sign in sign up
<<
Home , Morolimumab, Rovelizumab

(12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2012/144892 Al 26 October 2012 (26.10.2012) P O P C T

(51) International Patent Classification: (81) Designated States (unless otherwise indicated, for every A61K 31/192 (2006.01) A61P 9/10 (2006.01) kind of national protection available): AE, AG, AL, AM, A61K 31/352 (2006.01) A61P 31/04 (2006.01) AO, AT, AU, AZ, BA, BB, BG, BH, BR, BW, BY, BZ, A61P 3/10 (2006.01) A61K 133/00 (2006.01) CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, (21) Number: International Application HR, HU, ID, IL, IN, IS, JP, KE, KG, KM, KN, KP, KR, PCT/NL20 12/050241 KZ, LA, LC, LK, LR, LS, LT, LU, LY, MA, MD, ME, (22) International Filing Date: MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, 12 April 2012 (12.04.2012) OM, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SC, SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, TR, (25) Filing Language: English TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (26) Publication Language: English (84) Designated States (unless otherwise indicated, for every (30) Priority Data: kind of regional protection available): ARIPO (BW, GH, 2006621 18 April 201 1 (18.04.201 1) NL GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, SZ, TZ, UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, MD, RU, (71) Applicant (for all designated States except US): TJ, TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, FYTAGORAS B.V. [NL/NL]; Sylviusweg 72, NL-2333 DK, EE, ES, FI, FR, GB, GR, HR, HU, IE, IS, IT, LT, LU, BE Leiden (NL). LV, MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, SM, TR), OAPI (BF, BJ, CF, CG, CI, CM, GA, GN, GQ, (72) Inventor; and GW, ML, MR, NE, SN, TD, TG). (75) Inventor/Applicant (for US only): KORTHOUT, Henri- cus Adriaan Anne Jacobus [NL/NL]; Domineestuin 2, Published: NL-1544 PT Zaandijk (NL). — with international search report (Art. 21(3)) (74) Agent: JANSEN, CM.; Johan de Wittlaan 7, NL-251 7 JR Den Haag (NL).

(54) Title: MEDICAL USE FOR ACIDIC CANNABINOIDS (57) Abstract: The invention relates to acidic cannabinoids as defined in the specification for use in increasing the natural resistance of an animal, for use in enhancing cellular resistance, for use in therapy of diabetes, for use in therapy of atherosclerosis, reduce the decline in stress response found in age ing or for use in decreasing the necessity for antibiotic treatment. Preferably said acidic cannabinoid is selected from the group consisting of A -tetrahy- drocannabinolic acid or THC acid (THCA), cannabidiolic acid (CBD-A), cannabidiol (CBD), cannabigerolic acid (CBGA), cannabigerol (CBG), can- nabinolic acid (CBN-A) and cannabinol (CBN), cannabichromenic acid (CBC-A) and cannabichromene (CBC). MEDICAL USE FOR ACIDIC CANNAB I OIDS

The invention relates to the field of medicine, more particularly the field of immunology, stress and infection. In particular, the invention relates to increasing the natural resistance of animals by administering medicinal acidic cannabinoids.

