Collaborative Research Investigating Public Health Challenges Related to Canines in Rural, Urban, and Remote Communities in Canada

Home , Dog walking, Rabies in Haiti

Epidemiology and One Health: Collaborative Research Investigating Public Health Challenges Related to Canines in Rural, Urban, and Remote Communities in Canada

Danielle Arlaine Julien

A Thesis presented to The University of Guelph

In partial fulfilment of requirements for the degree of Doctor of Philosophy in Population Medicine

Guelph, Ontario, Canada

ABSTRACT

EPIDEMIOLOGY AND ONE HEALTH: COLLABORATIVE RESEARCH INVESTIGATING PUBLIC HEALTH CHALLENGES RELATED TO CANINES IN RURAL, URBAN, AND REMOTE COMMUNITIES IN CANADA

Danielle Arlaine Julien Advisor(s): University of Guelph, 2020 Dr. Jan M. Sargeant Dr. Sherilee L. Harper (Co-Advisor)

This thesis is an investigation of public health challenges related to dogs in rural and urban communities in southern Ontario, and in remote Iqaluit, Nunavut, Canada, using cross- sectional observational studies. First, we conducted a scoping review of canine zoonotic and vectorborne research in North American countries, categorized by the Inequality-adjusted

Human Development Index (IHDI). Most research was conducted in “very high” and “high”

IHDI countries. Second, the prevalence of Giardia spp. and Cryptosporidium spp. were investigated in dogs in Iqaluit, Nunavut. Using Ecohealth and One Health approaches, feces were collected from three dog populations (sled (n=79), shelter (n=111), and community dogs

(n=104)). The fecal prevalence of at least one parasite when one sample was chosen at random for all dogs was 8.16% (95% CI: 5.52-11.92), and of Giardia spp., and Cryptosporidium spp. was 4.42% (95% CI: 2.58-7.49) and 6.12% (95% CI: 3.88-9.53), respectively. We identified

Giardia intestinalis, zoonotic assemblage B (n=2), and species-specific D (n=3) and E (n=1); and 5 samples containing Cryptosporidium canis. Third, we explored the prevalence of dog ownership, canine rabies vaccination, and the incidence of self-reported dog bites in humans; knowledge of zoonoses; and sources of dogs as pets in southern Ontario using an online

questionnaire of n=1,002 rural and 1,004 urban respondents. The probability of owning at least one dog was higher in rural households than in urban households (OR=1.24, 95% CI: 1.04-1.48, p=0.02). Irrespective of dog ownership, the incidence risk of at least one bite victim over a one- year period in rural households (6.09% per year) was less than in urban households (10.76% per year). Of respondent-owned biting dogs, 16.67% were unvaccinated against rabies. Many respondents were aware of canine zoonoses (55.88%) and there were no differences in awareness between rural and urban respondents. Finally, over a seven-year period, 731 (36.44%) respondents domestically sourced, and 55 (2.74%) imported at least one dog, most frequently from the USA (n=29 of 55 (52.73%)). Findings highlight that in three geographically distinct communities, culturally sensitive and appropriate public health strategies are needed to mitigate risks of public health challenges related to dogs and enhance public knowledge of canine zoonoses.

iii

DEDICATION Ah, but a man’s reach should exceed his grasp, Or what’s a heaven for? Robert Browning

I dedicate this dissertation to Sofia Mae Julien-Wright, Margot Jean Julien-Wright, and to all the little girls from Grenada sitting on the front steps of their homes, cuddling teddy bears in one hand and beloved dogs in another, emphatically expressing to their parents, “I want to make dogs well!” - You can and you will!

ACKNOWLEDGEMENTS It takes a village to raise a child – African proverb

I would argue, it also takes a village for an individual to complete a PhD.

I am extremely grateful to my thesis committee Drs. Jan Sargeant, Sherilee Harper, and

Catherine Filejski, for their unyielding advice, counsel, and dedication to my growth, development, and success.

Jan, you will never know just how much you positively impacted the course of my life, particularly during a time when I did not feel disserving of such an incredible opportunity as being able to do a PhD. I am eternally grateful for your exceptional mentorship, guidance, advice, patience, and genuine interest in my growth and development as a professional but also as a human being. You were, and will always remain, one of the most fascinating women I have ever had the privilege of knowing. Thank you for engaging with me in diverse conversations about the most wonderful and varied topics ranging from Jean-Claude Duvalier, to my indeterminate future as a young veterinarian. I feel extremely fortunate for having had you as my advisor and being one of your last PhD students. You are brilliant. And, while I often felt intimidated by your mind, I have learned more from you than I could ever possibly have imagined. I will never forget your kindness to me, your encouragement, and in every interaction that we have had to date, your ability to foster in me the ability to think about things differently - to extend my mental reach past its grasp. I will never be able to repay you for the incredible opportunities you provided for me but, I look forward to a future in which I am readily available to help you as your colleague and friend. Thank you from the bottom of my heart Jan!

Sheri, you are an extraordinary mentor and advisor and I will never forget your time, advice, and genuine compassion. I have always loved writing, but through your consistent v

efforts, I have learned to appreciate and strive for exceptional prose. Your kindness and support, particularly when Jan was on sabbatical, will always remain one of the most fundamental learning opportunities in my entire life. Although I have always admired you, my ignorance, in its truest definition, meant that unfortunately, I did not always fully appreciate you. I simply cannot comprehend your ability to accomplish all that you do in your professional life while being the source of support and guidance you are as an advisor. I am eternally grateful to you.

You were not only unfaltering in your dedication to me as your student, you were also an incredible support for my personal well-being. I have cried, laughed, wondered, “ah – Ha!” -ed, worried, and grown in your presence, and I will always be indebted to you for the pivotal role you have played in my development as an epidemiologist and human being. Thank you for listening to me and for being such a magnetic voice of reason. I want to be a better student and person because of you - Thank you, Sheri!

Catherine, you have been my mentor since my internship, under your supervision, at the

Ontario Ministry for Health and Long-Term Care in the summer of 2012. I have learned such an incredible amount from you regarding public health and life itself. I am always astounded by your ability to conceptualize ideas and bring them to fruition. Thank you for always redirecting me to our purpose – gathering and using data for the betterment of public health. I will never forget our conversations, each and every one of them a significant learning opportunity. Your incredible kindness and support have helped me through the tough times and given me impetus to continue through the good. Thank you, Catherine. I look forward to continuing professional relationships and friendships with Drs. Sargeant, Harper, and Filejski.

Thank you to the wonderful people and dogs in Iqaluit, Nunavut, Canada. To all of the sled dog owners in Iqaluit, Nunavut, my heart felt thank you. Our research would never have been possible without your help, and trust in me as a person and burgeoning researcher. I appreciate your time in helping with collecting stool samples and inviting me into your homes and into your lives – it meant the world to me. Thank you for your expertise in developing the knowledge translation materials. To the Nunavut Innovation and Research Institute (NIRI), thank you for your guidance, support, and advice in conducting research in Iqaluit, Nunavut. I really appreciated the kindness everyone extended to me; I felt very welcomed at NIRI. To the people of Iqaluit, Nunavut, I am eternally grateful to you for opening your hearts and community to me.

Thank you for giving me the opportunity to experience the incredible beauty of your land and your hospitality. I look forward to maintaining meaningful relationships with sled dog owners,

NIRI, and the Iqaluit community as friends and research collaborators in the future. Nakurmiik!

To the graduate student village: Drs. Kate Bishop-Williams, Stephanie Croyle, and Carly

Moody I could not imagine better human beings with whom to spend time in preparing for qualifying exams. You are such strong, resilient, and devoted women, and it was an honour to exchange and create knowledge with each and every one of you. To Amanda Armstrong,

Katherine Davenport, Michele Bergevin, Dr. Emma Gardner, Brianna Hagen, Dr. Melissa

MacKinnon, Ben Ouyang, Jordan Pelkmans, Dr. Jennifer Perret, Jocelyn Rivers, Dr. Steve

Roche, Dr. Dan Shock, Alex Swiriski, Carol Tinga, Amanda Rotella, Dr. Salah Udin-Khan, Dr.

Lee Wisener, Dr. Charlotte Winder, and Wendy Xie, thank you for your constant support over the years. You were ears, shoulders, arms, and rapidly firing neurons when mine had come to a standstill. You are all inspiring, passionate, and fantastic individuals and I will be forever

vii

grateful to you for your friendship, time, and encouragement. I look forward to maintaining relationships with each of you and perhaps even collaborating with you on research endeavours in the future!

To all within the Harper lab village: Thank you to everyone in the Harper lab for the innumerable times that you lent me your ears, and, in particular, being so welcoming to me when

I returned to the PhD after my first maternity leave. I would especially like to thank Anna Bunce,

Anna Manore, Stephanie Masina, for their companionship, kindness, and incredible help with community research in Iqaluit Nunavut. A special thank you to Manpreet Saini and Jacqueline

Middleton for your help in conducting immunoassays of canine fecal samples. An enormous thank you to Carlee Wright for your consistent help and dedication to our knowledge translation materials and your exceptional talent! I would also like to thank Kate Landry (née Patterson) for your help with some of the analysis for the Iqaluit dog stool study. You were patient and understanding and I appreciate the time that you gave of yourself to me, and I will never forget your kindness.

To the University of Guelph faculty and staff village: My sincerest thanks to all of the

administrative staff in the Department of Population Medicine for bearing with my constant and unrelenting questions and being genuine sources of support during my many years at the Ontario

Veterinary College. I will cherish the times we had together more than you know. I am extremely thankful to you all. A special thank you to Lily Arpa, Karla D’Uslar, Ariah Easley, Barb

Gaudette, Linda Kraemer, Joyce Rousseau, Christina Voll, and Ashley Whiteman.

To the village of past and present faculty of the Department of Population Medicine, at the Ontario Veterinary College: Thank you for opening your doors and classes to me, for the

viii

provision of invaluable advice that I will retain for the rest of my life, Teaching Assistantships, and providing innumerable opportunities for me to improve as a soon-to-be epidemiologist. Most of all, thank you for your kindness. Special thanks to Drs. Cathy Baumann, Olaf Berke, Katie

Clow, Ashlee Cunsolo, Cate Dewey, Michele Guerin, Claire Jardine, Andria Jones-Bitton, Jane

Parmley, David Pearl, Peter Physick Sheard, William Sears, and Scott Weese.

To the University of Guelph Library staff village: Your help enabled the motivation, knowledge, and skillsets that I needed to complete this degree. Thank you for Dissertation

Bootcamp which enabled me to meet my exceptional writing partner and friend Amanda Rotella, and positively impacted both my work ethic and focus. Thank you for Writing in the Sciences aids, for help with planning my semesters, months, weeks, and days. Sincerest thanks to Lucia

Costanzo, Victoria Fritz, Lenore Latta, Jacqueline McIssac, and Ali Versluis.

To Rachael Vriezen, it is my firm belief that the quality of writing in this dissertation would not exist without you. Rachael, thank you for taking the time to review many of my chapters. Your comments and advice helped improve my writing, but also, helped me to consider the broader context of my work. Most importantly, you helped me write for the reader. You are an incredible writer and I am eternally grateful to you.

My sincerest and deepest thanks to the new village that comprises my One Health family and colleagues at the University of Calgary: My utmost gratitude extends to Drs. Cindy Adams,

Michele Anholt, Herman Barkema, Sylvia Checkley, John Conly, Rose Geransar, and Karin

Orsel for being so welcoming to me, supporting me in my endeavour to complete my PhD degree while working in the Office of One Health, and contributing your time and expert advice

in helping me to prepare for my PhD defense. I am honoured to know and learn from each of you. Thank you for your kind, gracious, and deliberate efforts in helping me to succeed.

Although unconventional, I would like to express immense thanks to running and ballet.

Ballet has been the most consistent thing in my life since the age of 6. It has helped me through my own personal challenges and continues to provide me with immense joy. Admittedly, I am never so happy as when I am dancing. Ballet and running require structure, creativity, discipline, determination, resilience, and tenacity; these qualities have helped me in all aspects of my life including the completion of this degree. Thank you to ballet teachers and dancers for allowing me to express myself in the physical and, though less commonly, vocal form within your classes.

I would like to thank the village that consists of my friends and family: Aniya, Carlos,

Christina, Hamid, Isabel, Ivy, Jen, Karla, Lara, Liz, Matylda, Ovik, Simone, and my dear classmates from the OVC 2008 Qimmiqs, thank you for defining true and unconditional friendship. Thank you to the village of dogs in my life who were owned as pets, became family, and propelled my love of them into a profession as a veterinarian.

Mum, dad, and Kristian, thank you for continuously believing in me. I was determined to follow my passion and with your encouragement, I felt intrepid. Mum and dad, thank you for always listening and for your unwavering love, advice, as well as your financial and emotional support. I could not have succeeded in completing this degree, or any others past, without each of you by my side. You are the most incredible, altruistic parents; the most positive aspects about myself are because of the time you have devoted to me and the love you continuously bestow on me. Thank you mum and dad, from all that I am. Adam, you are my light, and for every moment that I felt the temptation to give up, your pragmatism, motivation, energy, and positive

reassurances built the rungs that allowed me to continue to climb. Thank you, my love. Sofia and

Margot, I am honoured to be your mother and to example, through your help, what persistence and passion can achieve. In all that you are, in all that you do, be your best selves and never give up. Thank you for helping me to redefine my priorities and realize my full potential. You gave me laughter when I had forgotten its definition, the ability to switch between tasks, and the ability to love unconditionally. These pages are for you. Always remember that you can accomplish whatever you set your minds to.

Finally, One Health is not only my passion and personal philosophy, but my raison d'être as a veterinarian and future epidemiologist. It is my firm conviction that this dissertation would not have existed without the collective efforts of many – we, ours.

DECLARATION OF WORK PERFORMED

Dr. Danielle A. Julien conducted data collection, data management, data analysis, and interpretation of results in collaboration and with advisement from her PhD committee and co- authors. Dr. Danielle A. Julien is the primary author of all chapters as part of this dissertation.

All authors were involved in the study design of the research presented herein.

The conceptualization of Chapters 2 and 3, A Protocol for A Scoping Review to Examine

Studies Investigating Zoonotic Diseases in Canis familiaris in North America Since the

Beginning of the 21st Century and Unleashing the Literature: A Scoping Review of Canine

Zoonoses Research in Canis familiaris in North America respectively, was developed by Drs.

Danielle A. Julien, Jan M. Sargeant, Sherilee L. Harper, and Catherine Filejski. Funding for this project included an Ontario Veterinary College PhD Fellowship awarded to Dr. Danielle A.

Julien. There was no external operating funding. Keyword searches were developed in consultation with Ali Versluis at the McLaughlin Library, University of Guelph. Title/abstract form development, pre-screening, and screening was completed by authors Dr. Danielle A.

Julien, Dr. Jan M. Sargeant and Research Assistant Victoria Waind. Full text screening and data- charting forms were developed in English, and pre-tested by Dr. Danielle A. Julien and Victoria

Waind. Full text screening for eligibility was completed by Dr. Danielle A. Julien and Victoria

Waind for English language texts. French and Spanish full texts were screened by Dr. Catherine

Filejski. Data-charting was completed by Dr. Danielle A. Julien and Victoria Waind for English language publications, and by Dr. Catherine Filejski for French and Spanish language publications. Data extraction and analysis of data were completed by Dr. Danielle A. Julien.

xii

There has been over 14 years of research relating to Acute Gastrointestinal Illness (AGI) in

Arctic Canada conducted by the Indigenous Health Adaptation to Climate Change (IHACC) team, in Iqaluit, Nunavut and Rigolet in Newfoundland and Labrador. From these research endeavours, the highest incidence of self-reported acute gastrointestinal illness (AGI) in the world was reported in Indigenous populations in Iqaluit, Nunavut. To investigate the transmission pathways of gastrointestinal illness in Iqaluit, Nunavut, the People, Animals, Water

& Sustenance (PAWS) project was set up in collaboration with community, government, and public health organizations in 2014. The community in Iqaluit, Nunavut identified dogs, brook water, and clams as suspected sources of previous AGI outbreaks. Drs. Sherilee L. Harper and

Jan M. Sargeant acquired ArcticNet funding for all aspects of Chapter 4, Prevalence and genetic characterization of Giardia spp. and Cryptosporidium spp. in dogs in Iqaluit, Nunavut, Canada - a component of the larger PAWS project. A research planning and prioritization meeting to identify species and pathogen targets was co-designed by Dr. Sherilee L. Harper and Anna

Bunce. Dr. Sherilee L. Harper and Anna Bunce developed and prepared all of the preparatory work for this meeting. The meeting was facilitated by Anna Bunce and Dr. Jan M. Sargeant.

Canine feces in Iqaluit, Nunavut were collected by Anna Bunce, Enooyaq Sudlovenick,

Stephanie Masina, Anna Manore, and Dr. Danielle A. Julien. Parasite tests for the identification of Giardia spp. and Cryptosporidium spp. in canine feces from Iqaluit were conducted at the

Centre for Public Health and Zoonoses Research Laboratory and the Department of Pathobiology at the University of Guelph. Rapid immunoassay tests were performed by Dr. Danielle A. Julien,

Jacqueline Middleton, and Manpreet Saini. Sucrose wet mount microscopy was conducted by

Rachel K. Imai. The plan of conduct for molecular analysis of canine feces and assessments of

xiii

molecular results were advised by Drs. Shu Chen, Rebecca Guy, and Karen Shapiro. Molecular analyses including DNA extraction by Polymerase Chain Reaction (PCR), and DNA sequencing, were conducted by Drs. Shu Chen and Jiping Li, and students at the Laboratory Services

Division, University of Guelph. All knowledge translation materials related to the PAWS project

(Chapter 4) were contributed to by Anna Manore, Stephanie Masina, Carlee Wright and Drs. Jan

Sargeant, Sherilee L. Harper and Danielle A. Julien, with continuous involvement by sled dog team owners, local public health and government officials. Drs. Sherilee L. Harper, Jan M.

Sargeant, and Danielle A. Julien, and Carlee Wright developed the Sled Dog Handbook and social media posts announcing the publication of Chapter 4. Results-sharing meetings of Chapter

4 with the community in Iqaluit, Nunavut which, included the presentation of project results and knowledge translation materials, were attended by Drs. Jan M. Sargeant and Sherilee L. Harper with contribution from Dr. Danielle A. Julien. Statistical analyses for this Chapter was contributed to by Dr. David L. Pearl and Kate Landry (née Patterson). Furthermore, Kate Landry edited an early draft of the methods and results sections.

The conceptualization of Chapters 5, 6, and 7, was developed by Drs. Danielle A. Julien, Jan

M. Sargeant, Sherilee L. Harper, and Catherine Filejski. Drs. Jan M. Sargeant, Sherilee L.

Harper, and Danielle A. Julien were involved with writing grant applications to acquire potential funding from the Ontario Ministry of Agriculture, Food and Rural Affairs (OMAFRA) -

University of Guelph Research Program (2013-14), for the canine zoonoses research project in rural and urban communities in southern Ontario (Chapters 5, 6, and 7). Final funding for this project was acquired from the Canadian Institutes of Health Research, Institute of Population and

Public Health and Public Health Agency of Canada Applied Public Health Research Chair

xiv

supporting Dr. Jan M. Sargeant (2008 – 2012), as well as an Ontario Veterinary College

Fellowship to Dr. Danielle A. Julien. Drs. Jan M. Sargeant, Sherilee L. Harper, Catherine

Filejski, and Danielle A. Julien contributed to the development of survey questions for this project. Dr. Catherine Filejski provided provincial data regarding dog bites in Ontario. Data management and analysis for Chapters 5, 6, and 7 was completed by Dr. Danielle A. Julien.

