The Association of an SNP in the EXOC4 Gene and Reproductive Traits Suggests Its Use As a Breeding Marker in Pigs

animals

Article The Association of an SNP in the EXOC4 Gene and Reproductive Traits Suggests Its Use as a Breeding Marker in Pigs

Yingting He 1,†, Xiaofeng Zhou 1,†, Rongrong Zheng 1, Yao Jiang 1, Zhixiang Yao 2, Xilong Wang 3, Zhe Zhang 1 , Hao Zhang 1, Jiaqi Li 1,* and Xiaolong Yuan 1,3,*

1 Guangdong Provincial Key Lab of Agro-Animal Genomics and Molecular Breeding, National Engineering Research Center for Breeding Swine Industry, College of Animal Science, South China Agricultural University, Guangzhou 510642, China; [email protected] (Y.H.); [email protected] (X.Z.); [email protected] (R.Z.); [email protected] (Y.J.); [email protected] (Z.Z.); [email protected] (H.Z.) 2 Guangdong Dexing Food Co., Ltd., Shantou 515100, China; [email protected] 3 Guangdong Provincial Key Laboratory of Laboratory Animals, Guangdong Laboratory Animals Monitoring Institute, Guangzhou 510260, China; [email protected] * Correspondence: [email protected] (J.L.); [email protected] (X.Y.) † These authors contributed equally to this work.

Simple Summary: The exocyst complex component 4 (EXOC4) gene is essential for the growth and development of humans and animals. However, the molecular mechanisms between EXOC4 and the reproductive performance of pigs is yet to be elucidated. The findings of our study revealed that single-nucleotide polymorphism (SNP) rs81471943 (C/T) was located in the EXOC4 gene by Sanger sequencing and PCR-restriction fragment length polymorphism (PCR-RFLP). We then analyzed Citation: He, Y.; Zhou, X.; Zheng, R.; the relationship between this SNP in EXOC4 and reproductive traits. We found that CC was the Jiang, Y.; Yao, Z.; Wang, X.; Zhang, Z.; most frequent genotype on number of piglets born alive (NBA), litter weight at birth (LWB), number Zhang, H.; Li, J.; Yuan, X. The 0 Association of an SNP in the EXOC4 of piglets weaned (NW), and litter weight at weaning (LWW). Finally, 5 -deletion and luciferase Gene and Reproductive Traits assays showed a positive transcription regulatory element in the EXOC4 promoter. Therefore, we Suggests Its Use as a Breeding Marker predicted that −1781G/A might regulate the expression of EXOC4 by affecting the potential binding in Pigs. Animals 2021, 11, 521. of transcription factors P53, E26 transformation specific sequence -like 1 transcription factor (ELK1), https://doi.org/10.3390/ani11020521 or myeloid zinc finger 1 (MZF1).

Academic Editor: Rodrigo Manjarin Abstract: In mammals, the exocyst complex component 4 (EXOC4) gene has often been reported to be involved in vesicle transport. The SNP rs81471943 (C/T) is located in the intron of porcine EXOC4, Received: 29 January 2021 while six quantitative trait loci (QTL) within 5–10 Mb around EXOC4 are associated with ovary Accepted: 10 February 2021 weight, teat number, total offspring born alive, and corpus luteum number. However, the molecular Published: 17 February 2021 mechanisms between EXOC4 and the reproductive performance of pigs remains to be elucidated. In this study, rs81471943 was genotyped from a total of 994 Duroc sows, and the genotype and allele Publisher’s Note: MDPI stays neutral frequency of SNP rs81471943 (C/T) were statistically analyzed. Then, the associations between SNP with regard to jurisdictional claims in rs81471943 and four reproductive traits, including number of piglets born alive (NBA), litter weight at published maps and institutional affil- iations. birth (LWB), number of piglets weaned (NW), and litter weight at weaning (LWW), were determined. Sanger sequencing and PCR restriction fragment length polymorphism (PCR-RFLP) were utilized to identify the rs81471943 genotype. We found that the genotype frequency of CC was significantly higher than that of CT and TT, and CC was the most frequent genotype for NBA, LWB, NW, and LWW. Moreover, 50-deletion and luciferase assays identified a positive transcription regulatory element Copyright: © 2021 by the authors. − Licensee MDPI, Basel, Switzerland. in the EXOC4 promoter. After exploring the EXOC4 promoter, SNP 1781G/A linked with SNP This article is an open access article rs81471943 (C/T) were identified by analysis of the transcription activity of the haplotypes, and distributed under the terms and SNP −1781 G/A may influence the potential binding of P53, E26 transformation specific sequence conditions of the Creative Commons -like 1 transcription factor (ELK1), and myeloid zinc finger 1 (MZF1). These findings provide useful Attribution (CC BY) license (https:// information for identifying a molecular marker of EXOC4-assisted selection in pig breeding. creativecommons.org/licenses/by/ 4.0/).

Animals 2021, 11, 521. https://doi.org/10.3390/ani11020521 https://www.mdpi.com/journal/animals Animals 2021, 11, 521 2 of 13

Keywords: commercial pig; reproductive traits; gene polymorphism; promoter

1. Introduction Pigs were the earliest livestock species to be domesticated. Pig breeding has a particu- larly long history involving artificial selection from domestication to modern breeding [1]. The abundant phenotypic variations established during pig breeding have been a valuable resource to study the economic trait mechanisms underlying domestication [2]. Causal gene identification provides useful information about the mutation types underlying the phenotypic evolution of domestic animals [3]. In porcine production, improvements in the reproductive performance of sows are slow due to the low heritability of reproductive traits [4]. The recent development of sequencing and genotyping technologies for pigs have enabled the exploration of genomic evidence of selection and the detection of can- didate genes associated with target traits. Studies have found that the positive selection of pigs is associated with specific genes related to lactation [5], reproduction [6,7], meat quality [8], and growth traits [9]. Reproductive traits, such as the number of piglets born alive (NBA) [10], lactation capacity, number of piglets weaned (NW) [11], and litter weight at weaning (LWW) [12], have all been genetically improved through artificial selection. Porcine reproduction performance is mostly evaluated by quantitative traits, which in turn are mainly affected by minor genes. These minor genes can be identified by quantitative trait loci (QTL) mapping [13]. According to PigQTLdb [14], there are 29,865 QTL associated with 688 different traits. On chromosome 18, there are three, three, two and five QTL significantly associated with porcine ovary weight [15], teat number, total offspring born alive, and corpus luteum number traits [16–18], respectively. In a commercial single nucleotide polymorphism (SNP) array, one SNP, rs81471943, located in the exon of the exocyst complex component 4 (EXOC4) gene, and six QTLs associated with reproductive traits were identified within 5–10 Mb around EXOC4. This suggested that EXOC4 might be associated with reproductive traits. EXOC4 is one of the subunits of the exocyst, which is an evolutionarily conserved complex of eight proteins, comprising EXOC1, EXOC2, EXOC3, EXOC4, and other subunits. The exocyst complex is posited to be involved in protein transfer between cells [19,20]. EXOC4 connects vesicles to the cell membrane and participates in vesicular-mediated transport. EXOC4 has been reported to be expressed in many human tissues, with slightly higher expression in the ovary, skeletal muscle, spleen, and hypothalamus [21]. A study investigating the gene interactions for body mass index (BMI) in a European–American adult female cohort used genome-wide interaction analyses and pathway association analyses to show that the EXOC4-1q23.1 interaction was associated with BMI. In the pathway-based association analysis, the Tob1 pathway, which contributes to obesity through the mitogen-activated protein kinase (MAPK) pathway, showed the most significant association with BMI. These findings were also replicated in different human populations [22]. In addition, we analyzed the general linkage disequilibrium (LD) within +/−100 Kb around the EXOC4 gene via Haploview. However, the underlying relationship between SNP rs81471943 and reproductive traits, as well as the transcription mechanism of EXOC4, are still unclear in pigs. To explore the relationship between SNP rs81471943 and reproduction traits in pigs, we acquired the genotype frequencies of SNP rs81471943 in Duroc pigs. The associations between SNP rs81471943 and reproductive traits such as NW, LWW, NBA, and litter weight at birth (LWB) were determined. Then, 50-deletion and a luciferase assay were utilized to identify whether SNP rs81471943 was associated with the transcription of EXOC4. This study contributes to the understanding of the regulatory mechanisms of the EXOC4 gene and molecular marker-assisted selection in pig breeding. Animals 2021, 11, 521 3 of 13

2. Materials and Methods 2.1. Ethics Approval and Consent to Participate Experiments and animal care in this study were conducted according to the Regu- lations for the Administration of Affairs Concerning Experimental Animals (Ministry of Science and Technology, Beijing, China, revised June 2004) and approved by the Animal Care and Use Committee of the South China Agricultural University, Guangzhou, China (approval number: SYXK 2019-0136).

