Detection of Legionella Pneumophila, Mycoplasma Pneumoniae and Chlamydophila Pneumoniae As Aetiological Agents of Community – Acquired Pneumonia in Holy Makkah, KSA

Egyptian Journal of Medical Microbiology, April 2006 Vol. 15, No 2

Detection Of Legionella Pneumophila, Mycoplasma Pneumoniae And Chlamydophila Pneumoniae As Aetiological Agents Of Community – Acquired Pneumonia In Holy Makkah, KSA.

Hassan Bokhary MD 1, Essam El-Gamal MD2, , Suzan El-Fiky MD 3.

Al-Noor Specialist Hospital Holy Makkah KSA, Thoracic medicine Department 1. Thoracic Medicine Department, Al-Mansoura University, Egypt 2. Microbiology Department, Alexandria University, Egypt3.

Atypical organisms such as Mycoplasma pneumoniae, Chlamydia pneumoniae, and Legionella pneumophila are implicated in up to 40 percent of cases of community-acquired pneumonia. Culture is labor-intensive, takes several days to weeks for growth, and can be very insensitive for the detection of some of these organisms. Antibiotic treatment is empiric and includes coverage for both typical and atypical organisms.In the present study we investigate the occurrence Mycoplasma pneumoniae, Chlamydia pneumoniae, and Legionella pneumophila as atypical pathogens responsible for considerable cases of atypical pneumonia.Among 71 bronchoalveolar lavage specimens taken from patients presented clinically with community-acquired pneumonia admitted to Al-noor specialist Hospital Holly Makkah, KSA., PCR results showed that 14 cases (19. 7 %) gave positive results for Mycoplasma pneumoniae,16 cases (22. 5%) gave positive results for Chlamydia pneumoniae and only 4 (5. 6%) cases gave positive results for Legionella pneumophila. All our patients were living in an air conditioned atmosphere due to high temperature in the holly Makkah city. Two(2. 8%) mortality cases from Legionella pneumophila were reported. Because of the non-specificity in clinical presentation of atypical pneumonia, specialized laboratory tests are necessary to establish the diagnosis. The PCR method is a rapid, sensitive and specific technique that has been applied to the detection of many infectious pathogens. Different PCR-based assays for the detection of Mycoplasma pneumoniae, Chlamydia pneumoniae, and Legionella pneumophila in clinical specimens have been described.

INTRODUCTION implicated in up to 40 percent of cases of community-acquired pneumonia. Antibiotic Community-acquired pneumonia treatment is empiric and includes coverage for (CAP) is commonly defined as an acute both typical and atypical organisms(2,3). infection of the lower respiratory tract Mycoplasma pneumoniae is primarily occurring in a patient who has not resided in a a respiratory pathogen that is responsible for hospital or healthcare facility in the previous approximately 15 to 20% of all community- 14 days. Current approaches to the empirical acquired pneumonias. The clinical management of CAP emphasise the type of presentation of patients with M. pneumoniae patient ("community" or "hospital"), rather infection is not significantly different from than the type of symptoms ("typical" or that of patients with infections caused by "atypical")(1,2). other respiratory pathogens such as CAP affects approximately 4. 5 Chlamydia pneumoniae, so diagnosis of million adults in the United States annually. infection relies primarily on laboratory About one third of these adults require testing. M. pneumoniae is, however, a hospitalization. The mortality rate among fastidious organism, requiring a laborious hospitalized patients with CAP varies each effort and 21 days or more for growth in year and can reach 35 percent. Atypical culture. Likewise, serology is lacking in pathogens are responsible for 30 to 40 percent sensitivity, has questionable specificity, and is of cases and may be copathogens in other dependent on specific collection times cases. Even with a knowledge of some of the relative to the onset of illness. DNA probes common characteristics of infections with have also been used, but cross-reactivity atypical organisms, determining the specific between M. pneumoniae and Mycoplasma pathogen on the basis of clinical, radiologic, genitalium has been observed, and methods and laboratory findings is difficult and usually that use these probes also lack sensitivity. done retrospectively, if at all (2). Numerous PCR approaches have been Atypical organisms such as developed to provide a rapid, sensitive Mycoplasma pneumoniae, Chlamydia method for the detection of M. pneumoniae. pneumoniae, and Legionella pneumophila are PCR targets have included the P1 adhesin

