DOCSLIB.ORG

Delajieldii, E. Falsen (EF) Group 13, EF Group 16, and Several Clinical Isolates, with the Species Acidovorax Facilis Comb

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Delajieldii, E. Falsen (EF) Group 13, EF Group 16, and Several Clinical Isolates, with the Species Acidovorax Facilis Comb INTERNATIONAL JOURNAL OF SYSTEMATIC BACTERIOLOGY, OCt. 1990, p. 384-398 Vol. 40, No. 4 OO20-7713/90/040384-15$02.OO/O Copyright 0 1990, International Union of Microbiological Societies Acidovorax, a New Genus for Pseudomonas facilis, Pseudomonas delaJieldii, E. Falsen (EF) Group 13, EF Group 16, and Several Clinical Isolates, with the Species Acidovorax facilis comb. nov. , Acidovorax delaJieldii comb. nov., and Acidovorax temperans sp. nov. A. WILLEMS,l E. FALSEN,2 B. POT,l E. JANTZEN,3 B. HOSTE,l P. VANDAMME,' M. GILLIS,l* K. KERSTERS,l AND J. DE LEY' Laboratorium voor Microbiologie en Microbiele Genetica, Rijksuniversiteit, B-9000 Ghent, Belgium'; Culture Collection, Department of Clinical Bacteriology, University of Goteborg, ,5413 46 Goteborg, Sweden2; and Department of Methodology, National Institute of Public Health, N-0462 Oslo, Norway3 Pseudomonas facilis and Pseudomonas delafeldii are inappropriately assigned to the genus Pseudomonas. They belong to the acidovorans rRNA complex in rRNA superfamily I11 (i.e., the beta subclass of the Proteobacteria). The taxonomic relationships of both of these species, two groups of clinical isolates (E. Falsen [EF] group 13 and EF group 16), and several unidentified or presently misnamed strains were examined by using DNA:rRNA hybridization, numerical analyses of biochemical and auxanographic features and of fatty acid patterns, polyacrylamide gel electrophoresis of cellular proteins, and DNA:DNA hybridization. These organisms form a separate group within the acidovorans rRNA complex, and we propose to transfer them to a new genus, Acidovorax. We describe the following three species in this genus: the type species, Acidovorax facilis (formerly Pseudomonas facilis), with type strain LMG 2193 (= CCUG 2113 = ATCC 11228); Acidovorax delafeldii (for the former Pseudomonas delufeldii and most of the EF group 13 strains), with type strain LMG 5943 (= CCUG 1779 = ATCC 17505); and Acidovorax temperans (for several former Pseudomonas and Alcaligenes strains and most of the EF group 16 strains), with type strain CCUG 11779 (= LMG 7169). It is generally accepted today that the genus Pseudomo- [Pseudomonas]facilis and [Pseudomonas]delajieldii be- nas, as described in Bergey's Manual of Systematic Bacte- long to the acidovorans rRNA complex (rRNA homology riology (36), is multigeneric and cannot be maintained as a group I11 sensu Palleroni [36]) in rRNA superfamily I11 sensu single genus (3, 12, 50, 53, 56). Using a limited number of De Ley (8), which corresponds to the beta subclass of the strains, Palleroni et al. delineated five Pseudomonas rRNA Proteobacteria (48). As explained previously (53), the aci- homology groups on the basis of DNA:rRNA hybridization dovorans rRNA complex is a heterogeneous group of organ- data (37). These groups were later considerably extended isms, many of which should be generically renamed. Our and were shown to be only very remotely related to each main tool to reveal the basic taxonomic structure of this other (12, IS). Therefore, the genus Pseudomonas sensu group at the generic and suprageneric levels is DNA:rRNA strict0 should be restricted to the Pseudomonas JEclorescens hybridization. The finer taxonomic relationships within the rRNA group, which contains the type species, Pseudomonas subgroups revealed by DNA:rRNA hybridization are then aeruginosa (12). All other Pseudomonas species should be studied by using appropriate techniques, such as phenotypic generically renamed (indicated below by brackets). analysis, protein gel electrophoresis, DNA:DNA hybridiza- [Pseudomonas]facilis was originally described as Hydro- tion, etc. Up to now this polyphasic approach has led to the genomonas facilis, a hydrogen-oxidizing isolate from lawn revival of the genus Comamonas (14) and the creation of two soil (44). At that time all gram-negative hydrogen-oxidizing new