DOCSLIB.ORG

The Small Ribosomal Subunit RNA Isoforms in Plasmodium Cynomolgi

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Small Ribosomal Subunit RNA Isoforms in Plasmodium Cynomolgi Copyright 0 1994 by the Genetics Society of America The Small Ribosomal Subunit RNA Isoforms in Plasmodium cynomolgi Vladimir Corredor' and Vincenzo Enea Department of Medical and Molecular Parasitology, New York University Medical Center, New York, New York 1001 0 Manuscript received May 8, 1993 Accepted for publication November 3, 1993 ABSTRACT We report the isolation, characterization and analysis of the small subunit rRNA genes in PZasmodium cynomolgi (Ceylon). As in other Plasmodium species, these genes are present in low copy number, are unlinked and form two types that are distinct in sequence and are expressed stage specifically. The asexually expressed(type A) genes are present in four copies inthe Ceylon- and in five copies inthe Berok' strain. Surprisingly, the sexually expressed (typeB) gene is present in a single copy. The vast majority of the differences between gene types is confined to the variable regions. The pattern of divergence is different from that observed in Plasmodium berghei or in Plasmodium falciparum.Analysis of the small subunit rRNA sequences of P. cynomolgi, P. berghei and P. falciparum,indicates that the two gene types do not evolve independently but rather interact (through gene conversion or some form of recombi- nation) to such an extent as to erase whatever stage-specific sequence signatures they may have had in the last common ancestor. HE organization of the ribosomal RNA genes in Here we report the isolation, characterization and T Plasmodium (the etiological agent of malaria) is analysis ofthe SSU rRNA isoforms in P. cynomolga (Cey- unusual on several counts: the genes arefew in number lon) and theresults of some comparative work on other (4-8 copies per haploid genome), scattered on differ- strains and on other species. ent chromosomes, and, most notably, are organized in two distinct subgroups whose expression is developmen- MATERIALSAND METHODS tally regulated (DAMEand MCCUTCHAN1983; LANGSLEY Parasites: P. cynomolgi parasites werepropagated in rhesus et al. 1983; VANDER PLOEGet al. 1985; GUNDERSONet al. monkeys (Macaca mulatta).Infected red blood cells (IRBC) 1987; WATERSet al. 1989). Type A genes are expressed containing parasites of the Berok and Ceylon strains of P. cy- in the asexual stages (which take place in the vertebrate nomolgi used for pulse field gel (PFG) analysis were kindly host), and type B genes are expressed in the sexual provided by Dr. J. W. Barnwell. stages (which initiate in the vertebrate host and con- Nucleic acids and restriction enzyme digestion analysis: DNA preparations from plasmid, phage and parasites as well tinue in the insect vector) (GUNDERSONet al. 1987; as restriction enzyme digestions, agarose gel fractionation, WATERSet al. 1989). The origin and significance of blotting and hybridizations wereperformed as previously de- this condition is not understood. The small subunit scribed (ENFAet al. 1984; SAMBROOKet al. 1989). Following ribosomal RNA (SSU rRNA) sequence of both gene hybridization with oligonucleotides, filters were washed se- types has been determined only in Plasmodium berghei quentially in 2 X SSC/O.2% SDS for 30 min, 1 X SSC/O.2% SDS for 30 min and in 0.2 X SSC/O.2% SDS for 5 min at room and Plasmodium falciparum (GUNDERSONet al. 1987; temperature. Total RNA was extracted as previously described MCCUTCHANet al. 1988). Analysis of these sequences (ENFA et al. 1984) and electrophoresed on agarose/ showed that: (1)the isoforms of a given species are more formaldehyde gels (SAMBROOKet al. 1989). similar to one another thanto the corresponding genes A P. cynomolgi (Ceylon strain) EcoRI genomic library was in the otherspecies and (2) the pattern of