2.2. Animals Ear samples from 994 Duroc sows prepared for SNP genotyping were obtained from a breeding herd and were collected from 2009 to 2017 in Fujian, China. The ear samples were collected into 75% alcohol and stored at −20 ◦C. TaKaRa MiniBEST Universal Ge- nomic DNA Extraction Kit Version 4.0 (TaKaRa, Dalian, China) was utilized to extract the genomic DNA from porcine ear tissues. The A260/280 ratios of all DNA samples were determined with a NanoDrop One (Thermo Fisher Scientiﬁc, Waltham, MA, USA). All DNA samples passed A260/280 ratio (1.7–2.0) detection and were genotyped on an Illumina PorcineSNP60 BeadChip (Illumina, San Diego, CA, USA). Four reproductive traits, including NBA, LWB, NW and LWW, were recorded. NBA and LWB were measured 24 h after delivery, and LWW and NW were recorded after weaning.

2.3. Polymorphism Identification and Genotype with PCR-Restriction PCR-RFLP To determine the polymorphic locus rs81471943 (C/T) of the porcine EXOC4 gene, 8 Duroc pigs were sequenced by Sanger sequencing, and 10 Duroc pigs were genotyped by PCR-restriction fragment length polymorphism (PCR-RFLP) as confirmation. DNA extracted from the ear samples of 10 pigs was set as the template. The fragment containing SNP rs81471943 (position: 16,079,412 of chromosome 18) of EXOC4, a gene with a length of 640 bp (position: 16,078,898–16,079,537 of chromosome 18), was amplified using PrimerSTAR® high fidelity enzyme (TaKaRa, Dalian, China). The primers are listed in Table1 and named EXOC4-SNP. The PCR reaction system (10 µL) included: 5 µL Primer STAR mix, 0.3 µL forward primer, 0.3 µL reverse primer, 1 µL DNA and 3.4 µL double ◦ distilled H2O (ddH2O). The PCR procedure involved: pre-denaturation at 98 C for 2 min, 35 cycles (denaturation at 98 ◦C for 10 s, annealing at 53 ◦C for 15 s, extension at 72 ◦C for 1 kb * min−1), and extension at 72 ◦C for 10 min.

Table 1. Primers used in this study. SNP: single nucleotide polymorphism.

Fragment Name Primer Sequence Length (bp) F: ACAGCCTCGGCTCAACCTTA EXOC4-SNP 640 R: TGCTTTTACGAAGGGGGACA F: GAGCGAGTCCTTGTCTACAGT EXOC4-Promoter 2791 R: TGCTTTTACGAAGGGGGACA F: CGACGCGTGAGCGAGTCCTTGTCTACAGT P0 (−2657/+134) 2791 R: CCCAAGCTTGCGCATTGGGGATTCTTACA P1 (−2204/+134) F: CGACGCGTGGGAACTCGTTCTTTCCCCC 2338 P2 (−1914/+134) F: CGACGCGTCCACTCGGACTGTCATCAGC 2048 P3 (−1682/+134) F: CGACGCGTAAGATGGGAGATGGTTCGGG 1816 P4 (−1323/+134) F: CGACGCGTGGATGGCTGGATTCCACACT 1457 P5 (−886/+134) F: CGACGCGTTTTTACAGGTTACTGGTCAGACT 1020 P6 (−518/+134) F: CGACGCGTATTTAATGTGCAGGACCATGCG 652 F: CGACGCGTATGGCTATGTCTAGCCTCCC P3A (−1826/+134) 1950 R: CCCAAGCTTGCGCATTGGGGATTCTTACA P4A (−1551/+134) F: CGACGCGTACCAGCCACCTCACTTTTGA 1685 P4B (−1225/+134) F: CGACGCGTTCATTGGGATGCTACCAGGC 1359 Animals 2021, 11, 521 4 of 13

Consequently, PCR products were separated by agarose gel electrophoresis and isolated using a Gel extraction kit (Meiji, Guangzhou, China). The isolated products were digested by BsrB I (identiﬁcation sequence: CCGCTC) restriction endonuclease (NEB, Ipswich, UK) and separated using agarose gel electrophoresis. PCR products with two digested fragments were CC genotype (565 bp + 75 bp), those with three digested fragments were CT genotype (640 bp + 565 bp + 75bp), and those with a single digested fragment were TT genotype (640 bp).

2.4. Culture of Porcine Granulosa Cells (GCs) In Vitro GCs were cultured according to previous studies [23]. Porcine ovaries were collected from a local slaughterhouse in Guangzhou, China. The ovaries were stored in phosphate- buffered saline (PBS) containing penicillin (100 IU/mL) and streptomycin (100 µg/mL; Invitrogen, Shanghai, China) at 37 ◦C and transported to the laboratory quickly. Then, 5–7 mm follicles were punctured, and GCs in follicular fluid were collected using a 1 mL syringe. After washing the isolated GCs twice with PBS, the GCs were seeded into 75 cm2 ◦ flasks and cultured at 37 C under 5% CO2 in Dulbecco’s modified Eagle medium (Hyclone, Logan, UT, USA) containing 10% fetal bovine serum (100 IU/mL penicillin and 100 µg/mL streptomycin; Hyclone, Logan, UT, USA).

2.5. Construction of EXOC4 50-Deletion Fragment Vectors According to the promoter sequences of porcine EXOC4 from release 89 of the En- sembl genome browser (accession number: ENSSSCG00000016543, position: 16,057,927– 16,346,564 of chromosome 18), we inferred that there was no leader exon present in EXOC4. Then, we designed 10 pairs of primers to amplify the deletion fragments of the EXOC4 promoter (Table1). The transcription start site of the EXOC4 gene (position: 16,346,564 of chromosome 18) was defined as +1. Thus, the longest 50 deletion fragment, which covered a 2657 bp sequence upstream of the transcription start site and a 134 bp sequence of the first exon, was named P0 (−2657/+134), and the other fragments were named P1 (−2204/+134), P2 (−1914/+134), P3 (−1682/+134), P4 (−1323/+134), P5 (−886/+134) and P6 (−518/+134). The shorter 50 deletion fragments were named P3A (−1826/+134), P4A (−1551/+134), and P4B (−1225/+134). The PCR product was obtained by Taq DNA polymerase (Vazyme, Piscataway, NJ, USA). The primers are listed in Table1. The PCR reaction system (10 µL) included: 5 µ L PCR Taq mix, 0.3 µL forward primer, 0.3 µL reverse primer, 1 µL DNA, and 3.4 µL ddH2O. The PCR procedure involved: pre-denaturation at 94 ◦C for 3 min, 35 cycles (denaturation at 94 ◦C for 30 s, annealing at 60 ◦C for 30 s, extension at 72 ◦C for 1 kb * min−1), and extension at 72 ◦C for 10 min. PCR products were purified by gelatinization and were added “AAA” tails to ligate with PMD-18T were performed prior to Sanger sequencing (RuiBiotech, Beijing, China). The DNA sequences of PCR products were determined by DNASTAR software. Each deletion fragment digested with Hind III and MIu I was cloned into the eukaryotic expression vector pGL3-vector, which was also digested with Hind III and MIu I restriction endonucleases.