genera, Xylophilus (54) and Hydrogenophaga (53), bacteria were grouped in a single genus, Hydrogenomonas. which accommodate several generically misnamed species In a study of the poly-P-hydroxybutyrate (PHB) metabolism from the acidovorans rRNA complex. of pseudomonads, Delafield et al. (6) compared morpholog- As reported previously (14, 53, 54), labeled rRNAs have ical and physiological properties of numerous PHB-using been prepared from the type strains of six species. By Pseudomonas and Hydrogenomonas strains. Hydrogenomo- hybridizing these rRNAs with DNAs from representative nas facilis was placed in their group I, together with five unidentified isolates. The genus Hydrogenomonas was later strains of all of the taxa belonging to the acidovorans rRNA rejected (4), Hydrogenomonas facilis was transferred to the complex, we delineated the following five rRNA sub- genus Pseudomonas as Pseudomonas facilis, and a new branches, which were linked at a Tm(e)level [Tm(e)is the species, Pseudomonas delajieldii, was created for the five temperature, in degrees Celsius, at which one-half of a unnamed strains belonging to group I of Delafield et al. DNA:rRNA hybrid is denatured] of 76.0 -+ 1.1"C: the Pseudomonas facilis and Pseudomonas delajieldii were de- Comamonas acidovorans rRNA subbranch, the Comamo- scribed as phenotypically similar; an important difference nas terrigena rRNA subbranch, the [Alcaligenes]paradoxus was the inability of Pseudomonas delafieldii to oxidize rRNA subbranch, the Xylophilus ampelinus rRNA sub- hydrogen (5). branch, and the Hydrogenophaga rRNA subbranch (53). Most other species of the acidovorans rRNA complex (e.g., [Pseudomonas]facilis, [Pseudomonas]delafieldii, [Pseudo- * Corresponding author monas] avenue, and Comamonas testosteroni) are located at 384 VOL. 40, 1990 ACZDOVORAX GEN. NOV. 385 the branching level of these five rRNA subbranches (53). its T,n(elvalue and by the percentage of rRNA binding (the Several species (e.g., [Pseudomonas] saccharophila, [Al- amount of rRNA [in micrograms] bound to 100 pg of caligenes] latus, and [Rhodocyclus]gelatinosus) are located filter-fixed DNA after RNase treatment). somewhat lower, at a T,,,(,, level of 73.1 5 1.4"C (53). DNA:DNA hybridization. The degree of binding, ex- A number of clinical isolates that were received for pressed as a percentage was determined spectrophotometri- identification at the Culture Collection of the University of cally by using the initial renaturation rate method (9), as Goteborg, Goteborg, Sweden, were examined by using described previously (53). Renaturations were performed in immunological methods (16) and were provisionally sorted 2x SSC (IxSSC is 0.15 M NaCl plus 0.015 M sodium into two unnamed groups, E. Falsen (EF) group 13 and EF citrate, pH 7.0) at an optimal renaturation temperature of group 16, which were found to be related to [Pseudomonas] 80.3"C and with a total DNA concentration of 0.102 mM base delajieldii (17). A routine numerical analysis of auxano- pairs. Degrees of binding of 25% and less do not represent graphic test results for a number of strains with mistaken any significant DNA binding. genus assignments showed that the following strains are also Morphological and biochemical features. We used the related to [Pseudomonas] delajieldii: (i) [Pseudomonas methods described by De Vos et al. (14). Nitrite reduction pseudoalcaligenes] strains CUETM 85-21, CUETM 85-23, was tested as described by Rossau et al. (43). Autotrophic and CUETM 85-25, which Gavini et al. (19) detected as a growth with hydrogen was tested on the basal medium separate cluster (cluster A2) in their phenotypic analysis of described by Meyer and Schlegel (34) to which 0.01% several Pseudomonas species; (ii) [Alcaligenesdenitrijicans] (wtlvol) yeast extract was added. For heterotrophic growth, strains CIP 239.74 and CIP 471.74, which clustered together 0.2% (wt/vol) succinic acid was added as a carbon source to with [Alcaligenes]paradoxus in the phenotypic study of the the same basal medium. To obtain a suitable atmosphere, we genus Alcaligenes performed by Kiredjian et al. (28); and (iii) modified the procedure of Sly (46) as described below. six