A R R H P D Y S V 2821 GTGCTGCTGCTGAGACTTGCCAAGACAATGAAACCACTCTAGAGAAGTGCTGTGCCGCT 941 W L L L R I, A K T Y.
Load more

Recommended publications
  • Teratogenicity and Embryotoxicity of Organophosphorus Compounds in Animal Models - a Short Review
    Mil. Med. Sci. Lett. (Voj. Zdrav. Listy) 2012, vol. 81(1), p. 16-26 ISSN 0372-7025 DOI: 10.31482/mmsl.2012.003 REVIEW ARTICLE TERATOGENICITY AND EMBRYOTOXICITY OF ORGANOPHOSPHORUS COMPOUNDS IN ANIMAL MODELS - A SHORT REVIEW Syed M Nurulain and M Shafiullah Department of Pharmacology and Therapeutic, Faculty of Medicine and Health Sciences, UAE University, AlAin, UAE. P.O.Box 17666, Alain, UAE Received 9 th December 2011. Revised 12 th February 2012. Published 9 th March 2012. Summary Organophosphorus compounds (OPCs) are a wide group of compounds both structurally and functionally. Each OPC has a unique toxicological profile. The exposure to this type of poison is not limited only to certain occupationally exposed people but also to children, women, pregnant women; all have chances to be exposed to this poison. During the recent past years it has been reported in many poison epidemiological studies and case reports that exposure of OPCs during pregnancy caused malformed fetuses, neural tube defect (NTD) and shortening of pregnancy. The literature for animal models reveals inconclusive evidence. The generalized view is that they are neither teratogenic nor embryotoxic. But it is not true. There is a lack of systematic study and scarcity of reports on the topic. The present study was undertaken to investigate the teratogenicity induced by organophosphorus compounds in different animal models by literature review. Literature was searched by Toxicology Data NetWork (TOXNET), Developmental and Reproductive Toxicology Database (DART), Toxicology Literature Online (TOXLINE), Hazardous Substances Data Bank (HSDB), Pubmed Central, Entrez-Pubmed, Science Direct, Directory Of Open Access Journal (DOAJ), Google Scholar and International Program on Chemical Safety (IPCS-INCHEM), Embase.
    [Show full text]
  • Organophosphate Poisoning : a Review
    120 Sinha and Sharma Med J Indones Organophosphate poisoning : A review Parmod K. Sinha, Ashok Sharma Abstrak Pestisida organofosfat digunakan secara luas di seluruh dunia. Keracunan oleh bahan ini merupakan masalah kesehatan masyarakat, terutama di negara berkembang. Zat neurotoksik organofosfat merupakan bahan yang dianggap mengancam dalam bidang militer dan terorisme. Mekanisme toksisitas bahan ini adalah dengan cara menghambat asetilkolinesterase yang mengakibatkan menumpuknya neurotransmitor asetilkolin dan terjadi rangsangan terus-menerus pada reseptor asetilkolin pada sistem saraf sentral maupun perifer. Selain krisis kolinergik, organofosfat dapat menimbulkan berbagai sindrom neurologis, baik akut maupun kronik. Sedangkan gejala peralihan ( intermediate) terjadi 1-4 hari setelah krisis kolinergik teratasi. Pengobatan standar terdiri dari reaktivasi asetilkolinesterase dengan antidot golongan oksim (prolidoksim, oksidoksime, HI-6 dan HLo7), dan pengendalian efek biokimia asetilkolin dengan menggunakan atropin. Golongan oksim yang baru HI-6 dan Hlo7 merupakan reaktivator asetilkolinesterase yang lebih cocok dan efektif untuk keracunan akut dan berat dibandingkan dengan prolidoksim dan obidoksim. Penderita yang mendapat pengobatan segera, biasanya dapat sembuh dari toksisitas akut, namun gejala neurologis ikutan dapat saja terjadi. (Med J Indones 2003; 12: 120-6) Abstract Organophosphate pesticides are used extensively worldwide, and poisoning by these agents, particularly in developing nations is a public health problem. Organophosphorous
    [Show full text]