2.6. Luciferase Assay According to the manufacturer’s instructions for the dual-luciferase reporter assay kit (Promega, Madison, WI, USA), we used the BioTek Synergy 2 multifunctional microplate reader for fluorescence detection (BioTek, Winooski, VT, USA). In the luciferase assay, firefly luciferase was set as the experimental reporter and renilla luciferase was set as the control. Relative luciferase activity is calculated by the ratio of the expression of firefly luciferase (560 nm) to renilla luciferase (465 nm). The ratio of expression can normalize the activity of an experimental reporter to the activity of an internal control, which minimizes or sometimes even eliminates the experimental variability. AnimalsAnimals2021 2021, ,11 11,, 521 x FOR PEER REVIEW 5 ofof 1313

2.7.2.7. IdentificationIdentification ofof SNPSNP andand TranscriptionTranscription Binding Binding Sites Sites ForFor sequencingsequencing and SNP SNP identification, identification, 35 35 pigs pigs were were randomly randomly selected selected from from the the994 994pigs pigs used used in inthis this study study.. PCR PCR was was performed performed using using PrimerSTAR PrimerSTAR® high fidelityfidelity enzymeenzyme (TaKaRa,(TaKaRa, Dalian,Dalian, China) to to obtain obtain the the fragment fragment containing containing the the EXOCEXOC44 promotor,promotor, and and the theprimers primers used used are arelisted listed in Table in Table 1 (1named (named EXOC4 EXOC4-Promoter).-Promoter). The The reaction reaction system system and andPCR PCR procedure procedure were were the same the same as in as Section in Section 2.3. Then, 2.3. Then, the PCR the product PCR product was linked was linked to the toT- thevector T-vector and sequenced and sequenced by Sanger by Sanger sequencing sequencing (Beijing (RuiBiotech, Aoboxingke Beijing,, China China).). After After com- comparingparing with with the the sequences sequences published published on on the the Ensembl Ensembl genome genome browser browser ( (releaserelease 89),89), oneone SNPSNP waswasidentified identified and and located located on on− −1781G/A1781G/A of EXOC4EXOC4,, and thisthis SNPSNP alsoalso locatedlocated onon thethe potentialpotential transcriptiontranscriptionfactor-binding factor-binding fragment fragment P3A-P4A P3A‐P4A ( −(−1826/1826/−−1551)1551) of of EXOC4EXOC4. . ToTo detectdetect the the linkage linkage between between SNP SNP− −1781G/A1781G/A and SNPSNP rs81471943rs81471943 ofof EXOC4EXOC4,, fourfour haplotypeshaplotypes werewere identifiedidentified andand defineddefined asas HA-1HA-1 (GC),(GC), HA-2HA‐2 (AC),(AC),HA-3 HA-3(GT) (GT)and andHA-4 HA-4 0 (AT).(AT). The The 5 5′deletion deletion fragments fragments EXOC4-P2 EXOC4-P2 (− (−1914/+134)1914/+134) of four haplotypes werewere amplifiedamplified andand clonedcloned intointo thethe eukaryoticeukaryotic expressionexpression vectorvectorpGL3-vector. pGL3‐vector. LuciferaseLuciferase assaysassays werewere usedused toto detect detect the the effect effect of of different different haplotypes haplotypes on on the the transcription transcription activity activity of EXOC4 of EXOC. We4. analyzedWe analyzed the generalthe general linkage linkage disequilibrium disequilibrium (LD) (LD) within within +/ −+/100−100 Kb Kb of of the theEXOC4 EXOC4gene gene viavia Haploview,Haploview, andand thethe locationlocation diagramdiagram ofof thethe SNP,SNP, exons, exons, deletion, deletion, bindingbinding sites,sites, andand promoterpromoter is isshown shown inin FigureFigure1 .1. Then, Then, the the potential potential transcription transcription factor factor binding binding region region was was alsoalso predictedpredicted byby TFBINDTFBIND [[21]21] andand JasparJaspar [22[22].]. TheThe resultsresults ofof the the potential potential transcription transcription factorfactor bindingbinding sitesite werewere scoredscored by by TFBIND. TFBIND.

FigureFigure 1.1. SchematicSchematic diagramdiagram ofof thethe EXOC4EXOC4 structure.structure. Notes: The linkage disequilib disequilibriumrium ( (LD)LD) plot plot withinwithin +/+/−110000 Kb Kb of of the the EXOC4 EXOC4 gene gene was was computed computed by by Haploview. Haploview. The color of each square from light to dark (white to red) indicates the degree of LD from low to high. 2.8. Statistical Analysis 2.8. StatisticalEstimated Analysis breeding values (EBVs) of all pigs were computed using animal model best Estimatedlinear unbiased breeding prediction values (EBVs)[24] and of obtained all pigswere fromcomputed the in-farm using genetic animal evaluation model bestsoft- linearware platform unbiased Herdsm predictionan [swine24] and management obtained from (S & the S in-farmProgramming, genetic Lafayette, evaluation IN, software USA). platformThe models Herdsman used were swine as follows: management (S & S Programming, Lafayette, IN, USA). The models used were as follows: Y = Xb + Za + Wpe + e = + + + where Y is a vector of phenotypicY records,Xb Za b isWpe the vectore of fixed effects (including parity and year-season), a is the vector of additive genes, pe is the vector of permanent en- where Y is a vector of phenotypic records, b is the vector of ﬁxed effects (including parity vironmental effects, e is a vector of residuals, and X, Z and W are incidence matrices and year-season), a is the vector of additive genes, pe is the vector of permanent environ- for b, a, and pe. mental effects, e is a vector of residuals, and X, Z and W are incidence matrices for b, a, and pe. Animals 2021, 11, x FOR PEER REVIEW 6 of 13 Animals 2021, 11, 521 6 of 13

The EBVs of reproductive traits (NBA, LWB, LWW and NW) were used for the mul- tipleThe comparisons EBVs of reproductive of SNP genotype traits (NBA, rs81471943 LWB, LWWby the and Tukey NW)–Kramer were used multiple for the multiplecompari- comparisonsson via the 9.2 of SNPversion genotype of SAS rs81471943 software ( byNorth the Tukey–KramerCarolina State multipleUniversity, comparison Raleigh, NC, via theUSA 9.2). p version < 0.05 indicates of SAS softwaresignificant (North difference Carolinas. State University, Raleigh, NC, USA). p < 0.05The indicates luciferase significant assay was differences. repeated at least three times independently, and the data are shownThe luciferase as the mean assay ± was standard repeated deviation at least three(SD) timesof repeated independently, experiments. and theThe data signifi- are showncance of as differences the mean ± instandard the means deviation between (SD)two groups of repeated was experiments.analyzed using The Student’s significance t-test of(two differences-tailed). ** in indicates the means significant between twodifference groups at was p < analyzed 0.01, and using * ind Student’sicates significantt-test (two- dif- tailed).ference ** at indicates p < 0.05. significant difference at p < 0.01, and * indicates significant difference at p < 0.05. 3. Results 3. Results 3.1.3.1. PolymorphismsPolymorphisms ofof SNPSNP rs81471943rs81471943 TheThe genotypegenotype frequencyfrequency ofof thethe rs81471943rs81471943 onon thetheEXOC4 EXOC4gene gene inin thethe 994994 DurocDuroc pigspigs waswas calculatedcalculated (Table(Table2 ).2). Three Three genotypes genotypes for for SNP SNP rs81471943 rs81471943 were were found. found. CC CC was was the the mostmost frequentfrequent genotype, genotype with, with a a genotype genotype frequency frequency of of 0.715, 0.715, which which was was higher higher than than that that of CTof CT (0.258) (0.258) and and TT (0.027).TT (0.027). The The most most frequent frequent allele allele was C,was with C, anwith allele an frequencyallele frequency of 0.844, of 2 which0.844, waswhich higher was thanhigher that than of Tthat (0.156). of T The(0.156).χ2 valued The χ 0.224valued < 5.990.224 and < 5.99 confirmed and confirmed that the frequencythat the frequency distribution distribution of SNP rs81471943 of SNP rs81471943 was in accordance was in accordance with the Hardy–Weinberg with the Hardy– equilibriumWeinberg equilibrium law in the selectedlaw in the Duroc selected pig population.Duroc pig population.

TableTable 2. 2.Genotype Genotype and and allele allele frequency frequency of of SNP SNP rs81471943 rs81471943 in in the theEXOC4 EXOC4gene gene in in Duroc Duroc pigs. pigs. Allele Sample Genotype Allele 2 GenotypeGenotype Sample Quantity Genotype FrequencyAllele Allele χ2 χ Quantity Frequency FrequencyFrequency CCCC 711711 0.7150.715 C 0.844C 0.844 0.2240.224 CTCT 256256 0.2580.258 T 0.156T 0.156 TTTT 2727 0.027 0.027 χχ220.05 0.05 (2) (2) = = 5.99. 5.99.