BACKGROUND 9-Tetrahydrocannabinol (THC) is naturally found in cannabis. THC has been reported to have use as an analgesic, for instance for patients suffering from rheumatoid arthritis. A side effect of THC is its psychoactive activity. Further, conventionally THC is administered by smoking, which may be detrimental to general health, in particular to the lungs and the coronary system. WO 89/01332 describes an acidic metabolite of THC, wherein the methyl group at the 9-position, a major metabolite formed in humans and other mammals, is substituted by a carboxyl group. This metabolite is reported to be non-psychoactive. Its use as a therapeutic agent for such purposes as the treatment of chronic pain and tissue inflammation often associated with illnesses such as rheumatoid arthritis is suggested. The Examples show a mouse hot plate test for analgesia, which indicates that, in mice, the metabolite shows about the same analgesic activity as THC and a somewhat lower activity than naproxen. The Examples further indicate that the metabolite does not induce the formation of gastric lesions in an animal test under conditions wherein aspirin does. In a review by Bhargava (Gen. Pharmac. Vol 9 (1978), No 4, pages 195-213), potential uses of cannabinoids are mentioned in rather general terms. Bhargava mentions that several cannabinoids have been pharmacologically tested, without disclosing in any detail, a specific medical activity for carboxylated cannabinoids (THC acids), such as ∆9- tetrahydrocannabinol^ acid or the like. In addition, reference is made to the analgesic activity of THC and several other cannabinoids compared to morphine. THC is reported to perform equi-analgesic with morphine, but other tested cannabinoids are reported to be much less potent or even inactive. Williamson and Evans (Drugs 2000, Dec. 60(6): 1303-1314 discuss in general terms a potential clinical use of cannabis. The specific use of THC acids, such as 9-tetrahydrocannabinolic acid or the like, as the active pharmaceutical ingredient, is not disclosed. GB-A 2 384 707 relates to the use of a cannobinoid acid, in particular cannabidiol (CBD) and cannabidiol acid (CBDA) for use as an active pharmaceutical substance in the treatment of nausea, vomiting, emesis and motion sickness. The compounds may be obtained by extraction from cannabis. As a result of the extraction, relatively small amounts of THC-acids may be present in the extract, but the use of a THC-acid as an active pharmaceutical substance is not mentioned. WO 2005/072719 describes medical uses of novel acidic cannabinoids obtained from plants for relieving pain, for suppression of an inflammatory response, preferably for suppressing release of a pro-inflammatory cytokine (such as TNF-a), and/or stimulating the release of an anti-inflammatory cytokine (such as IL- 10). Appendino et al. (J. Nat. prod. 2008, 71: 1427-1430) describe the antibacterial effect of cannabinoids, amongst which also acidic cannabinoids such as THC-acid, cannabidiolic acid (CBDA) and cannabigerolic acid (CBGA), which proved effective in particular against Staphylococcus aureus (MRSA). There remains a continuing desire for alternative therapeutics. It is therefore an object of the invention to provide such a therapeutic.

SUMMARY OF THE INVENTION The present inventors now have discovered that acidic cannabinoids are able to induce the expression of heat shock proteins, in particular Hsp70. The invention thus comprises the acidic cannabinoids of Formula la, lb or Ic, as defined in claim 1 for use in increasing the natural resistance of an animal, for use in enhancing cellular resistance, for use in therapy of diabetes, for use in therapy of atherosclerosis, reduce the decline in stress response found in ageing or for use in decreasing the necessity for antibiotic treatment. Preferably, said acidic cannabinoid is selected from the group consisting of ∆9- tetrahydrocannabinolic acid or THC acid (THCA), cannabidiolic acid (CBD-A), cannabidiol (CBD), cannabigerolic acid (CBGA), cannabigerol (CBG), cannabinolic acid (CBN-A) and cannabinol (CBN), cannabichromenic acid (CBC-A) and cannabichromene (CBC), more preferably said acidic cannabinoid is THCA. Also comprised in the invention is a plant extract, comprising at least one acidic cannabinoid as defined claim 1, wherein the amount of ∆9- tetrahydrocannabinol as a weight percentage of the total dry weight of the extract is 0-5 wt%, for use in increasing the natural resistance of an animal subject, for use in enhancing cellular resistance, for use in therapy of diabetes, for use in therapy of atherosclerosis, and to reduce the decline in stress response found in ageing. Preferably said plant extract comprises at least one compound selected from the group consisting of 9-tetrahydrocannabinolic acid or THC acid (THCA), cannabidiolic acid (CBD-A), cannabidiol (CBD), cannabigerolic acid (CBGA), cannabigerol (CBG), cannabinolic acid (CBN-A) and cannabinol (CBN), cannabichromenic acid (CBC-A) and cannabichromene (CBC), more preferably said compound is 9-tetrahydrocannabinolic acid (THCA). Further comprised in the invention is a method of treating an animal subject with an acidic cannabinoid as defined above or a plant extract as defined above, which treatment comprises administering the acid cannabinoid in acidic form, wherein the treatment comprises increasing the natural resistance of a mammalian subject, enhancing cellular resistance, therapy of diabetes, therapy of atherosclerosis, or reducing the decline in stress response found in ageing. Preferably, in such a method the animal subject is chosen from the group consisting of a human, a cow, a sheep, a pig, a horse, a fish and a culture of other animals (shrimps, lobster, bivalves). Further comprised in the invention is a pharmaceutical composition comprising an acidic cannabinoid as defined above or a plant extract as defined above and an immunosuppressant. Preferably said pharmaceutical composition comprises an acidic cannabinoid or a plant extract and (5R )-5- hydroxytriptolyde. The invention also relates to the use of an acidic cannabinoid as defined above or a plant extract as defined above in additional therapy of EAE. The invention also relates to a method to induce expression of Hsp70 in a cell by contacting the cell with an acidic cannabinoid as defined above or with a plant extract as defined above.