Writing and manuscript generation was performed by Dr. Danielle A. Julien. Knowledge translation materials in the form of oral and poster presentations conducted as part of the PhD were performed by Dr. Danielle A. Julien with supervision from Drs. Jan M. Sargeant, Sherilee

L. Harper, and Catherine Filejski.

TABLE OF CONTENTS

ABSTRACT ...... ii DEDICATION...... iv ACKNOWLEDGEMENTS ...... v DECLARATION OF WORK PERFORMED ...... xii TABLE OF CONTENTS ...... xvi LIST OF TABLES ...... xix LIST OF FIGURES ...... xxii LIST OF ABBREVIATIONS ...... xxiii LIST OF APPENDICES ...... xxiv

CHAPTER 1 ...... 1 INTRODUCTION, LITERATURE REVIEW, AND THESIS OBJECTIVES ...... 1 INTRODUCTION ...... 2 LITERATURE REVIEW ...... 5 The Benefits of Companion Dogs: An Historical and Cultural Perspective ...... 5 Canine Zoonoses with a Focus on Rabies and Giardia spp...... 10 Dog-Associated Challenges Affecting Public Health and Societal Well-Being ...... 13 The Importance of Geography in the Distribution of Disease in Epidemiology ...... 16 A Brief History of One Health, and its Importance and Application to the Study and Control of Canine Zoonoses...... 19 Cross-Sectional Study Designs in Epidemiology ...... 23 THESIS OBJECTIVES ...... 25 REFERENCES ...... 27

CHAPTER 2 ...... 36 A PROTOCOL FOR A SCOPING REVIEW TO EXAMINE STUDIES INVESTIGATING ZOONOTIC DISEASES IN CANIS FAMILARIS IN NORTH AMERICA SINCE THE BEGINNING OF THE 21ST CENTURY...... 36 INTRODUCTION ...... 37 METHODS ...... 39 DISCUSSION ...... 48 REFERENCES ...... 48

CHAPTER 3 ...... 52 UNLEASHING THE LITERATURE: A SCOPING REVIEW OF CANINE ZOONOTIC AND VECTORBORNE DISEASE RESEARCH IN CANIS FAMILIARIS IN NORTH AMERICA ...... 52 ABSTRACT ...... 53 INTRODUCTION ...... 53 METHODS ...... 57 RESULTS ...... 62 DISCUSSION ...... 65 xvi

LIMITATIONS ...... 72 CONCLUSIONS AND RECOMMENDATIONS ...... 73 REFERENCES ...... 74

CHAPTER 4 ...... 87 PREVALENCE AND GENETIC CHARACTERIZATION OF GIARDIA SPP. AND CRYPTOSPORIDIUM SPP. IN DOGS IN IQALUIT, NUNAVUT, CANADA ...... 87 ABSTRACT ...... 88 INTRODUCTION ...... 89 MATERIALS AND METHODS ...... 91 RESULTS ...... 101 DISCUSSION ...... 103 LIMITATIONS ...... 108 CONCLUSION ...... 108 REFERENCES ...... 109

CHAPTER 5 ...... 123 OUCH! A CROSS-SECTIONAL STUDY INVESTIGATING SELF-REPORTED HUMAN EXPOSURE TO DOG BITES IN RURAL AND URBAN HOUSEHOLDS IN SOUTHERN ONTARIO, CANADA ...... 123 ABSTRACT ...... 124 INTRODUCTION ...... 125 METHODS ...... 128 RESULTS ...... 133 DISCUSSION ...... 136 LIMITATIONS ...... 143 CONCLUSION ...... 144 REFERENCES ...... 145

CHAPTER 6 ...... 157 WHAT DO THEY KNOW? A CROSS-SECTIONAL STUDY TO ASSESS AWARENESS OF CANINE ZOONOSES IN RURAL AND URBAN COMMUNITIES IN SOUTHERN ONTARIO, CANADA ...... 157 ABSTRACT ...... 158 INTRODUCTION ...... 159 METHODS ...... 162 RESULTS ...... 168 DISCUSSION ...... 171 LIMITATIONS ...... 176 CONCLUSION ...... 177 REFERENCES ...... 178

CHAPTER 7 ...... 192

xvii

WHO LET THE DOGS IN? AN EPIDEMIOLOGICAL STUDY QUANTIFYING DOMESTICALLY SOURCED AND IMPORTED DOGS IN SOUTHERN ONTARIO, CANADA ...... 192 ABSTRACT ...... 193 INTRODUCTION ...... 194 METHODS ...... 197 RESULTS ...... 201 DISCUSSION ...... 205 LIMITATIONS ...... 210 CONCLUSION ...... 211 REFERENCES ...... 211

CHAPTER 8 ...... 224 DISCUSSION AND CONCLUDING CHAPTER ...... 224 OVERVIEW ...... 225 KEY FINDINGS AND RECOMMENDATIONS ...... 226 KEY THEMES ...... 230 LIMITATIONS ...... 234 FUTURE DIRECTIONS ...... 237 CONCLUSION ...... 240 REFERENCES ...... 241

APPENDICES ...... 244

xviii

LIST OF TABLES

Table 2. 1 Initial broad search of the literature of one electronic database...... 50

Table 2. 2 Platforms and the electronic databases within which keyword searches will be conducted of canine zoonoses in domestic dogs in North America ...... 51

Table 3. 1 Final search strategy for the conduct of title/abstract screening in MEDLINE® via NCBI® to identify literature on canine zoonoses and vectorborne research in Canis familiaris in North America since the start of the 21st century ...... 80

Table 3. 2 Characteristics relating to publication year, pathogens, study-level, research methods at the dog and pathogen-level, domestic dogs, and whether integrated approaches were described for studies conducted in North American countries categorized as “very high”, “high”, “medium”, and “low” on the Inequality-adjusted Human Development Index ...... 81

Table 4. 1 Fecal prevalence (%) and 95% confidence intervals (95%CI), of Giardia spp. and Cryptosporidium spp. at the: aggregated dog level for sled dogs, sample level when one sample was chosen at random for sled dogs, and sample level for community and shelter dogs in Iqaluit, Nunavut in July, and September 2016 ...... 116

Table 4. 2 Fecal prevalence (%) and 95% confidence intervals (95% CI), of Giardia spp. and Cryptosporidium spp. detected by each parasitological test and calculated at the aggregated dog level for sled dogs, and at the sample level for community dogs, and shelter dogs in Iqaluit, Nunavut in July, and September 2016 ...... 118

Table 4. 3 Pairwise comparisons from final logistic regression models examining the dog level (N=274) associations of dog population (i.e., community dogs (n=104), shelter dogs (n=111), and sled dogs (n=59)) with the odds of fecal presence of Giardia spp. and Cryptosporidium spp. in dog feces from Iqaluit, Nunavut, in September 2016 ...... 119

Table 4. 4 Univariable logistic regression models examining the dog level (N=59) association of the continuous variable team size on the odds ratio (OR) of fecal presence of Giardia spp. and Cryptosporidium spp. in sled dogs in Iqaluit, Nunavut, in September 2016 ...... 120

Table 4. 5 Results of PCR for amplification of parasite DNA in dog fecal samples that were positive on Giardia- or Cryptosporidium-specific parasite tests, collected in Iqaluit, Nunavut in July and September 2016 ...... 121

Table 4. 6 The number (N) of Cryptosporidium spp. and Giardia spp. PCR amplicons for dog fecal samples from Iqaluit, Nunavut in July, and September 2016. The number (n) of C. canis

xix

species and the number and type of G. intestinalis assemblages sequenced from amplicons at each gene locus are also presented...... 122

Table 5. 1 Descriptive demographic information from an online questionnaire of all respondents (N=2,006) including rural (n=1,002) and urban (n=1,004) in southern Ontario, Canada ...... 150

Table 5. 2 Respondent-owned dog (N=1,345) demographics as reported by rural and urban dog- owning respondents (N=975). This subset of dog-owning data was collected from an online questionnaire of N=2,006 respondents (n=1,002 rural and n=1,004 urban) in southern Ontario, Canada...... 151

Table 5. 3 The frequency and incidence risk (%) of household member dog bite occurrences as self-reported by respondents. Dog bite information is presented by residential location, and by dog-owning and dog-free households. Data were collected from an online questionnaire of N=2,006 respondents (n=1,002 rural and n=1,004 urban) in southern Ontario, Canada ...... 153

Table 5. 4 Self-reported dog bite incident data including victim-level profiles (N=203) and biting dog characteristics. This subset of data was collected from an online questionnaire of N=2,006 respondents (n=1,002 rural and n=1,004 urban) in southern Ontario, Canada ...... 154

Table 5. 5 Univariable and multivariable models to determine whether a significant difference in dog bites existed between rural and urban households in southern Ontario and between dog- owning and dog-free households. Data were collected from an online questionnaire of N=2,006 respondents (n=1,002 rural and n=1,004 urban) in southern Ontario, Canada ...... 156

Table 6. 1 Descriptive statistics pertaining to respondent characteristics from an online cross- sectional questionnaire conducted in southern Ontario, Canada ...... 183

Table 6. 2 Descriptive statistics pertaining to respondent awareness, knowledge, and levels of concern about canine zoonoses from an online cross-sectional questionnaire conducted in southern Ontario, Canada...... 184

Table 6. 3 Descriptive statistics pertaining to possible pathways of canine contact among all respondents outside of their households (i.e., not owned by the household), and owned canine contact with wildlife and feces as reported from an online cross-sectional questionnaire conducted in southern Ontario, Canada ...... 187

Table 6. 4 Logistic regression analyses to determine whether awareness of canine zoonoses differed between rural and urban respondents in southern Ontario at three levels: 1) for all respondents, 2) dog-owning respondents, and 3) dog-owning respondents who used a veterinarian. Potential confounders were forced into each model. Data were collected from an online cross-sectional questionnaire conducted in southern Ontario, Canada ...... 190 xx

Table 7. 1 Descriptive proportions of household demographics from an online questionnaire investigating the domestic sourcing and importation of dogs as pets in southern Ontario, Canada ...... 215

Table 7. 2 Descriptive characteristics of domestically sourced dogs as pets from provinces/territories within Canada ...... 216

Table 7. 3 Descriptive characteristics of dogs imported as pets from outside of Canada into southern Ontario during a seven-year period ...... 219

Table 7. 4 Univariable and multivariable models to determine whether the importation of dogs differed between rural and urban households in southern Ontario. Potential confounders included in the multivariable analysis were: total number of household occupants and gross household income. Data were collected from an online questionnaire administered in southern Ontario, Canada...... 223

xxi

LIST OF FIGURES

Figure 3. 1 PRISMA© flow chart detailing the number of title/abstract citations identified, duplicates removed, full texts included and excluded, and the reasons for their exclusion ...... 84

Figure 3. 2 Map showing the number of eligible canine zoonoses and vectorborne studies of domestic dogs conducted in the sovereign states and dependent territories of North America between 2000 and 2018 ...... 85

Figure 3. 3 The number of studies of canine zoonoses and vectorborne diseases in domestic dogs conducted in the sovereign states and dependent territories of North America, categorized as “very high”, “high”, “medium”, and “low” on the Inequality-adjusted Human Development Index (IHDI), between 2000 and 2018 ...... 86

Figure 4. 1 A map indicating the country Canada (outlined in black), the territory of Nunavut (darker green), and the study location, the territorial capital Iqaluit ...... 115

xxii

LIST OF ABBREVIATIONS AAHA American Animal Hospital Association AE Alveolar echinococcosis AGI Acute gastrointestinal illness AHA American Heartworm Association ASV Association of Shelter Veterinarians BLAST Basic Logic Alignment Search Tool CAHI Canadian Animal Health Institute CDC Centers for Disease Control and Prevention CFIA Canadian Food Inspection Agency CI Confidence interval DNA Deoxyribonucleic acid DSL Digital Subscriber Line GDP Gross Domestic Product GERD Gross Domestic Expenditure on Research and Development GPS Global Positioning System IHACC Indigenous Health Adaptation to Climate Change ITK Inuit Tapiriit Kanatami MRSA Methicillin-resistant Staphylococcus aureus NIRI Nunavut Innovation and Research Institute OECD Organisation for Economic Cooperation and Development OIE World Organisation for Animal Health OMAFRA Ontario Ministry of Food, Agriculture and Rural Affairs OR Odds Ratio PAHO Pan American Health Organization PAWS People Animals Water and Sustenance Project PCR Polymerase Chain Reaction PHAC Public Health Agency of Canada PRISMA Preferred Reporting Items for Systematic Reviews and Meta-Analyses REB Research Ethics Board RNA Ribonucleic acid SE Standard Error SPCA Society for the Prevention of Cruelty to Animals SYREAF Systematic Reviews for Animals and Food UNDP United Nations Development Programme WHO World Health Organization

xxiii

LIST OF APPENDICES

Appendix 2. 1 Publicly available online information regarding canine zoonoses and vectorborne diseases from relevant region-specific organizations ...... 245

Appendix 2. 2 Explanation and elaboration (“guidance”) document for reviewers for title/abstract (Level 1) screening ...... 246

Appendix 2. 3 Explanation and elaboration (“guidance”) document for reviewers for full text (Level 2) screening ...... 247

Appendix 2. 4 Explanation and elaboration (“guidance”) document for reviewers for data- charting (Level 3 screening) ...... 251

Appendix 2. 5 Comprehensive list of canine zoonotic and vectorborne pathogens identified with the scoping review ...... 260

Appendix 4. 1 Laboratory Methods for the Molecular Detection and Characterization of Giardia spp. and Cryptosporidium spp. in canine fecal samples from Iqaluit Nunavut Canada ...... 264

Appendix 4. 2 The People, Animals, Water and Sustenance Project - Sled Dog Summary ..... 269

Appendix 5. 1 Questionnaire for human exposures to dog bites in southern Ontario, Canada . 271

Appendix 6. 1 Questionnaire for knowledge and awareness of diseases that humans can get from dogs in southern Ontario, Canada ...... 292

Appendix 7. 1 Questionnaire for sources of dogs as pets in southern Ontario, Canada ...... 296

xxiv

CHAPTER 1

INTRODUCTION, LITERATURE REVIEW, AND THESIS OBJECTIVES

INTRODUCTION

Companion animals are an integral part of human life across cultures, societies, and economies (Robertson et al. 2000). Small companion animals include companion dogs (hereafter referred to as “dogs”), which are one of the most common pets worldwide. The population of dogs within households in “very high” and “high” human development index countries has increased compared to the 1980s and 1990s (Chomel 2014, Rowan 2018). The Canadian Animal

Health Institute estimates that there are close to eight million domestic dogs in Canada, with approximately 41% of households owning at least one dog (Canadian Animal Health Institute

2017). Dogs provide companionship, but there is also evidence that dog ownership may be linked to human health (Wells 2007), as dogs provide a source of physical activity and an overall sense of well-being to their human companions (Chomel and Sun 2011, Hodgson and Darling

2011). Furthermore, the majority of dog owners regard their dogs as members of the family; some even consider their dogs to be children (Chomel and Sun 2011).

Although dog ownership offers benefits, there are also well-documented hazards.

Zoonoses are diseases that are naturally transmissible between vertebrate animals and humans, and account for over 60% of all human infectious diseases (Taylor et al. 2001a, Karesh et al.

2012). A variety of parasitic, bacterial, fungal, and viral pathogens can be transmitted to humans from dogs (Robertson et al. 2000). As there are a substantial number of dog-owning households in Canada, and a large number of people who share close living environments and relationships with dogs, it is important to consider the public health implications of dog ownership, including the potential transmission of canine zoonoses that can occur as a result of the interactions

between humans and dogs. Although canine zoonotic infections are prevalent in Canada and around the world, there are few canine zoonoses that result in a high burden of illness (e.g., health complications or the loss of life) in either dogs or people, with the exception of rabies.

However, canine zoonoses can lead to public health challenges; for instance, when there are increased incidences of rare or previously nonendemic pathogens (e.g., the recent rabies insurgence in wildlife and some pets, (Canadian Food Inspection Agency 2017)), leading to adverse health outcomes that may burden humans and dogs and public health resources.

Additionally, when there are newly suspected and/or confirmed modes of canine zoonotic infection, there is potential compromise to the health and well-being of other animals and humans (Chomel 2014). For example, a study identified puppies as a suspected exposure for acute gastrointestinal illness in humans in Arctic Canada, thus illustrating a route for zoonotic pathogen transmission from dogs with the potential to compromise the health of humans

(Goldfarb et al. 2013, Iqbal et al. 2015). Such canine zoonotic challenges are evident within many geographic locations across Canada (Alton et al. 2009, Procter et al. 2014, Bouchard et al.

2015).

The direct and indirect links between human, animal, and environmental health have been increasingly recognized since the beginning of the 21st century, and there is now a greater focus on emerging and re-emerging diseases, including zoonoses (Cunningham et al. 2017). The philosophy of One Health recognizes the complex interconnections between humans, animals, and their social and ecological environments, and thus the framework promotes integrated approaches to human and animal health while being cognizant of social and environmental

contexts (Zinsstag et al. 2011). Health geography, a subset of human geography, considers the outcomes of health, well-being and disease from a holistic perspective that not only encompasses society and space, but also emphasizes the importance of the role of place, location and physical geography (Dummer 2008). This dissertation focuses broadly on the prevalence and incidence of canine zoonoses within the context of health geography. This context regards the interactions of people and dogs within their shared environments and considers potential contributing factors to zoonotic disease.

Where possible and appropriate, this dissertation adopts and supports the One Health research philosophy. The research chapters that contribute to this dissertation focus specifically on bacterial, parasitic, and viral zoonoses related to dogs and span three different geographical locations in Canada: rural and urban southern Ontario, and remote Iqaluit, Nunavut. However, to position oneself to understand the importance and implications of canine zoonoses, it is crucial to understand the historical context through which the domestication of dogs arose, the socio- ecological relationships between humans and dogs in modern society, and the epidemiology of some of the more common and serious canine zoonoses that exist. The following literature review aims to examine these crucial topics as well as describing the benefits of domestic dog ownership and their importance to humans. The review then examines some of the public health challenges of dog ownership and human-dog interactions, with particular focus on social (history and culture) and environmental contexts (geography and place). Furthermore, the review includes a brief history of One Health and its application to the study and control of canine

zoonoses. Finally, the review highlights the current gaps in knowledge pertaining to canine zoonoses in domestic dogs and provides rationale for the conduct of the research herein.

LITERATURE REVIEW

The Benefits of Companion Dogs: An Historical and Cultural Perspective

Dogs and humans have co-existed for thousands of years (O’Haire 2010, Morand et al.