unnamed clinical isolates which were received at the Anaerobic jars (type HP11; Oxoid) and gas-generating kits Culture Collection of the University of Goteborg for identi- (type BR38; Oxoid) were used without a catalyst; 4 h after fication. We studied the relationships of all of these strains, the gas-generating process was started, the pressure, which [Pseudomonas]facilis, [Pseudomonas]delajieldii, and sev- had then stabilized at about 0.6 bar was decreased to 0.05 eral unidentified or misidentified strains, mostly of clinical bar. Gas chromatographic analyses of the atmosphere in the origin, by using genotypic, chemotaxonomic and phenotypic jar gave the following mean composition: 47.0% N,, 13.0% techniques. We propose a new genus, Acidovorax, for these O,, 5.0% CO,, and 35.0% H,. In each jar four or five strains, strains, with three species, Acidovorax facilis, Acidovorax including one well-known hydrogen-oxidizing reference delajieldii, and Acidovorax temperans. strain, were tested on one petri dish each. The jars were incubated at 28°C for at least 3 weeks. Controls for each MATERIALS AND METHODS strain on autotrophic and heterotrophic medium were incu- bated in air. Autotrophic growth was regarded as positive if Bacterial strains. The strains which we used are listed in growth on the autotrophic medium in the jar was clearly Table 1. Most of these organisms were grown on nutrient visible and more abundant than growth on the same medium agar (0.1% [wt/vol] beef extract, 0.2% [wt/vol] yeast extract, incubated in air. All strains were tested at least twice. 0.5% [wt/vol] NaC1, 0.5% [wt/vol] peptone, 2% [wt/vol] Carbon substrate assimilation tests. API galleries (types agar; pH 7.4); exceptions were [Rhodocyclus] gelatinosus API 50CH, API SOAO, and API 50AA; API System S.A., and Xyfophilus ampelinus, which were grown on the media Montalieu-Vercieu, France) were used to test the assimila- described previously (54). For fatty acid analysis, cells were tion of 147 organic compounds as sole carbon sources. The grown for 40 h on Columbia agar (Oxoid Ltd., Basingstoke, experimental procedure which we used has been described England) containing 5% [vol/vol] defibrinated horse blood.
Load more

Recommended publications
  • Characterization of Endophytic Bacterial Strains Isolated from Rice Grain Discoloration
    Characterization of Endophytic Bacterial Strains Isolated from Rice Grain Discoloration Muhammad Ashfaq*, Muhammad Saleem Haider, Amna Ali, Sehrish Mushtaq, Muhammad Ali and Urooj Mubashar Institute of Agricultural Sciences. University of the Punjab, Quaid-E-Azam campus, Lahore 54590 Pakistan. Government Elementary Teachers Education College,Ghakkhar Mandi, Gujranwala, Pakistan Corresponding author email: [email protected] ABSTRACT The present study was conducted to isolate bacterial species obtained from different rice varieties: Kainat, Basmati-385, Super basmati, Basmati 86, KSK-133, Basmati-198, Basmati- 2000x1053-2-2, Kasur, Stg 567989 and Basmati-2000x33797-1 collected from all agro ecological zones of Pakistan. When plated infected grain samples gave various bacterial colonies on Luria Bertani (L.B) agar medium. The isolates were identified on the basis of various morphological and biochemical features. Out of 22 isolates, five showed rod cell shape in microscope. Sixteen biochemical tests were conducted to characterize 22 isolates of bacteria. Gram stain demonstrated that three isolates were gram positive and rod shaped. All other isolates were gram negative. The presence of bacteria was also estimated in ten different varieties of rice. The highest presence of bacteria was observed in KSK-133, Kainat and Stg 567989. Burkholderia species and Enterobacter species have high frequency almost in all tested rice varieties. The overall objective of this study was to screen, classify and associate the bacterial species present on the basis of various morphological characteristics isolated from diverse rice [SYLWAN., 158(8)]. ISI Indexed 165 genotype. The results demonstrated that collected and investigated rice varieties have a diverse range of bacterial species, some of which are considered as severe pathogens for plants.