3.2.3.2. AssociationAssociation BetweenBetween SNPSNP rs81471943rs81471943 andand ReproductionReproduction TraitsTraits DescriptiveDescriptive statisticsstatistics forfor thethe phenotype phenotype of of 994 994 Duroc Duroc sows sows with with CC, CC, CT CT and and TT TT geno- gen- typesotypes are are shown shown in in Figure Figure2. The2. The NBA NBA (Figure (Figure2A), 2A), NW NW (Figure (Figure2A) and 2A) andLWW LWW (Figure (Figure2B) of2B) individuals of individuals with with CC wasCC was higher higher than than CT andCT and TT. TheTT. The LWB LWB (Figure (Figure2B) of 2B) individuals of individ- withuals CCwith was CC higher was higher than thosethan those with CTwith and CT lower and lower than thosethan those with TTwith (Figure TT (Figure2). 2).

FigureFigure 2.2.Descriptive Descriptive statistics statistics for for phenotypes phenotypes of of Duroc Duroc pigs pigs with with three three genotypes. genotypes. (A) ( TheA) The descriptive de- statisticsscriptive forstatistics genotypes for genotypes of NBA and of NBA NW ofand the NW three of phenotypesthe three phenotypes of Duroc pigs;of Duroc (B) The pigs; descriptive (B) The descriptive statistics for genotypes of LWB and LWW of the three phenotypes of Duroc pigs. statistics for genotypes of LWB and LWW of the three phenotypes of Duroc pigs. Notes: NBA— Notes: NBA—number of piglets born alive, LWB—litter weight at birth, LWW—litter weight at number of piglets born alive, LWB—litter weight at birth, LWW—litter weight at weaning, NW— weaning, NW—number of piglets weaned. number of piglets weaned.

Moreover, descriptive statistics for EBVs of phenotypes are shown in Table3. The EBVs of NBA of individuals with CC was higher than CT and TT, but there was no signiﬁcant Animals 2021, 11, x FOR PEER REVIEW 7 of 13 Animals 2021, 11Animals, x FOR2021 PEER, 11 REVIEW, 521 7 of 13 7 of 13

Moreover, descriptive statistics for EBVs of phenotypes are shown in Table 3. The Moreover, descriptive statistics for EBVs of phenotypes are shown in Table 3. The EBVsdifference of NBA among of individuals the three with genotypes. CC was higher The EBVs than of CT LWB and ofTT, individuals but there was with no CC signif- was EBVs of NBA of individuals with CC was higher than CT and TT, but there was no signif- icanthigher difference than CT among and lower the three than genotypes. TT. The EBVs The ofEBVs NW of and LWB LWW of individuals of individuals with CC with was CC icant difference among the three genotypes. The EBVs of LWB of individuals with CC was higherwas significantly than CT and higher lower thanthan CTTT. and The non-significantly EBVs of NW and higher LWW thanof individuals TT (Table 3with). These CC higher than CT and lower than TT. The EBVs of NW and LWW of individuals with CC wasobservations significantly suggested higher thatthan CC CT was and the non most-signific frequentantly genotypehigher than for NWTT (Table and LWW. 3). These was significantly higher than CT and non-significantly higher than TT (Table 3). These observations suggested that CC was the most frequent genotype for NW and LWW. observationsTable suggested 3. Multiple that comparisons CC was the between most frequent genotypes genotype of SNP rs81471943 for NW and and estimatedLWW. breeding values Table 3. Multiple comparison(EBVs)s between of reproductive genotypes traits of SNP in Durocrs81471943 pigs. and estimated breeding values (EBVs) of repro- Table 3. Multiple comparisons between genotypes of SNP rs81471943 and estimated breeding values (EBVs) of reproductive traits in Duroc pigs. ductive traits Genotypein Duroc pigs. Genotype Genotype FrequencyGenotype (NumberFrequency) NBANBA EBV EBV LWB LWB EBV EBV NW NW EBV EBV LWW LWW EBV EBV Genotype Genotype Frequency (Number) (Number)NBA EBV LWB EBV NW EBV LWW EBV a ab a a CC 0.715 (711) 0.21a ± 0.19 0.24ab ± 0.31 0.61a ± 0.26 6.06a ± 1.94 CC 0.715 (711) CC 0.7150.21 ± (711) 0.19 0.210.24± ±0.19 0.31a 0.240.61± 0.31 ± 0.26ab 0.616.06± 0.26 ± 1.94a 6.06 ± 1.94 a CT 0.258 (256) 0.17 ± 0.09 a 0.12 ± 0.14 a 0.36 ± 0.20 b 3.66 ± 1.48 b CT 0.258 (256) CT 0.2580.17 ± (256) 0.09 a 0.170.12± ±0.09 0.14a a 0.120.36± 0.14± 0.20a b 0.363.66± 0.20 ± 1.48b b 3.66 ± 1.48 b TT 0.027 (27) 0.12 ± 0.07 a a 0.38 ± 0.12 b b 0.53 ± 0.19 ab ab 5.35 ± 1.43 abab TT 0.027 (27) TT0.12 0.027 ± (27) 0.07 a 0.120.38± ±0.07 0.12 b 0.380.53± 0.12± 0.19 ab 0.535.35± 0.19 ± 1.43 ab5.35 ± 1.43 Notes: NBA—number of piglets born alive, LWB—litter weight at birth, LWW—litter weight at weaning, NW—number Notes: NBA—number of piglets born alive,Notes: LWB NBA—number—litter weight of piglets at birth, born LWW alive,— LWB—litterlitter weight weight at weaning, at birth, LWW—litter NW—number weight at weaning, NW— of piglets weaned. The multiple comparisons between the SNP genotype and EBVs of NBA, LWB, NW and LWW were of piglets weaned. The multiple comparisonnumbers between of piglets the weaned. SNP genotype The multiple and comparisonsEBVs of NBA, between LWB, theNW SNP and genotype LWW were and EBVs of NBA, LWB, calculated using the Tukey–Kramer method. The data used were the EBVs of least square means (LSM) ± standard errors calculated using the Tukey–Kramer method.NW andThe LWW data wereused calculatedwere the usingEBVs theof least Tukey–Kramer square means method. (LSM) The data± standard used were errors the EBVs of least square (SE). The a, b, ab were multiple comparisons result of Tukey test. In same column, LSM ± SE of EBVs followed by different (SE). The a, b, ab were multiple comparisonsmeans result (LSM) of Tukey± standard test. errorsIn same (SE). column, The a, b, abLSMwere ± multipleSE of EBVs comparisons followed result by different of Tukey test. In same column, lowercase letters indicated significant difference (p < 0.05) and followed by same lowercase letters indicated no significant lowercase letters indicated significant differenceLSM ± SE (pof < EBVs0.05) followedand followed by different by same lowercase lowercase letters letters indicated indicated significant no differencesignificant (p < 0.05) and followed difference (p > 0.05). difference (p > 0.05). by same lowercase letters indicated no significant difference (p > 0.05). 3.3. Isolation of SNP rs81471943 on EXOC4 3.3. Isolation3.3. of SNP Isolation rs81471943 of SNP on rs81471943 EXOC4 on EXOC4 Target fragments of EXOC4 containing SNP rs81471943 were amplified from ex- Target fragmentsTarget fragmentsof EXOC4of containingEXOC4 containing SNP rs81471943 SNP rs81471943 were amplified were amplified from ex- from extracted tracted DNA from eight Duroc pigs and identified by Sanger sequencing (Figure 3A–C). tracted DNADNA from from eight eight Duroc Duroc pigs pigs and and identified identified by by Sanger Sanger sequencing sequencing (Figure (Figure 3A3A–C).–C). Compared Compared with the sequence of EXOC4 in the Ensembl genome browser (release 89), a Compared with the sequence ofof EXOC4EXOC4 inin the the Ensembl Ensembl genome genome browser browser (release (release 89), 89), a polymorphica polymorphic mutation base C/T was found on EXOC4 (position: 16,079,412 of chromo- polymorphicmutation mutation base base C/T C/T was was found found on onEXOC4 EXOC4(position: (position: 16,079,412 16,079,412 of chromosome of chromo- 18), which some 18), which is in line with SNP rs81471943 in the commercial SNP array. To determine some 18), whichis in lineis in withline with SNP SNP rs81471943 rs81471943 in the in commercial the commercial SNP SNP array. array. To determine To determine the polymorphic the polymorphic loci SNP rs81471943 of EXOC4, 10 pigs were used in the PCR-RFLP de- the polymorphicloci SNP loci rs81471943 SNP rs81471943 of EXOC4 of EXOC4, 10 pigs, 10 were pigs used were in used the PCR-RFLP in the PCR detection.-RFLP de- As shown in tection. As shown in Figure 4, the three genotypes CC, CT and TT were identified by re- tection. As shownFigure 4in, theFigure three 4, genotypes the three genotypes CC, CT and CC, TT CT were and identified TT were byidentified restriction by endonucleasere- striction endonuclease BsrB I. striction endonucleaseBsrB I. BsrB I.

