EYA1 Phosphatase Function Is Essential to Drive Breast Cancer Cell Proliferation Through Cyclin D1

Published OnlineFirst May 1, 2013; DOI: 10.1158/0008-5472.CAN-12-4078

Cancer Tumor and Stem Cell Biology Research

EYA1 Phosphatase Function Is Essential to Drive Breast Cancer Cell Proliferation through Cyclin D1

Kongming Wu1,2, Zhaoming Li1,3, Shaoxin Cai1,2, Lifeng Tian1, Ke Chen1,2, Jing Wang1, Junbo Hu3, Ye Sun4, Xue Li4, Adam Ertel1,2, and Richard G. Pestell1,2

Abstract The Drosophila Eyes Absent Homologue 1 (EYA1) is a component of the retinal determination gene network and serves as an H2AX phosphatase. The cyclin D1 gene encodes the regulatory subunits of a holoenzyme that phosphorylates and inactivates the pRb protein. Herein, comparison with normal breast showed that EYA1 is overexpressed with cyclin D1 in luminal B breast cancer subtype. EYA1 enhanced breast tumor growth in mice in vivo, requiring the phosphatase domain. EYA1 enhanced cellular proliferation, inhibited apoptosis, and induced contact-independent growth and cyclin D1 abundance. The induction of cellular proliferation and cyclin D1 abundance, but not apoptosis, was dependent upon the EYA1 phosphatase domain. The EYA1-mediated transcriptional induction of cyclin D1 occurred via the AP-1–binding site at 953 and required the EYA1 phosphatase function. The AP-1 mutation did not affect SIX1-dependent activation of cyclin D1. EYA1 was recruited in the context of local chromatin to the cyclin D1 AP-1 site. The EYA1 phosphatase function determined the recruitment of CBP, RNA polymerase II, and acetylation of H3K9 at the cyclin D1 gene AP-1 site regulatory region in the context of local chromatin. The EYA1 phosphatase regulates cell-cycle control via transcriptional complex formation at the cyclin D1 promoter. Cancer Res; 73(14); 1–12. 2013 AACR.

Introduction Altered expression or functional activity of the RDGN has The Drosophila Eyes Absent Homologue 1 (EYA1) is a com- been documented in a variety of malignancies. DACH1 expres- ponent of the retinal determination gene network (RDGN) sion is reduced in breast, prostate, endometrial, and brain – involved in organismal development (1, 2). The cell fate deter- cancer (2, 4 6). EYA2 is upregulated in ovarian cancer, pro- mination gene network includes the dachshund (dac), twin-of- moting tumor growth (7). EYA1 and EYA2 enhanced survival in – eyeless (toy), eye absent (eya), teashirt (tsh), and sine oculis (So). response to DNA damage producing agents in HEK293 cells b In Drosophila, mutations of the RDGN leads to failure of eye (8). Eya2 was required for Six1/TGF signals that govern a – formation, whereas forced expression induces ectopic eye prometastatic phenotype and epithelial mesenchymal transi- formation. EYA functions as a transcriptional co-activator tion (EMT; ref. 9). Although EYA proteins are expressed in being recruited in the context of local chromatin but lacking human breast cancer, the relationship to molecular genetic intrinsic DNA-binding activity. EYA family members EYA 1– subtype, prognosis, and the molecular mechanisms governing 4aredeﬁned by a 275-amino acid carboxyl-terminal motif contact-independent growth are not known. that is conserved between species, referred to as the EYA Previous studies have shown functional interactions domain (ED). The human homologs EYA 1–4arehighly between the RDGN and cell-cycle control proteins (2, 6). The conserved in their EYA domain and amino termini, with DACH1 protein inhibits breast cancer cellular metastasis via the exception of a small tyrosine rich residue region named the transcriptional repression of interleukin (IL)-8 (10). Breast – EYA domain II (3). tumor initiating cells (BTIC) are inhibited by endogenous DACH1 expression through binding to the promoter-regulatory regions of the Nanog and SOX2 genes (11). DACH1 was also shown to inhibit breast cancer cell proliferation via Authors' Afﬁliations: 1Department of Cancer Biology, 2Kimmel Cancer Center, Thomas Jefferson University, Philadelphia, Pennsylvania; 3Tongji repression of cyclin D1 (6). The cyclin D1 gene encodes the Hospital, Tongji Medical College, Huazhong University of Science and regulatory subunit of a holoenzyme that phosphorylates and Technology, Shanghai, PR China; and 4Boston Children's Hospital, Har- vard Medical School, Boston, Massachusetts inactivates the pRb protein, thereby promoting the DNA synthetic phase of the cell cycle. The maintenance of HER2- Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/). positive breast cancer tumor growth by HER2-positive cells requires cyclin D1 (12). Corresponding Authors: Richard G. Pestell, The Kimmel Cancer Center, Thomas Jefferson University, 233 South 10th Street, Philadelphia, PA The current studies were conducted to determine the 19107. Phone: 215-503-5692; Fax: 215-503-9334; E-mail: molecular mechanisms by which EYA1 promotes breast tumor [email protected] or [email protected] cellular growth. Herein, EYA1 expression in 2,154 breast cancer doi: 10.1158/0008-5472.CAN-12-4078 samples showed enrichment with cyclin D1 in luminal B breast 2013 American Association for Cancer Research. cancer expression. EYA1 induced contact-independent growth

www.aacrjournals.org OF1

Wu et al.