    [Show full text]
  • Which Organisms Are Used for Anti-Biofouling Studies
    Table S1. Semi-systematic review raw data answering: Which organisms are used for anti-biofouling studies? Antifoulant Method Organism(s) Model Bacteria Type of Biofilm Source (Y if mentioned) Detection Method composite membranes E. coli ATCC25922 Y LIVE/DEAD baclight [1] stain S. aureus ATCC255923 composite membranes E. coli ATCC25922 Y colony counting [2] S. aureus RSKK 1009 graphene oxide Saccharomycetes colony counting [3] methyl p-hydroxybenzoate L. monocytogenes [4] potassium sorbate P. putida Y. enterocolitica A. hydrophila composite membranes E. coli Y FESEM [5] (unspecified/unique sample type) S. aureus (unspecified/unique sample type) K. pneumonia ATCC13883 P. aeruginosa BAA-1744 composite membranes E. coli Y SEM [6] (unspecified/unique sample type) S. aureus (unspecified/unique sample type) graphene oxide E. coli ATCC25922 Y colony counting [7] S. aureus ATCC9144 P. aeruginosa ATCCPAO1 composite membranes E. coli Y measuring flux [8] (unspecified/unique sample type) graphene oxide E. coli Y colony counting [9] (unspecified/unique SEM sample type) LIVE/DEAD baclight S. aureus stain (unspecified/unique sample type) modified membrane P. aeruginosa P60 Y DAPI [10] Bacillus sp. G-84 LIVE/DEAD baclight stain bacteriophages E. coli (K12) Y measuring flux [11] ATCC11303-B4 quorum quenching P. aeruginosa KCTC LIVE/DEAD baclight [12] 2513 stain modified membrane E. coli colony counting [13] (unspecified/unique colony counting sample type) measuring flux S. aureus (unspecified/unique sample type) modified membrane E. coli BW26437 Y measuring flux [14] graphene oxide Klebsiella colony counting [15] (unspecified/unique sample type) P. aeruginosa (unspecified/unique sample type) graphene oxide P. aeruginosa measuring flux [16] (unspecified/unique sample type) composite membranes E.
    [Show full text]
  • Short Communication Biofilm Formation and Degradation of Commercially Available Biodegradable Plastic Films by Bacterial Consortiums in Freshwater Environments
    Microbes Environ. Vol. 33, No. 3, 332-335, 2018 https://www.jstage.jst.go.jp/browse/jsme2 doi:10.1264/jsme2.ME18033 Short Communication Biofilm Formation and Degradation of Commercially Available Biodegradable Plastic Films by Bacterial Consortiums in Freshwater Environments TOMOHIRO MOROHOSHI1*, TAISHIRO OI1, HARUNA AISO2, TOMOHIRO SUZUKI2, TETSUO OKURA3, and SHUNSUKE SATO4 1Department of Material and Environmental Chemistry, Graduate School of Engineering, Utsunomiya University, 7–1–2 Yoto, Utsunomiya, Tochigi 321–8585, Japan; 2Center for Bioscience Research and Education, Utsunomiya University, 350 Mine-machi, Utsunomiya, Tochigi 321–8505, Japan; 3Process Development Research Laboratories, Plastics Molding and Processing Technology Development Group, Kaneka Corporation, 5–1–1, Torikai-Nishi, Settsu, Osaka 556–0072, Japan; and 4Health Care Solutions Research Institute Biotechnology Development Laboratories, Kaneka Corporation, 1–8 Miyamae-cho, Takasago-cho, Takasago, Hyogo 676–8688, Japan (Received March 5, 2018—Accepted May 28, 2018—Published online August 28, 2018) We investigated biofilm formation on biodegradable plastics in freshwater samples. Poly(3-hydroxybutyrate-co-3- hydroxyhexanoate) (PHBH) was covered by a biofilm after an incubation in freshwater samples. A next generation sequencing analysis of the bacterial communities of biofilms that formed on PHBH films revealed the dominance of the order Burkholderiales. Furthermore, Acidovorax and Undibacterium were the predominant genera in most biofilms. Twenty-five out of 28 PHBH-degrading
    [Show full text]
  • Phage-Induced Lysis Enhances Biofilm Formation in Shewanella Oneidensis MR-1
    The ISME Journal (2011) 5, 613–626 & 2011 International Society for Microbial Ecology All rights reserved 1751-7362/11 www.nature.com/ismej ORIGINAL ARTICLE Phage-induced lysis enhances biofilm formation in Shewanella oneidensis MR-1 Julia Go¨deke, Kristina Paul, Ju¨ rgen Lassak and Kai M Thormann Department of Ecophysiology, Max-Planck-Institut fu¨r Terrestrische Mikrobiologie, Marburg, Germany Shewanella oneidensis MR-1 is capable of forming highly structured surface-attached communities. By DNase I treatment, we demonstrated that extracellular DNA (eDNA) serves as a structural component in all stages of biofilm formation under static and hydrodynamic conditions. We determined whether eDNA is released through cell lysis mediated by the three prophages LambdaSo, MuSo1 and MuSo2 that are harbored in the genome of S. oneidensis MR-1. Mutant analyses and infection studies revealed that all three prophages may individually lead to cell lysis. However, only LambdaSo and MuSo2 form infectious phage particles. Phage release and cell lysis already occur during early stages of static incubation. A mutant devoid of the prophages was significantly less prone to lysis in pure culture. In addition, the phage-less mutant was severely impaired in biofilm formation through all stages of development, and three-dimensional growth occurred independently of eDNA as a structural component. Thus, we suggest that in S. oneidensis MR-1 prophage-mediated lysis results in the release of crucial biofilm-promoting factors, in particular eDNA. The ISME Journal (2011) 5, 613–626; doi:10.1038/ismej.2010.153; published online 21 October 2010 Subject Category: microbe–microbe and microbe–host interactions Keywords: Shewanella; biofilm; eDNA; lysis; phage Introduction been demonstrated to adhere to various surfaces and form biofilms (Bagge et al., 2001; Thormann et al., Shewanella oneidensis MR-1 belongs to the Gram- 2004, 2005, 2006; Teal et al., 2006; McLean et al., negative g-proteobacteria and is characterized by an 2008a; Zhang et al., 2010).