437 Egyptian Journal of Medical Microbiology, April 2006 Vol. 15, No 2 gene,the ATPase operon, genomic clones, or person spread has not been reported. a combination of these(4,5,6). Legionellae are found most commonly in M. pneumoniae infection occurs freshwater and man-made water systems. The throughout the year but can cause periodic pathogens also can be found in moist soil, outbreaks within small communities. especially near streams and ponds. Man-made Transmission is by person-to-person contact, systems for heating and cooling water can be and infection spreads slowly, most often prime environments for the proliferation of within closed populations (e. g., households, legionellae, because of conditions such as schools, businesses). Mycoplasma temperatures between 32°C (89.6°F) and pneumoniae causes a wide range of 45°C (113°F), stagnation of water, and the respiratory infections, including pneumonia, presence of scale sediment and amebas. tracheobronchitis, and upper respiratory tract Condensers, cooling towers, respiratory infection. Only 3 to 10 percent of persons therapy equipment, showers, water faucets, infected with M. pneumoniae develop and whirlpools have been associated with pneumonia. Because M. pneumoniae infection outbreaks of legionellosis(11,12). Risk factors becomes more common with increasing age, for the development of legionellosis include it is particularly important to consider this overnight stays outside the home, recent agent in elderly patients. The clinical course home plumbing work, renal or liver failure, of pneumonia caused by M. pneumoniae is diabetes, malignancy, and other conditions usually mild and self-limited. The mortality that compromise the immune system (13,14,15). rate is approximately 1. 4 percent. However, A properly designed PCR assay pulmonary complications can be significant could improve the speed, accuracy, and and include effusion, empyema, sensitivity of diagnosis of legionellosis. A pneumothorax, and respiratory distress PCR assay was developed in which the target syndrome(6,7). for the test is the 16S rRNA gene, which Chlamydia pneumoniae is an obligate exists in multiple copies per genome, thus intracellular organism capable of persistent improving the sensitivity of detection(16). latent infection. Humans are the only known reservoir. Transmission results from contact Because of the non-specificity in with respiratory secretions, with an incubation clinical presentation of atypical pneumonia, period of several weeks. Most cases of C. specialized laboratory tests are necessary to pneumoniae infection are mild, but severe establish the diagnosis. The PCR method is a disease can occur, necessitating admission to rapid, sensitive and specific technique that an intensive care unit. The mortality rate has has been applied to the detection of many been estimated to be 9 percent, and death infectious pathogens. Different PCR-based usually is associated with secondary infection assays for the detection of M. pneumoniae, C. and underlying co-morbid disease (8,9). pneumonia, and L. pneumophila in clinical C. pneumoniae infection has been specimens have been described (4,16,17). detected by serological methods but PCR is currently viewed as an advantageous AIM OF THE WORK alternative since it detects the presence of the This work aimed at; DNA of the organism. This allows for an Diagnosis of community acquired early and clinically relevant diagnosis in pneumonia caused by Legionella contrast to the detection of C. pneumoniae pneumophila, Mycoplasma pneumonia specific antibodies that develop late in the and Chlamydia pneumoniae in course of the infection (9). bronchoalveolar lavage (BAL) samples Like C. pneumoniae, Legionella obtained from population living in air species are intracellular organisms. conditioned atmosphere. Legionella pneumophila is the most pathogenic species, and several serotypes MATERIALS & METHODS have been identified. Serotype 1 has been associated with most reported human cases of Study Population. Makkah has a resident pneumonia caused by L. pneumonphila(1,10). population of 650,000 people. Al Noor Infection occurs from exposure to legionellae Specialist Hospital is a 520-bed, organisms in the environment. Person-to- multispeciality teaching hospital in

438 Egyptian Journal of Medical Microbiology, April 2006 Vol. 15, No 2

Makkah and is managed under a self with occasional vortexing until the pellet was operating program by the Ministry of completely lysed, which usually took 30 min. Health, Saudi Arabia. The hospital serves After lysis of the sample, 200 µl of buffer AL as a referral base for the province of was added to the sample and the mixture was Makkah in the Western region of Saudi incubated for 10 min at 70°C. The mixture Arabia. Between December 2004 to July was then combined with 200 µl of absolute 2005, 71 (37 males & 34 females ) ethanol and mixed by pulse-vortexing for cases were admitted to Al-Noor Specialist 15 s. The mixture was applied to a spin Hospital. The cases were presented column, which holds a silica gel membrane, clinically on admission with signs and and spun for 1 min at 6,000 × g. The spin symptoms of atypical community column was washed with 500 µl of buffer acquired pneumonia. This study was AW2 by centrifugation at 20,000 × g for chosen for this specific group of patients 3 min. The DNA bound on a membrane was because they live in air conditioned eluted by centrifugation with 50 µl of buffer atmosphere throughout the year as the AE after a 5-min incubation at room temperature in Makkah province ranges temperature. The resulting DNA extracts were from 40-45 oC all around the year. stored at 20°C until PCR assessment.

Clinical diagnosis. DNA amplification. The clinical diagnosis based upon; Chlamydia pneumoniae(17) 1. clinical presentations (fever >38 oC, PCR: The extracted DNAs were subjected to cough with or without expectoration, PCR with primers specific for C. pneumoniae dyspnea & chest pain). omp1; 5'-TTA TTA ATT GAT GGT ACA 2. chest x-ray. ATA-3' &5'-ATC TAC GGC AGT AGT 3. Flexible bronchoscopy during which ATA GTT-3' ( PCR base product 207 bp ) BAL samples were taken. (7). In brief, 5 µl of DNA extracts was 4. Exclusion of pulmonary tuberculosis processed in a 25-µl reaction volume was done by doing acid fast bacilli ( containing PCR buffer (10 mM Tris [pH 9. 0], AFB) smear on BAL as well as on 50 mM KCl, 0. 01% gelatin), 200 µM other sputum samples taken from the deoxynucleoside triphosphates, 3. 5 mM