of breast cancer cell lines requiring its phosphatase function. Western blot EYA1 induced cyclin D1 expression via its phosphatase func- For Western blot analyses, cells were pelleted and lysed tion and was recruited to the cyclin D1 promoter AP-1 site. in buffer (50 mmol/L HEPES, pH 7.2, 150 mmol/L NaCl, 1 The EYA1 phosphatase function determined the induction of mmol/L EDTA, 1 mmol/L EGTA, 1 mmol/L dithiothreitol, cyclin D1 transcription and local histone acetylation and co- 0.1% Triton X100) supplemented with a protease inhibitor activator recruitment at the cyclin D1 promoter regulatory mixture (Roche Diagnostics). Antibodies used for immuno- region. precipitation and Western blotting are as follows: anti-FLAG (M2 clone, Sigma), anti-EYA1 (ab85009, Abcam), and antibo- Materials and Methods dies from Santa Cruz Biotechnology were cyclin D1(sc-20044), cyclin E1 (sc-481), CDC25B (sc-5619), b-catenin (sc-7963), p27 Cell culture (sc-7767), b-actin (sc-47778), and b-tubulin (sc-9104). For Human embryonic kidney 293T (HEK 293T) and breast cyclin D1 degradation assays, EYA1 wt or mutant stable cell cancer cell lines were maintained in SKBR3 (McCoy's 5A), lines (SKBR3 or MDA-MB-453) were treated with 50 mg/mL BT-474 and T47D (RPMI1640), and MDA-MB-231, MDA-MB- cycloheximide (CHX), and total protein was collected at 453, HBL100, HS578T, and MCF-7 (Dulbeccos' Modified Eagle sequential time points (15, 30, 60, 90, 120 minutes) for Western Media) containing 1% penicillin/streptomycin and supple- blot analysis. mented with 10% FBS. Chromatin immunoprecipitation assay Plasmids and short hairpin RNA Chromatin immunoprecipitation (ChIP) analysis was con- The mouse cDNA of EYA1 WT and EYA1 D327A phosphatase ducted following a previously described protocol (15). MDA- (EYA1 D327A) mutant were cloned into the p3 FLAG-CMV-10 MB-453 cells stably expressing 3FLAG-EYA1 or EYA1 D327A (Sigma-Aldrich) vector for transient transfection assays and or control vector were prepared using a ChIP assay kit (Upstate into the pCDF lentivirus expression vector to establish stable Chemicon) following the manufacturer's guidelines. Chroma- cell lines. The human cyclin D1 promoter luciferase reporter tin solutions were precipitated overnight with agitation at 4C was previously described (13). The short hairpin RNAs (shRNA) using 30 mL of agars with specific antibodies. For a negative for EYA1 were purchased from OpenBiosystems, using the control, mouse IgG was immunoprecipitated by incubating targeted sequences CCCACAAAGAATATAGATGAT and CGA- the supernatant fraction for 1 hour at 4C with rotation. CGGGTCTTTAAACAATTT. Precipitated DNAs were analyzed by PCR. The human cyclin D1 promoter–specific primers used were as follows: AP-1 site: Transfections, gene reporter assays, and EYA1 stable cell 50-GGCAGAGGGGACTAATATTTCCAGCA-30 and 50-GAATG- lines GAAAGCTGAGAAACAGTGATCTCC-30. Primers as negative DNA transfection and luciferase assays were conducted as control site were 50- TTTCGGAAGCGTTTTCCC-30and 50- previously described. Briefly, cells were seeded at 25% con- AGCGCGTTCATTCAGGAA-30. Antibodies used for IP were: fluence in 24-well plates the day before transfection. Cells anti-FLAG (M2 clone, Sigma), anti-CBP (sc-369, Santa Cruz), were transiently transfected with the appropriate combina- anti-acetyl Histone H3K9 (07–352, Millipore), and anti-Pol II tion of the reporter (0.5 mg per well), expression vectors (sc-9001, Santa Cruz). (calculated as molar concentration equal to 300 ng of control vector), and control vector (300 ng per well) via calcium Reverse transcription PCR and quantitative PCR phosphate precipitation for HEK293T or Lipofectamine 2000 Total RNA was prepared using TRIzol reagent (Invitrogen) (Invitrogen) for the remaining cell lines, according to the following the manufacturer's instructions. Five micrograms of manufacturer's instructions. Twenty-four hours after the total RNA was subjected to reverse transcription to synthesize transfection, luciferase assays were conducted at room cDNA using the SuperScript II Reverse Transcriptase Kit temperature using an Autolumat LB 953 (EG&G Berthold) (Invitrogen). A 25-mL volume reaction consisted of 1 mL reverse as previously described. Lentiviruses were prepared by tran- transcription product and 10 pmol/L of each primer. The sient co-transfections of plasmid DNA expressing EYA1 or primers used for reverse transcription (RT)-PCR of the EYA1 EYA1 D327A or the vector and packaging plasmids using that are isoform-specific corresponding to exon 9 to 11 (16) calcium phosphate precipitation. The lentiviral superna- were: 50-GTTCATCTGGGACTTGGA-30 and 50-GCTTAGGTCC- tants were harvested 48 hours after transfection and filtered TGTCCGTT-30, primers for cyclin D1 were: 50GTGCTGCGA- through a 0.45-mm filter. Human breast cancer cell line cells AGTGGAAACC-30 and 50- ATCCAGGTGGCGACGATCT-30, pri- were incubated with the lentiviral supernatants in the mers for GAPDH: 50-ATCTTCCAGGAGCGAGACCCC-30 and presence of 8 mg/mL polybrene for 24 hours, cultured for 50-TCCACAATGCCAAAGTTGTCATGG-30. a further 48 hours, and subjected to fluorescence-activated cell sorting (FACS; FACStar Plus; BD Biosciences) to select Mammosphere formation and animal studies for cells expressing GFP. GFP-positive cells were used for Mammosphere formation assays were conducted as subsequent analysis. The cyclin D1 promoter mutant lucif- described previously (17). Five- to 6-week-old female NOD/ erase reporter genes were previously described (14). The SCID mice were purchased from NCI-Frederick and main- cyclin D1 AP-1 site at 953 TGACTCAT TTT was mutated to tained in the transgenic mouse facility. Ten mice in each group TGgCgCAT TTT. were subcutaneously injected with 3 106 MDA-MB-453 cells