    [Show full text]
  • Fish Bacterial Flora Identification Via Rapid Cellular Fatty Acid Analysis
    Fish bacterial flora identification via rapid cellular fatty acid analysis Item Type Thesis Authors Morey, Amit Download date 09/10/2021 08:41:29 Link to Item http://hdl.handle.net/11122/4939 FISH BACTERIAL FLORA IDENTIFICATION VIA RAPID CELLULAR FATTY ACID ANALYSIS By Amit Morey /V RECOMMENDED: $ Advisory Committe/ Chair < r Head, Interdisciplinary iProgram in Seafood Science and Nutrition /-■ x ? APPROVED: Dean, SchooLof Fisheries and Ocfcan Sciences de3n of the Graduate School Date FISH BACTERIAL FLORA IDENTIFICATION VIA RAPID CELLULAR FATTY ACID ANALYSIS A THESIS Presented to the Faculty of the University of Alaska Fairbanks in Partial Fulfillment of the Requirements for the Degree of MASTER OF SCIENCE By Amit Morey, M.F.Sc. Fairbanks, Alaska h r A Q t ■ ^% 0 /v AlA s ((0 August 2007 ^>c0^b Abstract Seafood quality can be assessed by determining the bacterial load and flora composition, although classical taxonomic methods are time-consuming and subjective to interpretation bias. A two-prong approach was used to assess a commercially available microbial identification system: confirmation of known cultures and fish spoilage experiments to isolate unknowns for identification. Bacterial isolates from the Fishery Industrial Technology Center Culture Collection (FITCCC) and the American Type Culture Collection (ATCC) were used to test the identification ability of the Sherlock Microbial Identification System (MIS). Twelve ATCC and 21 FITCCC strains were identified to species with the exception of Pseudomonas fluorescens and P. putida which could not be distinguished by cellular fatty acid analysis. The bacterial flora changes that occurred in iced Alaska pink salmon ( Oncorhynchus gorbuscha) were determined by the rapid method.
    [Show full text]
  • Acidovorax Citrulli
    Bulletin OEPP/EPPO Bulletin (2016) 46 (3), 444–462 ISSN 0250-8052. DOI: 10.1111/epp.12330 European and Mediterranean Plant Protection Organization Organisation Europe´enne et Me´diterrane´enne pour la Protection des Plantes PM 7/127 (1) Diagnostics Diagnostic PM 7/127 (1) Acidovorax citrulli Specific scope Specific approval and amendment This Standard describes a diagnostic protocol for Approved in 2016-09. Acidovorax citrulli.1 This Standard should be used in conjunction with PM 7/76 Use of EPPO diagnostic protocols. strain, were mainly isolated from non-watermelon, cucurbit 1. Introduction hosts such as cantaloupe melon (Cucumis melo var. Acidovorax citrulli is the causal agent of bacterial fruit cantalupensis), cucumber (Cucumis sativus), honeydew blotch and seedling blight of cucurbits (Webb & Goth, melon (Cucumis melo var. indorus), squash and pumpkin 1965; Schaad et al., 1978). This disease was sporadic until (Cucurbita pepo, Cucurbita maxima and Cucurbita the late 1980s (Wall & Santos, 1988), but recurrent epi- moschata) whereas Group II isolates were mainly recovered demics have been reported in the last 20 years (Zhang & from watermelon (Walcott et al., 2000, 2004; Burdman Rhodes, 1990; Somodi et al., 1991; Latin & Hopkins, et al., 2005). While Group I isolates were moderately 1995; Demir, 1996; Assis et al., 1999; Langston et al., aggressive on a range of cucurbit hosts, Group II isolates 1999; O’Brien & Martin, 1999; Burdman et al., 2005; Har- were highly aggressive on watermelon but moderately ighi, 2007; Holeva et al., 2010; Popovic & Ivanovic, 2015). aggressive on non-watermelon hosts (Walcott et al., 2000, The disease is particularly severe on watermelon (Citrullus 2004).