Figure 3. Sanger sequencing of SNP rs81471943 (C/T) on EXOC4. SNP rs81471943 (C/T) polymor- Figure 3. SangerFigure sequencing 3. Sanger of sequencing SNP rs81471943 of SNP (C/T) rs81471943 on EXOC4. (C/T) SNP on rs81471943EXOC4. SNP (C/T) rs81471943 polymor- (C/T) polymorphism locus is located at position 16,079,412 of chromosome 18, and the three genotypes were CC phism locus isphism located locus at position is located 16,079,412 at position of c 16,079,412hromosome of 18, chromosome and the three 18, andgenotypes the three were genotypes CC were CC (A), CT (B), and TT (C), respectively. M1000: DNA marker of 1000 bp. (A), CT (B), and(A), TT CT (C (B),), respectively. and TT (C), respectively.M1000: DNA M1000: marker DNA of 1000 marker bp. of 1000 bp.

Figure 4. PCR-restriction fragment length polymorphism (RFLP) detection of rs81471943 in Duroc Figure 4. PCR-restriction fragment length polymorphism (RFLP) detection of rs81471943 in Duroc Figure 4. PCR-restriction fragmentpigs. M1000: length DNA polymorphism marker of 1000 (RFLP) bp. Three detection genotype of rs81471943s were identified in Duroc by Bsr pigs.B I. M1000:PCR products DNA pigs. M1000: DNA marker of 1000 bp. Three genotypes were identified by BsrB I. PCR products marker of 1000 bp. Three genotypeswith two weredigested identiﬁed fragments by Bsr wereB I. PCR CC genotype products with(565 twobp + digested 75 bp); PCR fragments products were with CC three genotype di- with two digested fragments were CC genotype (565 bp + 75 bp); PCR products with three di- (565 bp + 75 bp); PCR productsgested withfragments three digestedwere CT genotype fragments (640 were bp CT + 565 genotype bp + 75 (640bp); and bp + PCR 565 products bp + 75 bp); with and one PCR digested fragments were CT genotype (640 bp + 565 bp + 75 bp); and PCR products with one di- products with one digestedgested fragment fragment were TTwere genotype TT genotype (640 bp). (640 bp). gested fragment were TT genotype (640 bp). 3.4. Transcription Activity Analysis of the EXOC4 Promoter 3.4. Transcription Activity Analysis of the EXOC4 Promoter Animals 2021, 11, 521 8 of 13

Animals 2021, 11, x FOR PEER REVIEW 8 of 13 Animals 2021, 11, x FOR PEER REVIEW 8 of 13

3.4. Transcription Activity Analysis of the EXOC4 Promoter 0 ToTo identify identify regulatory regulatory elements elements on on the the EXOC4EXOC4 promoter,promoter, 5 ′-deletion-deletion and and luciferase luciferase To identify regulatory elements on the0 EXOC4 promoter, 5′-deletion and luciferase assaysassays were were used. used. Six Six fragments fragments with with a 5 a′-deletion 5 -deletion of the of theEXOC4EXOC4 promoterpromoter were were amplified ampli- assays were used. Six fragments with a 5′-deletion of the EXOC4 promoter were amplified (Figureﬁed (Figure 5A) 5andA) andcloned cloned into into pGL3-vector pGL3-vector (Figure (Figure 5B).5B). Compared Compared with with EXOC4-P2 EXOC4-P2 (- (Figure 5A) and cloned into pGL3-vector (Figure 5B). Compared with EXOC4-P2 (- 1914/+134),(−1914/+134), the therelative relative luciferase luciferase activity activity of ofEXOC4-P1 EXOC4-P1 (-2204/+134), (−2204/+134), EXOC4-P3 EXOC4-P3 (- 1914/+134), the relative luciferase activity of EXOC4-P1 (-2204/+134), EXOC4-P3 (- 1682/+134),(−1682/+134), and andEXOC4-P4 EXOC4-P4 (-1323/+134) (−1323/+134) were a werell significantly all signiﬁcantly decreased decreased (Figure (Figure 5C). This5C). 1682/+134), and EXOC4-P4 (-1323/+134)− −were all significantly decreased (Figure 5C). This indicatedThis indicated that the that P1-P2 the P1–P2(-2204/-1914) ( 2204/ region1914) might region harbor might the harbor negative the control negative elements, control indicated that the P1-P2 (-2204/-1914)− − region might harbor the negative control elements, andelements, the P2-P4 and (-1914/-1323) the P2–P4 ( region1914/ might1323) harbor region the might positive harbor transcription the positive regulatory transcription ele- and the P2-P4 (-1914/-1323) region might harbor the positive transcription regulatory elements.regulatory elements. ments.

Figure 5. Transcription activity of the 5′ deletion0 fragment of the EXOC4 promoter. (A) PCR products of 5′ deletion0 frag- Figure 5. 5. TranscriptionTranscription activity activity of of the the 5′ 5deletiondeletion fragment fragment of the of theEXOC4EXOC4 promoter.promoter. (A) PCR (A) PCRproducts products of 5′ deletion of 5 deletion fragments from EXOC4 promoter; (B) enzyme digestion identification of pGL3-vector with a deletion fragment of the EXOC4 mentsfragments from from EXOC4EXOC4 promoter;promoter; (B) enzyme (B) enzyme digestion digestion identification identification of pGL3 of-vector pGL3-vector with a deletion with a deletion fragment fragment of the EXOC4 of the promoter by restriction enzyme digestion; (C) the relative luciferase activity of the 5’ deletion fragment on the EXOC4 promoterEXOC4 by restriction enzyme digestion; (C) the relativeC luciferase activity of the 5’ deletion fragment on the EXOC4 promoter.promoter M5000: DNA by restriction marker of enzyme 5000 bp. digestion; ** indicates ( )p the< 0.01. relative Data luciferaseare presented activity as means of the ± 5’ SD. deletion fragment on the promoter.EXOC4 promoter. M5000: DNA M5000: marker DNA of marker 5000 bp. of 5000 ** indicates bp. ** indicates p < 0.01. pData< 0.01. are Datapresented are presented as means as ± meansSD. ± SD. Then, the shorter 5′ deletion fragments of P3A (-1826/+134), P4A (-1551/+134), and Then,Then, the shortershorter 550 ′deletion deletion fragments fragments of of P3A P3A (− (-1826/+134),1826/+134),P4A P4A ( −(-1551/+134),1551/+134), and and P4B (-1225/+134) were amplified (Figure 6A) and cloned into the eukaryotic expression P4BP4B (-1225/+134) (−1225/+134) were were amplified amplified (Figure (Figure 6A)6A) and and cloned cloned into the eukaryotic expressionexpression vector pGL3-vector (Figure 6B). Compared with EXOC4-P3A, the relative luciferase activ- vectorvector pGL3-vector (Figure6 6B).B). Compared Compared with with EXOC4-P3A, EXOC4-P3A, the the relative relative luciferase luciferase activity activity of EXOC4-P3 and EXOC4-P4A were significantly decreased. Similarly, compared with ityof EXOC4-P3of EXOC4-P3 and and EXOC4-P4A EXOC4-P4A were were significantly significantly decreased. decreased. Similarly,Similarly, compared with EXOC4-P3, the relative luciferase activity of EXOC4-P4A was significantly decreased (Fig- EXOC4-P3,EXOC4-P3, the the relative relative luciferase luciferase activity activity of EXOC4-P4A of EXOC4-P4A was wassignificantly significantly decreased decreased (Fig- ure 6C). These results indicated that positive transcription regulatory elements might exist ure(Figure 6C).6 TheseC). These results results indicated indicated that thatpositive positive transcription transcription regulatory regulatory elements elements might might exist in the P3A–P4A (-1826/-1551) region of EXOC4. inexist thein P3A–P4A the P3A–P4A (-1826/-1551) (−1826/ region−1551) of region EXOC4 of. EXOC4.