  • Chemical Name Federal P Code CAS Registry Number Acutely
    Acutely / Extremely Hazardous Waste List Federal P CAS Registry Acutely / Extremely Chemical Name Code Number Hazardous 4,7-Methano-1H-indene, 1,4,5,6,7,8,8-heptachloro-3a,4,7,7a-tetrahydro- P059 76-44-8 Acutely Hazardous 6,9-Methano-2,4,3-benzodioxathiepin, 6,7,8,9,10,10- hexachloro-1,5,5a,6,9,9a-hexahydro-, 3-oxide P050 115-29-7 Acutely Hazardous Methanimidamide, N,N-dimethyl-N'-[2-methyl-4-[[(methylamino)carbonyl]oxy]phenyl]- P197 17702-57-7 Acutely Hazardous 1-(o-Chlorophenyl)thiourea P026 5344-82-1 Acutely Hazardous 1-(o-Chlorophenyl)thiourea 5344-82-1 Extremely Hazardous 1,1,1-Trichloro-2, -bis(p-methoxyphenyl)ethane Extremely Hazardous 1,1a,2,2,3,3a,4,5,5,5a,5b,6-Dodecachlorooctahydro-1,3,4-metheno-1H-cyclobuta (cd) pentalene, Dechlorane Extremely Hazardous 1,1a,3,3a,4,5,5,5a,5b,6-Decachloro--octahydro-1,2,4-metheno-2H-cyclobuta (cd) pentalen-2- one, chlorecone Extremely Hazardous 1,1-Dimethylhydrazine 57-14-7 Extremely Hazardous 1,2,3,4,10,10-Hexachloro-6,7-epoxy-1,4,4,4a,5,6,7,8,8a-octahydro-1,4-endo-endo-5,8- dimethanonaph-thalene Extremely Hazardous 1,2,3-Propanetriol, trinitrate P081 55-63-0 Acutely Hazardous 1,2,3-Propanetriol, trinitrate 55-63-0 Extremely Hazardous 1,2,4,5,6,7,8,8-Octachloro-4,7-methano-3a,4,7,7a-tetra- hydro- indane Extremely Hazardous 1,2-Benzenediol, 4-[1-hydroxy-2-(methylamino)ethyl]- 51-43-4 Extremely Hazardous 1,2-Benzenediol, 4-[1-hydroxy-2-(methylamino)ethyl]-, P042 51-43-4 Acutely Hazardous 1,2-Dibromo-3-chloropropane 96-12-8 Extremely Hazardous 1,2-Propylenimine P067 75-55-8 Acutely Hazardous 1,2-Propylenimine 75-55-8 Extremely Hazardous 1,3,4,5,6,7,8,8-Octachloro-1,3,3a,4,7,7a-hexahydro-4,7-methanoisobenzofuran Extremely Hazardous 1,3-Dithiolane-2-carboxaldehyde, 2,4-dimethyl-, O- [(methylamino)-carbonyl]oxime 26419-73-8 Extremely Hazardous 1,3-Dithiolane-2-carboxaldehyde, 2,4-dimethyl-, O- [(methylamino)-carbonyl]oxime.
    [Show full text]
  • The List of Extremely Hazardous Substances)
    APPENDIX A (THE LIST OF EXTREMELY HAZARDOUS SUBSTANCES) THRESHOLD REPORTABLE INVENTORY RELEASE QUANTITY QUANTITY CAS NUMBER CHEMICAL NAME (POUNDS) (POUNDS) 75-86-5 ACETONE CYANOHYDRIN 500 10 1752-30-3 ACETONE THIOSEMICARBAZIDE 500/500 1,000 107-02-8 ACROLEIN 500 1 79-06-1 ACRYLAMIDE 500/500 5,000 107-13-1 ACRYLONITRILE 500 100 814-68-6 ACRYLYL CHLORIDE 100 100 111-69-3 ADIPONITRILE 500 1,000 116-06-3 ALDICARB 100/500 1 309-00-2 ALDRIN 500/500 1 107-18-6 ALLYL ALCOHOL 500 100 107-11-9 ALLYLAMINE 500 500 20859-73-8 ALUMINUM PHOSPHIDE 500 100 54-62-6 AMINOPTERIN 500/500 500 78-53-5 AMITON 500 500 3734-97-2 AMITON OXALATE 100/500 100 7664-41-7 AMMONIA 500 100 300-62-9 AMPHETAMINE 500 1,000 62-53-3 ANILINE 500 5,000 88-05-1 ANILINE,2,4,6-TRIMETHYL- 500 500 7783-70-2 ANTIMONY PENTAFLUORIDE 500 500 1397-94-0 ANTIMYCIN A 500/500 1,000 86-88-4 ANTU 500/500 100 1303-28-2 ARSENIC PENTOXIDE 100/500 1 THRESHOLD REPORTABLE INVENTORY RELEASE QUANTITY QUANTITY CAS NUMBER CHEMICAL NAME (POUNDS) (POUNDS) 1327-53-3 ARSENOUS OXIDE 100/500 1 7784-34-1 ARSENOUS TRICHLORIDE 500 1 7784-42-1 ARSINE 100 100 2642-71-9 AZINPHOS-ETHYL 100/500 100 86-50-0 AZINPHOS-METHYL 10/500 1 98-87-3 BENZAL CHLORIDE 500 5,000 98-16-8 BENZENAMINE, 3-(TRIFLUOROMETHYL)- 500 500 100-14-1 BENZENE, 1-(CHLOROMETHYL)-4-NITRO- 500/500 500 98-05-5 BENZENEARSONIC ACID 10/500 10 3615-21-2 BENZIMIDAZOLE, 4,5-DICHLORO-2-(TRI- 500/500 500 FLUOROMETHYL)- 98-07-7 BENZOTRICHLORIDE 100 10 100-44-7 BENZYL CHLORIDE 500 100 140-29-4 BENZYL CYANIDE 500 500 15271-41-7 BICYCLO[2.2.1]HEPTANE-2-CARBONITRILE,5-
    [Show full text]
  • Ambient Water Quality Criteria for Chlorpyrifos