patient. MgCl2, 0. 5 µM each primer, and 1 U of Taq 5. Exclusion of other bacteria causes of polymerase (Promega, Madison, Wis. ). pneumonia was done by doing Amplifications were carried out in a routine Gram stain and routine thermacycler (Uno II, Biometra ). The first aerobic BAL culture, all our selected cycle, consisting of a 5-min denaturation at cases showed no growth or normal 94°C, was followed by 50 cycles each of 30 s flora of upper respiratory tract. at 94°C, 45 s at 50°C, and 1 min, 30 s, at From each case BAL sample was 72°C, with a final extension for 10 min at taken, each sample was divided into two 72°C. The PCR products were visualized in portions, one portion was processed for 2% agarose gel containing 0. 5 µg of ethidium Gram stain, Ziehl-Neelsen stain and bromide/ml. ( Figure1) aerobic culture, the other portion was kept at -700C till PCR processing for Mycoplasma pneumoniae(4); Legionella pneumophila, Mycoplasma PCR. M. pneumoniae-specific PCR was pneumonia and Chlamydia pneumoniae. performed with a total reaction mixture volume of 25 µl. Each primer at a final Nucleic acid extraction. concentration of 1 µM (primer MP-F [5′- DNA extraction: Bacterial DNA was CCCTCGACCAAGCCAACCTC-3′] and extracted from BAL samples using QIAmp primer MP-R [5′- DNA Mini Kit with a bacterial DNA TGCGCGTTGTTCTTGTTGGTG-3′]), PCR extraction protocol. Three ml of sample was base product 309 to 339 bp, each centrifuged for 30 min at 20,000 × g. The deoxynucleoside triphosphate at a final pellet was resuspended in 180 µl of buffer concentration of 200 µM, and final ATL (QIAGEN Valencia, Calif. ) with 20 µl concentrations of 10 mM Tris-HCl (pH 8. 3), of proteinase K and then incubated at 56°C 50 mM KCl, 2 mM MgCl2, and 2. 5 U of Taq

439 Egyptian Journal of Medical Microbiology, April 2006 Vol. 15, No 2 polymerase (Promega, Madison, Wis. ) were mixture was held at this temperature until gel used for PCR in a thermocycler (Uno II, analysis. Biometra ). Thermocycler conditions consisted of an initial incubation of 95°C for (iii) Amplicon detection. Ten microliters of 9 min, followed by 40 cycles of 94°C for 30 the PCR amplicon was mixed with s, 62°C for 30 s, and 72°C for 30 s. An 1 ml of gel loading buffer (0. 5 M Tris, 2.5 additional incubation at 72°C for 7 min was mg of bovine serum albumin per ml, added to complete the elongation. The 20% sucrose, 1 mM cresol red, 20 mM amplified products were visualized in 2% MgCl2), and the mixture was electrophoresed agarose gel containing 0. 5 µg of ethidium on 1. 5% agarose gels in TBE buffer (5 mM bromide/ml. (Figure 2) Tris, 5 mM boric acid, 0. 1 mM EDTA) with ethidium bromide (0. 5 mg/ml) Legionella pneumophila(16) at 80 V for 60 min. The gels were viewed under UV light. The migration DNA amplification. (i) Primers. The distance was compared to that of BioMarker primers for the PCR assay amplified a portion Low (New England Biolabs.) to determine the of the 16S rRNA gene from approximately approximate number of base pairs of the (PCR base product 451 bp). Forward primer amplification product. (Figure 3) (5′-AGGGTTGATAGGTTAAGAGC-3′) and reverse primer (5′- Statistical analysis: CCAACAGCTAGTTGACATCG-3′). The Data was collected suitable statistical analysis was done, the Chi-square test used to (ii) PCR conditions. analysis of categorical data, the 5% was The extracted DNAs were subjected chosen as the cut off level of significance.(18) to PCR with primers specific for Legionella pneumophila. Forward primer (5′- RESULTS AGGGTTGATAGGTTAAGAGC) and Between December 2004 to July reverse primer (5′- 2005, 71 (37 males & 34 females ) cases CCAACAGCTAGTTGACATCG), PCR base were admitted to Al-Noor Specialist product 451 bp. Hospital, Holly Makkah,KSA. The cases were Five microliters of extracted template DNA clinically presented with CAP. Among 71 was used in a 50-ml reaction mixture that BAL samples, PCR results showed that 14 included (50 mM KCl, 10 mM Tris-HCl [pH cases (19.7 %) gave positive results for 8. 3]), 3 mM MgCl2, 200 mM dATP, 200 Mycoplasma pneumoniae, 16 cases (22.5%) mM dCTP, 200 mM dGTP, 400 mM dUTP, 1 gave positive results for Chlamydia mM forward primer, 1 mM reverse primer, pneumoniae and only 4 (5.6%) cases gave 2.8 U of AmpliTaq polymerase (Promega, positive results for Legionella pneumophila Madison, Wis.). Thermal cycling was (table I). Male to female distribution of cases performed with a (Uno II, Biometra ). showed no significance difference regarding Cycling conditions began with an initial mycoplasma pneumoniae and Chlamydia incubation at 37°C for 10 min to prevent pneumoniae (tables II &III),while for carryover amplicon contamination. Legionella pneumophila all the affected cases After a 20-min hold at 95°C, 38 were males (table IV). Age group distribution cycles consisting of 94°C for 45 s, 57°C for showed that the peak age was between 30- 60 45 s, and 72°C for 45 s were followed by a years of age. Two(2. 8%) mortality cases final extension at 72°C for 60 min, and the from Legionella pneumophila were reported.

440 Egyptian Journal of Medical Microbiology, April 2006 Vol. 15, No 2

Table I. DNA amplification results among 71 BAL specimens from clinically diagnosed Community – acquired pneumonia cases.

Result Mycoplasma Chlamydia Legionella pneumoniae pneumoniae pneumophila

No. % No. % No. %

Positive 14 19. 7 16 22. 5 4 5. 6* Negative 57 80. 3 55 77. 5 67 94. 4 Total 71 100 71 100 71 100 2 X 8.7 p 0.01*

Table II. Sex distribution for Mycoplasma pneumoniae positive and negative cases.