    [Show full text]
  • Plant-Derived Benzoxazinoids Act As Antibiotics and Shape Bacterial Communities
    Supplemental Material for: Plant-derived benzoxazinoids act as antibiotics and shape bacterial communities Niklas Schandry, Katharina Jandrasits, Ruben Garrido-Oter, Claude Becker Contents Supplemental Tables 2 Supplemental Table 1. Phylogenetic signal lambda . .2 Supplemental Table 2. Syncom strains . .3 Supplemental Table 3. PERMANOVA . .6 Supplemental Table 4. PERMANOVA comparing only two treatments . .7 Supplemental Table 5. ANOVA: Observed taxa . .8 Supplemental Table 6. Observed diversity means and pairwise comparisons . .9 Supplemental Table 7. ANOVA: Shannon Diversity . 11 Supplemental Table 8. Shannon diversity means and pairwise comparisons . 12 Supplemental Table 9. Correlation between change in relative abundance and change in growth . 14 Figures 15 Supplemental Figure 1 . 15 Supplemental Figure 2 . 16 Supplemental Figure 3 . 17 Supplemental Figure 4 . 18 1 Supplemental Tables Supplemental Table 1. Phylogenetic signal lambda Class Order Family lambda p.value All - All All All All 0.763 0.0004 * * Gram Negative - Proteobacteria All All All 0.817 0.0017 * * Alpha All All 0 0.9998 Alpha Rhizobiales All 0 1.0000 Alpha Rhizobiales Phyllobacteriacae 0 1.0000 Alpha Rhizobiales Rhizobiacaea 0.275 0.8837 Beta All All 1.034 0.0036 * * Beta Burkholderiales All 0.147 0.6171 Beta Burkholderiales Comamonadaceae 0 1.0000 Gamma All All 1 0.0000 * * Gamma Xanthomonadales All 1 0.0001 * * Gram Positive - Actinobacteria Actinomycetia Actinomycetales All 0 1.0000 Actinomycetia Actinomycetales Intrasporangiaceae 0.98 0.2730 Actinomycetia Actinomycetales Microbacteriaceae 1.054 0.3751 Actinomycetia Actinomycetales Nocardioidaceae 0 1.0000 Actinomycetia All All 0 1.0000 Gram Positive - All All All All 0.421 0.0325 * Gram Positive - Firmicutes Bacilli All All 0 1.0000 2 Supplemental Table 2.
    [Show full text]
  • Genomic Features of Bacterial Adaptation to Plants
    ARTICLES https://doi.org/10.1038/s41588-017-0012-9 Genomic features of bacterial adaptation to plants Asaf Levy 1, Isai Salas Gonzalez2,3, Maximilian Mittelviefhaus4, Scott Clingenpeel 1, Sur Herrera Paredes 2,3,15, Jiamin Miao5,16, Kunru Wang5, Giulia Devescovi6, Kyra Stillman1, Freddy Monteiro2,3, Bryan Rangel Alvarez1, Derek S. Lundberg2,3, Tse-Yuan Lu7, Sarah Lebeis8, Zhao Jin9, Meredith McDonald2,3, Andrew P. Klein2,3, Meghan E. Feltcher2,3,17, Tijana Glavina Rio1, Sarah R. Grant 2, Sharon L. Doty 10, Ruth E. Ley 11, Bingyu Zhao5, Vittorio Venturi6, Dale A. Pelletier7, Julia A. Vorholt4, Susannah G. Tringe 1,12*, Tanja Woyke 1,12* and Jeffery L. Dangl 2,3,13,14* Plants intimately associate with diverse bacteria. Plant-associated bacteria have ostensibly evolved genes that enable them to adapt to plant environments. However, the identities of such genes are mostly unknown, and their functions are poorly characterized. We sequenced 484 genomes of bacterial isolates from roots of Brassicaceae, poplar, and maize. We then com- pared 3,837 bacterial genomes to identify thousands of plant-associated gene clusters. Genomes of plant-associated bacteria encode more carbohydrate metabolism functions and fewer mobile elements than related non-plant-associated genomes do. We experimentally validated candidates from two sets of plant-associated genes: one involved in plant colonization, and the other serving in microbe–microbe competition between plant-associated bacteria. We also identified 64 plant-associated pro- tein domains that potentially mimic plant domains; some are shared with plant-associated fungi and oomycetes. This work expands the genome-based understanding of plant–microbe interactions and provides potential leads for efficient and sustain- able agriculture through microbiome engineering.