    United State. Office of Water EPA 440/5-86~05 Environmental Protection Regulations and Standards September 1986 Amy l. lea~erry Agency Criteria and Standards Division Washington DC 20460 Water &EPA Ambient Wat'er Quality Criteria for Chlorpyrifos - 1986 &~IENT AQUATIC LIFE WATER QUALITY CRITERIA FOR CHLORPYRIFOS U.S. ENVIRONMENTAL PROTECTION AGENCY OFFICE OF RESEARCH AND DEVELOPMENT ENVIRONMENTAL RESEARCH LABORATORIES DULUTH, MINNESOTA NARRAGANSETT, RHODE ISLAND NOTICES This document has been reviewed by the Criteria and Standards Division, Office of Water Regulations and Standards, U.S. Environmental Protection Agency, and approved for publication. Mention of trade names or commercial products does not constitute endorsement or recommendation for use. This document is availaryle to the public throu~h the National Technical Inf0rmation Service (NTIS), 5285 Port Royal Road, Springfield, VA 22161. 11 FOREWORD Section 304(a)(1) of the Clean Water Act of 1977 (P.L. 95-217) requires the Administrator of the Environmental Protection Agency to publish water quality criteria that accurately reflect the latest scientific knowledge on the kind and extent of all identifiable effects on health and welfare that might be expected from the presence of pollutants in any body of water~ including ground water. This document is a revision of proposed criteria based upon consideration of comments received from other Federal agencies~ State agencies~ special interest groups~ and individual scientists. Criteria contained in this document replace any previously published EPA aquatic life criteria for the same pollutant(s). The term "water quality criteria" is used in two sections of the Clean Water Act~ section 304(a)(1) and section 303(c)(2).
    [Show full text]
  • SECRETARY HICKEL BANS USE of 16 PESTICIDES on ANY INTERIOR LANDS OR PROGRAMS -- June 18, 1970
    i DEPARTMENT of the INTERIOR news release OFFICE OF THE SECRETARY For Release Thursday, June 18, 1970 SECRETARYHICKEL BANS USE OF 16 PESTICIDES ON ANY INTERIOR LANDS OR PROGRAMS Secretary of the Interior Walter J. Hickel today announced a new policy flatly banning the use of 16 types of pesticides on any lands managed by the Department's bureaus and agencies, or in any program run by them. The Department administers approximately 70 percent of all federally owned lands. Included in this list of prohibited pesticides are such widely-known substances as DDT, Aldrin, 2, 4, 5,-T, Dieldrin, Endrin, Heptachlor, Lindane and Toxaphene. Also on the list of unconditionally banned items are Amitrol, arsenical compounds (inorganic), Azodrin, Bidrin, DDD (TDE), mercurial compounds, Strobane, and Thallium Sulfate. The Secretary pointed out that nearly all use of these pesticides has been banned on Interior Lands during recent years. The purpose of the new statement, he said, is to establish a policy for guidance of all Interior personnel. Another group of chemical pesticides, titled the Restricted List, are to be used only when non-chemical techniques have been considered and found inadequate, and when use can be limited to small-scale applications. Secretary Hickel emphasized that the use of any chemical pesticide by his agencies must be aimed at a specific pest problem, and involve minimum strength and minimum frequency of application. "We in the Interior Department-- the Nation's chief conservation agency have a special obligation to protect the environment for all the people,“’ Secretary Hickel said. "We are charged by law with responsibility for protecting interstate and coastal water quality, our fish and wildlife resources, the integrity of our national parks, public lands, and recreation areas," the Secretary continued.