Figure 6. Transcription activity of the P2-P4 region of EXOC4. (A) PCR products of smaller 5′ deletion fragments from the Figure 6. Transcription activity of the P2-P4 region of EXOC4. (A) PCR products of smaller 5′0 deletion fragments from the promoterFigure 6. ofTranscription EXOC4; (B) activity enzyme of digestion the P2–P4 identification region of EXOC4 of pGL3-vec.(A) PCRtor products with a further of smaller deletion 5 deletion fragment fragments of the fromEXOC4 the promoter of EXOC4; (B) enzyme digestion identification of pGL3-vector with a further deletion fragment of the EXOC4 promoter;promoter of(CEXOC4) the relative;(B) enzyme luciferase digestion activity identiﬁcation of a smaller of5’ pGL3-vectordeletion fragment with a on further the EXOC4 deletion promoter. fragment M5000: of the EXOC4 DNA promoter; (C) the relative luciferase activity of a smaller 5’ deletion fragment on the EXOC4 promoter. M5000: DNA markerpromoter; of 5000 (C) the bp. relative ** indicates luciferase p < 0.01. activity Data of are a smallerpresented 5’ deletion as means fragment ± SD. on the EXOC4 promoter. M5000: DNA marker marker of 5000 bp. ** indicates p < 0.01. Data are presented as means ± SD. of 5000 bp. ** indicates p < 0.01. Data are presented as means ± SD.

AnimalsAnimals 20212021,, 1111,, 521x FOR PEER REVIEW 99 of of 1313

3.5. Transcription Activity Analysis ofof DifferentDifferent HaplotypesHaplotypes ofof thethe EXOC4EXOC4 GeneGene The −11826/826/−1−5511551 fragment fragment of of EXOC4EXOC4 waswas amplified amplified and and sequenced. sequenced. Interestingly, Interestingly, one SNP was identifiedidentified as beingbeing locatedlocated onon −−11781781 of of EXOC4.. As As shown shown in in Table 4 4,, there there was anan SNPSNP locatedlocated onon −−11781G/A781G/A of of EXOCEXOC44, ,and and four four haplotypes haplotypes were were defined defined as HA-1HA-1 (GC),(GC), HA-2HA-2 (AC),(AC), HA-3HA-3 (GT),(GT), and HA-4HA-4 (AT).(AT).

Table 4.4. Relationship betweenbetween DurocDuroc pigspigs ofof differentdifferent EXOC4EXOC4 genotypegenotype withwith thethe SNPSNP promoter.promoter.

HaplotypeHaplotype HA-1HA-1 HA-2HA-2 HA-3HA-3 HA-4HA-4 −1781−1781 GG AA GG AA rs81471943rs81471943 CC CC TT T T

As shown in Figure 7 7,, wewe foundfound thatthat thethe luciferaseluciferase activityactivity ofof HA-1HA-1 waswas significantlysignificantly (p < 0.05) higher than HA-2,HA-2, whilst HA HA-3-3 was significantlysignificantly ( p < 0.05) higher than HA HA-4.-4. These observationsobservations suggestedsuggested thatthat thethe SNPSNP rs81471943rs81471943 mightmight link link with with− −1781G/A1781G/A andand −11781G781G to to potentially potentially affect affect the the expression expression of of EXOCEXOC44.. Moreover, Moreover, many potential binding sites of transcription transcription factors factors were were predicted predicted on on −1−7811781G/AG/A of EXOC of EXOC44 (Table(Table 5). P5).53 P53and andETS transcriptionETS transcription factor factor (ELK1 (ELK1) might) might bind bind at at−1−7811781A,A, while while myeloid myeloid zinc zinc finger finger 1 1 ( MZFMZF11) might bind at −11781G.781G.

Figure 7. Transcriptional activityactivity ofof different different haplotypes haplotypes at at the the binding binding region region of ofEXOC4 EXOC4. The. The relative relative luciferase activity of EXOC4 with different haplotypes (HA-1 (GC), HA-2 (AC), HA-3 (GT), luciferase activity of EXOC4 with different haplotypes (HA-1 (GC), HA-2 (AC), HA-3 (GT), and HA-4 and HA-4 (GT)). ** indicates p < 0.01. Data are presented as means ± SD. (GT)). ** indicates p < 0.01. Data are presented as means ± SD. Table 5. Prediction of potential binding sites on −1781G/A. Table 5. Prediction of potential binding sites on −1781G/A. TF Nucleotide Location Chain Scored Position Sequence Pattern Nucleotide TF Chain Scored Position Sequence Pattern LocationP53 −1786–1777 - 0.796 −1781A AGGAAGGTCA ELK1 −1785–1773 - 0.783 −1781A ACGTGAGGAAGGTC P53 −1786–1777 − 0.796 −1781A AGGAAGGTCA ELK1 −1785–1773MZF1 −−1787–1775 0.783 + 0.856−1781A −1781G ACGTGAGGATGAGGAGGGTCATAGGTC MZF1 −1787–1775Note: The mutation + site is in bold. 0.856 −1781G TGAGGAGGGTCAT Note: The mutation site is in bold. 4. Discussion 4. DiscussionThe exocyst is a protein complex composed of EXOC1 to EXOC8. The exocyst mediates theThe docking exocyst isof a vesicles protein complexcarrying composedmembrane of proteinsEXOC1 to[25]EXOC8. EXOC. The4 is exocyst a component mediates of the exocyst docking complex, of vesicles which carrying is associated membrane with proteins various [ 25phenomena]. EXOC4 suchis a component as cell migration, of the endexocystophoria complex, formation, which cytokinesis, is associated glucose with uptake various, and phenomena neural development such as cell in migration,mammals. Previousendophoria stud formation,ies indicate cytokinesis, that the mutation glucose uptake,of specific and SNP neural loci development in EXOC4 leads in mammals. to an in- creasePrevious in the studies malformation indicate thatrate theof human mutation newborns of speciﬁc [26]. SNPEXOC loci4 is in alsoEXOC4 involveleadsd in toinsu- an linincrease, triiodothyronine, in the malformation and thyroxine rate of secretion human newborns in Chinese [26 Holstein]. EXOC4 cattleis also [27] involved. Jiao et al in. investigatedinsulin, triiodothyronine, the interactions and between thyroxine EXOC secretion4-1q23.1 in Chinese and BMI Holstein in a European cattle [27–].Americ Jiao etan al. adultinvestigated female thecohort interactions via genome between-wideEXOC4 interaction-1q23.1 analyses, and BMI inand a European–Americanresults suggest that EXOC4-related pathways may contribute to the development of obesity [22]. Similarly, Animals 2021, 11, 521 10 of 13