2014). Evidence of the origins of the domestic dog can be traced back to wolves (Canis. lupus pallipes and Canis lupus variabilis) - the ancestors of the domestic dog (Canis familiaris) - who cohabitated with humans over 15,000 years ago as their companions, first as part of nomadic and hunter/gatherer societies and then within agricultural settlements and homes (O’Haire 2010,

Macpherson 2012). In the 1970s, archaeologists discovered the remains of a human embracing a puppy in a 12,000-year old tomb in modern Israel (Davis and Valla 1978). As time progressed in western society, humans and their dogs formed a true social grouping; that is, humans became pack leaders, masters, and owners of dogs, and dogs became members of the family unit and/or providers of services to humans (Macpherson 2012). The pack mentality benefits both dogs and humans, and exemplifies the crucial hierarchical structure for the successful relationship between humans and dogs (Macpherson 2012). In contrast to the pack leader hierarchy, when the dog is dominant within the familial structure, or when there is a lack of clarity regarding the roles of humans and dogs, inappropriate behaviours and negative consequences can ensue, including human exposure to dog bites (Macpherson 2012).

By the middle of the 20th century, the concept of dogs as family members became more common (Udell and Wynne 2008, Chomel and Sun 2011). Research on the benefits of dogs to human health dates back to the 1980s, and both past and current research promotes the importance of human attachment to dogs (McNicholas et al. 2005, Friedmann and Son 2009,

O’Haire 2010). The term “Zooeyia” was developed to describe the positive impacts that animals can have on human health (Hodgson and Darling 2011). Dogs confer joy, service, a sense of security and protection, and physiological support to their owners, and research indicates that dog companionship promotes quality of life, social development, and positive inspiration for humans (Wood et al., 2005; Endenburg et al., 2011). For example, dogs are utilized as service animals for persons with disabilities and for the elderly, and evidence suggests that persons with disabilities experience more social interaction and acceptance from others, including children, when a service dog is present than when it is not (Hart et al. 1987). Dog walking has the potential to confer health benefits in humans from increased physical activity (Johnson et al.

2011). Additionally, the emotional bond between owners and dogs can be as crucial to the owner as relationships between themselves and other humans, and, in some cases, may surpass the psychological benefits of human-human relationships (McNicholas et al. 2005). Many people have such strong emotional attachments to their dogs that they choose to risk their own lives to assure the safety of their dogs (Sable 2013). Furthermore, there is evidence to suggest that dog ownership can contribute to healthier and happier lives for people of various ages (Raina et al.

1999): for example, not only is there evidence that children raised with dogs demonstrate developmental advantages, but children brought up with dogs as pets exemplify better empathy,

social skills, and confidence than children who were not brought up with dogs (Purewal et al.

2017). Thus, owning and being around dogs confers positive impacts that have a varied and multidimensional effect on people. Indeed, dogs provide significant and beneficial effects in those who own them, but also in those with whom they come into contact (Oxley et al. 2018).

The community as a whole can benefit from the presence of a dog; dogs in communities provide a sense of safety, and owners are more likely to be engaged with other members of the community as compared with non-dog owners (Wood et al., 2007). Therefore there are clearly many benefits to both owning and having dogs within western societal structures (McNicholas et al. 2005, Voith 2009, Sable 2013).

In Canada, dogs are highly important to and integral for many Indigenous Peoples and an historically complex relationship exists between dogs and many Indigenous Peoples in Arctic

Canada. Indigenous Peoples in Canada comprise First Nations, Métis, and Inuit. As the majority of Indigenous Peoples living in Arctic Canada are Inuit (Hotez 2010), Inuit will be the focus herein. Inuit, meaning “the people”, are Indigenous people whose homeland is Inuit Nunangat

(“lands, waters and ices of the [Inuit] people”) (Inuit Tapiriit Kanatami 2014). This geographic area includes four settled land claim regions in northern Canada: Nunavik, Nunatsiavut,

Inuvialuit, and Nunavut comprising 50 percent of the Canadian coastline and approximately 35 percent of the landmass in Canada (Inuit Tapiriit Kanatami 2018).

Qimmiit (qimmiq sing.) are Inuit sled dogs (Qikiqtani Inuit Association 2014). Qimmiit accompanied Inuit ancestors, the Thule, to Alaska and settled with humans in Arctic Canada just over 1,000 years ago. In addition to the Siberian husky, Samoyed, and the Malamute, Inuit sled

dogs comprise one of the four North America Arctic breeds of dog. Historically, Inuit and their qimmiit lived and hunted together for incalculable generations (Qikiqtani Inuit Association

2014). The human-dog relationship exhibited in many Inuit populations can contrast with the human-dog bond in western society: Qimmiit have been vital to Inuit as companions in their way of life, in their cultural identity, and as part of their societal beliefs (Aenishaenslin et al. 2018).

For example, for generations qimmiit provided many Inuit with their only means of transportation and protection while out on the land during the winter. Qimmiit carried packs, defended Inuit against polar bears, alerted Inuit to seal holes and ice cracks, and led their way through fog and darkness (Qikiqtani Inuit Association 2014). Until the late 1960s, for many

Inuit, qimmiit were a means of access to food, an indication of perceptions of the hunting abilities and masculinity of Inuit men, and were indicative of the graduation of Inuk boys to Inuk men (Qikiqtani Inuit Association 2014). Puppies were given to children to raise, and an Inuk boy was determined to be mature and ready to become a man when he could raise and be responsible for an entire team of qimmiit (Qikiqtani Inuit Association 2014). In further contrast to western society, by traditional practice, qimmiit were not perceived as property, but rather were allowed to roam freely in society (Daveluy et al. 2011).

In 1929, the Northwest Territories adopted An Ordinance Respecting Dogs on the premise of protecting dogs and people from random and unjustified harm (Daveluy et al. 2011).

The Ordinance, which was modelled on southern Canadian law and developed without consultation or advice from Inuit or consideration for the relationship between Inuit and qimmiit, made it illegal for dogs to roam freely in designated areas including the regions of Inuit

Nunangat (Qikiqtani Inuit Association 2014). Therefore, as per The Ordinance, any free-roaming dogs in Inuit communities were killed. The demise of dogs in Inuit communities was both traumatic and profound for many Inuit (Qikiqtani Inuit Association 2014). The deaths of qimmiit effectively reduced the ability of many Inuit to hunt and support themselves and their families

(Qikiqtani Inuit Association 2014). Despite the complex history, qimmiit remain an essential and central part of Inuit culture and society (Aenishaenslin et al. 2018).

In the conduct of epidemiological research in western and Inuit societies, it is vital to consider differences in the culture, history, and relationships between dogs and humans in each respective community. Furthermore, it is crucial to actively and genuinely engage with community members, including an openness and willingness by researchers to learn, understand, and respect the connections between people and dogs in the community. Not only can actively and genuinely engaging with the community inform and lead the research, these actions have the potential to provide a foundation from which research findings can be presented, discussed, and contextualized in a culturally appropriate and sensitive manner. However, it is not enough to simply engage with communities. The Inuit Tapiriit Kanatami (ITK) is a national organization representing the rights and interests of 65,000 Inuit in Canada, the majority of whom reside in

Inuit Nunangat (Inuit Tapiriit Kanatami 2018). According to ITK’s National Inuit Strategy on

Research, it is imperative that researchers and research institutions respect Inuit self- determination not only by engaging with communities but, more importantly, by conducting research in partnership with Inuit to improve value, impact, and effectiveness of research (Inuit

Tapiriit Kanatami 2018).

Canine Zoonoses with a Focus on Rabies and Giardia spp.

The role of companion animals, including dogs, in the transmission of zoonotic diseases has been recognized worldwide (Chen et al. 2012, Day et al. 2012, Esch and Petersen 2013).

Due to their potential to adversely impact the health of people and animals, some concerning canine zoonotic pathogens include parasites (e.g., Echinococcus multilocularis, Giardia intestinalis, Leishmania chagasi, Toxocara canis), bacteria (e.g., Salmonella spp., Leptospira spp., Brucella spp.), and viruses (e.g., rabies virus, and Influenza spp.) (Chomel 2014,

Ghasemzadeh and Namazi 2015). However, in public health, the role of many companion animal zoonoses is often misunderstood and under-recognized by pet owners and healthcare providers

(i.e., doctors and veterinarians) (Day et al. 2012). In Canada, with the exception of rabies, many zoonotic pathogens transmitted by dogs are not reportable (Government of Canada 1990), and therefore the true contribution of canine zoonoses as a public health challenge is largely unquantified and may be under-recognized. Yet, canine zoonoses can negatively impact the health of humans and usurp public health resources (Macpherson 2012).

As human and canine populations continue to increase, living spaces are likely to become more compact, and the convergence of public health issues related to dogs within the human social environment may occur (Udell and Wynne 2008). In general, the evolution of the human- dog relationship, including the increasingly close contact between humans and dogs, provides opportunities for the transmission of certain zoonotic pathogens (Damborg et al. 2016). Dogs can constitute reservoirs or intermediate hosts of canine zoonoses and can be a source of pathogen transmission through direct contact (e.g., licking, petting) or indirectly through canine

contamination of domestic environments and food (Day et al. 2012, Damborg et al. 2016).

Despite the potential for zoonotic infection, the surveillance of canine zoonoses is not mandated under any international health agency, and globally, canine zoonotic disease surveillance is minimal (Day et al. 2012). With an increasing number of dogs as pets in Canada, evidenced by the change in national proportion of dog populations from 2014 to 2016 (Canadian Animal

Health Institute (CAHI) 2017), there is the potential for a change in the proportion of canine zoonoses that can potentially be transmitted from dogs to humans (Anderson et al. 2016).

Each year, approximately 55,000 people die from the rabies virus; the fatality rate for rabies virus in humans is nearly 100% (World Health Organization 2013). Ninety-nine percent of people who develop rabies are exposed via domestic dogs (C. familiaris) (World Health

Organization 2013, Taylor et al. 2017a). As compared to some low-income countries in Africa and Asia, deaths as a result of canine rabies are not common in higher income countries, and this lower relative number of deaths has been attributed to mandatory dog leash laws combined with widespread canine rabies vaccination (Burgos-Cáceres 2011). Despite differences in global mortality attributed to rabies, canine rabies in higher income countries still comprises an important public health challenge, which is exacerbated by public non-compliance with canine rabies vaccination that in many countries is required by law (Chomel 2014). For instance, since the 1960s, human rabies cases, via a canine transmission route, in Canada have been extremely rare, due in part to successful rabies vaccination programs (Middleton et al. 2015). However, after four years of no cases of rabies being identified due to terrestrial animal strains, the emergence of raccoon rabies in southern Ontario Canada has threatened the health of domestic

pets, including dogs, which poses a particular risk of rabies transmission in dogs not vaccinated against the virus (Filejski 2016, Canadian Food Inspection Agency 2017).

Giardia spp. is another important pathogen that may be transmitted to humans via dogs.

Giardia spp. is a common cause of gastrointestinal illness in humans and animals worldwide

(Bouzid et al. 2015), and it is considered a pathogen of significant public health importance due to its high incidence and burden of infection (e.g., diarrhoeal disease) in both low- and high- income countries (Feng and Xiao 2011). Human infections by Giardia are most often the result of person-to-person fecal-oral transmission or the result of contamination of food and/or water consumed by humans (Prystajecky et al. 2014). Surveillance systems for Giardia in Canada do not collect information on the source of infection; that is, whether infections occur through person-to-person contact, environmental sources, drinking water, or animal contact (Murphy et al. 2016). Giardia is found in a wide range of animal hosts including livestock and dogs, and there are several species and assemblages of Giardia which are host-specific or can be transmitted between species (Feng and Xiao 2011). In humans, molecular epidemiology of giardiasis suggests that generally only G. intestinalis assemblages A and B are connected with human infections (Feng and Xiao 2011). There is evidence to suggest that dogs are implicated in the transmission of zoonotic giardiasis, specifically Giardia intestinalis assemblage B; however, the magnitude of infectivity in humans via a canine transmission route is neither well-known nor well-understood (Bouzid et al. 2015). Thus, the human disease burden attributable to Giardia intestinalis of canine origin is lacking (Feng and Xiao 2011).

In Canada, there is limited understanding of exposures that might contribute to gastrointestinal illness in subsets of the human population that are at-risk, vulnerable, or resource-restricted (Majowicz et al. 2007, Harper et al. 2011, Thomas et al. 2017). Many

Indigenous Peoples in Canada are disproportionately affected by endemic protozoan zoonoses, including Giardia, which may be due to the changing climate, landscape, and the introduction of zoonotic pathogens from temperate geographical locations into Arctic Canada, which have subsequently become endemic (Jenkins et al. 2011). Zoonotic and foodborne transmission of

Giardia is also of concern in Arctic Canada, and researchers have postulated that food and water contamination might occur through contact with wildlife and dogs (Iqbal et al. 2015).

Researchers and community members have expressed concerns regarding the risks to public health from dogs, particularly within populations in certain geographic regions of Arctic Canada, including Inuit communities in Iqaluit, Nunavut (Iqbal et al. 2015). The gaps in knowledge regarding the number and types of species of Giardia spp., and the limited understanding of dogs as potential exposures to gastrointestinal illness residents in Iqaluit, Nunavut, warrants an epidemiological investigation of the prevalence and characterization of Giardia in this region of

Arctic Canada.

Dog-Associated Challenges Affecting Public Health and Societal Well-Being

Many companion animal-related public health challenges in western society originate from or involve dogs in some capacity (Macpherson 2012). Dogs are one of the most common household pets particularly within modern and urbanized society (Chomel and Sun 2011). Dog- associated public health challenges can impact owners, entire households, and neighbourhoods

and communities more broadly. Some of the more concerning dog-associated challenges to public health include human exposure to dog bites and the transmission of canine zoonoses through human-dog contact and through environmental contamination from canine feces and urine (Damborg et al. 2016).

Dog biting incidents can occur between dogs and other animals (e.g., wildlife, livestock, and other pets), and between dogs and humans. Human exposure to dog bites can result in emotional and physical trauma for the victim; subsequent emotive results can include fear of dogs and fear of being attacked by dogs. In terms of disease transmission, dog bites constitute one of the main sources of dog-human zoonotic bacterial infections, which are caused by commensal bacteria in the mouth of dogs and on the skin of humans (e.g., Pasteurella canis, Capnocytophaga canimorsus) (Damborg et al. 2016). These infections can lead to debilitating consequences in humans, depending on the anatomical location and type of bite injury that ensues (e.g., wound infections), pathogen(s) involved, wound care and the time within which the wound is addressed, and immune status of the victim (Damborg et al. 2016). A more deleterious outcome of human exposure to dog bites involves the potential for the transmission of rabies. As domestic dogs remain the main reservoir for lyssavirus transmission to humans outside of Canada and the United States, human exposure to dog bites represents a serious public health challenge of global concern because of the potential transmission of rabies (WHO et al.

2015). Dog bites can be categorized according to characteristics of the victim (e.g., age, gender), characteristics of the biting dog (e.g., age, sex, breed), and/or the context in which the bite occurs

(e.g., residential location, within or outside the household, human–animal interaction preceding

the bite). Understanding information related to the victim, the biting dog, and the context of the bite is essential in developing public health policy, education and strategies relating to the prevention of victim trauma and zoonotic risks associated with the transmission of dog bite associated infections (Macpherson 2012).

Dog-associated public health challenges are not restricted solely to western societies and have been identified in multiple cultures despite differences in the history and the nature of human–dog interactions (Bingham et al. 2010, Macpherson 2012, Stull et al. 2015,

Aenishaenslin et al. 2018). In Inuit communities in Inuit Nunangat, a number of public health challenges posed by dogs exist; these challenges include human exposures to bites, aggression, and dogs as potential sources of zoonotic parasites (Aenishaenslin et al. 2018, Julien et al. 2019).

Rabies is endemic in wildlife (i.e., Arctic foxes) in Nunavik and Nunavut, and rabies-naïve dogs

(i.e., unvaccinated dogs or dogs not up to date on vaccination) may become infected with the virus if bitten by infected wildlife (Aenishaenslin et al. 2014, Government of Nunavut 2018).

Therefore, dog bites remain a potential source of rabies transmission to humans in Nunavik and

Nunavut (Aenishaenslin et al. 2014).

The study of dog-associated public health challenges falls under the purview of public health research, and the complex relationships between human-dog bonds and disease risks also constitute important One Health issues (Udell and Wynne 2008). Thus, investigating and addressing the complex nature of canine zoonoses, both as a primary dog-associated public health concern and as a One Health challenge, requires coordinated actions by authorities responsible for human and animal health with significant consideration for culture and context.

The Importance of Geography in the Distribution of Disease in Epidemiology

In epidemiology, information regarding the rate or risk of diseases in relation to place is a critical first step toward understanding disease (Martin et al. 1987). Initial epidemiological investigations, particularly within geographic locations in which previous research is limited or non-existent, help to provide data regarding the frequency and distribution of disease from which decisions for the prevention and control of disease in populations can be based (Martin et al.

1987). Geography is an important consideration in epidemiology; this is because human and animal behaviours, conditions (e.g., climatic, environmental, living), exposures that influence disease incidence or prevalence, and the determinants of health can and do differ by geographic location (Lambin et al. 2010). The occurrence of, and change in, risk of disease may be higher or lower in different geographic areas for various reasons, many of which concern aspects of the host (e.g., age, sex, level of education, socioeconomic status), the vector (e.g., whether the vector is endemic, rare, or absent within the geographical location), or the agent of disease (e.g., features of the bacteria, virus, protozoa, fungi, helminths, or features of the agent environment)

(Martin et al. 1987). Notwithstanding other determinants of health, research from the disciplines of epidemiology, public health, and geography indicate that the location in which people live can impact human health outcomes (Tunstall et al. 2004, Acevedo-Whitehouse and Duffus 2009,

Lacetera 2019). The distribution of differences in health outcomes can range from global divergences in healthy life expectancy (World Health Organization 2019), differences in the rates of disease within different regions of the world (Shaw et al. 2000, Murray and Lopez

2013), variations of within-country health outcomes (Frohlich et al. 2006), and disparities in

access to health services and resources within specific locales (Adelson 2005, King 2009,

Jenkins et al. 2011, Aenishaenslin et al. 2018).

As with other types of diseases, the geographic distribution of zoonoses may be influenced by both abiotic and biotic factors, including differences in air, soil, water and climate, as well as differences in the relationships between animals, humans, and the environments they share (Martin et al. 1987). Assessments of zoonotic diseases by place provide information on the geographic extent of the zoonotic challenge, and may also provide insights into the identity and origins of specific pathogens (Esteve-Gassent et al. 2014). To our knowledge, there have been no studies conducted to investigate public health challenges related to canines specifically in rural and urban communities in southern Ontario, Canada. Knowledge and awareness of the proportion of owned pets, and of the dynamics associated with pet-ownership, is important for the planning and implementation of public health strategies regarding zoonotic disease awareness, prevention and control information, and for the promotion of responsible dog ownership; all of which underscore the rationale for the conduct of this research. For this research we engaged in a collaborative epidemiological framework primarily aimed at gaining a better understanding of rural and urban perspectives. These perspectives may be linked to policy impacts on public health challenges related to dogs while providing guidance for the conduct of future studies framing their research within the rural and urban contexts.