    [Show full text]
  • Acutely / Extremely Hazardous Waste List
    Acutely / Extremely Hazardous Waste List Federal P CAS Registry Acutely / Extremely Chemical Name Code Number Hazardous 4,7-Methano-1H-indene, 1,4,5,6,7,8,8-heptachloro-3a,4,7,7a-tetrahydro- P059 76-44-8 Acutely Hazardous 6,9-Methano-2,4,3-benzodioxathiepin, 6,7,8,9,10,10- hexachloro-1,5,5a,6,9,9a-hexahydro-, 3-oxide P050 115-29-7 Acutely Hazardous Methanimidamide, N,N-dimethyl-N'-[2-methyl-4-[[(methylamino)carbonyl]oxy]phenyl]- P197 17702-57-7 Acutely Hazardous 1-(o-Chlorophenyl)thiourea P026 5344-82-1 Acutely Hazardous 1-(o-Chlorophenyl)thiourea 5344-82-1 Extemely Hazardous 1,1,1-Trichloro-2, -bis(p-methoxyphenyl)ethane Extemely Hazardous 1,1a,2,2,3,3a,4,5,5,5a,5b,6-Dodecachlorooctahydro-1,3,4-metheno-1H-cyclobuta (cd) pentalene, Dechlorane Extemely Hazardous 1,1a,3,3a,4,5,5,5a,5b,6-Decachloro--octahydro-1,2,4-metheno-2H-cyclobuta (cd) pentalen-2- one, chlorecone Extemely Hazardous 1,1-Dimethylhydrazine 57-14-7 Extemely Hazardous 1,2,3,4,10,10-Hexachloro-6,7-epoxy-1,4,4,4a,5,6,7,8,8a-octahydro-1,4-endo-endo-5,8- dimethanonaph-thalene Extemely Hazardous 1,2,3-Propanetriol, trinitrate P081 55-63-0 Acutely Hazardous 1,2,3-Propanetriol, trinitrate 55-63-0 Extemely Hazardous 1,2,4,5,6,7,8,8-Octachloro-4,7-methano-3a,4,7,7a-tetra- hydro- indane Extemely Hazardous 1,2-Benzenediol, 4-[1-hydroxy-2-(methylamino)ethyl]- 51-43-4 Extemely Hazardous 1,2-Benzenediol, 4-[1-hydroxy-2-(methylamino)ethyl]-, P042 51-43-4 Acutely Hazardous 1,2-Dibromo-3-chloropropane 96-12-8 Extemely Hazardous 1,2-Propylenimine P067 75-55-8 Acutely Hazardous 1,2-Propylenimine 75-55-8 Extemely Hazardous 1,3,4,5,6,7,8,8-Octachloro-1,3,3a,4,7,7a-hexahydro-4,7-methanoisobenzofuran Extemely Hazardous 1,3-Dithiolane-2-carboxaldehyde, 2,4-dimethyl-, O- [(methylamino)-carbonyl]oxime 26419-73-8 Extemely Hazardous 1,3-Dithiolane-2-carboxaldehyde, 2,4-dimethyl-, O- [(methylamino)-carbonyl]oxime.