conservation constructed by standard methods in lambda EMBL4 (SA" BROOK et al. 1989) and screened with oligonucleotides span- and divergence between isoforms is quite different in ning various conservedor semiconserved regions of the SSU the two species (ENEAand CORREDOR1991). To extend rRNA segment. the database we chose to analyze a lineage, Plasmodium Oligonucleotides: Oligonucleotides weresynthesized by cynomolgi, which being relatively distantly related to standard phosphoramidite chemistry in an Applied Biosystems P. berghei and to P. falciparum (DIGIOVANNI et al. 1990), 381A DNAsynthesizer according to the manufacturers instruc- tions and purified on acrylamide gels. Oligonucleotides were and being composed of a numberof closelyrelated but 5' end labeled with [y3*P]ATP(5000 Ci/mmol) (Amersham) distinct strains (COATNEYet al. 1971; GALINSKIet al. and polynucleotide kinase (SAMBROOKet aL 1989). Oligonuclee 1987),would allow for analyses involvinglarge phyletic tides representing sequenceswith different degreeof consem- distances as well as short ones. tion were used for screening genomic libraries, clone character- ization and sequencing in both orientations (Table 1). 'Present address: Department of Cell Biology and Anatomy, Box 1007, PCR amplification and cloning: The SSU rDNA comple- Mount Sinai Medical Center, OneGustave L. Levy Place, New York, NY 10029- ment was amplified using 1-2 ng of total parasite genomic 6574. DNA and oligonucleotides 0009 and 2134.1. Polymerasechain Genetics 136: 857-865 (March, 1994) 858 V. Corredor and V. Enea TABLE 1 Southern transfer was performed by standard methods ex- cept that the gel was soaked in 0.15 N HCl for 15 min before Catalog of oligonucleotides used in this study denaturation and neutralization. ~~ ~~~~ Primer Sequence" Primer Polarity Position Sequence determination and analysis: he sequence of the V7 variable region (NEEFSet al. 1990) of Berok and Ceylon 0001 actggcaagatcaaccaggtt 1-21 blood stage SSU rRNA was determined by primer extension of 0009 tgatcttgccagtagtcatat 9 -29 the RNA (GHOSH1980), using a 5' end-labeled oligonucleotide 0096 tataactgttttaatgagccg 97-1 17 (1880) and M-MLV reverse transcriptase. (BRL)and the product 0382 caggctccctctccggaatcg 389-409 sequenced by the "GILBERT (1980) method as described. 0401 atgacgggtaacggggaatta 363-383 0416 ctgctgccttccttagatgt 423-443 Sequence of genomic clones, pUC subclones and cloned 0508 gagaggtagtgacaagaaata 470 - 490 amplification products was determined by the chain termina- 0651 taactgcaacaattttaatat 611-631 tion dideoxy method (SANGERet al. 1977) using either Taq 1037 acctctgacatctgaatacaa 969-989 polymerase and 5' end-labeled primers as recommended by 1126 gaaagttaagggagtgaagac 1064-1084 the manufacturer (Promega) or T7 polymerase sequencing in 621 1 gtcttcactcccttaactttc 1064-1084 the presence of [35S]dCTPusing 7deaza dGTP and 7-deaza 1162 atagtttatggttaagatta 1099-1119 1171 aagactttgatttctcataag 1202-1222 dITP analogs as substitutes for dGTP as recommended by the 1273 gcttaatttgactcaacacgg 1303-1323 manufacturer (Pharmacia LKB). Oligonucleotides repre- 1508 tggttaattccgataacgaac 1432-1452 sented in Table 1 were used for sequencing reactions in both 1623 tctaacacaaggaagtttaag 1715-1735 orientations. 1880 gacatcacagacctgttgttg 1737-1757 Sequence alignments were generated with the PILEUP/ 1863 cttactaggcattcctcgttc 1944-1964 high road program available inthe Genetic Computer Group 1900 tgccctttgtacacaccgccc 1997-2017 2134 tcacctacggaaaccttgtta 2133-2153 (DEVEREUXet al. 1984) with gap opening penalties ranging 2134.1 gtaacaaggtttccgtaggtga 2133-2153 from 0.5 to 5.0 and gap extension penalties equal to 0.06 times 2401 aagaaagagctattaatctgt 1358-1378 or 0.1 times the gap opening penalty. Different alignments 2401.1 tgacagattaatagctctttc 1356-1376 were collated with the help of the program MALIGNED 3553 ctttaaaagataggatttacg 