Sex Positive Negative Total

No. % No. % No. % Male 8 57.1 29 50.9 37 52. 1 Female 6 42.8 28 49.1 34 47. 9 Total 14 19. 7 57 80. 3 71 100 X2 0.18 p 0.67 N.S.

Table III. Sex distribution for Chlamydia pneumoniae positive and negative cases.

Sex Positive Negative Total

No. % No. % No. % Male 7 42.7 30 54.5 37 52. 1 Female 9 56.3 25 45.5 34 47. 9 Total 16 22.5 55 77.5 71 100 X2 0.58 p 0.44 N.S.

Table IV. Sex distribution of Legionella pneumophila positive and negative cases.

Sex Positive Negative Total

No. % No. % No. % Male 4 100.0 33 49.3 37 52. 2 Female 0 0.0 34 50.7 34 47. 8 Total 4 5. 6 67 94. 4 71 100 X2 3.9 p 0.049*

441 Egyptian Journal of Medical Microbiology, April 2006 Vol. 15, No 2

Table V. Age & sex distribution among 71 BAL specimens obtained from clinically diagnosed cases of Community – acquired pneumonia. Sex Age Male Female No. % No. % No. %

0-10 0 0.0 0 0.0 0 0.0 11-20 12 16.9 2 5.4 10 28.6 21-30 4 5.6 1 2.7 3 8.6 31- 40 11 15.5 6 16.2 5 14.3 41-50 7 9.9 4 10.8 4 11.4 51-60 16 22.5 8 21.6 8 22.9 61-70 11 15.5 9 24.3 2 5.7 71-80 8 11.3 6 16.2 2 5.7 81-90 0 0.0 0 0.0 0 0.0 91-100 0 0.0 0 0.0 0 0.0 101-110 2 2.8 1 2.7 1 2.9 Total 71 100 37 100 34 100

Fig. 1: : Agarose gel electrophoresis showing positive PCR products for Chlamydia pneumoniae ( lanes 1,2,4,8).

442 Egyptian Journal of Medical Microbiology, April 2006 Vol. 15, No 2

Fig. 2: Agarose gel electrophoresis showing positive PCR products mycoplasma pneumoniae (lanes 3, 8, 9).

Fig. 3: Agarose gel electrophoresis showing positive PCR products Legionella pneumophila (lans 2,3).

DISCUSSION atmosphere allover the year which is a predisposing factor for CAP . In order to identify the etiology of Mycoplasma pneumoniae is respiratory tract infections, clinicians have responsible for the greatest number of cases historically divided the patient’s clinical and of atypical pneumonia, and accounts for 1- laboratory presentation into “typical” and 10% of community-acquired pneumonias. “atypical” pneumonia syndromes. Atypical Mycoplasma infections occur throughout the pneumonia is generally defined as a mild year, although a relative increase in incidence respiratory tract illness with nonproductive has been noted in the late summer and fall. cough, fever, headache and abnormal chest X- Older children, adolescents, and young adults ray which progresses from upper to lower are at greatest risk for developing this respiratory tract. Focus Technologies has infection. Fever, malaise, coryza, headache developed a PCR-based assay for the and cough represent the major clinical detection of three pathogens associated with findings. Sputum production is variable and atypical pneumonias: Mycoplasma purulent in one third to one-half of cases. The pneumoniae, Chlamydia pneumoniae, and overall clinical course of M. pneumoniae Legionella pneumophila. The Atypical infection in most cases is benign, although Pneumonia PCR Panel assay is able to detect occasionally it may present as severe the presence of any one of these pathogens community-acquired pneumonia requiring from a single respiratory specimen(2,19). intensive care(5,6,20). Makkah is a city in the Western Saudi Pneumonia caused by M. pneumoniae has Arabia located inland 73 kilometers east of long been a difficult disease to diagnose Jeddah. It is considered the holiest city in because there are both clinical and laboratory Islam and is the site for annual pilgrimage diagnostic problems associated with its (Hajj) that is performed by nearly two million identification. It has been realized for quite Muslims coming from all parts of the world. some time that the detection of M. The temperature all the year ranges from 40- pneumoniae is greatly enhanced by the use of 45oC. In this paper, we described the the PCR methodology. PCR methods have clinically diagnosed CAP trying to detect the provided an advantage because they are fast, three pathogens associated with atypical specific, and sensitive(4). CAP: Mycoplasma pneumoniae, Chlamydia pneumoniae, and Legionella pneumophila. In this study we investigate the Our patients living in an air conditioned occurrence of M. pneumoniae in this group of