LEGENDS TO THE FIGURES Figure 1 . Effect of different concentrations of THC-acid on the activation of the human DNAJB1 (Hsp40) promoter in a 023 reporter cell line in the presence of different concentrations of arsenite. The DNAJB1 promotor was coupled to a luciferase reporter gene to measure promoter activation. In this experiment the 023 cells were stressed with sodium arsenite (according to Wieten et al 2010).

DETAILED DESCRIPTION OF THE INVENTION Within the context of the invention, the term "acidic" is used to describe a compound having a carboxyl group, unless specified otherwise. In general, an acidic precursor of THC is transformable into THC by decarboxylation, optionally in combination with one or more other reactions, such as a cyclisation of a precursor having two of the rings forming the core of the THC to form the third ring, (de)alkylation, (de)hydroxylation and the like. Besides the compounds of formula la and of lb, examples of acidic THC precursors are cannabidiolic acid (CBDA), cannabichromenic acid (CBCA), cannabinorolic acid (CBNRA), cannabigerolic acid (CBGA), cannabinolic acid (CBNA) and functional and structural analogues thereof. It is known from e.g. WO 2005/072719 that a compound according to the invention is only lowly psychoactive or even non-psychoactive. Besides, it is expected that the risk for gastro-intestinal damage as a result of using a compound according to the invention is low, and in particular less than for at least some commercially very successful drugs, e.g. aspirin. More in particular, the present invention relates to an acidic cannabinoid represented by formula la, lb or Ic

Formula la Formula Ic for use in increasing the natural resistance of an animal subject for use in enhancing cellular resistance, for use in therapy of diabetes, for use in therapy of atherosclerosis, and to reduce the decline in stress response found in ageing. Since this use also comprises increasing the natural resistance, this also means that less biocidal compounds are needed to suppress infections in anaimals that have been treated with the acid cannabinoids of the present invention. These acid cannabinoids can thus also be used to decrease the use of biocidal treatments, especially antibacterial treatments, which is especially advantageous for humans and farm animals. In these formulae X, Z and A each represent a different group selected from the groups -OH, hydrogen and a first alkyl; accordingly, each of these four groups are present in the compound. The first alkyl is preferably a Cl-ClO linear or branched alkyl, more preferably a C4-C7 linear or branched alkyl, even more preferably n-pentyl. The first alkyl is preferably Z . D represents -OH or alkyl, preferably a C1-C3 linear or branched alkyl, in particular a methyl. R represents a hydrogen, a C n-OH, a C n-COOH or a second alkyl; The n in these groups is an integer, preferably 0, 1 or 2 . R is preferably a C1-C3 linear or branched alkyl, more preferably -CH3. Preferably, the acidic cannobinoid of the present invention is ∆9- tetrahydrocannabinolic acid , THC acid (THCA), i.e. the structure of formula la, in which X is OH, D and R are methyl, A is hydrogen, and Z is n-pentyl, or cannabidiolic acid, CBD acid (CBDA), i.e. the structure of formula Ic, in which X is OH, R is methyl, A is hydrogen and Z is n-pentyl.