2099-2119 (CWUC 1991). V7-84 ccgcaatttagcaaatcatac 1562-1582 Parsimony and distance trees were generated with the PHY- V2-114 185-205 caagacattcgtcgagagtaa LIP package, version 3.4 (FELSENSTEIN1985). Bootstrappings v7-174 acaatcaascaaatacattct 1668-1688 were performed with the PHYLIP programs DNABOOT for * Primers display different degrees of conservation varying from parsimony-based trees, and SEQBOOT for distance-based universally conserved to strain specific. Primers used for screeningof trees (FELSENSTEIN1985). Alternative topologies were gener- libraries only hybridize to Plasmodium DNA as determined hy align- ing the corresponding region to the available SSU rRNA genes con- ated with the program DNAMOVE for parsimony (FELSENSTEIN sidered as more closely relatedto the parasite's hosts. These se- 1985) and TREE for distance trees (OLSEN1991). quences include the human (Homo sapiens), and mosquito (Aedes The three pairs of A and B sequences were analyzed in de- albopictus) genes. All primer sequences are oriented5' to 3' and the tail. A number of alignments were generated, including pair- polarity given with respect to the rRNA sequence. wise alignments, separate alignments of the A and B se- Primer positions refer to the sequence alignment in Figure 1. quences, alignments of the A and B sequences of pairs of reactions (PCR) were performed in 50-p1 reaction volumes, as species and alignments of the full set. For each of the above, described by SAIKI(1990) with the following parameters: 90"/1 several gap opening and gap extension penalties were used. min denaturation, 55"/1 min annealing and 71"/2 min poly- These were used as inputs to generate trees by distance meth- merization, for 30 cycles. ods, parsimony and evolutionary parsimony. PCR products were extracted with phenol,phenol/ chloroform and chloroform followed by two to threecycles of RESULTS ethanol precipitation in the presence of ammonium acetate. DNA was blunt ended with Klenow fragment (New England
Load more

Recommended publications
  • Characterizing the Genetic Diversity of the Monkey Malaria Parasite Plasmodium Cynomolgi
    Infection, Genetics and Evolution 40 (2016) 243–252 Contents lists available at ScienceDirect Infection, Genetics and Evolution journal homepage: www.elsevier.com/locate/meegid Characterizing the genetic diversity of the monkey malaria parasite Plasmodium cynomolgi Patrick L. Sutton a,1, Zunping Luo a,PaulC.S.Divisb,c, Volney K. Friedrich d,2,DavidJ.Conwayb,c, Balbir Singh c, John W. Barnwell e,JaneM.Carltona, Steven A. Sullivan a,⁎ a Center for Genomics and Systems Biology, Department of Biology, New York University, 12 Waverly Place, New York, NY 10003, United States b Pathogen Molecular Biology Department, London School of Hygiene and Tropical Medicine, Keppel St, London WC1E 7HT, United Kingdom c Malaria Research Centre, Faculty of Medicine and Health Sciences, University Malaysia Sarawak, 94300 Kota Samarahan, Sarawak, Malaysia d Department of Anthropology, New York University, 38 Waverly Place, New York, NY 10003, United States e Laboratory Research and Development Unit, Malaria Branch, Centers for Disease Control and Prevention, Atlanta, GA, United States article info abstract Article history: Plasmodium cynomolgi is a malaria parasite that typically infects Asian macaque monkeys, and humans on rare Received 4 January 2016 occasions. P. cynomolgi serves as a model system for the human malaria parasite Plasmodium vivax, with which Received in revised form 1 March 2016 it shares such important biological characteristics as formation of a dormant liver stage and a preference to Accepted 2 March 2016 invade reticulocytes. While genomes of three P. cynomolgi strains have been sequenced, genetic diversity of Available online 14 March 2016 P. cynomolgi has not been widely investigated. To address this we developed the first panel of P.