In rural and urban southern Ontario, which accounts for approximately 15% of the land mass of entire province and is defined at its northern limit by the union of the Mattawa and

Ottawa rivers below the Quebec border and east of Lake Nipissing (Horn et al. 2019), and in

remote Nunavut, Canada, there exist certain commonalities: in these three regions there are human and canine populations, there is a paucity of research regarding public health challenges related to canines, there are suspected and confirmed zoonotic pathogens (e.g., Cryptosporidium parvum, Giardia intestinalis, and the rabies virus) (Jacobs et al. 2001, Shukla et al. 2006, Iqbal et al. 2015, Curry et al. 2016), and dogs are an important source of societal companionship and human well-being (Leslie et al. 1994, Qikiqtani Inuit Association 2014). However, there are distinct differences across these geographic areas, including differences in culture, climate, densities of human populations, breeds of dogs, and endemicities of canine zoonotic pathogens.

For instance, the human population of southern Ontario is approximately 12.7 million, which accounts for close to 95% of the provincial population and about 35% of the national population

(Statistics Canada 2016a). In contrast, in 2016 the population of Nunavut was just over 35,000 residents (Statistics Canada 2017a). Toronto, the capital city of the province of Ontario, had a human population of over 2.7 million in 2016 (Statistics Canada 2017b). In contrast, the human population of Iqaluit, the capital city of the territory of Nunavut, was just over 7,000 residents, close to 60% of whom identify as Indigenous, and primarily Inuit (Statistics Canada 2016b). In rural and urban communities, dog population density is related to the different habitats, cultures, and socio-economic structures of human populations, and also to different epidemiological factors (Ortega-Pacheco et al. 2007). It is possible that differences in culture, climate, and the population densities of human and dogs between rural and urban southern Ontario and remote

Iqaluit, Nunavut account – at least in part - for the differences in pathogen prevalence, incidence, and in the potential transmission of canine zoonoses between human and dog populations in

those two locations. The study of dog ownership and canine zoonoses of interest in rural and urban southern Ontario, and in Iqaluit, Nunavut, can serve to establish baseline information for understanding the epidemiology of canine zoonoses. However, distinct differences in geography, history, and culture must be taken into consideration, especially during the planning and execution of research investigations, as well as in the implementation of public education strategies for canine care, husbandry, and the control of canine zoonotic diseases.

A Brief History of One Health, and its Importance and Application to the Study and Control of Canine Zoonoses

The importance of the One Health approach in the prevention and control of zoonoses is evident (Bidaisee and Macpherson 2014). Increasingly, the philosophy of One Health has been advocated as a means to address complex global health challenges and as an essential paradigm for the management of global health (Day 2011). By definition, the One Health approach provides a worldwide strategy for collaboration and communication across disciplines relating to animal, human, and environmental health at the local, national, and international scale (Rabozzi et al. 2012). However, the One Health approach is largely unknown outside of health sectors and institutions focusing on infectious diseases, particularly zoonoses (Rabozzi et al. 2012). This is not entirely surprising given that the One Health paradigm was predominantly marked by the work of physicians and veterinarians in the 18th, 19th, and 20th centuries (Evans and Leighton

2014, Takashima and Day 2014). In 18th century France, Claude Bourgelat, considered the father of veterinary education, recommended a comparative approach to human and animal medical science (Takashima and Day 2014). During the 19th century, Canadian physician

William Osler, known as the father of veterinary pathology, expressed interest in the connections 19

between the health of humans and animals. In the same century, German physician Rudolf

Virchow documented the link between diseases of humans and those of animals, and created the term “zoonosis” (Schultz 2008, Saunders et al. 2017). In the 1980s, veterinarian and epidemiologist Calvin Schwabe created and popularized the term “One Medicine” to emphasize the close relationship between animal and human health, and to encourage veterinary and human health professionals to collaborate on controlling and preventing zoonoses (Schwabe 1984).

Since the 1980’s, building on the definition of “One Medicine”, the “One World One

Health” approach, now “One Health”, also incorporates ecosystem health (Gibbs 2014,

Destoumieux-Garzón et al. 2018). There is no single One Health framework, but evidence suggests that since 2010, One Health principles have been incorporated and applied as part of international frameworks for the control and reduction of infectious diseases at the animal human ecosystems interface (Gibbs 2014). Such frameworks have sought to encourage transdisciplinary

(regarding more than one field of knowledge) and holistic approaches to health challenges, and to direct multisectoral expertise towards disease mitigation (Day 2011, Stephen and Karesh

2014, Schurer et al. 2016).

Central to One Health is the surveillance of infectious diseases in wild and domestic animals to detect the emergence of novel zoonoses at the human-animal-ecosystem interface

(Day 2011, Cunningham et al. 2017). However, although there are existing systems in place for the surveillance of human and production animal diseases at the national and international levels, there are still major gaps in surveillance of diseases shared between humans and companion animals (Day 2011). With a growing number of pets worldwide, including dogs, and with close

interactions between humans and pets, companion animals are meaningful within the global One

Health agenda with regard to their impact on the health and well-being of humans and our shared environment (Takashima and Day 2014). The benefit of dogs to the health of humans is of direct

One Health importance: not only can dogs provide a sense of well-being for humans, but under the umbrella of comparative medicine, dogs also provide models for research into certain neoplastic, allergic, autoimmune, and degenerative disorders that also affect humans (Takashima and Day 2014). Furthermore, dogs can act as both sources and sentinels of zoonotic disease in human populations (Day et al. 2012). In addition to humans, the close connection that dogs may have with wildlife presents opportunities for the direct or indirect exchange (e.g., via vectors, contaminated feces, and urine) of pathogens (Day 2011). Free-roaming dogs in rural communities may be more often exposed to wildlife, and the connection and potential for exchange of zoonoses is also possible for dogs in urban areas where there are wildlife including raccoons, foxes, and wild rodent species (e.g., mice, rats, voles) (Day 2011). Human-dog and dog-wildlife interactions and exchange of pathogens illustrate one of many existing reasons why a collaborative One Health approach to health is imperative.

Compared to traditional siloed approaches to health research, the One Health approach provides benefits including the potential for improved resource efficiency and enhanced understanding of health impacts and their solutions (Lebov et al. 2017). However, in the conduct of health research, it is important that studies focus on the ways in which One Health approaches are actually implemented and not simply on how they are defined (Zinsstag et al., 2012; Evans and Leighton, 2014). In line with this imperative, two major shortcomings of canine zoonotic

research are clear: first, despite the public health importance of many canine zoonoses, studies that propose the application of the One Health approach and/or its framework to the control and prevention of canine zoonoses have almost exclusively focused on rabies and have infrequently examined other zoonotic diseases (Vercauteren et al. 2012, Cleaveland et al. 2014, Häsler, Hiby, et al. 2014, Fitzpatrick et al. 2016, Lavan et al. 2017). Considering the severity of rabies and the importance of its control at the local, national, and international levels, as well as research evidence suggesting that multidisciplinary approaches to the control and prevention of rabies are necessary, this makes sense (Häsler, Hiby, et al. 2014). However, the application of One Health to the surveillance, control, and mitigation of other serious canine zoonoses including Echinococcus multilocularis and zoonotic visceral leishmaniasis has been postulated

(Palatnik-de-sousa and Day 2011, Kotwa et al. 2019). Another short coming of past applications of the One Health approach to canine zoonoses is that while canine zoonoses can contribute to disease in humans, there is limited evidence of the successful application of One Health philosophies to canine health research with an a priori One Health design (Schurer et al. 2016,

Muñoz-prieto et al. 2018). Although the importance of One Health is mentioned in studies of canine zoonoses, the philosophy is not consistently applied to the conduct of the research

(Palatnik-de-sousa and Day 2011, Narrod et al. 2012, Bidaisee and Macpherson 2014, Hubbard et al. 2018). This highlights a major gap regarding the potential to address complex canine zoonotic health issues with collaborative efforts. This gap may be further explored by an investigation of the literature that has been conducted regarding canine zoonoses in Canada

specifically, and across North America broadly, to describe and quantify the number of studies that include the philosophy of One Health in research objectives and/or methods.

Cross-Sectional Study Designs in Epidemiology

Study designs are classified as either descriptive or analytical (Dohoo et al. 2010). Of the analytical or hypothesis-testing studies, observational designs differ from experimental designs in that the subjects (animal or human) are observed without manipulation by the researcher, and are therefore not randomized or allocated to intervention groups (Sargeant et al. 2014).

Generally, observational studies explore associations between exposures and outcomes but may not be sufficient to determine cause and effect (Sargeant et al. 2014). Cross-sectional study designs constitute one of the three major types of observational studies (the others being cohort and case-control studies), which differ from other study designs by the way in which the study population is selected (Mann 2003). The defining feature of cross-sectional studies is the sampling is neither based on exposure nor outcome status (Mann 2003). Cross-sectional study designs provide the best design from which to determine prevalence of exposures and outcomes, and they can be relatively straightforward to conduct. Furthermore, data from cross-sectional studies can provide information regarding new or previously undescribed emerging diseases and potential environmental risk factors; they are often used to identify preliminary associations that can be more rigorously investigated using other study designs including cohort or case control designs (Mann 2003, Trevejo 2007). In cross-sectional studies, information related to the exposure and the outcome of interest is collected at a single moment in time, and so it can be difficult to discern cause and effect from associations in these studies (Mann 2003). Despite this,

cross-sectional studies have been and continue to be frequently used to investigate the epidemiology and public health importance of canine zoonoses (Bingham et al. 2010, Stull et al.

2012, Procter et al. 2014, Moran et al. 2018).

Questionnaires are an instrument commonly used in healthcare epidemiology research to collect data in cross-sectional and other types of observational studies (Mann 2003, Safdar et al.

2016). In healthcare, and other fields, questionnaires are commonly delivered in an online format

(Fan and Yan 2010). Online (or electronic) questionnaires are not only convenient but can have higher response rates than face-to-face or phone interviews (Bowling 2005). Online questionnaires are devoid of interviewers, which may make participants more willing to share information, but conversely do not allow for the clarification of questions or subject matter.

Questionnaires constitute a useful information gathering method when no other sources of information are available, when an efficient means of data collection is necessary, and/or when large study sizes and greater statistical power are needed than would be available through data collection by other methods (Nieuwenhuijsen 2005). The shortcomings of questionnaires, including the limits of recall and social desirability bias (i.e., data that is systematically influenced by what the respondent perceives to be the “correct” or socially acceptable response)

(Fisher 1993), can be minimized through careful planning, design, and pilot testing of the questionnaire. Questions should be clear, concise, and well-organized, and should relate to the research question of interest (Safdar et al. 2016). Pilot testing of any questionnaire is essential to evaluate the layout, the comprehensibility for participants, and the precision of skip patterns (a question or series of questions pertaining to a conditional response) (Bowling 2005). As a

common means of data collection within cross-sectional studies,(Mann 2003, Bowling 2005), questionnaires have been used in many studies regarding the investigation of canine zoonoses

(Leslie et al. 1994, Jacobs et al. 2001, Bingham et al. 2010, Leonard et al. 2011, Stull et al.

2012, Krueger et al. 2014, Maxwell et al. 2017).

THESIS OBJECTIVES

Dogs have been, and continue to be, important to humans across geography and cultures by providing companionship and a sense of well-being to those who own them and to those with whom they come into contact. Yet, the role of dogs in the transmission of zoonoses is well- evidenced, and canine zoonoses constitutes an important public health issue and One Health challenge for which epidemiological research is warranted. The public health importance of many canine zoonoses may be under-recognized or poorly understood by medical and veterinary health care providers, and by dog owners. Although there are many studies of canine zoonoses, few have compared public health outcomes related to dogs between rural and urban communities. With an increasing number of dogs as pets in Canada, it is possible that dogs may play a major role in the transmission and/or understanding of zoonoses in the future, either by acting as reservoirs, immediate hosts, or as sentinels of disease. This dissertation presents information about known and potential dog-associated zoonoses and includes novel canine zoonotic research in one Inuit community in Inuit Nunangat. Furthermore, this thesis builds on an existing body of research evidence pertaining to public health challenges related to dogs, including canine zoonoses, in southern Ontario, Canada.

The objectives of this dissertation were to:

1. Identify and characterize the available literature on canine zoonotic and vectorborne

diseases in domestic dogs published within North America since the start of the 21st

century, including whether specific collaborative integrated approaches to research (e.g.,

One Health, Ecosystem Health, and others) were reported in the study objectives or

methods sections;

2. Estimate the fecal prevalence of Giardia spp. and Cryptosporidium spp. in dogs,

investigate potential associations between the type of dog population and the fecal

presence of Giardia spp. and Cryptosporidium spp., and describe the molecular

characteristics of Giardia spp. and Cryptosporidium spp. in dogs in Iqaluit, Nunavut;

3. Determine the household-level incidence of dog bites, as self-reported by residents in

rural and urban southern Ontario, describe the profile of victims, the profile of biting

dogs, and the proportion of biting dogs not up-to-date on rabies vaccination at the time of

the bite incident in southern Ontario, and compare human exposure to dog bites between

rural and urban households in southern Ontario, Canada;

4. Describe questionnaire respondent knowledge, awareness, and levels of concern

regarding canine zoonoses, describe the possible pathways of respondent exposure to

canine zoonoses through contact, and determine if awareness of canine zoonoses differs

between rural and urban respondents in southern Ontario, Canada; and,

5. Describe the proportions of newly acquired dogs that were domestically sourced and

those imported from outside of the country into southern Ontario, describe the

characteristics of dogs that were domestically sourced and those that were imported as

pets in southern Ontario, including their source of origin or importation, whether

domestically sourced and imported dogs were accompanied with health documentation,

and respondent opinions regarding disease risks from canine movement, and determine

whether urban households acquiring new dogs in southern Ontario, Canada, were more

likely to import dogs compared to rural households.

REFERENCES

Acevedo-Whitehouse, K. and Duffus, A.L.J., 2009. Effects of environmental change on wildlife health. Philosophical Transactions of the Royal Society B: Biological Sciences, 364 (1534), 3429–3438. Adelson, N., 2005. The embodiment of inequity: Health disparities in Aboriginal Canada. Canadian Journal of Public Health, 96 (2), 45–61. Aenishaenslin, C., Brunet, P., Lévesque, F., Gouin, G.G., Simon, A., Saint-Charles, J., Leighton, P., Bastian, S., and Ravel, A., 2018. Understanding the connections between dogs, health and Inuit through a mixed-methods study. EcoHealth. Aenishaenslin, C., Simon, A., Forde, T., Ravel, A., Proulx, J.F., Fehlner-Gardiner, C., Picard, I., and Bélanger, D., 2014. Characterizing rabies epidemiology in remote Inuit communities in Quebec, Canada: A ‘one health’ approach. EcoHealth, 11 (3), 343–355. Alton, G.D., Berke, O., Reid-Smith, R., Ojkic, D., and Prescott, J.F., 2009. Increase in seroprevalence of canine leptospirosis and its risk factors, Ontario 1998-2006. Canadian Journal of Veterinary Research, 73 (3), 167–175. Anderson, M., Douma, D., Kostiuk, D., Filejski, C., Rusk, R., Weese, J.S., Bourque, T., Lee- Fuller, C., and Rajzman, C., 2016. Report of the Canadian National Canine Importation Working Group. Bidaisee, S. and Macpherson, C.N.L., 2014. Zoonoses and One Health : A Review of the Literature. Journal of Parasitology Research. Bingham, G.M., Budke, C.M., and Slater, M.R., 2010. Knowledge and perceptions of dog- associated zoonoses: Brazos County, Texas, USA. Preventive Veterinary Medicine, 93 (2– 3), 211–221. Bouchard, C., Leonard, E., Koffi, J.K., Pelcat, Y., Peregrine, A., Chilton, N., Rochon, K., Lysyk, T., Lindsay, L.R., and Ogden, N.H., 2015. Special report: The increasing risk of Lyme disease in Canada. Canadian Veterinary Journal, 56 (7), 693–699. Bouzid, M., Halai, K., Jeffreys, D., and Hunter, P.R., 2015. The prevalence of Giardia infection in dogs and cats, a systematic review and meta-analysis of prevalence studies from stool samples. Veterinary Parasitology, 207 (3–4), 181–202. Bowling, A., 2005. Mode of questionnaire administration can have serious effects on data

quality. Journal of Public Health, 27 (3), 281–291. Burgos-Cáceres, S., 2011. Canine rabies: a looming threat to public health. Animals, 1 (4), 326– 342. Canadian Animal Health Institute, 2017. Latest Canadian Pet Population Figures Released [online]. Available from: https://www.canadianveterinarians.net/documents/canadian-pet- population-figures-cahi-2017 [Accessed 22 Nov 2018]. Canadian Animal Health Institute (CAHI), 2017. Latest Canadian pet population figures released. Canadian Food Inspection Agency, 2017. Rabies in Canada [online]. Available from: http://www.inspection.gc.ca/animals/terrestrial-animals/diseases/reportable/rabies/rabies-in- canada/eng/1356156989919/1356157139999 [Accessed 23 Jul 2019]. Chen, J., Xu, M.J., Zhou, D.H., Song, H.Q., Wang, C.R., and Zhu, X.Q., 2012. Canine and feline parasitic zoonoses in China. Parasites and Vectors, 5 (1), 1–8. Chomel, B.B., 2014. Emerging and re-emerging zoonoses of dogs and cats. Animals, 4 (3), 434– 445. Chomel, B.B. and Sun, B., 2011. Zoonoses in the bedroom. Emerging Infectious Diseases, 17 (2), 167–172. Cleaveland, S., Lankester, F., Townsend, S., Lembo, T., and Hampson, K., 2014. Rabies control and elimination: a test case for One Health. Veterinary Record, 175 (8), 188–193. Cunningham, A.A., Daszak, P., and Wood, J.L.N., 2017. One health, emerging infectious diseases and wildlife. Philosophical Transactions of the Royal Society of London. B., 372, 4. Curry, P., Kostiuk, D., Werker, D., Baikie, M., Ntiamoah, W., Atherton, F., Enns, A., Opondo, J., Guirgis, H., and Mema, S., 2016. Translocated dogs from Nunavut and the spread of rabies. Canada Communicable Disease Report, 42 (6), 121–124. Damborg, P., Broens, E.M., Chomel, B.B., Guenther, S., and Pasmans, F., 2016. Bacterial zoonoses transmitted by household pets : State-of-the-art and future perspectives for targeted research and policy actions. Journal of Comparative Pathology, 155 (1), S27–S40. Daveluy, M., Lévesque, F., and Ferguson, J., 2011. Humanizing security in the Arctic. Edmonton, Alberta: CCI Press and IPSSAS. Davis, S.J. and Valla, F.R., 1978. Evidence for domestication of the dog 12,000 years ago in the Natufian of Israel. Nature, 276 (5688), 608–610. Day, M.J., 2011. One health: the importance of companion animal vector-borne diseases. Parasites & vectors, 4 (1), 302–302. Day, M.J., Breitschwerdt, E., Cleaveland, S., Karkare, U., Khanna, C., Kirpensteijn, J., Kuiken, T., Lappin, M.R., McQuiston, J., Mumford, E., Myers, T., Palatnik-de-Sousa, C.B., Rubin, C., Takashima, G., and Thiermann, A., 2012. Surveillance of zoonotic infectious disease transmitted by small companion animals. Emerging Infectious Diseases, 18 (12), e1–e1. Destoumieux-Garzón, D., Mavingui, P., Boetsch, G., Boissier, J., Darriet, F., Duboz, P., Fritsch, C., Giraudoux, P., Le Roux, F., Morand, S., Paillard, C., Pontier, D., Sueur, C., and Voituron, Y., 2018. The One Health concept: 10 years old and a long road ahead. Frontiers in Veterinary Science, 5 (February), 1–13.