    [Show full text]
  • Diaphorobacter Nitroreducens Gen. Nov., Sp. Nov., a Poly (3
    J. Gen. Appl. Microbiol., 48, 299–308 (2002) Full Paper Diaphorobacter nitroreducens gen. nov., sp. nov., a poly(3-hydroxybutyrate)-degrading denitrifying bacterium isolated from activated sludge Shams Tabrez Khan and Akira Hiraishi* Department of Ecological Engineering, Toyohashi University of Technology, Toyohashi 441–8580, Japan (Received August 12, 2002; Accepted October 23, 2002) Three denitrifying strains of bacteria capable of degrading poly(3-hydroxybutyrate) (PHB) and poly(3-hydroxybutyrate-co-3-hydroxyvalerate) (PHBV) were isolated from activated sludge and characterized. All of the isolates had almost identical phenotypic characteristics. They were motile gram-negative rods with single polar flagella and grew well with simple organic com- pounds, as well as with PHB and PHBV, as carbon and energy sources under both aerobic and anaerobic denitrifying conditions. However, none of the sugars tested supported their growth. The cellular fatty acid profiles showed the presence of C16:1w7cis and C16:0 as the major com- ponents and of 3-OH-C10:0 as the sole component of hydroxy fatty acids. Ubiquinone-8 was de- tected as the major respiratory quinone. A 16S rDNA sequence-based phylogenetic analysis showed that all the isolates belonged to the family Comamonadaceae, a major group of b-Pro- teobacteria, but formed no monophyletic cluster with any previously known species of this fam- (DSM 13225؍) ily. The closest relative to our strains was an unidentified bacterium strain LW1 (99.9% similarity), reported previously as a 1-chloro-4-nitrobenzene degrading bacterium. DNA- DNA hybridization levels among the new isolates were more than 60%, whereas those between our isolates and strain DSM 13225 were less than 50%.
    [Show full text]
  • Transfer of Several Phytopathogenic Pseudomonas Species to Acidovorax As Acidovorax Avenae Subsp
    INTERNATIONALJOURNAL OF SYSTEMATICBACTERIOLOGY, Jan. 1992, p. 107-119 Vol. 42, No. 1 0020-7713/92/010107-13$02 .OO/O Copyright 0 1992, International Union of Microbiological Societies Transfer of Several Phytopathogenic Pseudomonas Species to Acidovorax as Acidovorax avenae subsp. avenae subsp. nov., comb. nov. , Acidovorax avenae subsp. citrulli, Acidovorax avenae subsp. cattleyae, and Acidovorax konjaci A. WILLEMS,? M. GOOR, S. THIELEMANS, M. GILLIS,” K. KERSTERS, AND J. DE LEY Laboratorium voor Microbiologie en microbiele Genetica, Rijksuniversiteit Gent, K.L. Ledeganckstraat 35, B-9000 Ghent, Belgium DNA-rRNA hybridizations, DNA-DNA hybridizations, polyacrylamide gel electrophoresis of whole-cell proteins, and a numerical analysis of carbon assimilation tests were carried out to determine the relationships among the phylogenetically misnamed phytopathogenic taxa Pseudomonas avenue, Pseudomonas rubrilineans, “Pseudomonas setariae, ” Pseudomonas cattleyae, Pseudomonas pseudoalcaligenes subsp. citrulli, and Pseudo- monas pseudoalcaligenes subsp. konjaci. These organisms are all members of the family Comamonadaceae, within which they constitute a separate rRNA branch. Only P. pseudoalcaligenes subsp. konjaci is situated on the lower part of this rRNA branch; all of the other taxa cluster very closely around the type strain of P. avenue. When they are compared phenotypically, all of the members of this rRNA branch can be differentiated from each other, and they are, as a group, most closely related to the genus Acidovorax. DNA-DNA hybridization experiments showed that these organisms constitute two genotypic groups. We propose that the generically misnamed phytopathogenic Pseudomonas species should be transferred to the genus Acidovorax as Acidovorax avenue and Acidovorax konjaci. Within Acidovorax avenue we distinguished the following three subspecies: Acidovorax avenue subsp.