    [Show full text]
  • Stump-Tailed Macaques (Macaca Arctoides)
    Fungfuang et al. Malar J (2020) 19:350 https://doi.org/10.1186/s12936-020-03424-0 Malaria Journal RESEARCH Open Access Malaria parasites in macaques in Thailand: stump-tailed macaques (Macaca arctoides) are new natural hosts for Plasmodium knowlesi, Plasmodium inui, Plasmodium coatneyi and Plasmodium feldi Wirasak Fungfuang1, Chanya Udom1, Daraka Tongthainan2, Khamisah Abdul Kadir3 and Balbir Singh3* Abstract Background: Certain species of macaques are natural hosts of Plasmodium knowlesi and Plasmodium cynomolgi, which can both cause malaria in humans, and Plasmodium inui, which can be experimentally transmitted to humans. A signifcant number of zoonotic malaria cases have been reported in humans throughout Southeast Asia, includ- ing Thailand. There have been only two studies undertaken in Thailand to identify malaria parasites in non-human primates in 6 provinces. The objective of this study was to determine the prevalence of P. knowlesi, P. cynomolgi, P. inui, Plasmodium coatneyi and Plasmodium feldi in non-human primates from 4 new locations in Thailand. Methods: A total of 93 blood samples from Macaca fascicularis, Macaca leonina and Macaca arctoides were collected from four locations in Thailand: 32 were captive M. fascicularis from Chachoengsao Province (CHA), 4 were wild M. fascicularis from Ranong Province (RAN), 32 were wild M. arctoides from Prachuap Kiri Khan Province (PRA), and 25 were wild M. leonina from Nakornratchasima Province (NAK). DNA was extracted from these samples and analysed by nested PCR assays to detect Plasmodium, and subsequently to detect P. knowlesi, P. coatneyi, P. cynomolgi, P. inui and P. feldi. Results: Twenty-seven of the 93 (29%) samples were Plasmodium-positive by nested PCR assays.
    [Show full text]
  • Plasmodium Vivax-Like Genome Sequences Shed New Insights Into Plasmodium Vivax Biology and Evolution
    bioRxiv preprint doi: https://doi.org/10.1101/205302; this version posted March 12, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Title: Plasmodium vivax-like genome sequences shed new insights into Plasmodium vivax biology and evolution Authors: Aude Gilabert1,#, Thomas D. Otto2,3,#, Gavin G. Rutledge2, Blaise Franzon1, Benjamin Ollomo4, Céline Arnathau1, Patrick Durand1, Nancy D. Moukodoum4, Alain- Prince Okouga4, Barthélémy Ngoubangoye4, Boris Makanga4, Larson Boundenga4, Christophe Paupy1,4, François Renaud1, Franck Prugnolle1,4,*, Virginie Rougeron1,4,* Affiliations: 1MIVEGEC, IRD, CNRS, Univ. Montpellier, Montpellier, FRANCE 2Wellcome Trust Sanger Institute, Wellcome Trust Genome Campus, Cambridge CB10 1SA, UK 3 Institute of Infection, Immunity and Inflammation, University of Glasgow, College of Medical, Veterinary and Life Sciences, Sir Graeme Davies Building, 120 University Place, Glasgow G12 8TA, UK 4Centre International de Recherches Médicales de Franceville, B.P. 769, Franceville, GABON #Contributed equally to this work *Corresponding authors: Rougeron Virginie; Laboratoire MIVEGEC (UM-CNRS-IRD), 34394 Montpellier, France; [email protected] / [email protected]; Prugnolle Franck; Laboratoire MIVEGEC (UM-CNRS-IRD), 34394 Montpellier, France; [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/205302; this version posted March 12, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Although Plasmodium vivax is responsible for the majority of malaria infections outside Africa, little is known about its evolution and pathway to humans.
    [Show full text]
  • Evolutionary History of Human Plasmodium Vivax Revealed by Genome-Wide Analyses of Related Ape Parasites
    Evolutionary history of human Plasmodium vivax revealed by genome-wide analyses of related ape parasites Dorothy E. Loya,b,1, Lindsey J. Plenderleithc,d,1, Sesh A. Sundararamana,b, Weimin Liua, Jakub Gruszczyke, Yi-Jun Chend,f, Stephanie Trimbolia, Gerald H. Learna, Oscar A. MacLeanc,d, Alex L. K. Morganc,d, Yingying Lia, Alexa N. Avittoa, Jasmin Gilesa, Sébastien Calvignac-Spencerg, Andreas Sachseg, Fabian H. Leendertzg, Sheri Speedeh, Ahidjo Ayoubai, Martine Peetersi, Julian C. Raynerj, Wai-Hong Thame,f, Paul M. Sharpc,d,2, and Beatrice H. Hahna,b,2,3 aDepartment of Medicine, University of Pennsylvania, Philadelphia, PA 19104; bDepartment of Microbiology, University of Pennsylvania, Philadelphia, PA 19104; cInstitute of Evolutionary Biology, University of Edinburgh, Edinburgh EH9 3FL, United Kingdom; dCentre for Immunity, Infection and Evolution, University of Edinburgh, Edinburgh EH9 3FL, United Kingdom; eWalter and Eliza Hall Institute of Medical Research, Parkville VIC 3052, Australia; fDepartment of Medical Biology, The University of Melbourne, Parkville VIC 3010, Australia; gRobert Koch Institute, 13353 Berlin, Germany; hSanaga-Yong Chimpanzee Rescue Center, International Development Association-Africa, Portland, OR 97208; iRecherche Translationnelle Appliquée au VIH et aux Maladies Infectieuses, Institut de Recherche pour le Développement, University of Montpellier, INSERM, 34090 Montpellier, France; and jMalaria Programme, Wellcome Trust Sanger Institute, Genome Campus, Hinxton Cambridgeshire CB10 1SA, United Kingdom Contributed by Beatrice H. Hahn, July 13, 2018 (sent for review June 12, 2018; reviewed by David Serre and L. David Sibley) Wild-living African apes are endemically infected with parasites most recently in bonobos (Pan paniscus)(7–11). Phylogenetic that are closely related to human Plasmodium vivax,aleadingcause analyses of available sequences revealed that ape and human of malaria outside Africa.