OF2 Cancer Res; 73(14) July 15, 2013 Cancer Research

Phosphatase Function of the EYA1 in Breast Cancer

in 0.1 mL PBS with 10% Matrigel. Tumor size was monitored Results twice a week for 8 weeks, and tumor weight was measured at Endogenous EYA maintains cyclin D1 levels in breast the end of the experiment. cancer cells The molecular genetic subtypes of human breast cancer cell Cell proliferation and apoptosis assays lines also include luminal A, luminal B, basal, ErbB2, and For the MTT assay, cells infected with PCDF, PCDF-Flag- claudin-low (19, 20). To determine the relative abundance of EYA1, or PCDF-Flag-EYA1 D327A were seeded into 96-well EYA1 in breast cancer cell lines, a series of breast cancer cell plates in normal growth medium, and cell growth was lines including representative examples of these subtypes was measured every day by MTT assay. To measure the growth examined. Quantitative RT-PCR primers were deployed that are curve, cells were seeded into 12-well plates and serially specific for the EYA1 isoform. The relative abundance of EYA1 counted for 6 to 7 days. Tritiated thymidine incorporation compared with the loading control glyceraldehyde-3-phos- was conducted as previously described as an assay of cell phate dehydrogenase (GAPDH) was higher in claudin-low proliferation (6). For bromodeoxyuridine (BrdUrd) staining, (MDA-MB-231 and HS578T), luminal B (BT-474), and ErbB2 m cells were labeled with 100 mol/LBrdUrdfor1hourin positive (MDA-MB-453 and SKBR3) cells (Fig. 1A). The gene regular culture medium, then washed 3 times with PBS, expression profile of the MDA-MB-231 cells are considered a fi xed in 3.7% formaldehyde/PBS for 10 minutes, treated with claudin-low subtype, the MDA-MB-453 and SKBR3 as a Her2 4N HCL/1% Triton-X100 for 10 minutes, washed 3 times subtype, and BT-474 are considered luminal B subtype in with 0.1% NP-40/PBS; incubated with mouse anti-BrdU expression profile (20, 21). Western blot analysis showed similar (B8434, Sigma) at 1:1,000 for 2 hours at room temperature trends in protein relative abundance as found with the mRNA and stained with goat anti-mouse AlexaFluor 568 at 1:1,000 level in each cell line (inset, Fig. 1A; Supplementary Fig. S1). after washing. Ten thousand cells were analyzed by BD The increased abundance of EYA1 in MDA-MB-231 cells FACScan. Apoptotic cells were measured using BD Phar- provided an opportunity to determine the function of EYA1 mingen PE Annexin V apoptosis Kit following standard using shRNA. DNA synthesis evaluated by tritiated thymidine protocol. incorporation was reduced 40% using 2 separate shRNA (Fig. 1B). Cellular proliferation, assessed by either cell counting or Colony formation assay MTT activity, was reduced about 80% (Fig. 1C and D). We 3 For contact-independent growth (soft agar), cells (4.0 10 ) examined the role of endogenous EYA1 in maintaining the were plated in triplicate in 2 mL of 0.3% agarose (sea plaque) abundance of endogenous cell-cycle–related protein expres- in complete growth medium overlaid on a 0.5% agarose sion. EYA1 shRNA reduced EYA1 abundance by about 90%, base, also in complete growth medium. Two weeks after without altering the cyclin E levels in both MDA-MB-231 and > m incubation, colonies 50 m in diameter were counted using BT-474 (Fig. 1E). CDC25B abundance was reduced by about an Omnicom 3600 image analysis system. For contact-depen- 25%. However, cyclin D1 abundance was reduced by about 70% 3 dent growth, 2.0 10 cells were plated in 6-well plates in (Fig. 1E). EYA1 shRNA reduced EYA1 and cyclin D1 mRNA triplicate in 2 mL of complete growth medium for 2 weeks. The levels by about 90% (Supplementary Fig. S2). The reduction in medium was changed every 4 days. The colonies were visual- cyclin D1 abundance and subsequent reduction in cell prolif- ized after staining with 0.04% crystal violet in methanol for 1 to – eration are in agreement with the previous report that the G1 S 2 hours. cell-cycle transition and proliferation of human breast cancer cells are dependent upon the abundance of cyclin D1 (22). To Analysis of public breast cancer microarray datasets analyze the co-expression of cyclin D1 and EYA1 in human A breast cancer microarray dataset that was previously breast cancer, we used a collection of 2,152 breast tumor compiled from the public repositories Gene Expression Omni- samples (15). We stratified the samples into 5 molecular bus and ArrayExpress was used to evaluate co-expression of subtypes including luminal A, luminal B, basal, normal-like, cyclin D1 and EYA1. This microarray dataset includes 102 and Her2-overexpressing. Compared with normal breast tissue healthy breast and 2,152 breast tumor samples, and tumor (Fig. 1F) and all breast cancers (Fig. 1G), significant enrichment fi samples were classi ed into 5 molecular subtypes as previously for cyclin D1 and EYA1 co-expression was identified in the described (15, 18). luminal B subtype (P < 1 10 15; Fig. 1H). Kaplan–Meier The relationship between CCND1 and EYA1 was explored survival analysis revealed that co-expression of cyclin D1 and within each of the 5 subtypes by comparing EYA1 expression EYA1 have a negative impact on recurrence-free survival time against CCND1 RNA expression using 2-dimensional (2D) (P ¼ 0.035; Fig. 1I). There was no significant independent scatter plots with 4 quadrants. EYA1 expression was centered relapse-free survival significance of either cyclin D1 or EYA1 around its median expression in healthy breast, whereas alone in patients with luminal B breast cancer. CCND1 expression was centered around its median expression across all breast samples. Within each subtype, the distribution of samples among the 4 quadrants around x ¼ 0 and y ¼ 0 was The EYA1 phosphatase domain is required for the quantified and significance was assessed using a c2 test. induction of breast cancer cell contact–independent Kaplan–Meier curves and the Log-rank test P value was used growth to evaluate survival differences for co-expression profiles To examine further the functional significance of EYA1 among the 4 quadrants. in breast cancer cellular proliferation, the human BT-474,

www.aacrjournals.org Cancer Res; 73(14) July 15, 2013 OF3

Wu et al.

A B C 5 25 25 MDA-MB-231 4.5 α EYA1 MDA-MB-231 shCTL 4 α Actin 20 ∗ 20 shEYA1-B4 3.5 shEYA1-B7 100)

3 × 15 15 ∗ 2.5 2 10 10 1.5 TdR (CPM,

1 Relative cell number 5 3 5

0.5 H 0 0

EYA1 mRNA relative abundance 0 B7B4 54321 T47D shCTL Days BT474 MCF-7 HBL100 HS578T SKBR3 shEYA1

MDA-MB-231 MDA-MB-453

D E shRNA CTL B4 B7 F 25 αEYA1 Healthy MDA-MB-231 αCyclin D1 2 shCTL 20 1.5 shEYA1-B4 αCdc25B 1 49 2 shEYA1-B7 αCyclin E 15 0.5

MDA-MB-231 αβ-Tubulin ∗ 0 10 shRNA CTLB4 B7 –0.5 35 16 αEYA1 –1 5 α EYA1 Normalized –1.5 Relative MTT activity Relative MTT Cyclin D1 α –2 Cdc25B –2 –1 0 1 2 0 BT-474 α 54321 CyclinE Normalized cyclin D1 Days αβ-Tubulin G H I All Five Subtypes Luminal B 1 2 2 P = 0.035 -15 1.5 1.5 P < 10 397 331 0.8 1 1 19 109 0.5 0.5 0.6 0 0 0.4 –0.5 252 186 –0.5 –1 –1 10 62 0.2 Survival probability Normalized EYA1 Normalized Normalized EYA1 Normalized –1.5 –1.5 upper right all others –2 –2 0 –2 –1 0 1 2 –2 –1 0 1 2 0 2 4 6 8 10 Normalized cyclin D1 Normalized cyclin D1 Relapse-free survival (yrs)

Figure 1. Endogenous EYA maintains breast tumor cellular growth and cyclin D1 abundance. A, qRT-PCR analysis for EYA1 mRNA levels normalized to GAPDH in a series of breast cancer cell lines. Inset, corresponding Western blotting of the breast cancer cell lines, with the protein loading control b-actin. B, tritiated thymidine incorporation of EYA1 shRNA–transduced MDA-MB-231 cells with data shown as mean SEM of 3 separate experiments. C and D, cellular proliferation assays of MDA-MB-231 cell transduced with 2 distinct shRNAs to EYA1 show either cell number (C) or MTT activity (D), with the data shown as mean SEM for n equals 5 separate experiments. E, MDA-MB-231 and BT-474 cells transduced with EYA1 shRNA were subjected to Western blot analysis for the relative abundance of cell-cycle control proteins using antibodies as indicated. F, normalized expression of EYA1 and cyclin D1 in 102 healthy breast tissues. G and H, relative expression of EYA1 and cyclin D1 in all 5 type breast cancer (G) or luminal B (H) subtype. I, Kaplan– Meier survival curve analysis comparing high cyclin D1/high EYA1 (top right) with all other breast cancers. Outcome by relapse-free survival is worse for high EYA1/high cyclin D1 breast cancers.