Dohoo, I.R., Stryhn, H., and Martin, S.W., 2010. Veterinary Epidemiologic Research. 2nd ed. Charlottetown, PEI: VER Inc. Dummer, T.J.B., 2008. Health geography: supporting public health policy and planning. Canadian Medical Association Journal, 178 (9), 1177–1180. Esch, K.J. and Petersen, C.A., 2013. Transmission and epidemiology of zoonotic protozoal diseases of companion animals. Clinical Microbiology Reviews, 26 (1), 58–85. Esteve-Gassent, M.D., Pérez de León, A.A., Romero-Salas, D., Feria-Arroyo, T.P., Patino, R., Castro-Arellano, I., Gordillo-Pérez, G., Auclair, A., Goolsby, J., Rodriguez-Vivas, R.I., and Estrada-Franco, J.G., 2014. Pathogenic landscape of transboundary zoonotic diseases in the Mexico-US border along the Rio Grande. Frontiers in Public Health, 2 (NOV), 1–23. Evans, B. and Leighton, F., 2014. A history of One Health. Rev. sci. tech. Off. int. Epiz, 33 (2), 413–420. Fan, W. and Yan, Z., 2010. Factors affecting response rates of the web survey: A systematic review. Computers in Human Behavior, 26 (2), 132–139. Feng, Y. and Xiao, L., 2011. Zoonotic potential and molecular epidemiology of Giardia species and giardiasis †. Clinical Microbiology Reviews, 24 (1), 110–140. Filejski, C., 2016. The changing face of rabies in Canada. Canada Communicable Disease Report, 42 (6), 118–120. Fisher, R.J., 1993. Social desirability bias and the validity of indirect questioning. Journal of Consumer Research, 2 (20), 303. Fitzpatrick, M.C., Shah, H.A., Pandey, A., Bilinski, A.M., Kakkar, M., Clark, A.D., Townsend, J.P., Abbas, S.S., and Galvani, A.P., 2016. One Health approach to cost-effective rabies control in India. Proceedings of the National Academy of Sciences of the United States of America, 113 (51), 14574–14581. Friedmann, E. and Son, H., 2009. The human-companion animal bond: How humans benefit. Veterinary Clinics of North America - Small Animal Practice, 39 (2), 293–326. Frohlich, K.L., Ross, N., and Richmond, C., 2006. Health disparities in Canada today: Some evidence and a theoretical framework. Health Policy, 79 (2–3), 132–143. Ghasemzadeh, I. and Namazi, S.H., 2015. Review of bacterial and viral zoonotic infections transmitted by dogs. Journal of Medicine and Life, 8 (4), 1–5. Gibbs, E.P.J., 2014. The evolution of one health: A decade of progress and challenges for the future. Veterinary Record, 174 (4), 85–91. Goldfarb, D.M., Dixon, B., Moldovan, I., Barrowman, N., Mattison, K., Zentner, C., Baikie, M., Bidawid, S., Chan, F., and Slinger, R., 2013. Nanolitre real-time PCR detection of bacterial, parasitic, and viral agents from patients with diarrhoea in Nunavut, Canada. International Journal of Circumpolar Health, 72 (1), 1–8. Government of Canada, 1990. Reportable Diseases Regulations Règlement sur les maladies déclarables. Government of Nunavut, 2018. Rabies confirmed in Igloolik [online]. Harper, S.L., Edge, V.L., Schuster-Wallace, C.J., Berke, O., and McEwen, S.A., 2011. Weather, water quality and infectious gastrointestinal illness in two inuit communities in Nunatsiavut, Canada: Potential implications for climate change. EcoHealth, 8 (1), 93–108.

Hart, L.A., Hart, B.L., and Bergin, B.L., 1987. Socializing Effects of Service Dogs for People with Disabilities. Anthrozoös, 1 (1), 41–44. Häsler, B., Hiby, E., Gilbert, W., Obeyesekere, N., Bennani, H., and Rushton, J., 2014. A one health framework for the evaluation of rabies control programmes: a case study from Colombo City, Sri Lanka. PLoS Neglected Tropical Diseases, 8 (10). Hodgson, K. and Darling, M., 2011. Zooeyia: an essential component of ‘One Health’. The Canadian Veterinary Journal, 52 (2), 189–191. Horn, M., Ewen, G., and Wise, S.F., 2019. Ontario [online]. Encyclopædia Britannica, inc. Available from: https://www.britannica.com/place/Ontario-province [Accessed 18 Jul 2019]. Hotez, P.J., 2010. Neglected infections of poverty among the indigenous peoples of the Arctic. PLoS Neglected Tropical Diseases, 4 (1). Hubbard, K., Wang, M., and Smith, D.R., 2018. Seroprevalence of brucellosis in Mississippi shelter dogs. Preventive Veterinary Medicine, 159 (September), 82–86. Inuit Tapiriit Kanatami, 2014. Social Determinants of Inuit Health in Canada, Fact Sheet 06: Availability of Health Services. Inuit Tapiriit Kanatami, 2018. National Inuit Strategy on Research. Iqbal, A., Goldfarb, D.M., Slinger, R., and Dixon, B.R., 2015. Prevalence and molecular characterization of Cryptosporidium spp. and Giardia duodenalis in diarrhoeic patients in the Qikiqtani Region, Nunavut, Canada. International Journal of Circumpolar Health, 74 (2), 1–9. Jacobs, S.R., Forrester, C.P.R., and Yang, J., 2001. A survey of the prevalence of Giardia in dogs presented to Canadian veterinary practices. Canadian Veterinary Journal, 42 (1), 45–46. Jenkins, E.J., Schurer, J.M., and Gesy, K.M., 2011. Old problems on a new playing field: Helminth zoonoses transmitted among dogs, wildlife, and people in a changing northern climate. Veterinary Parasitology, 182 (1), 54–69. Johnson, R., Beck, A., and McCune, S., 2011. The health benefits of dog walking for pets and people: Evidence and case studies. Purdue University Press. Julien, D.A., Sargeant, J.M., Guy, R.A., Shapiro, K., Imai, R.K., Bunce, A., Sudlovenick, E., Chen, S., Li, J., and Harper, S.L., 2019. Prevalence and genetic characterization of Giardia spp. and Cryptosporidium spp. in dogs in Iqaluit, Nunavut, Canada. Zoonoses and Public Health, (June), zph.12628. Karesh, W.B., Dobson, A., Lloyd-smith, J.O., Lubroth, J., Dixon, M.A., Bennett, M., Aldrich, S., Harrington, T., Formenty, P., Loh, E.H., Machalaba, C.C., Thomas, M.J., and Heymann, D.L., 2012. Ecology of zoonoses : natural and unnatural histories. The Lancet, 380 (9857), 1936–1945. King, M., 2009. An overall approach to health care for Indigenous Peoples. Pediatric Clinics of North America, 56 (6), 1239–1242. Kotwa, J.D., Isaksson, M., Jardine, C.M., Campbell, G.D., Berke, O., Pearl, D.L., Mercer, N.J., Osterman-Lind, E., and Peregrine, A.S., 2019. Echinococcus multilocularis infection, southern Ontario, Canada. Emerging Infectious Diseases, 25 (2), 265–272. Krueger, W.S., Heil, G.L., Yoon, K.J., and Gray, G.C., 2014. No evidence for zoonotic

transmission of H3N8 canine influenza virus among US adults occupationally exposed to dogs. Influenza and other Respiratory Viruses, 8 (1), 99–106. Lacetera, N., 2019. Impact of climate change on animal health and welfare. Animal Frontiers, 9 (1), 26–31. Lambin, E.F., Tran, A., Vanwambeke, S.O., Linard, C., and Soti, V., 2010. Pathogenic landscapes: Interactions between land, people, disease vectors, and their animal hosts. International Journal of Health Geographics, 9 (1), 54. Lavan, R.P., King, A.I.M., Sutton, D.J., and Tunceli, K., 2017. Rationale and support for a One Health program for canine vaccination as the most cost-effective means of controlling zoonotic rabies in endemic settings. Vaccine, 35, 1668–1674. Lebov, J., Grieger, K., Womack, D., Zaccaro, D., Whitehead, N., Kowalcyk, B., and MacDonald, P.D.M., 2017. A framework for one health research. One Health, 3, 44–50. Leonard, E.K., Pearl, D.L., Finley, R.L., Janecko, N., Peregrine, A.S., Reid-Smith, R.J., and Weese, J.S., 2011. Evaluation of pet-related management factors and the risk of Salmonella spp. carriage in pet dogs from volunteer households in Ontario (2005-2006). Zoonoses and Public Health, 58 (2), 140–149. Leslie, B.E., Meek, A.H., Kawash, G.F., and McKeown, D.B., 1994. An epidemiological investigation of pet ownership in Ontario. The Canadian Veterinary Journal, 35 (4), 218– 222. Macpherson, C.N., 2012. Dogs, Zoonoses and Public Health. 2nd ed. CABI. Majowicz, S.E., Horrocks, J., and Bocking, K., 2007. Demographic determinants of acute gastrointestinal illness in Canada: A population study. BMC Public Health, 7, 1–8. Mann, C.J., 2003. Observational research methods. Research design II: cohort, cross sectional, and case-control studies. Emergency Medicine Journal, 20 (1), 54–60. Martin, S.W., Meek, A.H., and Willeberg, P., 1987. Veterinary epidemiology: principles and methods. Iowa State University Press, Ames IA. Maxwell, M.J., De Carvalho, M.H.F., Hoet, A.E., Vigilato, M.A.N., Pompei, J.C., Cosivi, O., and Del Rio Vilas, V.J., 2017. Building the road to a regional zoonoses strategy: A survey of zoonoses programmes in the Americas. PLoS ONE, 12 (3), 1–19. McNicholas, J., Gilbey, A., Rennie, A., Ahmedzai, S., Dono, J., and Ormerod, E., 2005. Pet ownership and human health: a brief review of evidence and issues. BMJ, 331 (7527), 1252–1254. Middleton, D., Johnson, K.O., Rosatte, R.C., Hobbs, J.L., Moore, S.R., Rosella, L., and Crowcroft, N.S., 2015. Human rabies post-exposure prophylaxis and animal rabies in Ontario, Canada, 2001-2012. Zoonoses and Public Health, 62 (5), 356–364. Moran, N.E., Ferketich, A.K., Wittum, T.E., and Stull, J.W., 2018. Dogs on livestock farms: A cross-sectional study investigating potential roles in zoonotic pathogen transmission. Zoonoses and Public Health, 65 (1), 80–87. Morand, S., McIntyre, K.M., and Baylis, M., 2014. Domesticated animals and human infectious diseases of zoonotic origins: Domestication time matters. Infection, Genetics and Evolution, 24, 76–81. Muñoz-prieto, A., Nielsen, L.R., Martinez-subiela, S., and Mazeikiene, J., 2018. Application of

the NEOH framework for self-evaluation of One Health elements of a case-study on obesity in European dogs and dog-owners, 5 (July), 1–9. Murphy, H.M., Thomas, M.K., Schmidt, P.J., Medeiros, D.T., McFadyen, S., and Pintar, K.D.M., 2016. Estimating the burden of acute gastrointestinal illness due to Giardia , Cryptosporidium , Campylobacter , E. Coli O157 and norovirus associated with private wells and small water systems in Canada. Epidemiology and Infection, 144 (7), 1355–1370. Murray, C.J.L. and Lopez, A.D., 2013. Measuring the global burden of disease. New England Journal of Medicine, 369 (5), 448–457. Narrod, C., Zinsstag, J., and Tiongco, M., 2012. One health framework for estimating the economic costs of zoonotic diseases on society. EcoHealth, 9 (2), 150–162. Nieuwenhuijsen, M.J., 2005. Design of exposure questionnaires for epidemiological studies. Occupational and Environmental Medicine, 62 (4). O’Haire, M., 2010. Companion animals and human health: Benefits, challenges, and the road ahead. Journal of Veterinary Behavior: Clinical Applications and Research, 5 (5), 226–234. Ortega-Pacheco, A., Rodriguez-Buenfil, J.C., Bolio-Gonzalez, M.E., Sauri-Arceo, C.H., Jiménez-Coello, M., and Forsberg, C.L., 2007. A survey of dog populations in urban and rural areas of Yucatan, Mexico. Anthrozoos, 20 (3), 261–274. Oxley, J.A., Christley, R., and Westgarth, C., 2018. Contexts and consequences of dog bite incidents. Journal of Veterinary Behavior: Clinical Applications and Research, 23, 33–39. Palatnik-de-sousa, C.B. and Day, M.J., 2011. One Health : The global challenge of epidemic and endemic leishmaniasis. Parasites & Vectors, 4 (1), 197. Procter, T.D., Pearl, D.L., Finley, R.L., Leonard, E.K., Janecko, N., Reid-Smith, R.J., Weese, J.S., Peregrine, A.S., and Sargeant, J.M., 2014. A Cross-Sectional Study Examining Campylobacter and Other Zoonotic Enteric Pathogens in Dogs that Frequent Dog Parks in Three Cities in South-Western Ontario and Risk Factors for Shedding of Campylobacter spp. Zoonoses and Public Health, 61 (3), 208–218. Prystajecky, N., Huck, P.M., Schreier, H., and Isaac-Renton, J.L., 2014. Assessment of Giardia and Cryptosporidium spp. as a microbial source tracking tool for surface water: Application in a mixed-use watershed. Applied and Environmental Microbiology, 80 (8), 2328–2336. Purewal, R., Christley, R., Kordas, K., Joinson, C., Meints, K., Gee, N., and Westgarth, C., 2017. Companion animals and child/adolescent development: A systematic review of the evidence. International Journal of Environmental Research and Public Health, 14 (3). Qikiqtani Inuit Association, 2014. Qikiqtani Truth Commission. Thematic Reports and Special Studies 1950–1975: QTC Final Report: Achieving Saimaqatiqiingniq. Thematic Reports and Special Studies. Rabozzi, G., Bonizzi, L., Crespi, E., Somaruga, C., Sokooti, M., Tabibi, R., Vellere, F., Brambilla, G., and Colosio, C., 2012. Emerging zoonoses: the ‘one health approach’. Safety and health at work, 3 (1), 77–83. Raina, P., Waltner-Toews, D., Bonnett, B., Woodward, C., and Abernathy, T., 1999. Influence of companion animals on the physical and psychological health of older people: An analysis of a one-year longitudinal study. Journal of the American Geriatrics Society, 47 (3), 323–329. Robertson, I.D., Irwin, P.J., Lymbery, A.J., and Thompson, R.C.A., 2000. The role of companion

animals in the emergence of parasitic zoonoses. International Journal for Parasitology, 30 (12–13), 1369–1377. Rowan, A.N., 2018. Companion Animal Statistics in the USA. Demography and Statistics for Companion Animal Populations. Sable, P., 2013. The pet connection: An attachment perspective. Clinical Social Work Journal, 41 (1), 93–99. Safdar, N., Abbo, L.M., Knobloch, M.J., and Seo, S.K., 2016. Research methods in healthcare epidemiology: Survey and qualitative research. Infection Control and Hospital Epidemiology, 37 (11), 1272–1277. Sargeant, J.M., Kelton, D.F., and O’Connor, A.M., 2014. Study designs and systematic reviews of interventions: Building evidence across study designs. Zoonoses and Public Health, 61 (SUPPL1), 10–17. Saunders, J., Parast, L., Babey, S.H., and Miles, J. V., 2017. Exploring the differences between pet and non-pet owners: Implications for human-animal interaction research and policy. PLoS ONE, 12 (6), 1–15. Schultz, M., 2008. Rudolf Virchow. Emerging Infectious Diseases, 14 (9), 1479–1481. Schurer, J.M., Mosites, E., Li, C., Meschke, S., and Rabinowitz, P., 2016. Community-based surveillance of zoonotic parasites in a ‘One Health’ world: A systematic review. One Health, 2, 166–174. Schwabe, C., 1984. Veterinary Medicine and Human Health. In: W.& Wilkins, ed. Baltimore, 713. Shaw, M., Orford, S., Brimblecombe, N., and Dorling, D., 2000. Widening inequality in mortality between 160 regions of 15 European countries in the early 1990s. Social Science and Medicine, 50 (7–8), 1047–1058. Shukla, R., Giraldo, P., Kraliz, A., Finnigan, M., and Sanchez, A.L., 2006. Cryptosporidium spp. and other zoonotic enteric parasites in a sample of domestic dogs and cats in the Niagara region of Ontario. Canadian Veterinary Journal, 47 (12), 1179–1184. Statistics Canada, 2016a. Population size and growth in Canada: Key results from the 2016 Census. Archived from the original on February 10, 2017 [online]. Available from: https://www150.statcan.gc.ca/n1/daily-quotidien/170208/dq170208a-eng.htm [Accessed 20 Aug 2019]. Statistics Canada, 2016b. Statistics Canada. (2016) [online]. Census Profile. Available from: http://www12.statcan.gc.ca/census-recensement/2016/dp- pd/prof/details/page.cfm?Lang=E&Geo1=CSD&Code1=5915022&Geo2=PR&Code2=59& Data=Count&SearchText=Vancouver&SearchType=Begins&SearchPR=01&B1=All&Geo Level=PR&GeoCode=5915022&TABID=1. Statistics Canada, 2017a. Nunavut [Territory] and Canada [Country] (table). Census Profile. 2016 Census. Statistics Canada Catalogue no. 98-316-X2016001. Ottawa. Released November 29, 2017 [online]. Available from: https://www12.statcan.gc.ca/census- recensement/2016/dp-pd/prof/index.cfm?Lang=E [Accessed 11 Oct 2019]. Statistics Canada, 2017b. Toronto, C [Census subdivision], Ontario and Canada [Country] (table). Census Profile. 2016 Census. Statistics Canada Catalogue no. 98-316-X2016001.