    [Show full text]
  • The Historical Ecology of Human and Wild Primate Malarias in the New World
    Diversity 2010, 2, 256-280; doi:10.3390/d2020256 OPEN ACCESS diversity ISSN 1424-2818 www.mdpi.com/journal/diversity Article The Historical Ecology of Human and Wild Primate Malarias in the New World Loretta A. Cormier Department of History and Anthropology, University of Alabama at Birmingham, 1401 University Boulevard, Birmingham, AL 35294-115, USA; E-Mail: [email protected]; Tel.: +1-205-975-6526; Fax: +1-205-975-8360 Received: 15 December 2009 / Accepted: 22 February 2010 / Published: 24 February 2010 Abstract: The origin and subsequent proliferation of malarias capable of infecting humans in South America remain unclear, particularly with respect to the role of Neotropical monkeys in the infectious chain. The evidence to date will be reviewed for Pre-Columbian human malaria, introduction with colonization, zoonotic transfer from cebid monkeys, and anthroponotic transfer to monkeys. Cultural behaviors (primate hunting and pet-keeping) and ecological changes favorable to proliferation of mosquito vectors are also addressed. Keywords: Amazonia; malaria; Neotropical monkeys; historical ecology; ethnoprimatology 1. Introduction The importance of human cultural behaviors in the disease ecology of malaria has been clear at least since Livingstone‘s 1958 [1] groundbreaking study describing the interrelationships among iron tools, swidden horticulture, vector proliferation, and sickle cell trait in tropical Africa. In brief, he argued that the development of iron tools led to the widespread adoption of swidden (―slash and burn‖) agriculture. These cleared agricultural fields carved out a new breeding area for mosquito vectors in stagnant pools of water exposed to direct sunlight. The proliferation of mosquito vectors and the subsequent heavier malarial burden in human populations led to the genetic adaptation of increased frequency of sickle cell trait, which confers some resistance to malaria.
    [Show full text]
  • Plasmodium Asexual Growth and Sexual Development in the Haematopoietic Niche of the Host
    REVIEWS Plasmodium asexual growth and sexual development in the haematopoietic niche of the host Kannan Venugopal 1, Franziska Hentzschel1, Gediminas Valkiūnas2 and Matthias Marti 1* Abstract | Plasmodium spp. parasites are the causative agents of malaria in humans and animals, and they are exceptionally diverse in their morphology and life cycles. They grow and develop in a wide range of host environments, both within blood- feeding mosquitoes, their definitive hosts, and in vertebrates, which are intermediate hosts. This diversity is testament to their exceptional adaptability and poses a major challenge for developing effective strategies to reduce the disease burden and transmission. Following one asexual amplification cycle in the liver, parasites reach high burdens by rounds of asexual replication within red blood cells. A few of these blood- stage parasites make a developmental switch into the sexual stage (or gametocyte), which is essential for transmission. The bone marrow, in particular the haematopoietic niche (in rodents, also the spleen), is a major site of parasite growth and sexual development. This Review focuses on our current understanding of blood-stage parasite development and vascular and tissue sequestration, which is responsible for disease symptoms and complications, and when involving the bone marrow, provides a niche for asexual replication and gametocyte development. Understanding these processes provides an opportunity for novel therapies and interventions. Gametogenesis Malaria is one of the major life- threatening infectious Malaria parasites have a complex life cycle marked Maturation of male and female diseases in humans and is particularly prevalent in trop- by successive rounds of asexual replication across gametes. ical and subtropical low- income regions of the world.