In principle, it is possible to synthesise a compound according to the invention (bio)chemically. The skilled person will know how to perform such synthesis based upon common general knowledge and the present disclosure. It is however an advantage of the invention that an acidic cannabinoid - in particular a compound wherein the first alkyl at the aromatic ring is n-pentyl (such as Z in formula la, lb or Ic, or in the equivalent position in an acidic precursor of THC in general) - may be derived from a natural source, such as cannabis. An acidic cannabinoid can be used (to treat a medical indication) directly without further chemical modifications, such as decarboxylising the compound into THC and subsequently metabolising the THC. A compound according to the invention may be used in isolated form or in an extract from a natural source, in particular from flower tops of cannabis. Particular suitable is a plant or a part thereof, comprising at least 5 wt. % of acidic cannabinoids, e.g. 5-15 wt. %. Very good results have been achieved with Ca abis sativa, Cannabis indica. . Suitable methods to extract an acidic compound according to the invention are known in the art and include liquid extraction, e.g. with an apolar phase, such as chloroform and a polar phase, in particular an aliphatic alcohol, such as methanol or ethanol. In such an extraction the acidic cannabinoid typically is found in the apolar phase, especially if the extraction procedure is carried out at pH lower than 7. The skilled person will know how to carry out a suitable extraction and further process the acidic cannabinoid, based on common general knowledge and the information disclosed herein. It has been found that an extract according to the invention, comprising an acidic cannabinoid is effective in inducing heat shock proteins, in particular hsp70 (see Example). Heat shock proteins (Hsps) are intracellular proteins important for maintenance of cellular and immune homeostasis (Lindquist and Craig, 1988, Ann. Rev. Genet. 22:631-677). Through their chaperone and refolding capacity, Hsps assist in transport and refolding of damaged proteins, processes that are essential to maintain cellular integrity during stress (Fink, A.L., 1999, Physiol. Rev. 79:425-449; Hartl, F.U, 1996, Nature 381:571-579). Hsps are up- regulated in response to various forms of stress, like oxidative, heat, and inflammatory stress (Hartl et al. 1992, Ann. Rev. Biophys. Biomol. Struct. 21:293-322). Based on their molecular weight, Hsps are divided into multiple families and expression of family members can be either constitutive or stress inducible. The Hsp70 family consists of 13 members among which HspAlA and HspAlB (here further referred to as Hsp70) are the best known inducible Hsp70 family members. Also, some members of the DNAJ (Hsp40) and Hsp90 families are highly stress inducible (Kampinga et al. 2009, Cell Stress Chaperones 14: 105-111; Daugaard et al. 2007, FEBS Lett. 581:3702-3710). Transcription of inducible Hsp is initiated by binding of heat shock factor 1 (HSF1) to heat shock binding elements (HSE) in the promoter region (Morimoto, R.I., 1993, Science 259:1409-1410). The expression of inducible Hsp family members is increased in cells in inflamed tissue. The immunoregulatory potential of stress proteins is becoming increasingly clear (Cohen, I.R., 2007, J . Autoimmun. 29:246-249; van Eden et al. 1988, Nature 331: 171-173; van Eden et al., 2007, Ann. NY Acad. Sci. 1113:217-237). In experimental models of inflammatory disease, like diabetes, and atherosclerosis, administration of exogenous Hsp or Hsp peptides suppressed disease via the induction of T-cells that specifically recognized Hsp60 or Hsp 70 (for review, see van Eden et al. (2005, Nat. Rev. Immunol. 5:318-330). Thus, by the effect on inducing expression of het shock proteins, especially Hsp 70, the acidic cannabinoid(s) of the invention, more particularly THCA, is able to enhance the cellular resistance to stress and to increase the natural resistance of a subject. Further use of the compound of the invention can be found in therapy of diabetes, in therapy of atherosclerosis, and to reduce the decline in stress response found in ageing. Further, by increasing the natural resistance of the subject its need for biocidal, e.g. antibacterial treatment will be decreased, which is particularly advantageous in human or farm animal subjects. For this purpose, the acidic cannabinoid of the invention can be provided as an isolated compound, or in an extract from a natural source.