Ottawa. Released November 29, 2017 [online]. Available from: https://www12.statcan.gc.ca/census-recensement/2016/dp-pd/prof/index.cfm?Lang=E [Accessed 10 Mar 2020]. Stephen, C. and Karesh, W.B., 2014. Is One Health delivering results? Introduction. Revue scientifique et technique (International Office of Epizootics), 33 (2), 375–92. Stull, J.W., Brophy, J., and Weese, J.S., 2015. Reducing the risk of pet-associated zoonotic infections. Canadian Medical Association Journal, 187 (10), 736–743. Stull, J.W., Peregrine, A.S., Sargeant, J.M., and Weese, J.S., 2012. Household knowledge, attitudes and practices related to pet contact and associated zoonoses in Ontario, Canada. BMC Public Health, 12 (1), 553. Takashima, G.K. and Day, M.J., 2014. Setting the one health agenda and the human-companion animal bond. International Journal of Environmental Research and Public Health, 11 (11), 11110–11120. Taylor, L.H., Hampson, K., Fahrion, A., Abela-Ridder, B., and Nel, L.H., 2017. Difficulties in estimating the human burden of canine rabies. Acta Tropica, 165, 133–140. Taylor, L.H., Latham, S.M., and Woolhouse, M.E.J., 2001. Risk factors for human disease emergence. Philosophical Transactions of the Royal Society B: Biological Sciences, 356 (1411), 983–989. Thomas, M.K., Murray, R., Nesbitt, A., and Pollari, F., 2017. The incidence of acute gastrointestinal illness in Canada, foodbook survey 2014-2015. Canadian Journal of Infectious Diseases and Medical Microbiology, 2017. Trevejo, R.T., 2007. A small animal clinician’s guide to critical appraisal of the evidence in scientific literature. Veterinary Clinics of North America - Small Animal Practice, 37 (3), 463–475. Tunstall, H. V., Shaw, M., and Dorling, D., 2004. Places and health. Journal of epidemiology and community health, 58 (1), 6–10. Udell, M.A.. and Wynne, C.D.., 2008. A review of domestic dogs’ (Canis Familiaris) human- like behaviors: Or why behavior analysts should stop worrying and love their dogs. Journal of the Experimental Analysis of Behavior, 89 (2), 247–261. Vercauteren, K., Health, P., and Service, I., 2012. Rabies in North America : A model of the One Health approach. Voith, V.L., 2009. The impact of companion animal problems on society and the role of veterinarians. Veterinary Clinics of North America - Small Animal Practice, 39 (2), 327– 345. Wells, D.L., 2007. Domestic dogs and human health: An overview. British Journal of Health Psychology, 12 (1), 145–156. WHO, FAO, and OIE, 2015. Rationale for investing in the global elimination of dog-mediated human rabies. WHO Press 20 Avenue Appia 1211 Geneva 27 Switzerland, 6–11. World Health Organization, 2013. WHO expert consultation on rabies, second report. WHO Technical Report Series 982. World Health Organization, 2019. World health statistics overview 2019: monitoring health for the SDGs, sustainable development goals. Geneva.

Zinsstag, J., Schelling, E., Waltner-Toews, D., and Tanner, M., 2011. From ‘one medicine’ to ‘one health’ and systemic approaches to health and well-being. Preventive Veterinary Medicine, 101 (3–4), 148–156.

CHAPTER 2

A PROTOCOL FOR A SCOPING REVIEW TO EXAMINE STUDIES INVESTIGATING ZOONOTIC DISEASES IN CANIS FAMILARIS IN NORTH AMERICA SINCE THE BEGINNING OF THE 21ST CENTURY

Julien, D.A., Sargeant J.M., Filejski, C., Versluis, A.M., and Harper S.L. 2018. A Protocol for a Scoping Review to Examine Studies Investigating Zoonotic Diseases in Canis familaris in North America Since the Beginning of the 21st Century. This protocol is archived in the University of Guelph’s institutional repository (The Atrium: http://hdl.handle.net/10214/13047) and published online with Systematic Reviews for Animals and Food (SYREAF) available at: http://www.syreaf.org/

INTRODUCTION

Rationale

While animals, including dogs, provide many health benefits to humans (Friedmann and

Son 2009, Hodgson and Darling 2011), dogs can harbour zoonotic diseases that can be directly transmitted to humans, resulting in a range of infection from subclinical to serious and potentially life-threatening disease (Deplazes and Eckert 2001, Lefebvre et al. 2006, WHO et al.

2015, Esteva et al. 2017).

Canine zoonotic diseases are present in many countries across the world but their endemicity varies on the basis of certain socio-economic influences including, but not limited to: availability of animal and human health resources, income, and the predominance of closely shared living environments (Mableson et al. 2014). While dog-related zoonotic diseases represent a major public health concern irrespective of country-status (Otranto et al. 2009, Little et al. 2010, Chomel 2011, Chikweto et al. 2012), the nature and level of that concern may vary, depending on local socio-economic influences.

North America comprises 16.5% of the earth’s land mass (Hoffman et al. 2016). The

Inequality-adjusted Human Development Index (IHDI), developed by the United Nations

Development Programme (UNDP), describes the average achievements of a country on the basis of health, education and income, while taking into account the human development cost of inequality(United Nations Development Programme 2016). North American comprises sovereign states and dependent territories classified as “very high”, “high”, “medium” and “low” human development according to the IHDI(United Nations Development Programme 2016). and

within which previous studies have identified canine zoonoses (Barr 2009, Petersen and Barr

2009, Chikweto et al. 2013, Velasco-Villa et al. 2017).

While opportunities for the transmission of zoonoses from animals to humans has been described as a complex global problem driven largely by a series of socio-economic factors (i.e., biological, ecological, political and socio-economic), it is also significantly influenced by if, how, where and when people interact with animals (Taylor et al. 2001b, Woldehanna and

Zimicki 2015). The inclusion of integrated collaborative approaches to health research (i.e., One

Health, EcoHealth) thus provides a mechanism to address complex global health problems including those posed by canine zoonoses, while increasing the ability to identify sustainable health solutions. (Conrad et al. 2013a, Häsler, Hiby, et al. 2014).

A synthesis of research on canine zoonoses taking into account a standardized indicator of socio-economic factors across countries, such as the IHDI, could enhance knowledge and understanding of the health of domestic dogs within a given period and concomitantly, the potential ways in which dogs may be contributing to human disease in this part of the world.

This protocol describes the methods for conducting a scoping review, which will describe the extent, methodologies, and general characteristics of the literature, including proposed integrated collaborative approaches to health in studies investigating canine zoonoses in domestic dogs in North America.

This review will follow the framework developed by Arksey and O’Malley (Arksey and

O’Malley 2005a) and further enhanced by the Joanna Briggs Institute methodology guidance for scoping reviews (Peters et al. 2015).

Research Question and Objectives

The broad research question guiding the review is: ‘What is known about canine zoonoses in domestic dogs from the existing literature in the continent of North America, and how does the literature on canine zoonoses vary across the continent?’

The goal of this review will be to: Identify, characterize, and map the available literature in comparison to state/territory ranking on the current Inequality-adjusted Human Development

Index (IHDI), in order to:

1. Identify the studies related to types of canine zoonoses in domestic dogs that have been

published in North America since the beginning of the 21st century;

2. Identify the main objectives and types of study methodologies reported

3. Identify and characterize the research that has been conducted in “very high”, “high”,

“medium” and “low” human development North American countries of North America;

and

4. Examine whether collaborative integrated approaches (e.g., One Health, EcoHealth and

others) have been described by authors and how they report their inclusion.

METHODS

Review Registration

This protocol is archived in the University of Guelph’s institutional repository (The

Atrium) and published online with Systematic Reviews for Animals and Food (SYREAF) available at: http://www.syreaf.org/

Eligibility Criteria

Studies will be eligible if they:

• Are original scientific reports of research findings (i.e., primary research studies) of

animal-level and/or pathogen-level (e.g., studies relating to molecular epidemiology of

pathogens that have been sampled from dogs) outcomes;

• Have been published in the English, French or Spanish languages;

• Have investigated any of the listed canine zoonoses or their disease-causing agent

(Table 2.1) in the target population of interest;

• Have been conducted in one or more North American countries; and

• Were published between January 1, 2000 and the present.

Conference proceedings of less than 500 words and citations for which the full text document in English, French or Spanish is unavailable, will be excluded; all other primary research study designs relevant to answering the broad research question will be eligible.

Eligible Target Population of Interest

Studies where the population of interest includes any breed of dog belonging to Canis familiaris, including owned and unowned domestic dogs, or the focus of interest is a disease- causing agent affecting dogs as a target population, will be eligible.

Eligible Diseases of Interest

Studies investigating any of the canine zoonoses of known public health significance listed in Table 2.1, in the target population of interest will be eligible. The list of eligible diseases was developed on the basis of their relevance to dogs and humans: For the purposes of

the scoping review for which this protocol has been developed, relevant canine zoonoses are defined as diseases of domestic dogs which have potentially serious (morbidity and/or mortality) dog and human health and economic impacts within the countries/regions of interest.

Relevant canine zoonoses terms (Table 2.1) were acquired from a combination of published literature and books as well as relevant region-specific organizations including the: Pan

American Health Organization (PAHO); Canadian Food Inspection Agency (CFIA); World

Health Organization (WHO); World Organisation for Animal Health (OIE); Centre for Food- borne, Environmental and Zoonotic Infections (via the Public Health Agency of Canada

(PHAC); and US Centers for Disease Control and Prevention (CDC)).

Eligible Countries (including within-country regions) of Interest

Any country (or region within) listed as part of North America (Hoffman et al. 2016) including: Anguilla; Antigua and Barbuda; Aruba; The Bahamas; Barbados; Belize; Bermuda;

Bonaire; British Virgin Islands; Canada; Cayman Islands; Clipperton Island; Costa Rica; Cuba;

Curacao; Dominica; Dominican Republic; El Salvador; Federal Dependencies of Venezuela;

Greenland; Grenada; Guadeloupe; Guatemala; Haiti; Honduras; Jamaica; Martinique; Mexico;

Montserrat; Navassa Island; Nicaragua; Nueva Esparta; Panama; Puerto Rico; Saba; San Andres and Providencia; Saint Barthelemy; Saint Kitts and Nevis; Saint Lucia; Saint-Martin; Saint Pierre and Miquelon; Saint Vincent and the Grenadines; Sint Eustatius; Sint Maarten; Trinidad and

Tobago; Turks and Caicos Islands; United States; and the United States Virgin Islands.

Identifying Relevant Studies

An initial broad search of the literature of one electronic database was conducted by DAJ in May 2018. A list of the search terms is shown in Table 2.1. Comprehensive literature searches will be conducted through the McLaughlin Library, University of Guelph in the following electronic databases: AGRICOLA©, CAB Direct©, PubMed© via NCBI©, and the Science

Citation Index Expanded (SCI-EXPANDED)™, and Emerging Sources Citation Index (ESCI)™ databases via the Web of Science platform™, Table 2.2.

Key word searches were developed from the findings of the initial broad search and will include combinations of variations of the concept terms “dog” and applicable canine zoonoses with the controlled vocabulary option included where available. The search strategy will be modified for each database accounting for differences in syntax, indexing, and functionality where appropriate.

The literature search will be conducted in May 2018 and limited to English, French or Spanish language studies published between 2000 and 2017.

Data Management

Search results will be uploaded into Mendeley© reference management software and duplicates removed. Information relating to the number of studies found, duplicates removed, and the final studies included in the scoping review will be presented in the final report using the

Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA)© flowchart template.

Study Selection

Level 1 and Level 2 screening for eligibility will be completed by DAJ and other reviewers, working independently. To enhance rigor and reliability between reviewers, training exercises will be conducted, and interrater reliability scored between the two reviewers prior to commencing screening.

Level 1: Title, abstract, and index terms will be screened for relevance using the following questions, with the response options “yes”, “no”, and “unclear”. Keywords pertaining to the question will be listed where relevant for clarity:

1. Does the title/abstract describe primary research?

2. Does the title/abstract investigate canine zoonoses in the primary target population (i.e.,

dogs)?

3. Was the study conducted in North America?

Studies will be excluded if both reviewers agree that the answer is “no” to any of the above questions.

Level 2: Screening will be conducted on full text publications for studies that meet the “yes” answer or “unclear” answer to Level 1 screening questions.

The following questions will be used for Level 2 eligibility screening and data extraction with answers “yes” or “no” only. Studies will be excluded if both reviewers are in agreement in answering “no” to any of the following questions:

1. Is the full text publication a journal article or conference proceeding (>500 words)?

2. Is the full text article or conference proceeding (>500 words) describing a primary

research study?

3. Is the full text article available in English, French or Spanish?

4. Has the primary research been published or presented (e.g., conference proceedings (>

500 words)) within the period 2000 – present?

5. Does the full text research investigate one or more canine zoonoses of interest?

6. Has the full text research been conducted in North America?

7. Is the study at the dog-level or pathogen (i.e., disease-causing agent) -level?

8. Does the dog-level full text publication identify domestic dogs as the target population?

9. Is the general categorical focus of the pathogen-level full text publication described?

10. Does the full publication list the type(s) of domestic dogs as the target population?

11. Was any type of integrated collaborative approach listed as part of the study (e.g., in the

objectives or methods)?

12. Was a study approach proposed by authors?

Discrepancies on eligibility between the two reviewers at both levels will be resolved by consensus and mediated by another co-author if consensus cannot be reached.

Please note that Level 2 eligibility screening and data extraction on non-English articles will be completed by a single reviewer (CF).

Data Extraction Strategy

Full text publications will be acquired and uploaded into the commercial review management program DistillerSR™ (Evidence Partners, Ottawa, Canada). Data extraction will be completed using structured pre-tested forms created in DistillerSR™ that will include:

General study characteristics

Publication year; North American country(ies) in which the study was conducted; and, whether any type of integrated collaborative approach (as described in the protocol rationale) was listed included in the study (e.g., in the objectives or methods).

Study population

Domestic dogs (owned or unowned); and sample size(s).

Disease(s) investigated

The canine zoonosis(es) investigated in domestic dogs.

Study approach

Pre-identified categories of why the study was conducted including:

Descriptive (1) examining distribution of canine zoonoses in the study population of

interest; (2) looking for patterns of disease occurrence:

o Case-reports (study describes rare condition or an unusual manifestation of a

more common [canine zoonotic] disease(s) in dogs);

o Case-series reports (study describes occurrence of or usual clinical presentation of

canine zoonotic condition/ disease); and

o Descriptive surveys (study estimates frequency and distribution of selected

outcomes (i.e., canine zoonoses) in defined canine population)).

Analytical

o Experimental hypothesis-testing:

Challenge trial of intervention to prevent (i.e., when an experiment is

conducted in domestic dogs with a deliberate disease induction (e.g.,

vaccination then exposure to an infectious disease agent));

Challenge trial of intervention to treat (i.e., when an experiment is

conducted in domestic dogs with a deliberate disease induction (e.g.,

exposure to an infectious disease agent and after onset of clinical signs,

then treatment));

Natural disease trial of intervention to prevent (i.e., controlled trial, field

trial or clinical trial); and

Natural disease trail of intervention to treat (i.e., controlled trial, field trial

or clinical trial).

o Observational study hypothesis-testing:

Intervention to prevent

Intervention to treat

Evaluation of risk factors for disease

Evaluation of mechanisms of disease / virulence

Diagnostic test development / evaluation

Categorical focus of Pathogen-Level Studies

Data will be collected on the premise for conducting the pathogen-level studies including whether the study, specific to the pathogen, was focused on: Molecular biology (proteins; nucleic acids (DNA; RNA)); phylogeny (molecular epidemiology); whole genome sequencing; virulence

factors and/or dynamics of transmission to host; development or validation of laboratory methods and diagnostics; characterization; pathophysiology and immunology of pathogen-host interaction. Following data extraction process, the Inequality-adjusted Human Development

Index (IHDI) will be derived based on the country of publication.

Results Strategy

Charting the Data

Study analysis will include descriptive analysis of study characteristics, target population and study approach.

Collating, Summarizing and Reporting the Results

A combination of figures and tables will be used to collate, summarize and report study results. A figure will be used to depict the scoping review flow chart detailing the process of study inclusion. Tables will be used to collate, summarize and report the primary level of study categorization prioritized by publication type (i.e., Descriptive - Case reports, Case series,

Descriptive surveys; Analytical experimental; Analytical observational; Conference proceedings;

Study approach unclear).

Secondly, descriptive and analytical studies will be further categorized by: Year of publication; country of origin within the region of interest; resource setting; integrated collaborative approach(es) proposed; target population (owned/unowned domestic dogs); and canine zoonoses investigated.

DISCUSSION

This scoping review will provide a synthesis of primary research investigating canine zoonoses in domestic dogs that has been conducted in North America during 2000 – 2018.

Results can be used to inform future scientific research studies inclusive of systematic reviews, government policy and public health strategies relating to canine zoonoses in multiple countries in this part of the world.

REFERENCES

Arksey, H., & O’Malley, L. (2005). Towards a Methodological Framework. . International Journal of Social Research Methodology, 8(1), 19–25. Barr, S. C. (2009). Canine Chagas’ Disease (American Trypanosomiasis) in North America. Veterinary Clinics of North America - Small Animal Practice, 39(6), 1055–1064. https://doi.org/10.1016/j.cvsm.2009.06.004 Chikweto, A., Bhaiyat, M. I., Tiwari, K. P., de Allie, C., & Sharma, R. N. (2012). Spirocercosis in owned and stray dogs in Grenada. Veterinary Parasitology, 190(3–4), 613–616. https://doi.org/10.1016/j.vetpar.2012.07.006 Chikweto, A., Tiwari, K., Kumthekar, S., Stone, D., Louison, B., Thomas, D., Sharma, R., & Hariharan, H. (2013). Serologic detection of antibodies to Brucella spp. using a commercial ELISA in cattle in Grenada, West Indies. Tropical Biomedicine, 30(2), 277–280. Chomel, B. (2011). Tick-borne infections in dogs-An emerging infectious threat. Veterinary Parasitology, 179(4), 294–301. https://doi.org/10.1016/j.vetpar.2011.03.040 Conrad, P. A., Meek, L. A., & Dumit, J. (2013). Operationalizing a One Health approach to global health challenges. Comparative Immunology, Microbiology and Infectious Diseases, 36(3), 211–216. https://doi.org/10.1016/j.cimid.2013.03.006 Deplazes, P., & Eckert, J. (2001). Veterinary aspects of alveolar echinococcosis - A zoonosis of public health significance. Veterinary Parasitology, 98(1–3), 65–87. https://doi.org/10.1016/S0304-4017(01)00424-1 Esteva, L., Vargas, C., & Vargas de León, C. (2017). The role of asymptomatics and dogs on leishmaniasis propagation. Mathematical Biosciences, 293, 46–55. https://doi.org/10.1016/j.mbs.2017.08.006 Friedmann, E., & Son, H. (2009). The human-companion animal bond: How humans benefit. Veterinary Clinics of North America - Small Animal Practice, 39(2), 293–326. https://doi.org/10.1016/j.cvsm.2008.10.015 Häsler, B., Hiby, E., Gilbert, W., Obeyesekere, N., Bennani, H., & Rushton, J. (2014). A one health framework for the evaluation of rabies control programmes: a case study from