MDA-MB-453, and SKBR3 breast cancer cell lines were trans- Cellular proliferation assessed by cell counting showed a duced with a lentiviral vector encoding either EYA1 or a 40% increase in proliferation by EYA1 (Fig. 2B). No prolifera- phosphatase-defective mutant (EYA1 D327A). Lentiviral trans- tive advantage was observed in phosphatase-defective EYA1 duction of the BT-474 cells with the expression vector result- D327A–transduced cells, which reduced cell number com- ed in green ﬂuorescence of the transduced cells (Fig. 2A). pared with vector control (Fig. 2B). Colony formation assays

OF4 Cancer Res; 73(14) July 15, 2013 Cancer Research

Phosphatase Function of the EYA1 in Breast Cancer

A BT-474 B 20 Vector EYA1 D327A 18 BT-474 16 Vector 14 EYA1 ∗ D327A Phase 12 10 ∗ P < 0.01 ∗ 8 6 4 GFP 2

Fold changes of cell number Fold 0 7654321 Days after seeding Figure 2. The phosphatase function of EYA1 is required for the induction of contact-independent C D 20 40 BT-474 – BT-474 breast tumor growth. A D, BT-474 ) Vector 2 35 Vector cells transduced with an P < 0.001 µm 30 P < 0.001 15 expression vector encoding either 3

EYA1 or a phosphatase dead 10 25 × mutant (EYA1 D327A) with an EYA1 20 EYA1 10 IRES-GFP were assessed by phase contrast microscopy (A) or 15 cellular proliferation by counting 10 5 (B), growth in soft agar (C) or Colony number per well D327A Colony size ( 5 D327A colony formation assays (D) of 0 0 contact-dependent growth in Vector EYA1 D327A Vector EYA1 D327A tissue culture, where the data shown are colony number per well, E F as mean SEM for 5 separate MDA-MB-453 7 Vector MDA-MB-453 experiments. MDA-MB-453 cells Vector EYA1 D327A EYA1 6 D327A expressing EYA1 or EYA1 D327A 5 were assessed by phase contrast Phase microscopy (E), cell proliferation 4 using the MTT assay (F), colony 3 number in contact-dependent culture (G), or the number of 2

colonies in soft agar (H). The data GFP activity Relative MTT 1 are shown as mean SEM for 5 0 separate experiments. 1 65432 G H Days after seeding 120 Vector 100 MDA-MB-453 MDA-MB-453 Vector 105 90 P < 0.01 P < 0.01 80 P < 0.01 P < 0.01 90 70 75 EYA1 60 EYA1 60 50 45 40 30 30 D3297A 15 20 Colony number Colony number per well D327A Colony number per well 10 0 0 Vector EYA1 D327A Vector EYA1 D327A

in contact-dependent growth showed a 3-fold increase in the Cyclin D1 is required by EYA1-induced breast tumor number of colonies that was dependent upon the EYA1 phos- colony formation, cellular proliferation, and phatase activity (Fig. 2C). Contact-independent growth in soft mammosphere formation agar showed a similar 3-fold induction in colony number by To determine whether cyclin D1 was required for pro- EYA1 that was dependent on the phosphatase domain (Fig. liferation induced by EYA1, cells were transduced with 2D). The human MDA-MB-453 breast cancer cell line showed a the EYA1 expression vector and shRNA to cyclin D1 or a similar increase in proliferation assessed by MTT assay and control shRNA. Cyclin D1 levels were reduced by cyclin D1 increase in colony formation in the presence of EYA1 that was shRNA (Fig. 3A), associated with a reduction in EYA1- reduced by mutation of the EYA1 phosphatase domain (Fig. dependent cellular proliferation from 10- to 4-fold (Fig. 3B 2E–H). In addition, phosphatase-dependent stimulation of and C). In addition, the EYA1-mediated induction of cellular growth and colony formation was also observed in colony formation was abrogated by cyclin D1 shRNA (Fig. the SKBR3 breast cancer cell line (Supplementary Fig. S3). 3D).

www.aacrjournals.org Cancer Res; 73(14) July 15, 2013 OF5

Wu et al.

AB12 SKBR3 10 Vector-shCTL Vector EYA1 Vector-shCD1 ∗ shRNA CTL CD1 CTL CD1 8 EYA1-shCTL EYA1-shCD1 αFlag (EYA1) 6 Figure 3. EYA1-dependent induction of breast cancer cell αCyclin D1 4 # proliferation and mammosphere αβ-Actin 2 ∗ P < 0.01 formation is cyclin D1–dependent. # P > 0.05 A, Western blot analysis of SKBR3 − − − − − − −

Cell number fold change 0 21 3 7654 cells transduced with either on EYA1 expression vector and/or Days after seeding shRNA to cyclin D1. Antibodies C 12 D were directed either to the FLAG SKBR3 shCTL shCD1 10 Vector-shCTL epitope of EYA1 or to endogenous Vector-shCD1 ∗ cyclin D1. B, cellular proliferation 8 EYA1-shCTL Vector determined by cell counting of EYA1-shCD1 SKBR3 cells expressing EYA1, 6 # with or without, shRNA to cyclin 4 D1. Analysis was also conducted ∗ P < 0.01 by MTT assay (C) as a surrogate 2 # P > 0.05 EYA1 measure of cellular proliferation or Relative MTT activity Relative MTT − − − − − − 0 − colony formation assays (D). 7654321 E, mammosphere assays were Days conducted with cells transduced E F with either EYA1 or the EYA1 40 SKBR3 shCTL shCD1 D327A. The numbers of 20 SKBR3 35 mammospheres are shown. F, P < 0.01 17.5 30 P < 0.01 cells transduced with shRNA to 15 P < 0.01 P < 0.01 cyclin D1 show a reduction in the 25 12.5 number of mammospheres in 20 10 EYA10-overexpressing cells. 15 7.5 10 5 2.5 5 Number ofmammosphere

Number of mammosphere of Number 0 0 Vector EYA1 D327A Vector EYA1

As SKBR3 colony number and size were increased by EYA1, Annexin V staining and BrdUrd incorporation were conducted. we considered the possibility that EYA1 may contribute to Both EYA1 wt and the phosphatase mutant signiﬁcantly enhancing BTIC. As a surrogate of BTIC, we conducted mam- inhibited apoptosis (Fig. 5B); however, stimulation of DNA mosphere assays as previously described (10, 23), assessing the synthesis by EYA1 depended on its phosphatase activity (Fig. number and size of the mammospheres. Expression of EYA1 5C and D). To measure the in vivo growth-promoting function enhanced mammosphere number, which was abrogated by of EYA1, MDA-MB-453 cells stably expressing EYA1 were mutation of the EYA1 phosphatase domain (Fig. 3E). Cyclin D1 injected subcutaneously into immunodeﬁcient mouse. shRNA reduced the number of mammospheres formed in the MDA-MB-453 tumor growth was dramatically increased by basal state (Fig. 3F) and completely abrogated EYA1-mediated EYA1 as determined by tumor volume (Fig. 5E) and tumor induction of mammosphere formation (Fig. 3F). weight (Fig. 5F and G). The stable expression of the EYA1 In MDA-MB-453 cells, cyclin D1 shRNA reduced cyclin D1 phosphatase–defective mutant showed reduced cell growth in abundance induced by EYA1 (Fig. 4A) and reduced cellular vivo by volume and tumor weight (Fig. 5E and F). proliferation as assessed by growth curve, MTT assay, or colony formation assays (Fig. 4B–D). EYA1 induction of cyclin D1 requires the EYA phosphatase activity EYA1 induced DNA synthesis but not apoptosis is Given the requirement for cyclin D1 in EYA1-mediated dependent upon the EYA1 phosphatase domain– growth, we determined the mechanism by which EYA1 determined growth ability induced cyclin D1 abundance. Western blot analysis was Cell growth, evaluated by counting cell number daily, conducted. The amino-terminal epitope of the EYA1 protein showed that EYA1 enhanced proliferation. The EYA1 phos- (Fig. 6A) was recognized by the FLAG antibody, showing phatase–defective mutant failed to induce cell proliferation similar levels of expression for EYA1 and EYA1 D327A (Fig. and showed reduced cell proliferation (Fig. 5A). To further 6A). The relative abundance of cyclin D1 was induced 5-fold distinguish the effect of EYA1 on apoptosis and proliferation, by EYA1, which was reduced (60%) by mutation of the