    [Show full text]
  • Co-Infections with Babesia Microti and Plasmodium Parasites Along The
    Zhou et al. Infectious Diseases of poverty 2013, 2:24 http://www.idpjournal.com/content/2/1/24 RESEARCH ARTICLE Open Access Co-infections with Babesia microti and Plasmodium parasites along the China-Myanmar border Xia Zhou1,2, Sheng-Guo Li3, Shen-Bo Chen1, Jia-Zhi Wang3, Bin Xu1, He-Jun Zhou1, Hong-Xiang Zhu Ge2, Jun-Hu Chen1 and Wei Hu1,4* Abstract Background: Babesiosis is an emerging health risk in several parts of the world. However, little is known about the prevalence of Babesia in malaria-endemic countries. The area along the China-Myanmar border in Yunnan is a main endemic area of malaria in P.R. China, however, human infection with Babesia microti (B. microti) is not recognized in this region, and its profile of co-infection is not yet clear. Methods: To understand its profile of co-infections with B. microti, our investigation was undertaken in the malaria-endemic area along the China-Myanmar border in Yunnan between April 2012 and June 2013. Four parasite species, including B. microti, Plasmodium falciparum (P. falciparum), P. vivax, and P. malariae, were identified among 449 suspected febrile persons detected by nested polymerase chain reaction (PCR) assay based on small subunit ribosomal ribonucleic acid (RNA) genes of B. microti and Plasmodium spp. Results: Of all the collected samples from febrile patients, mono-infection with B. microti, P. vivax, P. falciparum, and P. malariae accounted for 1.8% (8/449), 9.8% (44/449), 2.9% (13/449), and 0.2% (1/449), respectively. The rate of mixed infections of B.
    [Show full text]
  • Highly Rearranged Mitochondrial Genome in Nycteria Parasites (Haemosporidia) from Bats
    Highly rearranged mitochondrial genome in Nycteria parasites (Haemosporidia) from bats Gregory Karadjiana,1,2, Alexandre Hassaninb,1, Benjamin Saintpierrec, Guy-Crispin Gembu Tungalunad, Frederic Arieye, Francisco J. Ayalaf,3, Irene Landaua, and Linda Duvala,3 aUnité Molécules de Communication et Adaptation des Microorganismes (UMR 7245), Sorbonne Universités, Muséum National d’Histoire Naturelle, CNRS, CP52, 75005 Paris, France; bInstitut de Systématique, Evolution, Biodiversité (UMR 7205), Sorbonne Universités, Muséum National d’Histoire Naturelle, CNRS, Université Pierre et Marie Curie, CP51, 75005 Paris, France; cUnité de Génétique et Génomique des Insectes Vecteurs (CNRS URA3012), Département de Parasites et Insectes Vecteurs, Institut Pasteur, 75015 Paris, France; dFaculté des Sciences, Université de Kisangani, BP 2012 Kisangani, Democratic Republic of Congo; eLaboratoire de Biologie Cellulaire Comparative des Apicomplexes, Faculté de Médicine, Université Paris Descartes, Inserm U1016, CNRS UMR 8104, Cochin Institute, 75014 Paris, France; and fDepartment of Ecology and Evolutionary Biology, University of California, Irvine, CA 92697 Contributed by Francisco J. Ayala, July 6, 2016 (sent for review March 18, 2016; reviewed by Sargis Aghayan and Georges Snounou) Haemosporidia parasites have mostly and abundantly been de- and this lack of knowledge limits the understanding of the scribed using mitochondrial genes, and in particular cytochrome evolutionary history of Haemosporidia, in particular their b (cytb). Failure to amplify the mitochondrial cytb gene of Nycteria basal diversification. parasites isolated from Nycteridae bats has been recently reported. Nycteria parasites have been primarily described, based on Bats are hosts to a diverse and profuse array of Haemosporidia traditional taxonomy, in African insectivorous bats of two fami- parasites that remain largely unstudied.