The preparation of the extract in accordance with the invention is generally carried out under essentially non-decarboxylising conditions to avoid an excessive formation of THC, which may be undesired for its psycho-active side effects and/or for legal reasons, THC at present being illicit in many states. In practice, it is therefore preferred to perform the extraction at a temperature not exceeding 95 °C, more preferably at a temperature of less then about 50 °C, even more preferably of less than about 25 °C. Very good results have been achieved with extraction at a temperature not exceeding about 4 °C. The lower limit for the temperature is not particularly critical, as long as the extraction medium remains fluid. The extract may then be further processed in any way, without excessive exposure to heat to maintain essentially non-decarboxylising conditions and thus avoid excessive formation of THC. In particular such conditions are met if the extract is not excessively exposed to temperatures of about 200 °C or more. Preferably the extract is processed at a temperature not exceeding about 50 °C. More preferably any further processing of the extract takes place at a temperature of about 25 °C or less. Accordingly, the solvent of the extract is preferably removed by lyophilisation. In practice, conditions are considered to be essentially non- decarboxylising heat treatment is considered to be non-excessive when the amount of THC as a percentage of the total dry weight of the extract is less than 5 wt. %, preferably less than 2 wt. %, even more preferably less than 0.5 wt. %. For practical reasons the amount of THC is preferably less than the maximum allowable amount to allow use as a non-prescription medicament, as determined by law. In this respect it is interesting to note that the present invention allows for the preparation of extracts with less than about 0 .15 wt. % as a percentage of the dry weight without a need for selective removal of THC from the extract. THC may be totally absent (i.e. non-determinable by a conventional analytical technique) in an extract or other composition according to the invention. For practical reasons some THC may be present, such as about 0.01 wt. % as a percentage of the dry weight or more. Good results with respect to its pharmaceutical properties and low side effects have been achieved with an extract or other composition according to the invention wherein the amount of THC as a weight percentage of the amount of the at least one acidic cannabinoid is 0- 2 wt. %, preferably less than about 1 wt. %. As indicated above, THC may be absent, although some THC may be present; as such, for practical reasons a preferred lower limit for the amount of THC as a weight percentage of the amount of the at least one acidic cannabinoid is about 0.01 wt. %, more in particular about 0.1 wt. %. Good results have inter alia been achieved with an extract - in particular a cannabis extract - comprising at least about 10 mg/ g based upon the dry weight, preferably at least about 15 mg/g based upon the dry weight, of the acidic cannabinoid. Very good results have been achieved with an extract comprising at least about 20 mg/g based upon the dry weight of the acidic cannabinoid. The upper limit is not particularly critical. For practical reasons the upper limit is preferably about 500 mg/g, more preferably 250 mg/g dry weight. Preferably, a composition according to the invention, such as a (cannabis) extract, comprises at least one compound selected from the group consisting of 9-tetrahydrocannabinolic acid (THCA), cannabidiolic acid (CBD- A), cannabidiol (CBD), cannabigerolic acid (CBGA), cannabigerol (CBG), cannabinolic acid (CBN-A) and cannabinol (CBN), cannabichromenic acid(CBC-A) and cannabichromene (CBC). The amount of the compounds of this group may be chosen within wide limits. Good results have inter alia been achieved with a composition, in particular an extract, wherein the total amount is in the range of about 0.01-200 %, more in particular about 1-100 wt. %based upon the amount of the at least one acidic cannabinoid. In particular in this range indications exist that synergy occurs. An extract according to the invention may be employed in any form. It may for instance very suitably be in a dry form or in a liquid form, in particular solubilised in ethanol, water, a vegetable oil or a liquid comprising any of these compounds alone or in a combination. Particularly combinations of the compound(s) or extract of the invention with medicinal herbs and/or pharmaceutical compounds. An extract may very suitably be present in the form of a paste, cream or ointment. Such form is in particular attractive for topical applications, e.g. for treating a dermal inflammation. An acidic compound or extract according to the invention may very suitably be present in a pharmaceutical preparation, further comprising a pharmaceutically acceptable carrier. A preparation may for instance have the form of a tincture, an ointment, a spray, an inhalant, a powder, a granulate, a suppository, a tablet or a capsule. Of particular interest is administration as a liquid preparation for oral use or dermal application as a cream or ointment. Applications via the nasal or inhalatory route are in particular attractive for purified acids. The skilled person will know how to determine a particular dosage regime, depending upon the medical indication, the condition of the subject and the type of administration. The invention further relates to a method of enhancing the natural resistance by treating an animal, preferably a human, with an acidic cannabinoid, which treatment comprises administering the acidic cannabonoid in acidic form. This means in particular that the cannabinoid is administered under essentially non-decarboxylising conditions, in contrast to conventional ways of administering cannabinoids, i.e. by smoking (heating and inhaling) dried flower tops of cannabis plants. Besides avoiding the psycho active side-effects (as a result of the formation of THC during heating), the present form of administration does not impose any health risks normally associated with smoking. Suitable forms of administration include oral administration (such as ingestion or inhalation) and any other conventional medical ways of administering a medicament. In case of a combination of the cannabinoids of the present invention with herbs, these herbs can be administered in the same way. Accordingly, the invention further relates to the use of an acidic cannabinoid, optionally in the form of an extract or a pharmaceutical preparation as described herein, in the manufacture of a medicament for enhancing the natural resistance in a subject. With respect to the present invention, the subject is an animal, preferably a human, a mammalian animal (preferably a farm animal or a pet), a vertebrate, such as fish, or an insect. Preferably the animal has some kind of innate . Due to the general resistance increasing effect of the compounds of the invention, administration of these compounds is especially advantageous for animals that are treated with antibiotics, either to prevent infections or for growth enhancing effects, such as farm animals (cows, sheep, pigs, horses), fish in fish cultures (salmon, trout, tilapia, pangasius, abalone) and other animal cultures (shrimps, lobster, bivalves).