OF6 Cancer Res; 73(14) July 15, 2013 Cancer Research

Phosphatase Function of the EYA1 in Breast Cancer

A B 14 MDA-MB-453 12 Vector EYA1 Vector-shCTL Vector-shCD1 shRNA CTL CD1 CTL CD1 10 ∗ α EYA1-shCTL Flag (EYA1) 8 EYA1-shCD1 Figure 4. EYA-induced MDA-MB- α 6 – Cyclin D1 453 cell growth is cyclin D1 4 # dependent. A, Western blot αβ-Actin analysis of MDA-MB-453 cells 2 ∗P < 0.01 # P > 0.05 − − − − − − − overexpressing EYA1 with either change fold Cell number 0 control or cyclin D1 shRNA. 654321 7 B and C, cellular growth assays Days after seeding determined by cellular counting C 7 D (B) or by MTT assay (C). MDA-MB-453 shCTL shCD1 D, representative examples of 6 Vector-shCTL MDA-MB-453 colony formation in 5 Vector-shCD1 ∗ cells stably expressing EYA1 with EYA1-shCTL Vector 4 either control or shCyclin D1. EYA1-shCD1 3 2 1 ∗P < 0.01 EYA1 Relative MTT activity Relative MTT − − − − 0 − − 654321 Days after seeding

phosphatase domain after normalization for the relative abun- did not affect SIX1-dependent activation (Fig. 7C). Phospha- dance of EYA1 protein by Western blotting. The relative tase-dependent activation of the cyclin D1 promoter by EYA1 abundance of cyclin D1 was induced without changes in the at the AP-1 site was also observed in SKBR3 and MDA-MB-453 relative abundance of cyclin A, p27KIP1,orb-catenin protein cell lines (Fig. 7D and E). This finding indicates that EYA1 and (Fig. 6A). To determine the mechanisms by which EYA1 SIX1 regulate the cyclin D1 promoter through distinct ele- induced cyclin D1 abundance, analysis was conducted of cyclin ments. These findings do not however exclude a potential role D1 protein levels in the presence of the protein synthesis for Six1 in EYA1-dependent induction of cellular proliferation. inhibitor cycloheximide (Fig. 6B). Confirmed by quantitative ChIP showed the recruitment of EYA1 to the CRE/AP-1 site of analysis of multiple experiments, no significant change in the the cyclin D1 promoter at 953. Recruitment of EYA1 occurred relative abundance of cyclin D1 mRNA stability occurred when in a phosphatase-dependent manner (Fig. 7F). In contrast, EYA1 and the control empty vector was compared (Fig. 6C). there was no recruitment of EYA1 to negative control Cyclin D1 mRNA abundance determined by quantitative RT- sequences located at 1,500 (data not shown). Next, we PCR was increased 5-fold by EYA1 (Fig. 6D). The induction of examined the potential role of EYA1 in regulating the recruit- cyclin D1 mRNA by EYA1 was dependent upon the EYA1 ment of transcriptional co-regulators in the context of local phosphatase function (Fig. 6E). Similar results were observed chromatin. Expression of EYA1 enhanced the recruitment of in MDA-MB-453 cells (Fig. 6F–H). CBP and RNA polymerase II (Fig. 7G) and increased the acetylation of Histone3 [H3K9] (Fig. 7H), consistent with transcriptionally active chromatin (Fig. 7G). EYA1 induces the cyclin D1 promoter via the AP-1 site at 953, recruiting co-integrators in a phosphatase- dependent manner Discussion To determine whether EYA1 directly activated the cyclin D1 The current studies show that EYA1 enhances breast cancer promoter, luciferase reporter assays were conducted (Fig. 7A). cellular proliferation both in tissue culture and in vivo. EYA1 The cyclin D1 promoter was induced 4-fold by EYA1 in a enhanced growth via increased cellular proliferation and DNA phosphatase-dependent manner. Point mutation of the AP-1 synthesis. The induction of cellular proliferation by EYA1 in site at 953 reduced EYA1-dependent induction (Fig. 7B). In BT-474, SKBR3, and MDA-MB-453 cells was dependent upon Drosophila, eya and so form part of a common signaling the phosphatase function, and the induction of breast tumor pathway. Six1 is known to induce the cyclin D1 promoter growth in vivo required the phosphatase domain. EYA1 also (24). To determine whether SIX1 regulates the cyclin D1 reduced apoptosis as determined by Annexin V–positive cells; promoter through the EYA1 cis-response element, co-trans- however, the inhibition of apoptosis by EYA1 was independent fection experiments were carried out in several cell types (Fig. of the phosphatase domain. These findings suggest EYA1 7C–E). In HEK293 cells, SIX1 induced the cyclin D1 promoter; promotes breast tumor growth through both phosphatase- however, mutation of the EYA1-responsive AP-1 site at 953 dependent and -independent mechanisms. These studies

www.aacrjournals.org Cancer Res; 73(14) July 15, 2013 OF7

Wu et al.

A 18 B 7 C 15 MDA-MB-453 16 MDA-MB-453 MDA-MB-453 Vector 6 12.5 ∗ 14 EYA1 ∗ ∗ ) 5 D327A ∗ 5 P < 0.01 10 12 10 × 10 4 ∗P < 0.01 7.5 8 3 6 5

Cell number ( Cell number 4 2 % BrdUrd-positive cells % BrdUrd-positive 2.5 2 cells % Annexin-V–positive 1 ∗ P < 0.01 0 0 0 654321 Days after seeding Vector EYA1 D327A Vector EYA1 D327A D Vector EYA1 D327A

S-phase S-phase S-phase 4.64% 9.36% 6.47% BrdUrd Intensity

PI Intensity

E F Vector EYA1 D327A G 120 300 MDA-MB-453 MDA-MB-453

100 Vector ∗ 250 P < 0.001 P < 0.001 )

3 EYA1 N = 10 80 200 D327A ∗ 60 150

40 100 Tumor size (mm Tumor Tumor weight (mg) Tumor 20 50

0 7654321 0 Vector EYA1 D327A Weeks after implantation

Figure 5. Enhanced DNA synthesis and tumor growth depend upon the phosphatase domain. A–C, growth curve (A) of MDA-MB-453 cells expressing either EYA1 or the phosphatase mutant D327A shown as days after plating with percentage of cells positive for Annexin V (B) or BrdUrd staining (C) shown as mean SEM. D, example of FACS illustrating the proportion of cells in the S-phase. Comparison is shown of cells expressing EYA1 of the EYA1 D327A mutant. E and F, the size of the breast tumors (E) in nude mice with examples of extirpated tumors (F) comparing vector versus EYA1 or EYA1 D327A expression vector. G, tumor weight shown as mean SEM for n ¼ 10 separate tumors for each genotype (vector, EYA1, EYA1 D237A).

contrast with the ﬁndings in the developing kidney of Eya / phosphate (Y142), under hypoxic conditions or under circum- mouse embryos in which increased apoptosis correlated with stances of DNA damage. The EYA1 effect was dependent upon increased H2AX Ser139 phosphorylation (8). Tyrosine dephos- increased ATM/ATR activity. It is likely that the ability of the phorylation of H2AX is thought to modulate apoptosis, through EYA1 phosphatase function to regulate apoptosis may depend dephosphorylation of an H2AX carboxyl-terminal tyrosine upon the ATM/ATR activity and relative tumor hypoxia.