    [Show full text]
  • Inhibition of Mercaptan Odor in Organothiophosphate Biocides
    Europa,schesP_ MM M II M MM IN Ml MM I M Ml J European Patent Office _ _ _ © Publication number: 0 378 303 B1 Office_„. europeen des brevets EUROPEAN PATENT SPECIFICATION © Date of publication of patent specification: 05.04.95 © Int. CI.6: A01 N 57/02 © Application number: 90300080.0 @ Date of filing: 04.01.90 © Inhibition of mercaptan odor in organothiophosphate biocides. © Priority: 04.01.89 US 293244 © Proprietor: ZENECA LIMITED 15 Stanhope Gate @ Date of publication of application: London W1Y 6LN (GB) 18.07.90 Bulletin 90/29 @ Inventor: Chen, Chia-Chung © Publication of the grant of the patent: 124 Farragut Street 05.04.95 Bulletin 95/14 Hercules, California 94547 (US) Inventor: Rider, Richard H. © Designated Contracting States: 1308 Norvell Street AT BE CH DE DK ES FR GB GR IT LI LU NL SE El Cerrito, California 94530 (US) Inventor: Lo, Ray J. © References cited: 2908 Bayview Drive EP-A- 0 210 608 Alameda, California 94501 (US) FR-A- 2 196 751 CENTRAL PATENTS INDEX, BASIC AB- © Representative: Bishop, Nigel Douglas et al STRACTS JOURNAL, section C, 1967, ab- Intellectual Property Department stract no.67-8304g, Derwent Publications Ltd, ZENECA Agrochemicals London, GB; & JP-A-42 003 381 Jealotts Hill Research Station P.O. Box 3538 CHEMICAL ABSTRACTS, vol. 99, no. 6, 8th Bracknell August 1983, page 147, abstract no. 40962r, Berkshire RG12 6YA (GB) Columbus, Ohio, US; 00 00 o 00 00 00 Note: Within nine months from the publication of the mention of the grant of the European patent, any person may give notice to the European Patent Office of opposition to the European patent granted.
    [Show full text]
  • Qsar Analysis of the Chemical Hydrolysis of Organophosphorus Pesticides in Natural Waters
    QSAR ANALYSIS OF THE CHEMICAL HYDROLYSIS OF ORGANOPHOSPHORUS PESTICIDES IN NATURAL WATERS. by Kenneth K. Tanji Principal Investigator and Jonathan 1. Sullivan Graduate Research Assistant Department of Land, Air and Water Resources University of California, Davis Technical Completion Report Project Number W-843 August, 1995 University of California Water Resource Center The research leading to this report was supported by the University of California Water Resource Center as part of Water Resource Center Project W-843. Table of Contents Page Abstract 2 Problem and Research Objectives 3 Introduction 5 Theoretical Background 6 QSAR Methodology 7 Molecular Connectivity Theory 8 Organophosphorus Pesticides 12 Experimental Determination of Rates 15 Results and Discussion 17 Principal Findings and Significance 19 References 34 List of Tables Page Table 1. Statistical relationship between OP pesticides and first-order MC/'s. 30 Table 2. Inherent conditions of waters used in experimental work. 16 Table 3. Estimated half-lives for organophosphorus esters derived from model. 31 Table 4. Half-lives and first-order MCI' sfor model calibration data set. 31 Table 5. Experimental kinetic data for validation set compounds, Sacramento. 33 List of Figures Page Figure 1. Essential Features OfQSAR Modeling Methodology. 21 Figure 2. Regression plot for In hydrolysis rate vs. 1st order MCl' s. 22 Figure 3. a 3-D molecular model, a line-segment model and a graphical model. 23 Figure 4. Molecular connectivity index suborders. 24 Figure 5. Chlorpyrifos and its fourteen fourth order path/cluster fragments. 25 Figure 6. Abridged MClndex output. 26 Figure 7. Parent acids of most common organophosphorus pesticides. 12 Figure 8.
    [Show full text]
  • Gas-Phase Chemical Reduction (GPCR)
    Gas-Phase Chemical Reduction (GPCR) Name of Process: Status: Gas-Phase Chemical Reduction (GPCR) A Commercial system operated in Australia for more than 5 years, treating Vendor: more than 2,500 tons of PCB’s, DDT and other POPs. In 1999 a full-scale test ELI Eco Logic International Inc. on HCB was conducted using the commercial plant. Web site: http://www.ecologic.ca Eco Logic’s partners in Japan have recently built a semi-mobile GPCR plant for Applicable Pesticides and related the treatment of PCB wastes, which will be operational in 2003. POPs wastes: Pesticides such as Hexachlorobenzene, In combination with Foster Wheeler and Kvaerner the company is DDT, Aldrin, Dieldrin, HCB’s, DDT, PCB’s, participating at present in the ACWA (Army Chemical Weapons Assessment) dioxins and furans and other POPs. Program for the destruction of chemical warfare agents. Eco Logic has partnered with Torftech Inc. for the treatment of soils and sediments at rates of up to 20 tons per hour. Eco Logic has also been selected by UNIDO for a pilot project for treatment of 1000 tons of PCB wastes in Slovakia. Additional approvals received: -for PCB and dioxin waste in Japan -for PCB’s TSCA permit in USA -for PCB’s and other toxic compounds in the Province of Ontario (Canada) Technology description: Eco Logic’s GPCR technology involves the gas-phase chemical reduction of organic compounds by hydrogen at a temperature of 850°C or higher. Chlorinated hydrocarbons, such as HCB, polychlorinated dibenzo-p-dioxins (dioxins) and other POPs, are chemically reduced to methane and hydrogen chloride (HCl).