Further, the compounds and extracts of the present invention are useful as addition to known therapies, in case these therapies inflict stress on cells of the subject, or in case such therapies impair the natural resistance of the subject. A main beneficial effect of a combination of the compounds and extracts of the invention with existing therapies, is that the acidic cannabinoids of the invention also have been proven to have antibacterial (see e.g. Appendino G . et al., 2008, J . Nat. Prod. 71:1427-1430) and anti inflammatory effects (see e.g. WO 2005/072719). One of the specific applications is a combination of an acidic cannabinoid of the present invention with a compound used for suppressing experimental autoimmune encephalomyelitis (EAE). As has been described by Fu et al., (2006, J . Neuroimmunol. 175: 142-151) (5R)-5-hydroxytriptolyde (LLDT-8) is a suppressor of EAE, acting as an immunosuppressor. Combined therapy of LLDT-8, or any other immunosuppressor, with an acidic cannabinoid would prevent the disadvantageous effect of the immunosuppressor on the general (immune) resistance of the subject. Next to the treatment of EAE, immunosuppressors are also applied to prevent rejection of transplanted organs, in the treatment of graft-versus- host disease, in cancer , and in therapy of allergic asthma, HIV and SLE (systemic lupus erythematosus) . It is envisaged that the general immunostimulating action of the acidic cannabinoid will inhibit the disadvantageous general effects of the immunosuppressing compound. Thus, also part of the invention is a combined pharmaceutical preparation comprising an immunosuppressant drug and an acidic cannabinoid according to the present invention. An immunosuppressant drug can be chosen from the group of glucocorticoids, cytostatics, opioids, , inhibitors, like , myriocin, , vodosporin, cytotoxic antibiotics (such as dactinomycin, anthracycline, mitomycin C, bleomycin or mitramycin), enhancers (such as ), purine syntheis inhibitors (like , mercaptopurine or ), pyrimidine syntheis inhibitors (like or terflunomide), , like , (like , , or ), TNFa inhibitors (like elanercept, , and ), IL-1 receptor antagonists, like , mTOR-active compounds (like sirolimus, deforolimus, , , and biolimus A9), anti- immune (like polyclonal preparations (Atgam or thymoglobuline), and monoclonal antibodies, like infiximab, , certolizumab, afelimonab, , , omalzumab, , , elslimomab, , , muromonab-CD3, , , , , , , , , afutuzumab, , , , , , , , , , , , , , , , , , , , , , , zolimomab aritox, aterolimumab, , dorlixizumab, , gantenerumab, gomiliximab, , , , , , , , telimomab aritox, , ), The invention will now be illustrated by the following examples.

Example To test whether THCA sensitizes cells to stress or enhances hsp70 expression in stressed cells, we used arsenite as a stresser and 023 cells carrying a luciferase reporter gene driven by the DNAJBl (hsp40) promoter. Arsenite was chosen because it is experimentally easier to control the level of stress by adjusting the concentration of arsenite than by changing the severity of a heat shock; a luciferase reporter system was selected because it is quantitative; the DNAJBl promoter was selected as we found that the DNAJBl mRNA level is more sensitive to inhibition of HSF-1 than the level of hsp70 mRNA. Material and methods A fragment containing the sequence from -500 to +41 of the human DNAJBl (hsp40) gene was amplified from genomic DNA using the primers aagtcgaccagacacaggttaggtagttcgtcc and accatggcccctcctgcggcccgccga and cloned Sall/Ncol in the Xhol and Ncol sites of pGL#basic (Promega). The NhellBamHl fragment of DNAJBl-luc was cotransfected with a TK- hygromycin construct into 023 cells. Stable transfectants were selected and single clones were tested for inducible expression of luciferase. DNAJBl-luc- 023 cells were kept in culture at 37°C in DMEM containing 10% FBS, 100 units/ml penicillin, 100 g/ml streptomycin (Gibco BRL, Gaithersburg, MD USA) and 1 mg ml- 1 hygromycin (Roche Diagnostic). For the DNAJBa- luciferase assay, DNAJBl-luc-023 cells were seeded at 5*104 cells per well into 96-well white pClear-plates (Greiner Bio-One) and cultured at 37 °C in DMEM containing 10% FBS and p/s without hygromycin. On the next day arsenite and THCA were added to the indicated concentrations. After 16 hours overnight incubation, luminescence was measured with the Promega Steady- Glo Luciferase Assay System and counted on a 6-detector Wallac 1450 MicroBeta liquid scintillation counter. Data are expressed as 106 counts per minute (106 cpm). Results It was found that THCA dose-depently enhanced the luciferase activity induced by arsenite exposure (Figure 1). For THCA to act at least some stress is needed: no effect is seen at 10 µΜ arsenite, while at 20 µΜ arsenite the luciferase signal is nearly doubled with the highest concentrations of the THCA extract. These data suggest that THCA (like the positive control carvacrol) does not sensitize the cells to stress, but enhances the response to stress. Claims