OF8 Cancer Res; 73(14) July 15, 2013 Cancer Research

Phosphatase Function of the EYA1 in Breast Cancer

A B SKBR3 SKBR3 Vector EYA1 D327A αFlag (EYA1) Vector EYA1 αCyclin D1 CHX 0 3015 9060 120 0 15 30 60 90 120 αCyclin A αFlag(EYA1) α KIP1 p27 αCyclin D1 αβ-Catenin Figure 6. EYA1 induces cyclin D1 αβ-Actin αβ-Actin protein and mRNA abundance. A, Western blot analysis of SKBR3 C D cells transduced with vectors 1.2 Vector EYA1 D327A encoding either EYA1 or EYA1 SKBR3 1 2 3 1 2 3 1 2 3 1 Vector D327A. B, Western blot analysis of EYA1 0.8 EYA1 EYA or vector control SKBR3 cells treated with cycloheximide 0.6 Cyclin D1 showing cyclin D1 abundance is 0.4 GAPDH increased by EYA1. C, changes in cyclin D1 protein levels after 0.2 − − cycloheximide treatment. Data are 0 − − − − n ¼ 0 12090603015

mean SEM of 3. D, mRNA abundance Relative cyclin D1 levels of EYA1 or cyclin D1 Time (min) determined by qRT-PCR in SKBR3 stable lines. E, quantization of E 8 F SKBR3 Vector MDA-MB-453 mRNA shown as mean SEM of 7 EYA1 Vector EYA1 D327A n ¼ 3 separate experiments. F, 6 D327A αFlag (EYA1) Western blot analysis of MDA-MB- 5 αEYA1 453 cells expressing either EYA1 4 αCyclin D1 or EYA1 D327A shows the 3 αβ-Catenin induction of cyclin D1 abundance 2 αβ-Actin is dependent upon the EYA 1 Fold of EYA1 mRNA phosphatase domain. G, cyclin D1 0 EYA1 CyclinD1 protein levels upon cycloheximide treatment with the quantization 1.2 G H shown in H as mean SEM of MDA-MB-453 n > 1.0 3 separate experiments. MDA-MB-453 Vector EYA1 Vector EYA1 0.8 120 9060 3015 0 CHX 0 3015 9060 120 0 15 30 60 90 120 0.6 αFlag (EYA1) 0.4 αCyclin D1 0.2 − − αβ-Actin 0 − − − − 0 15 30 60 90 120 Relative cyclin D1 abundance Relative cyclin D1 Time (min)

To determine the mechanism by which EYA1 enhanced igenesis. The current studies extend our understanding of breast cancer cellular proliferation, we considered the cyclin the requirement for cyclin D1 in breast tumor proliferation genes as potential targets of EYA1-induced breast tumor by showing that cyclin D1 is required for EYA1-induced breast cellular proliferation. We considered targets of the cell cycle tumor growth. The studies do not exclude the possibility that in which the induction of the gene expression was dependent other genes may be induced by EYA1, which may also con- upon the EYA1 phosphatase domain. The abundance of cyclin tribute to EYA1-induced breast tumor growth. Furthermore, D1, but not cyclin E or CBC25A, was induced by EYA1, the ability of EYA1 to induce proliferation of breast cancer cells suggesting that cyclin D1 was a target of EYA1 induced cellular may depend upon the oncogenic drivers or the breast cell lines proliferation. Cyclin D1 shRNA showed the requirement for or tumor. In this regard, the EYA1 phosphatase function was cyclin D1 in EYA1-dependent breast cancer cellular prolifer- not required for the induction of cell proliferation assessed ation. These findings are consistent with evidence that cyclin using the WST assays in MCF-7 cells, a cell type in which the D1 antisense reduces ErbB2-induced mammary tumorigenesis cyclin D1 gene product is overexpressed through amplifica- in mice (12) and findings that breast tumor progression of tion (27). MMTV-Ras or MMTV-ErbB2 transgenics is reduced in cyclin The abundance of cyclin D1 is regulated through distinct D1 / mice (25). Cyclin D1 however is not required for the mechanisms, including posttranslational modification by induction of mammary tumors induced by either the activated phosphorylation and the induction of mRNA and/or gene b-catenin or c-Myc oncogenic pathways in vivo (25, 26), show- transcription. In the current studies, EYA1 induced cyclin ing oncogene-specific roles for cyclin D1 in mammary tumor- D1 mRNA transcription, as shown by cycloheximide mRNA

www.aacrjournals.org Cancer Res; 73(14) July 15, 2013 OF9

Wu et al.

A –1,745 Cyclin D1 1 B 3.0 LUC 5 HEK293 AP-1 TCF CRE HEK293 2.5 –1745 LUC 4 AP-1 TCF CRE 2.0 –1,745CRE x LUC 3 AP-1 TCF CRE 1.5 –1,745AP-1/CRE xx LUC 2 AP-1 TCF CRE 1.0 –963 LUC Fold changes 1 AP-1 TCF CRE Fold change by EYA1 0.5 –963AP-1 xx LUC

cyclin D1 promoter activity 0 0 EYA1 – + ++ +++ –– – – ––– –963 D327A + ++ +++ PA3Luc–1,745 –963AP-1 –1,745CRE C D –1,745AP-1/CRE E 4.5 7 4.5 HEK293 SKBR3 –1,745 MDA-MB-453 –1,745 4.0 4.0 6 –963 –963 3.5 –963AP-1 3.5 –963AP-1 5 3.0 3.0 4 2.5 2.5 2.0 3 2.0 1.5 1.5 2 1.0 1.0 Relative luciferase activity Relative luciferase activity Relative activation by SIX1 by Relative activation 1 0.5 0.5 0 0 0 EYA1 –+––+––+– EYA1 –+––+––+– –963 D327A –+– –+– –+– D327A –+–– –+––+ PA3Luc–1,745 –963AP-1 –1,745AP-1 F Negative AP-1 site G Negative AP-1 site H Negative AP-1 site –2,948 –955 –2,948 –955 –2,948 –955 –2,657 –862 –2,657 –862 –2,657 –862 12 16 1,000 MDA-MB-453 14 MDA-MB-453 MDA-MB-453 10 Vector Vector Vector 12 800 EYA1 EYA1 EYA1 8 10 D327A D327A 600 D327A 6 8 6 400 4 Fold enrichment Fold enrichment 4 Fold enrichment 2 200 2 0 0 0 IgG Flag IgG CBP RNA Pol II IgG Acetyl-H3K9

Figure 7. EYA1 induction of cyclin D1 promoter activity via the AP-1 site requires the EYA1 phosphatase function. A and B, cyclin D1 promoter reporter activity (A) in cells transfected with either EYA1 or the EYA1 D327A mutant with relative induction (B) of the mutant reporters shown as mean SEM of n > 5 separate experiments. C–E, luciferase reporter assays of cyclin D1 promoter fragments, assessed in the presence of cotransfected expression vectors for SIX1 in HEK293 (C), for EYA1 or EYA1 D327A in SKBR3 (D) and MDA-MB-453 (E). The data are mean SEM of n ¼ 5 separate transfection. F–H, ChIP assays of MDA-MB-453 cells transduced with either EYA1 or EYA1 D327A. Recruitment of EYA1 (FLAG), CBP, RNA polymerase II, or acetyl-H3K9 is shown as mean SEM for 3 separate experiments. The fold change in recruitment of proteins to the cyclin D1 AP-1 site is shown.