443 Egyptian Journal of Medical Microbiology, April 2006 Vol. 15, No 2 patients, 14 out of 71 patients (19.7 %) gave upper respiratory tract specimens, as positive results by PCR. Cultrera R et al did a demonstrated by PCR, without a concomitant similar study for detection of mycoplasma serological response, may indicate prolonged, DNA in respiratory specimens from adult harmless colonization of the respiratory tract HIV –positive patients, Mycoplasma DNA rather than the agent causing pneumonia. was detected in specimens from 12 of 84(14. 2%) patients. Our results were higher than Legionnaires’ disease, the Cultrera and this may be attributed to the pneumoniae caused by infection with specific environmental conditions that our Legionella pneumophila, encompasses a patients live in. (21). broad-spectrum of illness, ranging from a mild cough and slight fever to stupor with Chlamydia pneumoniae is another widespread pulmonary infiltrates and multi- major cause of community acquired system failure resulting in death. L. pneumonia and may account for up to 10% of pneumophila has been reported as the cases. Infections occur sporadically, though pathological agent involved in approximately several epidemics have been documented. 3-6% of severe atypical pneumonia cases. Clinical presentation is similar to Early in the illness, patients experience non- mycoplasmal infection, though the specific symptoms including fever, malaise, progression of symptoms may be slower. myalgia, anorexia and headache. Diarrhea, Pneumonia attributed to C. pneumoniae nausea, vomiting, abdominal and chest pain, infections have also been associated with and change in mental status are also common extrapulmonary manifestations, including manifestations. Because of the nonspecificity bronchitis, otitis, sinusitis, pericarditis, in clinical presentation of atypical pneumonia, myocarditis and endocarditis (9,22). specialized laboratory tests are necessary to In our study the result of Chlamydia establish the diagnosis (13,25). pneumoniae detection by PCR was 16 In the current study the results of L. (22.5%) patients out of 71 clinically pneumophila detection by PCR was 4 patients diagnosed CAP cases. In another study done out of 71 (5.6%), it was expected theoretically by Birkebaek NH et al(23) for detecton of to find more o L. pneumophila in our patients Chlamydia pneumoniae infection in adults due to the very closed conditioned with chronic cough, nasopharyngeal aspirates atmosphere that the patients live all-around from the 201 patients were examined for C. the year. pneumoniae deoxyribonucleic acid by In a study done by Cloud JI et al (16), polymerase chain reaction (PCR). Of nine of 212 specimens examined by both culture patients(4.4%) with acute infection diagnosed and PCR for detection of Legionella spp., 31 by serology (IgM), three were C. pneumoniae (14. 6%) samples positive by culture were PCR positive. They concluded that direct also positive by PCR. Sequencing was detection of Chlamydia pneumoniae by performed with DNA amplicons from 12 polymerase chain reaction on nasopharyngeal samples that were PCR positive and culture aspirates is highly correlated with detectable negative. They added a sequencing step to immunoglobulin M antibodies. confirm all PCR-positive results for culture- negative samples, specificity was improved In another prospective study done by from 93 to 98%. They concluded that a Verkooyen RP et al(24) fordiagnosis of legionella-specific PCR of respiratory Chlamydia pneumoniae respiratory infections samples that targets a 386-bp portion of the by PCR, out of 156 patients with a diagnosis 16S rRNA gene can be performed in 6 to 8 h of community-acquired pneumonia twenty- with high sensitivity and high specificity of three patients (15%) had serological results results. The specificity is further improved by compatible with acute C. pneumoniae confirming positive results by sequencing infection; nine (39%) of these subjects were analysis. If the PCR-positive samples C. pneumoniae PCR positive. Twenty-two confirmed to be positive by sequencing are patients (14%) had positive PCR results accepted as true positives on the basis of a without serological evidence of an acute C. comparison with sequences in the GenBank pneumoniae infection. They concluded that database, then no specimens have false- the presence of only C. pneumoniae DNA in

444 Egyptian Journal of Medical Microbiology, April 2006 Vol. 15, No 2 positive results (100% specificity) by the diagnosis of the disease. A negative PCR combined PCR-sequencing assay. result indicates absence of M. pneumoniae, C. pneumoniae and L. pneumophila DNA in the We didn't get any overlapping sample tested and does not exclude the results,for example, we didn’t have a patient diagnosis of the disease(27). got 2 atypical pathogens at the same time. Two(2. 8%) mortality cases from Legionella With the added sophistication and pneumophila were reported among our group modernization of amplification processes like of patients. multiplex PCR and real-time PCR, technology has enabled testing to be more The age distribution of the 71 cases efficient and precise. As with all molecular showed that 45 (63. 3%) cases were between biology-based amplification methods, 30-70 years of age, as our group of patients contamination and false positive results are were living in an air conditioned closed always a risk. Good molecular biology atmosphere throughout the year. To our practices in the laboratory and experience opinion this is a very strong predisposing reduce this to a very low level (27). factor for a susceptible person to got CAP especially L. pneumophila. REFERENCES Early and appropriate treatment of 1. Kristopher P. Thibodeau, LC, Anthony J. CAP patients is one of the most important Atypical Pathogens and Challenges in factors to reduce morbidity and mortality. A Community-Acquired Pneumonia. causative agent is seldom identified in >50– American Family Physicians 2004; 70% of cases. Pneumonia due to C. burnetii, 69(7):322-330. C. psitacci, C. pneumoniae, M. pneumoniae 2. Paul D R, Irving LB, Turnidge DJ. and respiratory viruses is usually mild, though Community-acquired pneumonia. MJA L. pneumophila pneumonia may be severe Practice Essentials - Infectious Diseases and its detection can be of epidemiological 2002; 176 (7): 341-347. importance. Regarding the aetiological 3. Niederman MS, McCombs JS, Unger diagnosis of pneumonia, clinical and chest AN, Kumar A, Popovian R. The cost of radiographical findings lack accuracy treating community-acquired pneumonia. cultures is not available most of the time in Clin Ther 1998; 20: 820-37. cases of atypical pathogens and specific rapid 4. Alfred L W, Tanya A H, Charles KC, tests based on the detection of soluble Cynthia J C. Development of a antigens of L. pneumophila in body fluids are Genomics-Based PCR Assay for not always available. Therefore, initial Detection of Mycoplasma pneumoniae in antibiotic therapy is usually chosen on an a Large Outbreak in New York State. J empirical basis (26). Clin Microbiol. 2001 April; 39(4): 1385–