    [Show full text]
  • Molecular Probes for the Identification of Avian Haemoproteus and Leucocytozoon Parasites in Tissue Sections by Chromogenic in S
    Himmel et al. Parasites Vectors (2019) 12:282 https://doi.org/10.1186/s13071-019-3536-2 Parasites & Vectors RESEARCH Open Access Molecular probes for the identifcation of avian Haemoproteus and Leucocytozoon parasites in tissue sections by chromogenic in situ hybridization Tanja Himmel1, Josef Harl1, Anna Kübber‑Heiss2, Cornelia Konicek3, Nuhacet Fernández4, Carles Juan‑Sallés5, Mikas Ilgūnas6, Gediminas Valkiūnas6 and Herbert Weissenböck1* Abstract Background: Avian haemosporidian parasites can cause severe disease in their hosts due to excessive exo‑eryth‑ rocytic merogony and anaemia caused by blood stages. Notably, the development of megalomeronts by species of Haemoproteus and Leucocytozoon has been associated with mortalities in birds. Diagnosis of lethal infections is currently accomplished by the detection of parasites’ tissue stages in histological sections combined with PCR and sequencing. However, sequences frequently are not reliably obtained and the generic discrimination of exo‑eryth‑ rocytic tissue stages based on morphological characters is challenging. Therefore, the present study aimed at devel‑ oping specifc molecular probes for the identifcation of Haemoproteus spp. and Leucocytozoon spp. in histological sections using chromogenic in situ hybridization. Methods: Parasite subgenus‑specifc oligonucleotide probes were designed to target the 18S ribosomal RNA of Haemoproteus species (subgenus Parahaemoproteus) and Leucocytozoon spp. (subgenus Leucocytozoon) and were in situ hybridized to sections from formalin‑fxed, parafn‑embedded tissue samples determined positive for these parasites by PCR and histopathology. To confrm the presence of parasites at sites of probe hybridization, consecutive sections were stained with haematoxylin–eosin and examined. Results: Parahaemoproteus‑ and Leucocytozoon‑specifc probes labelled erythrocytic and exo‑erythrocytic stages of Haemoproteus spp.
    [Show full text]
  • Plasmodium Cynomolgi Genome Sequences Provide Insight Into Plasmodium Vivax and the Monkey Malaria Clade
    LETTERS Plasmodium cynomolgi genome sequences provide insight into Plasmodium vivax and the monkey malaria clade Shin-Ichiro Tachibana1,13, Steven A Sullivan2, Satoru Kawai3, Shota Nakamura4, Hyunjae R Kim2, Naohisa Goto4, Nobuko Arisue5, Nirianne M Q Palacpac5, Hajime Honma1,5, Masanori Yagi5, Takahiro Tougan5, Yuko Katakai6, Osamu Kaneko7, Toshihiro Mita8, Kiyoshi Kita9, Yasuhiro Yasutomi10, Patrick L Sutton2, Rimma Shakhbatyan2, Toshihiro Horii5, Teruo Yasunaga4, John W Barnwell11, Ananias A Escalante12, Jane M Carlton2,14 & Kazuyuki Tanabe1,5,14 P. cynomolgi, a malaria-causing parasite of Asian Old World densities in the blood2, coupled with emerging antimalarial drug monkeys, is the sister taxon of P. vivax, the most prevalent resistance3, render P. vivax resilient to modern control strategies. malaria-causing species in humans outside of Africa. Because Recent evidence indicates that P. falciparum derives from parasites of P. cynomolgi shares many phenotypic, biological and genetic great apes in Africa4, whereas P. vivax is more closely related to para- characteristics with P. vivax, we generated draft genome sites of Asian Old World monkeys5–7, although not itself infective of sequences for three P. cynomolgi strains and performed these monkeys. genomic analysis comparing them with the P. vivax genome, P. vivax cannot be cultured in vitro, and the small New World mon- as well as with the genome of a third previously sequenced keys capable of hosting it are rare and do not provide an ideal model simian parasite, Plasmodium knowlesi. Here, we show that system. P. knowlesi, an Asian Old World monkey parasite recently genomes of the monkey malaria clade can be characterized by recognized as a zoonosis for humans8, has had its genome sequenced9, copy-number variants (CNVs) in multigene families involved but the species is distantly related to P.