stability studies. The induction of cyclin D1 mRNA and pro- AP-1 site of the cyclin D1 promoter 953 does not affect the moter activity by EYA1 was dependent upon the EYA1 phos- SIX1-binding sites located 30 at 919 and 614 of the murine phatase function. Mutational analysis showed a requirement cyclin D1 promoter (24) and did not affect transactivation by for the AP-1/CRE transcription factor–binding sites, and point SIX1 expression in reporter genes assays (Fig. 7C). These mutation at the AP-1 site abrogated EYA1 induced transcrip- ﬁndings suggest that SIX1 and EYA1 components of the RDGN tional induction of the cyclin D1 promoter. The mutation of the function induce a common gene target through distinct cis

OF10 Cancer Res; 73(14) July 15, 2013 Cancer Research

Phosphatase Function of the EYA1 in Breast Cancer

elements. Using c-fos / /fos B / , the AP-1 site was shown to Herein, the induction of mammosphere formation by EYA1 serve as a site of convergence between serum stimulation and was dependent upon the phosphatase domain. The mecha- cell-cycle progression (28), and the AP-1 site was previously nism by which EYA1 promotes BTSC expansion may include identified as a key site involved in the gene induction of cyclin the ability of EYA1 to be recruited to AP-1 sites as the AP-1 D1 expression by oncogenic Ras (14). transcription factor, c-Jun, is known to promote BTSC expan- ChIP assays showed the recruitment of EYA1 to the cyclin D1 sion (17). Alternately, previous studies had identified physical AP-1 site and no recruitment of EYA1 to distinct cyclin D1 interaction between DACH1 and EYA1. DACH1 is known to sequences unrelated to the AP-1 site. The combinatorial occupy the promoters of several stem cell regulatory genes patterns of histone modification at active genes are complex including Sox, Oct, and Nanog (10). The current studies raise (29); however, we chose H3K9 acetylation (H3K9), as regions the possibility that EYA1 may be recruited by a DACH/EYA1 enriched with H3 acetylation are often found to be enhancers complex to the genes associated with the induction of tumor (30). Measurements of transcriptionally active chromatin, in initiating cells that may in turn contribute to the progression of particular acetylated H3K9, showed increased H3K9 acetyla- tumorigenesis. tion in the presence of EYA1. A significant reduction in recruitment of the phosphatase-defective EYA1 mutant was Disclosure of Potential Conflicts of Interest associated with the reduced recruitment of H3K9 to the cyclin R.G. Pestell holds ownership interests in and serves as Founder of the D1 AP-1 site. The defect in recruitment to local chromatin of biopharmaceutical companies ProstaGene, LLC and AAA Phoenix, Inc. R.G. the EYA1 phosphatase mutant suggests that EYA1 dephos- Pestell additionally holds ownership interests (value unknown) for several submitted patent applications. No potential conflicts of interest were disclosed phorylation contributes actively to the chromatin interaction. by the other authors. Other phosphatases are known to interact with and regulate local chromatin structures including PP4, PP2A, PP6, Wip1, GLC7 (PP1 homology in Saccharomyces cerevisiae), and Rep- Authors' Contributions Conception and design: K. Wu, R.G. Pestell Man-PP1. Repo-Man-PP1 is a phosphatase complex that reg- Development of methodology: K. Wu, Z. Li, R.G. Pestell ulates histone H3 Thr3, Ser10, Ser28 dephosphorylation, which Acquisition of data (provided animals, acquired and managed patients, provided facilities, etc.): K. Wu, Z. Li, S. Cai, J. Wang, Y. Sun, R.G. Pestell is essential for the reestablishment of heterochromatin in Analysis and interpretation of data (e.g., statistical analysis, biostatistics, postmitotic cells (31). computational analysis): K. Wu, K. Chen, A. Ertel RNA polymerase II (RNA PII) is required for transcription of Writing, review, and/or revision of the manuscript: A. Ertel, R.G. Pestell Administrative, technical, or material support (i.e., reporting or orga- protein-coding genes (32), and reduced recruitment of RNA nizing data, constructing databases): L. Tian, R.G. Pestell polymerase II to the site is consistent with the reduced Study supervision: K. Wu, R.G. Pestell transcriptional activity of the EYA1-D327A mutant. The cyclin Providing viral expression constructs: X. Li D1 AP-1 site is known to recruit the AP-1 transcription factors c-Jun, c-Fos, FRA1, FRA2 (28), and reduced recruitment of RNA Grant Support polymerase II to the AP-1 site is consistent with a mechanism This work was supported in part by the NIH grants RO1CA132115, by which EYA1 determines the induction of cyclin D1 gene R01CA70896, R01CA75503, and R01CA86072 (R.G. Pestell) and grant P30CA56036 (Kimmel Cancer Center Core Grant to R.G. Pestell). This work was also supported expression. by a grant from the Dr. Ralph and Marian C. Falk Medical Research Trust (to Mammospheres reflect the combination of both symmetri- R.G. Pestell), the Breast Cancer Research Foundation (R.G. Pestell), Margaret cal and asymmetrical divisions (33). The number of mammo- Q. Landenberger Research Foundation (K. Wu), and a Department of Defense Concept Award W81XWH-11-1-0303 (K. Wu). spheres may serve as a surrogate of breast tumor stem cell The costs of publication of this article were defrayed in part by the payment expansion (BTSC). The current studies show that EYA1 of page charges. This article must therefore be hereby marked advertisement enhanced the number of mammospheres formed. Several lines in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. of evidence support the importance of BTSC or tumor-initi- Received November 6, 2012; revised April 3, 2013; accepted April 8, 2013; ating cells in the onset and progression of breast cancer (33). published OnlineFirst May 1, 2013.

References 1. Voas MG, Rebay I. Signal integration during development: insights naling and prostate cancer cellular growth. Cancer Res 2009;69: from the Drosophila eye. Dev Dyn 2004;229:162–75. 3347–55. 2. Popov VM, Wu K, Zhou J, Powell MJ, Mardon G, Wang C, et al. The 6. Wu K, Li A, Rao M, Liu M, Dailey V, Yang Y, et al. DACH1 is a cell fate Dachshund gene in development and hormone-responsive tumori- determination factor that inhibits cyclin D1 and breast tumor growth. genesis. Trends Endocrinol Metab 2010;21:41–9. Mol Cell Biol 2006;26:7116–29. 3. Silver SJ, Davies EL, Doyon L, Rebay I. Functional dissection of eyes 7. Zhang L, Yang N, Huang J, Buckanovich RJ, Liang S, Barchetti A, et al. absent reveals new modes of regulation within the retinal determina- Transcriptional coactivator Drosophila eyes absent homologue 2 is tion gene network. Mol Cell Biol 2003;23:5989–99. up-regulated in epithelial ovarian cancer and promotes tumor growth. 4. Popov VM, Zhou J, Shirley LA, Quong J, Yeow WS, Wright JA, et al. The Cancer Res 2005;65:925–32. cell fate determination factor DACH1 is expressed in estrogen recep- 8. Cook PJ, Ju BG, Telese F, Wang X, Glass CK, Rosenfeld MG. Tyrosine tor-alpha-positive breast cancer and represses estrogen receptor- dephosphorylation of H2AX modulates apoptosis and survival deci- alpha signaling. Cancer Res 2009;69:5752–60. sions. Nature 2009;458:591–6. 5. Wu K, Katiyar S, Witkiewicz A, Li A, McCue P, Song LN, et al. The cell 9. Farabaugh SM, Micalizzi DS, Jedlicka P, Zhao R, Ford HL. Eya2 is fate determination factor dachshund inhibits androgen receptor sig- required to mediate the pro-metastatic functions of Six1 via the

www.aacrjournals.org Cancer Res; 73(14) July 15, 2013 OF11

Wu et al.