    [Show full text]
  • Recommended Classification of Pesticides by Hazard and Guidelines to Classification 2019 Theinternational Programme on Chemical Safety (IPCS) Was Established in 1980
    The WHO Recommended Classi cation of Pesticides by Hazard and Guidelines to Classi cation 2019 cation Hazard of Pesticides by and Guidelines to Classi The WHO Recommended Classi The WHO Recommended Classi cation of Pesticides by Hazard and Guidelines to Classi cation 2019 The WHO Recommended Classification of Pesticides by Hazard and Guidelines to Classification 2019 TheInternational Programme on Chemical Safety (IPCS) was established in 1980. The overall objectives of the IPCS are to establish the scientific basis for assessment of the risk to human health and the environment from exposure to chemicals, through international peer review processes, as a prerequisite for the promotion of chemical safety, and to provide technical assistance in strengthening national capacities for the sound management of chemicals. This publication was developed in the IOMC context. The contents do not necessarily reflect the views or stated policies of individual IOMC Participating Organizations. The Inter-Organization Programme for the Sound Management of Chemicals (IOMC) was established in 1995 following recommendations made by the 1992 UN Conference on Environment and Development to strengthen cooperation and increase international coordination in the field of chemical safety. The Participating Organizations are: FAO, ILO, UNDP, UNEP, UNIDO, UNITAR, WHO, World Bank and OECD. The purpose of the IOMC is to promote coordination of the policies and activities pursued by the Participating Organizations, jointly or separately, to achieve the sound management of chemicals in relation to human health and the environment. WHO recommended classification of pesticides by hazard and guidelines to classification, 2019 edition ISBN 978-92-4-000566-2 (electronic version) ISBN 978-92-4-000567-9 (print version) ISSN 1684-1042 © World Health Organization 2020 Some rights reserved.
    [Show full text]
  • Chlorpyrifos Hazards to Fish, Wildlife, and Invertebrates: a Synoptic Review
    Biological Report Contaminant Hazard Reviews March 1988 Report No. 13 CHLORPYRIFOS HAZARDS TO FISH, WILDLIFE, AND INVERTEBRATES: A SYNOPTIC REVIEW By Edward W. Odenkirchen Department of Biology The American University Washington, DC 20016 And Ronald Eisler U.S. Fish and Wildlife Service Patuxent Wildlife Research Center Laurel, MD 20708 SUMMARY Chlorpyrifos (phosphorothioic acid O, O,-diethyl 0-(3,5,6,-trichloro-2-pyridinyl) ester), an organophosphorus compound with an anticholinesterase mode of action, is used extensively in a variety of formulations to control a broad spectrum of agricultural and other pestiferous insects. Domestic use of chlorpyrifos in 1982 was about 3.6 million kg; the compound is used mostly in agriculture, but also to control mosquitos in wetlands (0.15 million kg applied to about 600,000 ha) and turf-destroying insects on golf courses (0.04 million kg). Accidental or careless applications of chlorpyrifos have resulted in the death of many species of nontarget organisms such as fish, aquatic invertebrates, birds, and humans. Applications at recommended rates of 0.028 to 0.056 kg/surface ha for mosquito control have produced mortality, bioaccumulation, and deleterious sublethal effects in aquatic plants, zooplankton, insects, rotifers, crustaceans, waterfowl, and fish; adverse effects were also noted in bordering invertebrate populations. Degradation rate of chloropyrifos in abiotic substrates varies, ranging from about 1 week in seawater (50% degradation) to more than 24 weeks in soils under conditions of dryness, low temperatures, reduced microbial activity, and low organic content; intermediate degradation rates reported have been 3.4 weeks for sediments and 7.6 weeks for distilled water.
    [Show full text]