1390. Nucleic acid amplification-based 5. Haier J, Marwan N, Robert F A, Garth L techniques do not depend on the viability of N. Detection of Mycoplasmal Infections the target microbe, whereas conventional in Blood of Patients with Rheumatoid microbiological techniques. The PCR method Arthritis. Rheumatology 1999; 38: 504- is a rapid, sensitive and specific technique 509. that has been applied to the detection of many 6. Yang J, W. Craig W H, Donald J P, infectious pathogens. Different PCR-based Deborah F. Regulation of assays for the detection of M. pneumoniae, C. Proinflammatory Cytokines in Human pneumonia, and L. pneumophila in clinical Lung Epithelial Cells Infected with specimens have been described. Although the Mycoplasma pneumoniae. Infection and sensitivity and specificity of PCR has made Immunity 2002; 70(7): 3649-3655. the assay a very promising tool in clinical 7. Hu P C, Collier AM, Baseman JB. diagnosis, diagnosis of atypical pneumonia Surface parasitism by Mycoplasma should not rely solely upon the result of a pneumoniae of respiratory epithelium. PCR assay. A patient testing positive should JExp Med1977;145:1328-1343. be examined with other tests to establish the

445 Egyptian Journal of Medical Microbiology, April 2006 Vol. 15, No 2

8. Tina M, Svend B, Niels H B, Skov J, community-acquired pneumonia in Gunna C. Determination of PCR adults. Clin Infect Dis 2000; 31: 347-382. efficiency in chelex-100 purified clinical 20. Abele-Horn M, Busch U, Nitschko H, samples and comparison of real-time Jacobs E, Bax R, Pfaff F, Schaffer B, quantitative PCR and conventional PCR Heesemann J. Molecular approaches to for detection of Chlamydia pneumoniae. diagnosis of pulmonary diseases due to BMC Microbiology 2002,( 2);345-353. Mycoplasma pneumoniae. J Clin 9. Peeling RW, Brunham RC: Chlamydiae Microbiol. 1998;36:548–551. as pathogens: new species and new 21. Cultrera R, Roulland-Dussoix D, Romani issues. Emerg Infect Dis 1996, 2(4):307- R, Contini C. Use of PCR to detect 319. mycoplasma DNA in respiratory tract 10. Cotton EM, Strampfer MJ, Cunha BA. specimens from adult HIV-positive Legionella and mycoplasma pneumonia-a patients. The Journal of Medical community hospital experience with Microbiology 1998, Vol 47, Issue 11 983- atypical pneumonias. Clin Chest Med 986. 1987;8:441-53. 22. Vanessa R, Klaus D, Sabine B, Jörg, 11. File TM Jr, Tan JS, Plouffe JF. The role Matthias M. Interaction of Chlamydia of atypical pathogens: Mycoplasma pneumoniae and Human Alveolar pneumoniae, Chlamydia pneumoniae, and Macrophages: Infection and Legionella pneumophila in respiratory Inflammatory Response. Am J Respir infection. Infect Dis Clin North Am Mol Biol Cell 1998; 19: 721–727. 1998;12:569-92. 23. Birkebaek NH, Jensen JS, Seefeldt T, 12. Shands KN, Ho JL, Meyer RD, Gorman Degn J, Huniche B, Andersen PL, GW, Edelstein PH, Mallison GF. Potable Ostergaard L. Chlamydia pneumoniae water as a source of Legionnaires' infection in adults with chronic cough disease. JAMA 1985;253:1412-6. compared with healthy blood donors. Eur 13. Butler JC, Fields BS, Breiman RF. Respir J 2000;16: 108-111. Prevention and control of Legionellosis. 24. Verkooyen RP, Willemse D, Casteren Infect Dis Clin Pract 1997;6(7):458-64. HV et al. Evaluation of PCR, Culture, and 14. Straus WL, Plouffe JF, File TM Jr, Serology for Diagnosis of Chlamydia Lipman HB, Hackman BH, Salstrom SJ. pneumoniae Respiratory Infections. J Clin Risk factors for domestic acquisition of Microbiol, 1998; 36(8): 2301-2307. legionnaires disease. Ohio Legionnaires 25. Kazuhiro T, Tetsuya M, Yoshikazu I, Disease Group. Arch Intern Med Nobuhiko F,Akira O, Shuichi M. Serum 1996;156:1685-92. Cytokines in Patients with Legionella 15. Stout JE, Yu VL. Legionellosis. N Engl J Pneumonia: Relative Predominance of Med 1997;337:682-7. Th1-Type Cytokines. Clinical and 16. Cloud JI, CarrollKC, Pixton P, Erali M, Diagnostic Laboratory Immunology1998; Hillya RD. Detection of Legionella 5:401-403. Species in Respiratory Specimens Using 26. Mensa J, MarcosMA, Roux A, Torres A. PCR with Sequencing Confirmation. J C-reactive protein levels in community- Clin Microbiol 2000; 38(5):1709-1712. acquired pneumonia Eur Respir J 2003; 17. Ikejima H, Haranaga S, Takemura, H, et 21: 702–705. al. PCR-Based Method for Isolation and 27. Khanna M, Fan J, Pehler K, Harrington Detection of Chlamydia pneumoniae C, Waters P. Douglass J. The DNA in Cerebrospinal Fluids. Clin. Pneumoplex Assays, a Multiplex PCR- Diagn. Lab. Immunol. 2001; 8: 499-502. Enzyme Hybridization Assay That 18. Rebecca G. Knapp, M. Clinton Miller I. Allows Simultaneous Detection of Five Clinical epidemiology and biostatistics, Organisms, Mycoplasma pneumoniae, Williams & Wilkins, Baltimore, Chlamydia (Chlamydophila) pneumoniae, Maryland. 1998; 13:209-33. Legionella pneumophila, Legionella 19. Bartlett JG, Dowell SF, Mandell LA. micdadei, and Bordetella pertussis, and Practice guidelines for the management of Its Real-Time Counterpart. J Clin Microbiol 2005;43: 565–571.