adult female cohort via genome-wide interaction analyses, and results suggest that EXOC4- related pathways may contribute to the development of obesity [22]. Similarly, after EXOC4 knockout in embryos, mice can form gastrointestinal embryos normally, but are unable to progress beyond the primitive streak stage and die shortly after [20]. In addition, genome- wide association studies in chickens also report that three QTL are located on EXOC4 and are associated with growth traits of 49–56 day old chickens [28], bodyweight of 63 day old chickens [29], and pectoralis weight of 70 day old chickens [30], respectively. These observations suggest that ECOX4 might be important for economic traits in livestock. In this study, we found the SNP rs81471943 (C/T) located on the EXOC4 gene. After analyzing the relationship between genotype of the EXOC4 and reproductive traits, three genotypes (CC, CT and TT) were found in the Duroc pig population, while C was the most frequent allele. Moreover, multiple comparisons between SNP and phenotypes confirmed that CC was the most frequent genotype on NW and LWW in Duroc pigs (Figure2 and Table3). Previous studies have shown that there are three QTL which are significantly associated with teat number [16–18] on chromosome 18, which indicated that EXOC4 could affect the lactation performance of commercial pigs. In this study, we also found that CC was significantly associated with NW and LWW, but not NBA or LWB. In addition, previous studies demonstrated that reproductive traits were highly correlated with each other, such as NBA and LWB [31]. In this study, we found that CC was the most frequent genotype for NBA, but not LWB. This observation might be caused by the limited sample size used in this study, and it is likely that CC would be significantly associated with NBA in a larger population size [32]. Collectively, although the results were based on a relatively small population, to some extent, the association of SNP rs81471943 and lactation capacity, NW, and LWW could provide useful information for EXOC4-mediated reproduction in pigs. It is well known that transcription factors modulate gene expression by interacting with the promoter regions of related genes. For example, p65 may target the −348/−338 region of fibroblast growth factor receptor 1 (FGFR1) to promote the transcription of FGFR1 and enhance the pro-proliferation and anti-apoptotic effect of FGFR1 to facilitate the growth of follicles [33]. Thus, to explore effects of rs81471943 on the expression of EXOC4, the SNP markers which link with rs81471943 at the promoter of EXOC4 were further investigated by constructing 50-deletions for EXOC4. Interestingly, we found that positive regulatory elements might localize in the P3A–P4A (−1826/−1551) region (Figure6) , and the negative control element might localize in the P1–P2 (−2204/−1914) region (Figure5) . After exploring the SNPs in the P3A–P4A (−1826−1551) region (containing positive transcription regulatory elements), one SNP was found to be located on −1781. Then, we further analyzed the transcription activity of the four haplotypes. The results showed that SNP rs81471943 might link with SNP −1781G/A, and SNP −1781G showed the potential to affect the expression of EXOC4 (Figure7). These results indicate that SNP rs81471943 might link with SNP −1781G to affect the expression of EXOC4. The literature indicates that −1781G/A might regulate the expression of EXOC4 by affecting the binding of transcription factors. In this study, we also predicted that the transcription factors P53, ELK1, and MZF1 would be located on the −1826/−1551 region of the porcine EXOC4 promoter. P53 participates in maintaining cell growth [34]. P53 can enhance stability through phosphorylation and the activation or inhibition of the transcription of downstream genes, thus inducing cell cycle arrest and apoptosis [35]. ELK1 is a transcription factor belonging to the ETS oncogene family and induces endothelial-to- myofibroblast transition of tumor endothelial cells [36], which plays an important role in breast and ovarian cancers [15]. As a bifunctional transcription factor, MZF1 belongs to the zinc finger protein Kruppel transcription factor family, which regulate downstream gene expression by binding to the cis-acting element TGGGGA on gene promoters [37,38]. Results in Table4 and Figure7 indicate that the mutation of −1781G might be the cause of the differences in EXOC4 transcription. Taken together, SNP rs81471943, which was significantly associated with NW and LWW, might link with SNP −1781G/A, localizing at Animals 2021, 11, 521 11 of 13

the positive regulatory elements of the EXOC4 promoter, to affect the expression of EXOC4 in Duroc pigs.

5. Conclusions In Duroc pigs, we found that the CC genotype frequency was significantly higher than CT and TT in SNP rs81471943, and CC was the most frequent genotype for NW (p = 0.01) and LWW (p < 0.01). The −1826/−1551 region of EXOC4 contains a positive regulatory element, and the haplotypes of SNP −1781G/A and SNP rs81471943 might significantly affect the transcription activity of EXOC4. Moreover, SNP −1781G/A might influence the binding of the potential cis-acting elements P53, ELK1 and/or MZF1. These findings reveal that SNP rs81471943 is significantly associated with the reproductive traits NW and LWW in Duroc sows.

Author Contributions: Y.H. performed the research and wrote the original manuscript, X.Z., X.W. and X.Y. reviewed and edited the manuscript, R.Z., Y.J. and Z.Y. supervised the research, Z.Z. and H.Z. administrated the project, and J.L. managed the funding. All authors have read and agreed to the published version of the manuscript. Funding: This work was financially supported by the National Natural Science Foundation of China (31902131), the Science and Technology Pro-gram of Guangzhou (202002030071), the Natural Science Foundation of Guangdong Province (2019A1515010676), earmarked funds for the China Agriculture Research System (CARS-35) and the Key R&D Program of Guangdong Province (2018B020203003). Institutional Review Board Statement: Experiments and animal care in this study were conducted according to the Regulations for the Administration of Affairs Concerning Experimental Animals (Ministry of Science and Technology, Beijing, China, revised June 2004) and approved by the Animal Care and Use Committee of the South China Agricultural University, Guangzhou, China (approval number: SYXK 2019-0136). Informed Consent Statement: Not applicable. Data Availability Statement: The data presented in this study are available on request from the corresponding author. Acknowledgments: The authors would like to thank Fujian Yongcheng Farming and Animal Hus- bandry Co., Ltd. for providing the data and the opportunity to conduct this study. We gratefully thank Baoquan Shao, Shaopan Ye, Xiangchun pan, Haoqiang Ye, and Jun Zhou for their help in this work. Also, we are grateful to the editors and the three anonymous reviewers for their insightful comments and constructive suggestions that greatly improved our manuscript. Conflicts of Interest: The authors declare no conflict of interest.

References 1. Diamond, J. Evolution, consequences and future of plant and animal domestication. Nature 2002, 418, 700–707. [CrossRef] 2. Yang, Y.; Liu, C.; Adeola, A.C.; Sulaiman, X.; Xie, H.B.; Zhang, Y.P. Artiﬁcial selection drives differential gene expression during pig domestication. J. Genet. Genom. 2019, 46, 97–100. [CrossRef] 3. Andersson, L. Domestic animals as models for biomedical research. Upsala J. Med. Sci. 2016, 121, 1–11. [CrossRef][PubMed] 4. Goddard, M.E.; Hayes, B.J. Mapping genes for complex traits in domestic animals and their use in breeding programmes. Nat. Rev. Genet. 2009, 10, 381–391. [CrossRef] 5. Zhuang, Z.; Ding, R.; Peng, L.; Wu, J.; Ye, Y.; Zhou, S.; Wang, X.; Quan, J.; Zheng, E.; Cai, G.; et al. Genome-wide association analyses identify known and novel loci for teat number in Duroc pigs using single-locus and multi-locus models. BMC Genom. 2020, 21, 344. [CrossRef][PubMed] 6. Fischer, D.; Laiho, A.; Gyenesei, A.; Sironen, A. Identiﬁcation of Reproduction-Related Gene Polymorphisms Using Whole Transcriptome Sequencing in the Large White Pig Population. G3 (Bethesda) 2015, 5, 1351–1360. [CrossRef] 7. Bjerre, D.; Madsen, L.B.; Mark, T.; Cirera, S.; Larsen, K.; Jorgensen, C.B.; Fredholm, M. Potential Role of the Porcine Superoxide Dismutase 1 (SOD1) Gene in Pig Reproduction. Anim. Biotechnol. 2013, 24, 1–9. [CrossRef][PubMed] 8. Pugliese, C.; Sirtori, F. Quality of meat and meat products produced from southern European pig breeds. Meat Sci. 2012, 90, 511–518. [CrossRef] 9. Matika, O.; Robledo, D.; Pong-Wong, R.; Bishop, S.C.; Riggio, V.; Finlayson, H.; Lowe, N.R.; Hoste, A.E.; Walling, G.A.; Del-Pozo, J.; et al. Balancing selection at a premature stop mutation in the myostatin gene underlies a recessive leg weakness syndrome in pigs. PLoS Genet. 2019, 15, e1007759. [CrossRef] Animals 2021, 11, 521 12 of 13