    [Show full text]
  • Physiological and Genomic Features of Highly Alkaliphilic Hydrogen-Utilizing Betaproteobacteria from a Continental Serpentinizing Site
    ARTICLE Received 17 Dec 2013 | Accepted 16 Apr 2014 | Published 21 May 2014 DOI: 10.1038/ncomms4900 OPEN Physiological and genomic features of highly alkaliphilic hydrogen-utilizing Betaproteobacteria from a continental serpentinizing site Shino Suzuki1, J. Gijs Kuenen2,3, Kira Schipper1,3, Suzanne van der Velde2,3, Shun’ichi Ishii1, Angela Wu1, Dimitry Y. Sorokin3,4, Aaron Tenney1, XianYing Meng5, Penny L. Morrill6, Yoichi Kamagata5, Gerard Muyzer3,7 & Kenneth H. Nealson1,2 Serpentinization, or the aqueous alteration of ultramafic rocks, results in challenging environments for life in continental sites due to the combination of extremely high pH, low salinity and lack of obvious electron acceptors and carbon sources. Nevertheless, certain Betaproteobacteria have been frequently observed in such environments. Here we describe physiological and genomic features of three related Betaproteobacterial strains isolated from highly alkaline (pH 11.6) serpentinizing springs at The Cedars, California. All three strains are obligate alkaliphiles with an optimum for growth at pH 11 and are capable of autotrophic growth with hydrogen, calcium carbonate and oxygen. The three strains exhibit differences, however, regarding the utilization of organic carbon and electron acceptors. Their global distribution and physiological, genomic and transcriptomic characteristics indicate that the strains are adapted to the alkaline and calcium-rich environments represented by the terrestrial serpentinizing ecosystems. We propose placing these strains in a new genus ‘Serpentinomonas’. 1 J. Craig Venter Institute, 4120 Torrey Pines Road, La Jolla, California 92037, USA. 2 University of Southern California, 835 W. 37th St. SHS 560, Los Angeles, California 90089, USA. 3 Delft University of Technology, Julianalaan 67, Delft, 2628BC, The Netherlands.
    [Show full text]
  • Table S1 List of the Group Specific Probes
    Table S1 List of the group specific probes. Probe Sequence (5’ – 3’) Target References EUB338 GCTGCCTCCCGTAGGAGT EUB338 II GCAGCCACCCGTAGGTGT Bacteria [1][2] EUB338 III GCTGCCACCCGTAGGTGT Delta495a AGTTAGCCGGTGCTTCTT Delta495b AGTTAGCCGGCGCTTCCT Deltaproteobacteria [3,4] Delta495c AATTAGCCGGTGCTTCCT Lgc354a TGGAAGATTCCCTACTGC Firmicutes (Gram+ Lgc354b CGGAAGATTCCCTACTGC bacteria with low GC [5] Lgc354c CCGAAGATTCCCTACTGC content) Chloroflexi (green Gnsb941 AAACCACACGCTCCGCT [6] nonsulfur bacteria) Alphaproteobacteria Alf968 GGTAAGGTTCTGCGCGTT [7] (except Rickettsiales) Bet42a GCCTTCCCACTTCGTTT Betaproteobacteria [8] Gam2a GCCTTCCCACATCGTTT Gammaproteobacteria [8] Actinobacteria (high GC Hgc69a TATAGTTACCACCGCCGT [9] Gram+ bacteria) Pla46 GACTTGCATGCCTAATCC Planctomycetales [10] Flavobacteria, Cf319a TGGTCCGTGTCTCAGTAC Bacteroidetes, [11] Sphingobacteria Arc915 GTGCTCCCCCGCCAATTCCT Archaea [12] TM7905 CCGTCAATTCCTTTATGTTTTA Candidate division TM7 [13] DF988* GATACGACGCCCATGTCAAGGG Defluvicoccus [14] DF1020* CCGGCCGAACCGACTCCC TFO-DF218 GAAGCCTTTGCCCCTCAG Defluvicoccus related [15] TFO-DF618 GCCTCACTTGTCTAACCG TFO SBR9-1a AAGCGCAAGTTCCCAGGTTG Sphingomonas [16] THAU646 TCTGCCGTACTCTAGCCTT Thauera sp. [17] AZO644 GCCGTACTCTAGCCGTGC Azoarcus sp. [18] PAR651 ACCTCTCTCGAACTCCAG Paracoccus [19] AMAR839 CCGAACGGCAAGCCACAGCGTC Amaricoccus sp. [20] ACI145 TTTCGCTTCGTTATCCCC Acidovorax spp. [21] Table S2 Primers used in PCR and Sequencing. Primers Sequence (5’ – 3’) PCR 27f AGAGTTTGATCMTGGCTCAG 1492r TACGGYTACCTTGTTACGACTT T7f TAATACGACTCACTATAGGG
    [Show full text]