induction of TGF-beta signaling, epithelial-mesenchymal transition, type breast cancer cell lines. Breast Cancer Res Treat 2010;121: and cancer stem cell properties. Oncogene 2012;31:552–62. 53–64. 10. Wu K, Katiyar S, Li A, Liu M, Ju X, Popov VM, et al. Dachshund inhibits 22. Prall OW, Rogan EM, Musgrove EA, Watts CK, Sutherland RL. c-Myc oncogene-induced breast cancer cellular migration and invasion or cyclin D1 mimics estrogen effects on cyclin E-Cdk2 activation and through suppression of interleukin-8. Proc Natl Acad Sci U S A cell cycle reentry. Mol Cell Biol 1998;18:4499–508. 2008;105:6924–9. 23. Dontu G, Abdallah WM, Foley JM, Jackson KW, Clarke MF, Kawa- 11. Wu K, Jiao X, Li Z, Katiyar S, Casimiro MC, Yang W, et al. Cell fate mura MJ, et al. In vitro propagation and transcriptional profiling determination factor Dachshund reprograms breast cancer stem cell of human mammary stem/progenitor cells. Genes Dev 2003;17: function. J Biol Chem 2011;286:2132–42. 1253–70. 12. Lee RJ, Albanese C, Fu M, D'Amico M, Lin B, Watanabe G, et al. Cyclin 24. Yu Y, Davicioni E, Triche TJ, Merlino G. The homeoprotein six1 D1 is required for transformation by activated Neu and is induced transcriptionally activates multiple protumorigenic genes but requires through an E2F-dependent signaling pathway. Mol Cell Biol 2000;20: ezrin to promote metastasis. Cancer Res 2006;66:1982–9. 672–83. 25. Yu Q, Geng Y, Sicinski P. Specific protection against breast cancers by 13. Albanese C, D'Amico M, Reutens AT, Fu M, Watanabe G, Lee RJ, et al. cyclin D1 ablation. Nature 2001;411:1017–21. Activation of the cyclin D1 gene by the E1A-associated protein p300 26. Rowlands TM, Pechenkina IV, Hatsell SJ, Pestell RG, Cowin P. Dis- through AP-1 inhibits cellular apoptosis. J Biol Chem 1999;274: secting the roles of beta-catenin and cyclin D1 during mammary 34186–95. development and neoplasia. Proc Natl Acad Sci U S A 2003;100: 14. Albanese C, Johnson J, Watanabe G, Eklund N, Vu D, Arnold A, et al. 11400–5. Transforming p21ras mutants and c-Ets-2 activate the cyclin D1 27. Pandey RN, Rani R, Yeo EJ, Spencer M, Hu S, Lang RA, et al. The Eyes promoter through distinguishable regions. J Biol Chem 1995;270: Absent phosphatase-transactivator proteins promote proliferation, 23589–97. transformation, migration, and invasion of tumor cells. Oncogene 15. Casimiro MC, Crosariol M, Loro E, Ertel A, Yu Z, Dampier W, et al. ChIP 2010;29:3715–22. sequencing of cyclin D1 reveals a transcriptional role in chromosomal 28. Brown JR, Nigh E, Lee RJ, Ye H, Thompson MA, Saudou F, et al. Fos instability in mice. J Clin Invest 2012;122:833–43. family members induce cell cycle entry by activating cyclin D1. Mol Cell 16. Okada M, Fujimaru R, Morimoto N, Satomura K, Kaku Y, Tsuzuki K, Biol 1998;18:5609–19. et al. EYA1 and SIX1 gene mutations in Japanese patients with 29. Wang Z, Zang C, Rosenfeld JA, Schones DE, Barski A, Cuddapah S, branchio-oto-renal (BOR) syndrome and related conditions. Pediatr et al. Combinatorial patterns of histone acetylations and methylations Nephrol 2006;21:475–81. in the human genome. Nat Genet 2008;40:897–903. 17. Jiao X, Katiyar S, Willmarth NE, Liu M, Ma X, Flomenberg N, et al. c-Jun 30. Roh TY, Wei G, Farrell CM, Zhao K. Genome-wide prediction of induces mammary epithelial cellular invasion and breast cancer stem conserved and nonconserved enhancers by histone acetylation pat- cell expansion. J Biol Chem 2010;285:8218–26. terns. Genome Res 2007;17:74–81. 18. Velasco-Velazquez M, Jiao X, De La Fuente M, Pestell TG, Ertel A, 31. Vagnarelli P, Earnshaw WC. Repo-Man-PP1: a link between chromatin Lisanti MP, et al. CCR5 antagonist blocks metastasis of basal breast remodelling and nuclear envelope reassembly. Nucleus 2012;3: cancer cells. Cancer Res 2012;72:3839–50. 138–42. 19. Perou CM, Sorlie T, Eisen MB, van de Rijn M, Jeffrey SS, Rees CA, et al. 32. Kadonaga JT. Regulation of RNA polymerase II transcription by Molecular portraits of human breast tumours. Nature 2000;406: sequence-specific DNA binding factors. Cell 2004;116:247–57. 747–52. 33. Yu Z, Pestell TG, Lisanti MP, Pestell RG. Cancer stem cells. Int J 20. Holliday DL, Speirs V. Choosing the right cell line for breast cancer Biochem Cell Biol 2012;44:2144–51. research. Breast Cancer Res 2011;13:215. 34. Jamieson CH, Ailles LE, Dylla SJ, Muijtjens M, Jones C, Zehnder JL, 21. Hollestelle A, Nagel JH, Smid M, Lam S, Elstrodt F, Wasielewski M, et al. Granulocyte-macrophage progenitors as candidate leukemic et al. Distinct gene mutation profiles among luminal-type and basal- stem cells in blast-crisis CML. N Engl J Med 2004;351:657–67.

OF12 Cancer Res; 73(14) July 15, 2013 Cancer Research

EYA1 Phosphatase Function Is Essential to Drive Breast Cancer Cell Proliferation through Cyclin D1

Kongming Wu, Zhaoming Li, Shaoxin Cai, et al.

Cancer Res Published OnlineFirst May 1, 2013.

Updated version Access the most recent version of this article at: doi:10.1158/0008-5472.CAN-12-4078

Supplementary Access the most recent supplemental material at: Material http://cancerres.aacrjournals.org/content/suppl/2013/05/01/0008-5472.CAN-12-4078.DC1

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/early/2013/07/05/0008-5472.CAN-12-4078. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.