Colombo City, Sri Lanka. PLoS Neglected Tropical Diseases, 8(10). https://doi.org/10.1371/journal.pntd.0003270 Hodgson, K., & Darling, M. (2011). Zooeyia: an essential component of “One Health.” The Canadian Veterinary Journal, 52(2), 189–191. Hoffman, P. F., Schaetzl, R. J., Wreford Watson, J., & Zelinsky, W. (2016). North America | Countries, Regions, & Facts | Britannica.com. Encyclopædia Britannica, Inc. https://www.britannica.com/place/North-America Lefebvre, S. L., Waltner-Toews, D., Peregrine, A. S., Reid-Smith, R., Hodge, L., Arroyo, L. G., & Weese, J. S. (2006). Prevalence of zoonotic agents in dogs visiting hospitalized people in Ontario: Implications for infection control. Journal of Hospital Infection, 62(4), 458–466. https://doi.org/10.1016/j.jhin.2005.09.025 Little, S. E., Heise, S. R., Blagburn, B. L., Callister, S. M., & Mead, P. S. (2010). Lyme borreliosis in dogs and humans in the USA. Trends in Parasitology, 26(4), 213–218. https://doi.org/10.1016/j.pt.2010.01.006 Mableson, H. E., Okello, A., Picozzi, K., & Welburn, S. C. (2014). Neglected Zoonotic Diseases-The Long and Winding Road to Advocacy. PLoS Neglected Tropical Diseases, 8(6). https://doi.org/10.1371/journal.pntd.0002800 Otranto, D., Dantas-Torres, F., & Breitschwerdt, E. B. (2009). Managing canine vector-borne diseases of zoonotic concern: part two. Trends in Parasitology, 25(5), 228–235. https://doi.org/10.1016/j.pt.2009.02.005 Peters, M. D. J., Godfrey, C. M., Khalil, H., McInerney, P., Parker, D., & Soares, C. B. (2015). Guidance for conducting systematic scoping reviews. International Journal of Evidence- Based Healthcare, 13(3), 141–146. https://doi.org/10.1097/XEB.0000000000000050 Petersen, C. A., & Barr, S. C. (2009). Canine Leishmaniasis in North America: Emerging or Newly Recognized? Veterinary Clinics of North America - Small Animal Practice, 39(6), 1065–1074. https://doi.org/10.1016/j.cvsm.2009.06.008 Taylor, L. H., Latham, S. M., & Woolhouse, M. E. J. (2001). Risk factors for human disease emergence. Philosophical Transactions of the Royal Society of London. Series B: Biological Sciences, 356(1411), 983–989. https://doi.org/10.1098/rstb.2001.0888 United Nations Development Programme. (2016). Human development report 2016. In United Nations Development Programme. https://doi.org/eISBN: 978-92-1-060036-1 Velasco-Villa, A., Mauldin, M. R., Shi, M., Escobar, L. E., Gallardo-Romero, N. F., Damon, I., Olson, V. A., Streicker, D. G., & Emerson, G. (2017). The history of rabies in the Western Hemisphere. Antiviral Research, 146, 221–232. https://doi.org/10.1016/j.antiviral.2017.03.013 WHO, FAO, & OIE. (2015). Rationale for investing in the global elimination of dog-mediated human rabies. WHO Press 20 Avenue Appia 1211 Geneva 27 Switzerland, 6–11. http://www.oie.int/eng/RABIES2015/img/WHO-OIE-FAO_Rationale_Rabies_2015_2.pdf Woldehanna, S., & Zimicki, S. (2015). An expanded One Health model: Integrating social science and One Health to inform study of the human-animal interface. Social Science and Medicine, 129, 87–95. https://doi.org/10.1016/j.socscimed.2014.10.059

Table 2. 1 Initial broad search of the literature of one electronic database

Database: PubMed via NCBI Search period: 2000 – 2018 Library: McLaughlin Library, University of Guelph Date of Search: Monday May 14, 2018 Limits: Advanced Search Builder in Title/Abstract Filters activated Publication date (custom date range) 2000-01-01 to 2018-12-31; Species: Other Animals; Languages: English, French, Spanish; Text availability: Abstract Search terms: Domestic dog descriptor terms: “domestic dog” OR “Canis familiaris” OR canine OR chien OR perro AND Canine Zoonotic Diseases descriptor terms: Anaplasma OR Ancylostoma OR Babesia OR Bacillus OR “Baylisascaris procyonis” OR “Borrelia burgdorferi” OR Brucella OR “canine zoono*” OR Campylobacter OR Capnocytophaga OR Corynebacterium OR “Coxiella burnetii” OR “Cryptosporidium parvum” OR “Dipylidium caninum” OR “Echinococcus granulosus” OR “Echinococcus multilocularis” OR Ehrlichia OR “Entamoeba histolytica” OR “Escherichia coli” OR “Giardia intestinalis” OR Helicobacter OR Influenza OR “Leishmania chagasi” OR “Leishmania infantum” OR Leptospira OR “Methicillin resistance staphylococcus aureus” OR “Microsporum canis” OR “Onchocerca lupi” OR Pasteurella OR Pseudomonas OR Proteus OR Rabies OR “Rickettsia rickettsii” OR Salmonella OR “Sarcoptes scabiei” OR Spirocerca OR “Sporothrix schenckii” OR “Toxocara canis” OR “Toxoplasma gondii” OR “Trichinella spiralis” OR “Trypanosoma cruzi” OR “Uncinaria stenocephala” OR “Vibrio cholerae” OR “Yersinia enterocolitica” No. of articles: 3,628

Table 2. 2 Platforms and the electronic databases within which keyword searches will be conducted of canine zoonoses in domestic dogs in North America

Database: Platform: PubMed NCBI© CAB Direct CABI© AGRICOLA ProQuest® SCI-EXPANDED Web of Science™ ESCI Web of Science™

CHAPTER 3

UNLEASHING THE LITERATURE: A SCOPING REVIEW OF CANINE ZOONOTIC AND VECTORBORNE DISEASE RESEARCH IN CANIS FAMILIARIS IN NORTH AMERICA

Julien, D.A., Sargeant J.M., Filejski, C., Versluis, A.M., and Harper S.L. 2018. Unleashing the Literature: A Scoping Review of Canine Zoonoses Research in Canis familiaris in North America. This Chapter was submitted for publication to Animal Health Research Reviews on August 31, 2019 and is currently under peer-review.

ABSTRACT

Domestic dogs (Canis familiaris) provide important benefits to humans but also can transmit zoonotic pathogens. Information on the breadth of canine zoonotic and vectorborne research in North America is scarce. A scoping review was conducted to examine 1) the number and type of canine zoonotic and vectorborne studies in domestic dogs conducted in North

America since the start of the 21st century; 2) the main research methods reported; 3) the

Inequality-adjusted Human Development Index (IHDI) countries in which research was conducted; and 4) whether collaborative integrated terminology was reported in research objectives or methods sections. Title/abstract screening, full text screening, and data-charting were completed by two reviewers. We identified 507 publications that evaluated 43 zoonotic or vectorborne pathogens in domestic dogs. The majority of studies (n=391 of 512 (76.37%)) were conducted in the USA. The five most frequently researched pathogens were Ehrlichia spp. (n=81 of 507 (15.98%)), Borrelia burgdorferi (n=64 of 507 (12.62%)), Leptospira spp. (n=54 of 507

(10.65%)), Rabies virus (n=42 of 507 (8.28%)), and Influenza viruses (n=41 of 507 (8.09%)).

While these pathogens can cause moderate to severe health outcomes in humans and in dogs irrespective of IHDI ranking, our review highlights notable inequitable research gaps among

North American countries.

INTRODUCTION

Since their domestication between 30,000 and 15,000 years ago, dogs (Canis familiaris) have shared their environments with humans (Larson and Bradley 2014, Takashima and Day

2014). These shared environments have evolved (O’Haire 2010): dogs now reside in homes,

sometimes sleeping in the same beds as their human companions, may share confined spaces with humans while traveling in cars, and/or participate in animal-assisted therapies for humans

(Braun et al. 2009, Friedmann and Son 2009, González Ramírez and Landero Hernández 2014).

The human-animal bond describes the shared physiological and psychological benefits that can exist, including improved health, welfare, and overall wellbeing (Takashima and Day 2014) for both species. Not only can dogs contribute to significant improvements in the health of their owners, they can improve the health of others with whom they come into contact (Macpherson

2012).

However, dogs may present risks to the health of humans and other dogs (Macpherson

2012). Dogs can share important viral, bacterial, and parasitic zoonotic diseases with humans, including rabies, leptospirosis, leishmaniasis, and echinococcosis (Eckert and Deplazes 2004,

Hodgson and Darling 2011, WHO et al. 2015, Esteva et al. 2017). Furthermore, some vectorborne diseases can affect both humans and dogs (e.g., Borrelia burgdorferi) although dogs are not involved in the transmission to humans (Ontario Agency for Health Protection and

Promotion (Public Health Ontario) 2017). Canine zoonotic and vectorborne diseases exist in many countries but their endemnicity varies depending on: (1) genetic and biological factors, such as pathogen adaptation to macro- and microenvironmental changes along with changes in host susceptibility to infection; (2) environmental factors, including land use, climate change, changes in ecosystems, and changes in human and animal population densities affecting vector and reservoir distribution; and (3) socioeconomic and political factors, such as increasing international travel and commerce, social inequality, economic development, poverty, lack of political governance, and access to health services and resources (Rabozzi et al. 2012, Taylor

2013, Gebreyes et al. 2014, Woldehanna and Zimicki 2015). Dog-related zoonotic diseases can represent a major public health concern irrespective of country-status; however, the scope of this concern may differ depending on local socio-economic influences (Otranto et al. 2009, Little et al. 2010, Chomel 2011, Chikweto et al. 2013).

The sovereign states and dependent territories of North America comprise the world’s third largest continent and encompass 16.5% of the earth’s land mass (Hoffman et al. 2016). The

Inequality-adjusted Human Development Index (IHDI), developed by the United Nations

Development Programme, is a standardized indicator of country-specific levels of human development, when accounting for inequality (United Nations Development Programme 2016).

IHDI country ranking provides a direct relationship regarding inequalities in dimensions of the

Human Development Index (HDI) to the resulting loss in human development (United Nations

Development Programme 2016). Levels of human development are important considerations as they can help to inform and evaluate policies toward reduction of inequality. Regarding research, differences in country-specific levels of human development may also impact the amount of country-specific research, which is conducted, including the number of zoonotic research publications. Previous research has identified canine zoonoses and vectorborne diseases of significant public health concern in domestic dogs in many of the sovereign states and dependent territories of North America (Leal-Castellanos et al. 2003, Lefebvre et al. 2006, Himsworth et al.

2010, Millien et al. 2015). However, a synthesis of the research evidence to identify the nature, features, and extent of literature conducted in North American countries classified by IHDI has not been undertaken.

A recent systematic review of community-level research utilizing a One Health framework to investigate zoonotic diseases, including canine zoonoses, was conducted in 54 countries across the world (Schurer et al. 2016). The transmission of canine zoonoses is driven by biological, ecological, and political factors, and also significantly influenced by how, where, and when humans and dogs come into contact (Taylor et al. 2001, Woldehanna and Zimicki 2015). With increased recognition that the health of animals, people, and the environment is inextricably linked, integrated collaborative approaches to health research (e.g., One Health, Ecosystem

Health, and others) have been proposed as tools to address complex global health challenges, such as canine zoonoses, while providing opportunities to identify sustainable global health solutions (Conrad et al. 2013, Gebreyes et al. 2014, Häsler, Cornelson, et al. 2014, Häsler, Hiby, et al. 2014).

Currently, it is unclear what kind of information is available in the literature that specifically relates to canine zoonoses and vectorborne diseases of significant public health concern in North America, whether this research varies by IHDI-ranking, and whether any integrated collaborative approaches have been included in canine zoonotic research objectives or methods. For these reasons, we conducted a scoping review to address the broad research question: What types of canine zoonosis and vectorborne research in domestic dogs has been conducted in North American countries since the start of the 21st century, and how does the literature vary across its sovereign states and dependent territories?

Our specific objectives were to identify and characterize the available literature by examining 1) the number and type of canine zoonoses and vectorborne disease studies in domestic dogs conducted in North America since the start of the 21st century; 2) the main

research methods reported; 3) research from North American countries ranked on the Inequality- adjusted Human Development Index; and 4) whether specific collaborative integrated approaches to research (e.g., One Health, Ecosystem Health, and others) were reported in the study objectives and/or methods sections.

METHODS

Protocol and Registration

This review followed the framework developed by Arksey and O’Malley (Arksey and

O’Malley 2005) and was reported using the PRISMA Extension for Scoping Reviews (PRISMA-

ScR) reporting guidelines (Tricco et al. 2018). A protocol was developed a priori, and is archived in the University of Guelph’s institutional repository (The Atrium) available at: http://hdl.handle.net/10214/13047 and published online with Systematic Reviews for Animals and Food (SYREAF) available at: http://www.syreaf.org/.

Eligibility Criteria

Studies were eligible for inclusion if they: 1) were original scientific reports of research findings (i.e., primary research studies) of dog-level and/or pathogen-level outcomes; 2) were published in English, French, or Spanish; 3) investigated eligible canine zoonoses or vectorborne diseases or their disease-causing agent in the target population of interest; 4) were conducted in one or more North American countries; and 5) were published between January 1 2000 and May

14 2018. Conference proceedings less than 500 words, dissertations, and citations for which the full text document in English, French, or Spanish was unavailable, were excluded.

Eligible Population

Studies where the population of interest included any breed of dog belonging to Canis familiaris, including owned and unowned domestic dogs, or was a zoonotic agent affecting dogs, were eligible.

Eligible Pathogens

Eligible canine zoonotic or vectorborne pathogens were defined as those with the potential to cause moderate to severe health outcomes (i.e., morbidities and/or mortalities) in humans as a result of exposure to infected dogs or sharing an environment with infected dogs.

The list of eligible zoonoses was developed by the authors from a combination of published literature (Eckert and Deplazes 2004, Lefebvre et al. 2006, Chikweto et al. 2012, 2013, Krecek et al. 2012, Chomel 2014, Stull et al. 2015, Springer et al. 2018), and publicly available online information from relevant region-specific organizations (Appendix 2.1).

Eligible Countries (including within-country regions) of Interest

Any country (or region within) in North America (Hoffman et al. 2016) was eligible, including: Anguilla, Antigua and Barbuda, Aruba, The Bahamas, Barbados, Belize, Bermuda,

Bonaire, British Virgin Islands, Canada, Cayman Islands, Clipperton Island, Costa Rica, Cuba,

Curacao, Dominica, Dominican Republic, El Salvador, Federal Dependencies of Venezuela,

Greenland, Grenada, Guadeloupe, Guatemala, Haiti, Honduras, Jamaica, Martinique, Mexico,

Montserrat, Navassa Island, Nicaragua, Nueva Esparta, Panama, Puerto Rico, Saba, San Andres and Providencia, Saint Barthelemy, Saint Kitts and Nevis, Saint Lucia, Saint-Martin, Saint Pierre and Miquelon, Saint Vincent and the Grenadines, Sint Eustatius, Sint Maarten, Trinidad and

Tobago, Turks and Caicos Islands, United States, and the United States Virgin Islands.

Information Sources

Literature searches were conducted through the McLaughlin Library, University of

Guelph in the following electronic databases: AGRICOLA© via ProQuest®; CAB Direct© via

CABI©; MEDLINE® via NCBI©; and the Science Citation Index Expanded (SCI-

EXPANDED)™ and Emerging Sources Citation Index (ESCI)™ databases via the Web of

Science platform™.

Keyword searches were developed from exploring the literature and through consultation with librarians, and experts in academia and government familiar with canine zoonoses and vectorborne diseases. The keyword search included combinations of Spanish and French variations of the concept term “dog”, and applicable canine zoonoses, vectorborne diseases, or pathogens with the controlled vocabulary option included where available. The search strategy was modified for each database accounting for differences in syntax, indexing, and functionality when appropriate. The full literature search was conducted in five databases on May 14, 2018.

Table 3.1 shows the complete search approach for one database (MEDLINE® via NCBI©), which included the following filters: language was limited to English, French, or Spanish studies; species selection (‘other animals’) restricted results to animal studies; and publication date between 2000 and 2018.

Reference Management

Citation results were uploaded into EndNote® X8 (Clarivate Analytics) reference management software and duplicates were identified and removed. Subsequently, citations were uploaded into the commercial review management program DistillerSR™ (Evidence Partners,

Ottawa, Canada) and deduplication was conducted.

Selection of Sources of Evidence and Data Charting

Title/abstract (level 1) screening was completed in duplicate by authors DAJ, JMS, and

VW. The title/abstract screening form was pre-tested using 750 citations reviewed by DAJ, JMS, and VW. The three reviewers discussed the results, resolved disagreements, and amended the screening forms prior to beginning the title/abstract review.

Full text screening (level 2) and data-charting (level 3) forms were developed in English, and pre-tested by DAJ and VW using 10 full text publications for each form. Full text screening

(level 2) for eligibility was completed by DAJ and VW for English language texts. French and

Spanish full texts were screened by a single reviewer fluent in these languages (CF). Data- charting (level 3) was completed by DAJ and VW for English language publications and by CF for French and Spanish language publications. Disagreements were resolved by consensus.

Each reviewer worked independently to examine each eligible publication using structured online forms created in DistillerSR™. Screening forms were developed with minor adjustments to the wording presented in the protocol. The explanation and elaboration

(“guidance”) document for reviewers including questions specific to each of the title/abstract, full text, and data-charting forms can be found in Appendices 2.2, 2.3, and 2.4, respectively.

Data Items

We extracted data detailing the: (1) publication year; (2) North American country(ies) within which the study was conducted as explicitly indicated within full text publications; (3) zoonotic and vectorborne pathogens studied; (4) focus of study (i.e., dog-level, pathogen-level, or both); (5) research approach at the dog-level including: descriptive studies (outbreak investigations, case reports, case series, and studies estimating proportions, prevalence, incidence

without comparisons); experiments (challenge trials of interventions to prevent or treat, natural disease trials of interventions to prevent or treat); and observational studies (interventions to prevent or treat, evaluations of risk factors for disease, evaluations of mechanisms of disease/virulence; and diagnostic test development/evaluation; approach not-defined or unclear);

(6) research approach at the pathogen-level (i.e., development or validation of laboratory methods and diagnostics, identification of virulence factors, molecular biology, pathophysiology and immunology of pathogen-host interaction, phylogeny, whole genome sequencing, and approach not-defined or unclear); (7) domestic dog populations investigated (i.e., experimental, free-roaming, owned, stray, population not-defined); and (8) type of integrated collaborative research approach (collaborative approach, community-based approach, ecosystem approach to health, one health, participatory epidemiology, systems approach, approach not-defined or unclear, no approach listed) described as a component of the study objectives and/or methods

(i.e., the authors explicitly reported that one or a combination of these approaches were considered as part of the conduct of the research study) (Pyett 2002, Leung et al. 2004, Ahn et al.

2006, Taylor 2013, Lavan et al. 2017).

Following the data extraction process, a single reviewer (DAJ) categorized North

American countries into IHDI rankings created by the United Nations Development Programme

(United Nations Development Programme 2016). For studies conducted in more than one North

American country (e.g., Canada and Mexico), as indicated within the full text publication, the study was categorized into each appropriate level. Therefore, the total number of publications by

IHDI category was higher than the total number of studies.

A single reviewer (DAJ) categorized the pathogens as bacterial, fungal, parasitic, and viral. As many studies investigated multiple pathogens, the number of pathogens was higher than the number of studies. Using the extracted data, DAJ identified the five most frequently canine zoonotic or vectorborne pathogens with the potential to cause moderate to severe health outcomes (i.e., morbidities and/or mortalities) in humans and in dogs. Finally, dog-level approaches were categorized into experimental, analytical observational, and descriptive study designs (Sargeant et al. 2014).