1. An acidic cannabinoid represented by formula la, lb or Ic

Formula la

Formula Ic in which X, Z and A each represent a different group selected from the groups -OH, hydrogen and a first alkyl, wherein said first alkyl is preferably a Ci-Cio linear or branched alkyl, more preferably a C4-C7 linear or branched alkyl, even more preferably n-pentyl, D represents -OH or alkyl, preferably a C1-C3 linear or branched alkyl, in particular a methyl, R represents a hydrogen, a C n-OH, a C n-COOH or a second alkyl, wherein n in these groups is an integer, preferably 0, 1 or 2 ; in which R is preferably a C1-C3 linear or branched alkyl, more preferably -CH3, for use in increasing the natural resistance of an animal, for use in enhancing cellular resistance, for use in therapy of diabetes, for use in therapy of atherosclerosis, reduce the decline in stress response found in ageing or for use in decreasing the necessity for antibiotic treatment.

2 . Acidic cannabinoid according to claim 1, wherein said acidic cannabinoid is selected from the group consisting of 9-tetrahydrocannabinolic acid or THC acid (THCA), cannabidiolic acid (CBD-A), cannabidiol (CBD), cannabigerolic acid (CBGA), cannabigerol (CBG), cannabinolic acid (CBN-A) and cannabinol (CBN), cannabichromenic acid (CBC-A) and cannabichromene (CBC).

3. Acidic cannabinoid according to claim 1 or 2, wherein said acidic cannabinoid is THCA.

4 . Plant extract, comprising at least one acidic cannabinoid as defined in one of the preceding claims, wherein the amount of 9-tetrahydrocannabinol as a weight percentage of the total dry weight of the extract is 0-5 wt%, for use in increasing the natural resistance of an animal subject, for use in enhancing cellular resistance, for use in therapy of diabetes, for use in therapy of atherosclerosis, and to reduce the decline in stress response found in ageing.

5. Plant extract according to claim 4, comprising at least one compound selected from the group consisting of 9-tetrahydrocannabinolic acid or THC acid (THCA), cannabidiolic acid (CBD-A), cannabidiol (CBD), cannabigerolic acid (CBGA), cannabigerol (CBG), cannabinolic acid (CBN-A) and cannabinol (CBN), cannabichromenic acid (CBC-A) and cannabichromene (CBC), more preferably wherein said compound is 9-tetrahydrocannabinolic acid (THCA).

6 . Method of treating an animal subject with an acidic cannabinoid as defined in any one of claims 1-3 or a plant extract as defined in claim 4 or 5, which treatment comprises administering the acid cannabinoid in acidic form, wherein the treatment comprises increasing the natural resistance of an animal subject, enhancing cellular resistance, therapy of diabetes, therapy of atherosclerosis, or reducing the decline in stress response found in ageing.

7. Method according to any of the preceding claims, in which the animal subject is chosen from the group consisting of a human, a cow, a sheep, a pig, a horse, a fish and a culture of other animals (shrimps, lobster, bivalves).

8 . Pharmaceutical composition comprising an acidic cannabinoid as defined in one claims 1 - 3 or a plant extract according to claim 4 or 5 and an immunosuppressant. 9 . Pharmaceutical composition comprising an acidic cannabinoid as defined in any of claims 1 - 3 or a plant extract according to claim 4 or 5 and (5R)-5-hydroxytriptolyde.

10. An acidic cannabinoid as defined in one of claims 1 - 3 or a plant extract according to claim 4 or 5 for use in additional therapy of EAE.

11. Method to induce expression of Hsp70 in a cell by contacting the cell with an acidic cannabinoid as defined in any of claims 1- 3 or with a plant extract according to claim 4 or 5 .

INTERNATIONAL SEARCH REPORT

PCT/N L2012/050241

I NV . A61 K3 1/ 192 A6 1K3 1/352 A61 P3/1G A61P9/ 19 A61 P31/04 A61 K133/G0 ADD .