10. Stafuzza, N.B.; Silva, R.M.O.; Fragomeni, B.O.; Masuda, Y.; Huang, Y.; Gray, K.; Lourenco, D.A.L. A genome-wide single nucleotide polymorphism and copy number variation analysis for number of piglets born alive. BMC Genom. 2019, 20, 321. [CrossRef] 11. Zheng, X.; Zhao, P.; Yang, K.; Ning, C.; Wang, H.; Zhou, L.; Liu, J. CNV analysis of Meishan pig by next-generation sequencing and effects of AHR gene CNV on pig reproductive traits. J. Anim. Sci. Biotechnol. 2020, 11, 42. [CrossRef][PubMed] 12. Sell-Kubiak, E.; Duijvesteijn, N.; Lopes, M.S.; Janss, L.L.; Knol, E.F.; Bijma, P.; Mulder, H.A. Genome-wide association study reveals novel loci for litter size and its variability in a Large White pig population. BMC Genom. 2015, 16, 1049. [CrossRef] [PubMed] 13. Ernst, C.W.; Steibel, J.P. Molecular advances in QTL discovery and application in pig breeding. Trends Genet. 2013, 29, 215–224. [CrossRef] 14. Hu, Z.L.; Park, C.A.; Reecy, J.M. Building a livestock genetic and genomic information knowledgebase through integrative developments of Animal QTLdb and CorrDB. Nucleic Acids Res. 2019, 47, D701–D710. [CrossRef] 15. Goncharenko-Khaider, N.; Matte, I.; Lane, D.; Rancourt, C.; Piche, A. Ovarian cancer ascites increase Mcl-1 expression in tumor cells through ERK1/2-Elk-1 signaling to attenuate TRAIL-induced apoptosis. Mol. Cancer 2012, 11, 84. [CrossRef][PubMed] 16. Hernandez, S.C.; Finlayson, H.A.; Ashworth, C.J.; Haley, C.S.; Archibald, A.L. A genome-wide linkage analysis for reproductive traits in F2 Large White x Meishan cross gilts. Anim. Genet. 2014, 45, 191–197. [CrossRef][PubMed] 17. Tribout, T.; Iannuccelli, N.; Druet, T.; Gilbert, H.; Riquet, J.; Gueblez, R.; Mercat, M.J.; Bidanel, J.P.; Milan, D.; Le Roy, P. Detection of quantitative trait loci for reproduction and production traits in Large White and French Landrace pig populations. Genet. Sel. Evol. 2008, 40, 61–78. [CrossRef] 18. Duijvesteijn, N.; Veltmaat, J.M.; Knol, E.F.; Harlizius, B. High-resolution association mapping of number of teats in pigs reveals regions controlling vertebral development. BMC Genom. 2014, 15, 542. [CrossRef] 19. Schiller, J.T.; Day, P.M.; Kines, R.C. Current understanding of the mechanism of HPV infection. Gynecol. Oncol. 2010, 118, S12–S17. [CrossRef] 20. Tanaka, T.; Goto, K.; Iino, M. Sec8 modulates TGF-beta induced EMT by controlling N-cadherin via regulation of Smad3/4. Cell. Signal. 2017, 29, 115–126. [CrossRef] 21. Nagase, T.; Kikuno, R.; Hattori, A.; Kondo, Y.; Okumura, K.; Ohara, O. Prediction of the coding sequences of unidentiﬁed human genes. XIX. The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro. DNA Res. 2000, 7, 347–355. [CrossRef][PubMed] 22. Jiao, H.; Zang, Y.; Zhang, M.; Zhang, Y.; Wang, Y.; Wang, K.; Price, R.A.; Li, W.D. Genome-Wide Interaction and Pathway Association Studies for Body Mass Index. Front. Genet. 2019, 10, 404. [CrossRef] 23. Zhong, Y.; Li, L.; He, Y.; He, B.; Li, Z.; Zhang, Z.; Zhang, H.; Yuan, X.; Li, J. Activation of Steroidogenesis, Anti-Apoptotic Activity, and Proliferation in Porcine Granulosa Cells by RUNX1 Is Negatively Regulated by H3K27me3 Transcriptional Repression. Genes 2020, 11, 495. [CrossRef] 24. Henderson, C.R. Best linear unbiased estimation and prediction under a selection model. Biometrics 1975, 31, 423–447. [CrossRef] 25. Lipschutz, J.H.; Mostov, K.E. Exocytosis: The many masters of the exocyst. Curr. Biol. 2002, 12, R212–R214. [CrossRef] 26. Barkefors, I.; Fuchs, P.F.; Heldin, J.; Bergstrom, T.; Forsberg-Nilsson, K.; Kreuger, J. Exocyst complex component 3-like 2 (EXOC3L2) associates with the exocyst complex and mediates directional migration of endothelial cells. J. Biol. Chem. 2011, 286, 24189–24199. [CrossRef] 27. Gan, Q.; Li, Y.; Liu, Q.; Lund, M.; Su, G.; Liang, X. Genome-wide association studies for the concentrations of insulin, triiodothyronine, and thyroxine in Chinese Holstein cattle. Trop. Anim. Health Prod. 2020, 52, 1655–1660. [CrossRef] 28. Gao, Y.; Hu, X.X.; Du, Z.Q.; Deng, X.M.; Huang, Y.H.; Fei, J.; Feng, J.D.; Liu, Z.L.; Da, Y.; Li, N. A genome scan for quantitative trait loci associated with body weight at different developmental stages in chickens. Anim. Genet. 2006, 37, 276–278. [CrossRef] [PubMed] 29. Nadaf, J.; Pitel, F.; Gilbert, H.; Duclos, M.J.; Vignoles, F.; Beaumont, C.; Vignal, A.; Porter, T.E.; Cogburn, L.A.; Aggrey, S.E.; et al. QTL for several metabolic traits map to loci controlling growth and body composition in an F2 intercross between high- and low-growth chicken lines. Physiol. Genom. 2009, 38, 241–249. [CrossRef][PubMed] 30. Park, H.B.; Jacobsson, L.; Wahlberg, P.; Siegel, P.B.; Andersson, L. QTL analysis of body composition and metabolic traits in an intercross between chicken lines divergently selected for growth. Physiol. Genom. 2006, 25, 216–223. [CrossRef] 31. Ogawa, S.; Konta, A.; Kimata, M.; Ishii, K.; Uemoto, Y.; Satoh, M. Estimation of genetic parameters for farrowing traits in purebred Landrace and Large White pigs. Anim. Sci. J. 2019, 90, 23–28. [CrossRef] 32. Charlesworth, B. Fundamental concepts in genetics: Effective population size and patterns of molecular evolution and variation. Nat. Rev. Genet. 2009, 10, 195–205. [CrossRef][PubMed] 33. Yuan, X.; Li, Z.; Kong, Y.; Zhong, Y.; He, Y.; Zhang, A.; Zhou, X.; Jiang, Y.; Zhang, Z.; Zhang, H.; et al. P65 Targets FGFR1 to Regulate the Survival of Ovarian Granulosa Cells. Cells 2019, 8, 1334. [CrossRef][PubMed] 34. McKinley, K.L.; Cheeseman, I.M. Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53- Dependent Responses to Cell-Cycle Defects. Dev. Cell 2017, 40, 405–420.e402. [CrossRef][PubMed] 35. Zhu, R.X.; Cheng, A.S.L.; Chan, H.L.Y.; Yang, D.Y.; Seto, W.K. Growth arrest-speciﬁc gene 2 suppresses hepatocarcinogenesis by intervention of cell cycle and p53-dependent apoptosis. World J. Gastroenterol. 2019, 25, 4715–4726. [CrossRef][PubMed] Animals 2021, 11, 521 13 of 13

36. Akatsu, Y.; Takahashi, N.; Yoshimatsu, Y.; Kimuro, S.; Muramatsu, T.; Katsura, A.; Maishi, N.; Suzuki, H.I.; Inazawa, J.; Hida, K.; et al. Fibroblast growth factor signals regulate transforming growth factor-beta-induced endothelial-to-myoﬁbroblast transition of tumor endothelial cells via Elk1. Mol. Oncol. 2019, 13, 1706–1724. [CrossRef][PubMed] 37. Lin, S.; Wang, X.; Pan, Y.; Tian, R.; Lin, B.; Jiang, G.; Chen, K.; He, Y.; Zhang, L.; Zhai, W.; et al. Transcription Factor Myeloid Zinc-Finger 1 Suppresses Human Gastric Carcinogenesis by Interacting with Metallothionein 2A. Clin. Cancer Res. 2019, 25, 1050–1062. [CrossRef] 38. Brix, D.M.; Bundgaard Clemmensen, K.K.; Kallunki, T. Zinc Finger Transcription Factor MZF1-A Speciﬁc Regulator of Cancer Invasion. Cells 2020, 9, 223. [CrossRef][PubMed]