446 Egyptian Journal of Medical Microbiology, April 2006 Vol. 15, No 2

ﺍﻟﻤﻠﺨﺹ ﺍﻟﻌﺭﺒﻰ

ﺍﻟﻤﻴﻜﺭﻭﺒﺎﺕ ﺍﻟﺭﺌﻭﻴﺔ ﺍﻻﻨﻤﻁﻴﺔ ﻤﺜل ﺍﻟﻜﻼﻤﻴﺩﻴﺎ ﺍﻟﺭﺌﻭﻴﺔ ﻭ ﺍﻟﻤﻴﻜﻭﺒﻼﺯﻤﺎ ﺍﻟﺭﺌﻭﻴـﺔ ﻭ ﺍﻟﻠﻴﺠﻴـﻭﻨﻴﻼ ﻨﻴﻤـﻭﻓﻴﻼ

ﻤﺴﺌﻭﻟﺔ ﻋﻥ ﺤﻭﺍﻟﻰ ٤٠% ﻤﻥ ﺤﺎﻻﺕ ﻋﺩﻭﻯ ﺍﻻﻟﺘﻬﺎﺏ ﺍﻟﺭﺌﻭﻯ ﺍﻻﻨﻤﻁـﻰ ﺍﻟﻤﻜﺘـﺴﺏ ﻤـﻥ ﺨـﺎﺭﺝ ﺍﻟﻤﺴﺘـﺸﻔﻰ

(ﺍﻟﻤﺠﺘﻤﻊ). ﻭ ﺯﺭﺍﻋﺔ ﻫﺫﺓ ﺍﻟﻤﻴﻜﺭﻭﺒﺎﺕ ﻫﻰ ﻋﻤﻠﻴﺔ ﺸﺎﻗﺔ ﺘﺴﺘﻐﺭﻕ ﺍﻟﻜﺜﻴ ﺭ ﻤﻥ ﺍﻟﻭﻗﺕ ﺍﻟﺫﻯ ﻗﺩ ﻴـﺼل ﻓـﻰ ﺒﻌـﺽ

ﺍﻻﺤﻴﺎﻥ ﺍﻟﻰ ﺍﻴﺎﻡ ﺍﻭ ﺍﺴﺎﺒﻴﻊ ﻜﻰ ﻴﻨﻤﻭ ﺍﻟﻤﻴﻜﺭﻭﺏ ﻭ ﻓﻰ ﻤﻌﻅﻡ ﺍﻻﺤﻴﺎﻥ ﻴﺘﻡ ﻋﻼﺝ ﺍﻟﻤﺭﻴ ﺽ ﻋﻠﻰ ﺍﺴﺎﺱ ﺍﻻﻋـﺭﺍﺽ

ﺍﻟﻤﺭﻀﻴﺔ ﻓﻘﻁ ﻭﻓﻰ ﻫﺫﺓ ﺍﻟﺤﺎﻟﺔ ﻴﺘﻡ ﺍﻋﻁﺎﺀ ﺍﻟﻤﺭﻴﺽ ﺘﻐﻁﻴﺔ ﻜﺎﻤﻠﺔ ﻤﻥ ﺍﻟﻤﻀﺎﺩﺍﺕ ﺍﻟﺤﻴﻭﻴﺔ ﺍﻟﻭﺍﺴﻌﺔ ﺍﻟﻤﺠـﺎل . ﻭ ﻗـﺩ

ﻗﻤﻨﺎ ﻓﻰ ﻫﺫﺓ ﺍﻟﺩﺭﺍﺴﺔ ﺒﻤﺤﺎﻭﻟﺔ ﺘﺸﺨﻴﺹ ﺍﻟﻜﻼﻤﻴﺩﻴﺎ ﺍﻟﺭﺌﻭﻴﺔ ﻭ ﺍﻟﻤﻴﻜﻭﺒﻼﺯﻤﺎ ﺍﻟﺭﺌﻭﻴﺔ ﻭ ﺍﻟﻠﻴﺠﻴﻭﻨﻴﻼ ﻨﻴﻤـﻭﻓﻴﻼ ﻋﻠـﻰ

ﺍﺴﺎﺱ ﺍﻨﻬﻡ ﻤﺠﻤﻭﻋﺔ ﻻﻨﻤﻁﻴﺔ ﻤﻥ ﺍﻟﻤﻴﻜﺭﻭﺒﺎﺕ ﺍﻟﻤﺴﺒﺒﺔ ﻟﻼﻟﺘﻬﺎﺏ ﺍﻟﺭﺌﻭﻯ ﺍﻻﻨﻤﻁﻰ . ﻭ ﻗﺩ ﺘﻡ ﻓﺤﺹ ﻋﺩﺩ ٧١ ﻋﻴﻨﺔ