    [Show full text]
  • Highly Rearranged Mitochondrial Genome in Nycteria Parasites (Haemosporidia) from Bats
    Highly rearranged mitochondrial genome in Nycteria parasites (Haemosporidia) from bats Gregory Karadjiana,1,2, Alexandre Hassaninb,1, Benjamin Saintpierrec, Guy-Crispin Gembu Tungalunad, Frederic Arieye, Francisco J. Ayalaf,3, Irene Landaua, and Linda Duvala,3 aUnité Molécules de Communication et Adaptation des Microorganismes (UMR 7245), Sorbonne Universités, Muséum National d’Histoire Naturelle, CNRS, CP52, 75005 Paris, France; bInstitut de Systématique, Evolution, Biodiversité (UMR 7205), Sorbonne Universités, Muséum National d’Histoire Naturelle, CNRS, Université Pierre et Marie Curie, CP51, 75005 Paris, France; cUnité de Génétique et Génomique des Insectes Vecteurs (CNRS URA3012), Département de Parasites et Insectes Vecteurs, Institut Pasteur, 75015 Paris, France; dFaculté des Sciences, Université de Kisangani, BP 2012 Kisangani, Democratic Republic of Congo; eLaboratoire de Biologie Cellulaire Comparative des Apicomplexes, Faculté de Médicine, Université Paris Descartes, Inserm U1016, CNRS UMR 8104, Cochin Institute, 75014 Paris, France; and fDepartment of Ecology and Evolutionary Biology, University of California, Irvine, CA 92697 Contributed by Francisco J. Ayala, July 6, 2016 (sent for review March 18, 2016; reviewed by Sargis Aghayan and Georges Snounou) Haemosporidia parasites have mostly and abundantly been de- and this lack of knowledge limits the understanding of the scribed using mitochondrial genes, and in particular cytochrome evolutionary history of Haemosporidia, in particular their b (cytb). Failure to amplify the mitochondrial cytb gene of Nycteria basal diversification. parasites isolated from Nycteridae bats has been recently reported. Nycteria parasites have been primarily described, based on Bats are hosts to a diverse and profuse array of Haemosporidia traditional taxonomy, in African insectivorous bats of two fami- parasites that remain largely unstudied.
    [Show full text]
  • Hemoparasites in a Wild Primate: Infection Patterns Suggest Interaction of Plasmodium and Babesia in a Lemur Species*
    International Journal for Parasitology: Parasites and Wildlife 4 (2015) 385e395 Contents lists available at ScienceDirect International Journal for Parasitology: Parasites and Wildlife journal homepage: www.elsevier.com/locate/ijppaw Hemoparasites in a wild primate: Infection patterns suggest interaction of Plasmodium and Babesia in a lemur species* * Andrea Springer a, , Claudia Fichtel a,Sebastien Calvignac-Spencer b, Fabian H. Leendertz b, Peter M. Kappeler a, c a Behavioral Ecology and Sociobiology Unit, German Primate Center, Kellnerweg 4, 37077 Gottingen,€ Germany b Project Group “Epidemiology of Highly Pathogenic Microorganisms”, Robert-Koch-Institut, Seestraße 10, 13353 Berlin, Germany c Department of Sociobiology and Anthropology, University of Gottingen,€ Kellnerweg 6, 30077 Gottingen,€ Germany article info abstract Article history: Hemoparasites can cause serious morbidity in humans and animals and often involve wildlife reservoirs. Received 22 June 2015 Understanding patterns of hemoparasite infections in natural populations can therefore inform about Received in revised form emerging disease risks, especially in the light of climate change and human disruption of natural eco- 21 August 2015 systems. We investigated the effects of host age, sex, host group size and season on infection patterns of Accepted 16 October 2015 Plasmodium sp., Babesia sp. and filarial nematodes in a population of wild Malagasy primates, Verreaux's sifakas (Propithecus verreauxi), as well as the effects of these infections on hematological variables. We Keywords: tested 45 blood samples from 36 individuals and identified two species of Plasmodium, one species of Verreaux's sifakas fi Propithecus verreauxi Babesia and two species of larial nematodes. Plasmodium spp. and Babesia sp. infections showed Plasmodium sp. opposite patterns of age-dependency, with babesiosis being prevalent among young animals, while older Babesia sp.
    [Show full text]