A61K

EPO- I nternal , BI OS I S, EMBASE , WPI Data

VERHOECKX K C M ET AL : " Unheated Cannab i s 1- 7 sati va extracts and i t s maj or compound THC-aci d have potenti al uno- mod l ati ng properti es not medi ated by CB 1 and CB2 receptor coup l ed pathways " , I NTERNATI ONA L I MMUNOPHARMACO LOGY , ELSEV I ER, AMSTERDAM , NL, vol . 6 , no . 4 , 1 Apri l 2006 ( 2006 -04-01 ) , pages 656-665 , XP024976809 , I SSN : 1567-5769 , D0 I : 1 . 1O16/J . I NT I MP . 2OQ5 . 1 . 02 [retri eved on 2006-04-01] abstract 1- 11 tabl e 1 page 664 , r i ght-hand col umn , l ast paragraph the whol e document

-/--

X I

13 J ul y 2012 01/08/2012

Co l l ura Al essandra INTERNATIONAL SEARCH REPORT International application No PCT/N L2O12/05O241

C(Continuation). DOCUMENTS CONSIDERED TO BE RELEVANT

Category" Citation of document, with indication, where appropriate, of the relevant passages Relevant to olaim No.

COMELLI F ET AL: " Benefi c i a l effects of a 1- 7 Cannabi s sat i v a extract treatment on d i abetes - i nduced neuropathy and oxi dati v e s r s s " PHYTOTH ERAPY RESEARCH 2009 JOHN WI LEY AND SONS LTD GBR LNKD - DO I : 10 . 1002/PTR . 2806 , vol . 23 , no . 12 , December 2009 (2009 - 12 ) , pages 1678- 1684 , XP002679919 , I SSN : 095 1-4 18X page 1679 , l eft-hand col umn , paragraph 4 1- 11 Di scus s i on

APPEND I N0 GI OVANN I ET AL : "Anti bacteri a l 1- 3 cannabi noi d s from Cannab i s sati v a : a structure-act i i t y study . " , JOU RNAL OF NATURAL PRODUCTS AUG 2008 L NKD- PUBMED : 18681481 , vol . 7 1 , no . 8 , August 2008 ( 2008 -08) , pages 1427- 1430 , XP002679920 , I SSN : 1520-6025 c i ted i n the appl i cati on Y the whol e document 1- 11 x MECH0U LAM R ET AL : " HASH I SH - I V T HE 1 , 2 I SO LATI ON AND STRUCTU RE OF CANNAB I O LI C CANNAB I DI 0LI C AND CANNAB I ER0 LI C ACI DS " , TETRAH ED RON , ELSEV I ER SC I ENC E PUB LI SH ERS , AMSTERDAM , NL , vol . 2 1 , 1 January 1965 ( 1965 -01 -01 ) , pages 1223- 1229 , XP009008207 , I SSN : 0040-4020 , DO I : 10 . 1016/0040 -4020 ( 65 ) 80064-3 abstract 1- 11

W0 2007/ 1052 10 A2 ( HADAS I T MED RES SERV I CE 1- 11 [ I L] ; YI SSUM RES DEV CO [ I L] ; WE I SS LO LA [ I L] ; ) 20 September 2007 (2007 -09 -20) c l a i ms 1 , 6 , 7

WEI SS L ET A L : " Cannabi d i o l l owers 1- 11 i nci dence of d i abetes i n non - obe se d i abeti c mi c e " , AUTOI MMUN I TY , I FO MA HEALTHCARE , GB , vol . 39 , no . 2 , 1 January 2006 (2006-01 -01) , page s 143 - 15 1 , XP009 115725 , I SSN : 089 1-6934 , DO I : 10 . 1080/089 16930500356674 the whol e document

-/-- INTERNATIONAL SEARCH REPORT International application No PCT/NL2O12/05O241

C(Continuation). DOCUMENTS CONSIDERED TO BE RELEVANT

Category" Citation of document, with indication, where appropriate, of the relevant passages Relevant to olaim No.

BUCCELLATO ELENA ET AL: "Acute and 1-11 chroni c cannabinoi d extracts admini stration affects motor function i n a CREAE model of mul tiple sclerosi s . " , JOURNAL OF ETHNOPHARMACOLOGY 16 FEB 2011 LNKD- PUBMED:21094240, vol . 133, no. 3 , 16 February 2011 (2011-02-16) , pages 1033-1038, ΧΡ0Θ2679921, ISSN: 1872-7573 page 1034, r i ght-hand col umn , paragraph 6-7 page 1035, r i ght-hand col umn , last paragraph INTERNATIONAL SEARCH REPORT International application No PCT/N L2012/050241

Patent document Publication Patent family Publication cited in search report date member(s) date

WO 2007 1052 10 A2 20-09 -2007 2007376 A2 31- 12 -2008 2010 158973 Al 24-06-20 10 2007 1052 10 A2 20-09 -2007