ﻤﻥ ﺍﻟﻐﺴﻴل ﺍﻟﺸﻌﺒﻰ ﺍﻟﺤﻭﺼﻠﻰ ﺘﻡ ﺍﺨﺫﻫﺎ ﺒﻭﺍﺴﻁﺔ ﻤﻨﻅﺎﺭ ﺍﻟﺸﻌﺏ ﺍﻟﻬﻭﺍﺌﻴﺔ ﻭ ﺘﺭﺠﻊ ﻫﺫﺓ ﺍﻟﻌﻴﻨﺎﺕ ﺍﻟﻰ ٧١ ﻤ ﺭﻴﺽ ﺘﻡ

ﺤﺠﺯﻫﻡ ﺒﻤﺴﺘﺸﻔﻰ ﺍﻟﻨﻭﺭ ﺍﻟﺘﺨﺼﺼﻰ – ﻤﻜﺔ ﺍﻟﻤﻜﺭﻤﺔ ﻭ ﺘﺸﺨﻴﺼﻬﻡ ﺴﺭﻴﺭﻴﺎ ﻋﻠﻰ ﺍﻨﻬـﻡ ﺤـﺎﻻﺕ ﺍﻟﺘﻬـﺎﺏ ﺭﺌـﻭﻯ

ﻻﻨﻤﻁﻰ ﻤﻜﺘﺴﺏ ﻤﻥ ﺨﺎﺭﺝ ﺍﻟﻤﺴﺘﺸﻔﻰ ﺤﻴﺙ ﺍﻨﻬﻡ ﻴﻌﻴﺸﻭﻥ ﻓﻰ ﺍﺠﻭﺍﺀ ﻤﻜﻴﻔﺔ ﺍﻟﻬﻭﺍﺀ ﻁﻭﺍل ﺍﻟﻌﺎﻡ ﻓـﻰ ﻤﺩﻴﻨـﺔ ﻤﻜـﺔ

ﺍﻟﻤﻜﺭﻤﺔ. ﻭ ﻗﺩ ﺘﻡ ﻋﻤل ﺘﺤﻠﻴل ﺍﻟﺘﻔﺎﻋل ﺍﻟﺒﻭﻟﻴﻤﻴﺭﻴﺯﻯ ﺍﻟﻤﺘﺴﻠﺴل ﺍﻟﻤﺘﻌﺩﺩ ﺍﻻﻨﺯ ﻴﻡ ﻭ ﻜﺎﻨ ﺕ ﺍﻟﻨﺘﺎﺌﺞ ﺍﻨﺔ ﻫﻨﺎﻙ ﻋﺩﺩ ١٤

ﺤﺎﻟﺔ (١٩،٧%) ﺍﻋﻁﺕ ﻨﺘﺎﺌﺞ ﺍﻴﺠﺎﺒﻴﺔ ﻟﻤﻴﻜﺭﻭﺏ ﺍﻟ ﻤﻴﻜﻭﺒﻼﺯﻤﺎ ﺍﻟﺭﺌﻭﻴﺔ ﻭ ١٧ﺤﺎﻟﺔ (٢٢،٥%) ﺍﻋﻁﺕ ﻨﺘﺎﺌﺞ ﺍﻴﺠﺎﺒﻴﺔ

ﻟﻤﻴﻜﺭﻭﺏ ﺍﻟﻜﻼﻤﻴﺩﻴﺎ ﺍﻟﺭﺌﻭﻴﺔ ﻭ ﻋﺩﺩ ٤ ﺤﺎﻻﺕ (٥،٦%)ﺍﻋﻁﺕ ﻨﺘﺎﺌﺞ ﺍﻴﺠﺎﺒﻴﺔ ﻟﻤﻴﻜﺭﻭﺏ ﺍﻟﻠﻴﺠﻴﻭﻨﻴﻼ ﻨﻴﻭﻤﻭﻓﻴﻼ . ﻭ ﻗﺩ

ﺘﻡ ﺘﺴﺠﻴل ﻋﺩﺩ ٢ ﺤﺎﻟﺔ (٢،٨%)ﻭﻓﻴﺎﺕ ﺒﺴﺒﺏ ﻤﻴﻜﺭﻭﺏ ﺍﻟﻠﻴﺠﻴﻭﻨﻴﻼ ﻨﻴﻭﻤﻭﻓﻴﻼ . ﻭ ﺒﻨﺎﺀ ﻋﻠﻰ ﻤﺎ ﺴﺒﻕ ﻓـﺎﻥ ﻁﺭﻴﻘـﺔ

ﺍﻟﺘﻔﺎﻋل ﺍﻟﺒﻭﻟﻴﻤﻴﺭﻴﺯﻯ ﺍﻟﻤﺘﺴﻠﺴل ﺍﻟﻤﺘﻌﺩﺩ ﺍﻻﻨﺯﻴﻡ ﻫﻰ ﻁﺭﻴﻘﺔ ﺴﺭﻴﻌﺔ ﻭ ﺤﺴﺎﺴﺔ ﻭ ﻤﺘﺨﺼﺼﺔ ﻓﻰ ﺘﺸﺨﻴﺹ ﻤﺜل ﻫﺫﺓ

ﺍﻟﻤﻴﻜﺭﻭﺒﺎﺕ ﺍﻻﻨﻤﻁﻴﺔ ﻭ ﺍﻟﺘﻰ ﻴﺼﻌﺏ ﻓﻰ ﻜﺜﻴﺭ ﻤﻥ ﺍﻻﺤﻴﺎﻥ ﻋﺯﻟﻬﺎ ﻭ ﺘﻌﺭﻴﻔﻬﺎ .

447