Synthesis of Results

Data were cleaned and descriptive frequencies performed using statistical software,

STATA Intercooled 15 (StataCorp. 2017. Stata Statistical Software: Release 15. College Station,

TX: StataCorp LLC). A combination of figures, and tables were used to collate, summarize, and report study characteristics.

To meet objective one, we created a regional map identifying the number of eligible canine zoonoses and vectorborne disease studies in domestic dogs, tabulated a comprehensive list of canine zoonotic and vectorborne pathogen types, and created a line graph of the number of eligible studies conducted in North America since the beginning of the 21st century. For objectives two, three, and four we categorized and tabulated the remaining study characteristics by North American countries ranked as “very high”, “high”, “medium”, and “low” via the

Inequality-adjusted Human Development Index.

RESULTS

Selection of Sources of Evidence

We adhered to the scoping review protocol with minor deviations from the protocol made to clarify the wording in the broad research question, review objectives and screening forms. The wording was changed from “zoonotic” to “zoonotic or vectorborne”, to avoid the perception that dogs were involved in human transmission of certain vectorborne pathogens. Searches of the selected databases identified 6,969 unique citations after duplicates were removed with 847 full text articles accessed for eligibility screening. Of these, 507 studies were eligible for data characterization in this review (Fig. 3.1.).

Results of Individual Sources of Evidence

The most common type of primary research publications were journal articles (n=506 of

507 (99.80%)) and the most research was conducted at the dog-level (n=398 of 509 (78.19%)).

The majority of studies were published in English (n=502 of 507 (99.01%)), with five publications in Spanish. Our scoping review did not identify any French language studies meeting eligibility criteria. Overall, canine zoonotic and vectorborne disease research in domestic dogs was conducted in very few North American countries (13 of 48 (27.08%)) since the start of the 21st century (Fig. 3.2.). Most publications were conducted in the northernmost countries in North America including the United States of America (USA) (n=391 of 512

(76.37%)), Canada (n=44 of 512 (8.59%)), and Mexico (n=47 of 512 (9.18%)). In the south- central region of North America, the highest number of studies were conducted in Costa Rica

(n=6 of 512 (1.17%)), followed by that from Panama (n=4 of 512 (0.78%)), Nicaragua (n=3 of

512 (0.59%)), and Guatemala (n=1 of 512 (0.20%)). In the Caribbean, the majority of studies were conducted in Grenada (n=5 of 512 (0.98%)) and Trinidad and Tobago (n=5 of 512

(0.98%)), followed by Haiti (n=3 of 512 (0.59%)), and single publications (n=1 of 512 (0.20%)) each conducted in Cuba, Puerto Rico, and Saint Kitts and Nevis.

The number of eligible studies published that were conducted in countries in North

America since the start of the 21st century is shown in Figure 3.3. In “very high” and “high”

IHDI countries, the year in which the largest number of publications of canine zoonoses and vectorborne diseases in domestic dogs was 2014, and, for “medium” and “low” IHDI countries, was 2017. Our data indicate that there were several years during which there were no publications conducted in “medium” and “low” IHDI countries, and generally, there was annual variability in the number of publications conducted in “very high” and “high” IHDI countries

(Fig. 3.3.). While there was a predominance of studies conducted in “very high” IHDI countries, under which Canada is ranked, publications appear to be largely conducted in the USA for the last 17 years (Fig. 3.3.).

The comprehensive list of zoonotic and vectorborne pathogens included in eligible studies of domestic dogs in North America since the start of the 21st century can be found in

Appendix 2.5.

Of the 507 studies, 409 (80.67%) were specific to the investigation of one pathogen (i.e., single pathogen studies), and 98 (19.33%) included investigations of multiple pathogens (i.e., mixed pathogen studies). The majority of pathogen study types were bacterial (n=312 of 534 (58.43%)), followed by parasitic (n=136 of 534 (25.47%)), viral (n=82 of 534 (15.36%), and fungal (n=4 of

534 (0.75%)) (Table 3.2). The five most frequently researched pathogens with the potential to cause moderate to severe health outcomes (i.e., morbidities and/or mortalities) in humans and in dogs were Ehrlichia spp. (n=81 of 507 (15.98%)), Borrelia burgdorferi (n=64 of 507 (12.62%)),

Leptospira spp. (n=54 of 507 (10.65%)), Rabies virus (n=42 of 507 (8.28%)), and Influenza viruses (n=41 of 507 (8.09%)). Publications of the five most frequently pathogens in domestic dogs were predominantly from countries ranked as “very high” on the IHDI (Table 3.2).

Nearly all (39 of 43 (90.70%)) of the pathogens included in the literature search string were identified in one or more research studies. Although included in our search terms, we found no research publications pertaining to Coxiella burnetii, Entamoeba histolytica, Vibrio cholerae, nor Yersinia enterocolitica in domestic dogs. Other study characteristics also were most predominant in publications from “very high” and “high” IHDI countries (Table 3.2). The majority of studies were conducted at the dog-level (398 of 509 (78.19%)). Of these, the most common study type were analytical observational studies (215 of 398 (54.02%)). The majority of the 191 pathogen-level studies were related to molecular biology (55 (28.80%)) (Table 3.2).

Most studies investigated owned domestic dogs (239 of 419 (57.04%)), followed by domestic dogs bred for use in experiments (72 of 419 (17.18%)). Lastly, of the few studies that were reported as integrated collaborative approaches (11 of 512 (2.15%)), the One Health approach was most frequently reported in the study objectives and/or methods sections (6 of 512 (1.17%)).

DISCUSSION

Summary of evidence

There is a spectrum of canine zoonoses and vectorborne diseases with the potential to cause health implications in humans and animals in North America countries (Eckert and

Deplazes 2004, Lefebvre et al. 2006, Chikweto et al. 2012, 2013, Krecek et al. 2012, Chomel

2014, Stull et al. 2015, Springer et al. 2018). Canine zoonoses may be classified as true

zoonoses, spread by direct contact between dogs and humans (e.g., rabies, leptospirosis), vector- transmitted zoonoses for which dogs may act as key sources or reservoirs (e.g., Dipylidium caninum, Ehrlichia canis, and Leishmaniasis infantum), and zooanthroponoses, diseases transmitted from humans to dogs (e.g., methicillin-resistant Staphylococcus aureus, Influenza A virus) (Messenger et al. 2014). Within each category, there are pathogens with the potential to impact the morbidity and/or mortality of people and animals (Kahn 2006). This scoping review presented a broad summary of canine zoonoses and vectorborne disease studies at the dog- and pathogen-levels in North America. Our findings show the historical and current distribution of research related to pathogens that have the potential to cause moderate to severe health outcomes

(i.e., morbidities and/or mortalities) in humans as a result of exposure to infected dogs or their environment, as well as specific characteristics pertaining to the nature of canine zoonotic research in this part of the world.

Our results indicate an inequitable publication distribution in southern dependent territories and sovereign states, reflected by the dominance in numbers of publications from the northernmost North American countries. Previous evidence indicates the transmission of zoonoses between humans and animals occurs more frequently in low- and middle-income countries, as many of these countries are resource-constrained (Karesh et al. 2012, Vasco and

Graham 2016, Delahoy et al. 2018). Historically, the epidemiology of zoonotic and vectorborne pathogens, including the status and extent of emerging infectious and parasitic disease in the central and southern countries of North America including the Caribbean, has been both poorly researched and understood (Forde et al. 2011), which may explain our findings. It is plausible that in in less populous and research-constrained settings there may be fewer researchers,

particularly in countries without veterinary academic institutions, less research funding, and the available funding may be susceptible to social, economic, and political instabilities (Zicker

2018). Notably, there was variation in the number of publications from all four IHDI categories.

While a predominance in research conducted in northernmost countries in North America may be expected, there was disproportion in the frequency of publications among the top three countries. In particular, the frequency of research literature conducted in Canada was more similar to that conducted in Mexico, a “high” IHDI country, than would be expected considering

Canada’s “very high” IHDI ranking. Many variables determine research of zoonotic diseases generally, and canine zoonoses in particular, including differences in country-specific pathogen endemicities, changing political climates and associated research prioritizations, as well as the availability of and access to research funding (National Research Council 2009). Differences in country-specific human and domestic dog populations as well as differences in human-dog proximity and contact as a result of dog population density also may explain the disparities in publications generally, and between the USA, Canada, and Mexico specifically. A 2017-2018

National Pet Owners Survey found that within the USA of 126.2 million households, 84.6 million (68%) were pet-owning households (Springer 2017). Of these, the most popular pets were dogs, accounting for 48% of all animals in pet-owning households, and 40.6 million dogs nationally (Springer 2017). With a human population of close to 37 million (International

Monetary Fund 2018), there are 7.6 million dogs in Canada, and approximately 41% of households owning at least one dog (Canadian Animal Health Institute 2017). While the proportion of household dog ownership in Canada is similar to that of the USA, the total number of dogs in Canada is considerably less than that in the USA (Canadian Animal Health Institute

2017), which may explain the disparities in numbers of publications in ese two “very high” IHDI countries. In Mexico, a “high” IHDI ranked country, there are approximately 23 million dogs

(Cortez-Aguirre et al. 2018), which provides an important canine population consideration.

However, despite a canine population size larger than that of Canada, there are certain impediments to research in Mexico that are not found in “high” IHDI countries and need to be considered. For instance, while there is limited data regarding domestic dog population demographics in Mexico (Kisiel et al. 2016), it is estimated that of 23 million dogs, 70% are categorized as either ‘street’ or ‘stray’ dogs (Cortez-Aguirre et al. 2018). The surplus of stray dogs in Mexico affords more opportunities for dog-to-dog contact and shared human-dog environments than may exist in Canada, where there is currently no evidence-based estimate of the proportion of stray dogs, but stray dogs in dense urban settings are generally extremely rare as a result of sustained and extensive dog population management initiatives. Furthermore, high numbers of stray dogs may enhance the potential for public health challenges including infectious and zoonotic disease transmission between dogs and people. This is likely a significant driver behind the conduct of high numbers of canine zoonotic research studies in Mexico (Han et al. 2016). However, given disparities in numbers of academic institutions and in available research funding, while there are more dogs in Mexico than in Canada, the number of canine zoonoses publications from Mexico is not higher than, but rather similar to that of Canada.

Another driver of published research are the resources available to conduct it. At over

4.64 billion USD in 2016 (2.74% of Gross Domestic Product (GDP)), the USA’s Gross

Domestic Research and Development (GDRD) expenditures for scientific research far exceed that of any other country globally, including Canada (2.43 billion USD, or 1.53% of GDP), and

Mexico (1.01 billion USD, or 0.49% of GDP). Since 2000, GDRD has remained steady and, more recently, increased in the United States and Mexico, whereas Canada’s GDRD has shown a decreasing trend from 1.87% GDP in 2000 to its current value (Organisation for Economic

Cooperation and Development (OECD), 2018). The specific reasons for the disproportionality in the numbers of research studies are unknown; however, our review provides evidence that indicates the majority of studies of canine zoonoses and vectorborne diseases in domestic dogs were conducted in the two most populous North American countries.

For this scoping review we chose to include known canine zoonotic as well as common vectorborne pathogens and diseases as both can affect the health of humans and dogs (Ontario

Agency for Health Protection and Promotion (Public Health Ontario) 2017). We evaluated how commonly research was conducted on various pathogens relating to human and canine health.

We identified a list of the five most frequently researched canine zoonotic and vectorborne pathogens with the potential to cause moderate to severe health outcomes in humans, which comprised exclusively viral and bacterial organisms (i.e., Ehrlichia spp., Borrelia burgdorferi,

Leptospira spp., Influenza viruses., and Rabies virus). The number of publications pertaining to infectious diseases generally, and canine zoonoses specifically, does not necessarily correlate with the burden of illness in the country/region. There are other drivers that influence the number of research publications, including: numbers of academic journals available, funding agency priorities, country-specific disease profiles of importance, the financial impact of zoonoses on a particular country, available research infrastructure, and numbers of research scientists (Stephen et al. 2004, Cascio et al. 2011, Evans et al. 2014). Certain pathogens may be overrepresented in the literature due to their importance in terms of burden of illness in dogs and their high profile

in public perception, such as canine influenza virus, Ehrlichia spp., and B. burgdorferi. Indeed, there are some infectious diseases and disease-causing pathogens that attract both high and low research attention, regardless of disease burden (Furuse 2019). For instance, dogs predominantly carry canine influenza virus subtypes H3N8 and H3N2 and should be carefully considered for the roles they play as hosts of this virus (Li et al. 2018), and their potential to act as mixing vessels for influenza viruses. However, while dogs carrying H3N2 canine influenza virus may transmit the virus to other species with whom they come into close and frequent contact, including humans, there is very limited evidence that H3N2 canine influenza virus is zoonotic

(Krueger et al. 2014, Voorhees et al. 2017). Fundamentally, there is limited understanding of the global distribution of infectious diseases (Han et al. 2016); yet, the frequency with which emerging zoonoses are occurring, emphasizes the need for geographical distribution baseline data (Han et al. 2016). The gaps in Influenza virus, and Leptospira spp. research conducted in

“medium” and “low” IHDI countries in North America, as identified within this review, may highlight differences in country-specific research priorities.

Four pathogens in our search string were unrepresented in the literature. While there is evidence to suggest dogs may play a role in the epidemiology of Coxiella burnetii, Entamoeba histolytica, Vibrio cholerae, and Yersinia enterocolitica, and that some of these pathogens may cause illness in humans as a result of exposure to infected dogs or their environment (Alam et al.

2015a; Knobel et al. 2013; Buhariwalla et al. 1996; Merck Veterinary Manual), evidence of their relationship to emerging and characterized zoonotic illnesses is not widely available in North

America (Heddle and Rowley 1975, Alam et al. 2015, Ghasemzadeh and Namazi 2015, Mtshali et al. 2017). Commonly reported pathogens are not necessarily reflective of public health

importance. The gap may highlight other zoonoses are of higher importance in North America than outside of this geographic region of the world. Furthermore, the climatic conditions to support Coxiella burnetii, Entamoeba histolytica, Vibrio cholerae, and Yersinia enterocolitica endemicities in North America may only occur in certain countries. For instance, leptospirosis is a widespread and prevalent zoonotic disease; however, many Leptospira serovars are regionally distinct, occurring mainly in countries with humid subtropical and tropical climates (Pratt et al.

2017). Since the beginning of the 21st century, there has been increasing focus and advocacy for enhanced collaboration among various disciplines to address many health challenges of global significance (Gebreyes et al. 2014, Schurer et al. 2016). Collaborative approaches to research provide an holistic and integrated foundation from which to evaluate human, animal, and environmental health challenges (Anholt et al. 2012, Lebov et al. 2017). Moreover, these approaches propose a more comprehensive understanding of health challenges and engender potential solutions than would not be possible with siloed approaches (Lebov et al. 2017). Our findings suggest very few researchers in North America included descriptions of specific collaborative integrated approaches to research (e.g., One Health, Ecosystem Health, and others) in study the objectives and/or methods sections. However, as highlighted in our findings, there was a high frequency of canine zoonotic and vectorborne disease research studies which comprised experiments and investigations on the pathophysiology and immunology of pathogen- host interaction and molecular biology, for which an integrated collaborative approach may not be warranted. Furthermore, for applied research, including analytical observational studies, which can be supported by an integrated collaborative approach, there are potential barriers inherent to the success of such approaches generally. Although some guidelines do exist (Anholt

et al. 2012, Häsler, Hiby, et al. 2014, Davis et al. 2017, Lebov et al. 2017), there remains limited guidance available for investigators in the practical design and implementation of context- specific integrated collaborative approaches to research (Lebov et al. 2017). Indeed, there are difficulties with data sharing across nations and within institutions; communication within institutions and across languages may inhibit intersectoral-collaborations; access to applicable grants and cross-disciplinary funding sources; and maintaining momentum across multidisciplinary teams (Schurer et al. 2016). Regardless of the reason, our evidence indicates a distinct gap in the inclusion and application of collaborative approaches in canine health research in this part of the world.

LIMITATIONS

This scoping review contains a number of limitations. Firstly, we adhered to the scoping review protocol with minor deviations from the protocol made to clarify the wording in the broad research question, review objectives and screening forms, and avoid the perception that dogs were involved in human transmission of certain pathogens. Moreover, in our protocol we did not explicitly mention that dissertations would not be included in our search; for this scoping review, we were interested in original scientific reports of research findings (i.e., primary research studies) of animal-level and/or pathogen-level (e.g., studies relating to molecular epidemiology of pathogens that have been sampled from dogs) outcomes. In using electronic databases, we may have missed relevant information in the grey literature, including conference proceedings and dissertations. Secondly, we collected primary research information published in English,

Spanish, or French languages, which restricted our search to articles written in those specific languages. Thirdly, we developed our search string for this scoping review from a combination

of published literature and publicly available information from region-specific organizations.

Using this method, we could have inadvertently missed published literature related to pathogens with the potential to cause moderate to severe health outcomes in humans and dogs. As part of our search string we included the major (i.e., Capnocytophaga spp.) but not all potential dog bite pathogens and could therefore have missed publications that included Klebsiella, Fusobacterium,

Neisseria, and others. Fourthly, we focused our review on domestic dogs (Canis familiaris), and on relevant studies conducted within a specific time frame. Conference proceedings or journal articles less than 500 words and published and unpublished dissertations were excluded. Finally, applying the species filter in the MEDLINE® via NCBI© database, may have excluded some citations that had not yet completed the MEDLINE® indexing process. As such, our findings provided information specific to the eligibility criteria that we used to conduct this review, and thus are only generalizable to English, French, or Spanish publications, of canine zoonoses and vectorborne diseases in domestic dogs, from North American countries since the start of the 21st century.

CONCLUSIONS AND RECOMMENDATIONS

This scoping review mapped the evidence of canine zoonoses and vectorborne diseases and characterized the available literature in relation to the current IHDI country rankings (United

Nations Development Programme 2016). From a regional perspective, the disparity in research conducted in “very high” and “high” IHDI countries as compared with “medium” and “low”

IHDI countries is similar to that identified in previous studies regarding the conduct of research of other zoonoses (World Health Organization 2012, Cleaveland et al. 2017, Delahoy et al.

2018). Our findings, and that of others, reinforces the need for improved funding and

infrastructure development for the conduct of zoonotic research in “medium” and “low IHDI countries. Through our review of the literature, we identified five pathogens that have been commonly researched particularly within “very high” IHDI North American countries since the start of the 21st century. As many of these zoonotic pathogens can pose a direct threat to the health of human and dog populations, irrespective of country IHDI ranking, it may be beneficial for future applied research, particularly within “medium” and “low” IHDI countries, to be supported by integrated collaborative approaches (Bowser and Anderson 2018), when appropriate to the research question. This support has the potential to encourage open lines of communication across disciplines and countries in an effort to effectively convey research findings; inform regional mechanisms to manage new and emerging canine zoonoses and vectorborne diseases; and identify sustainable regional and global health solutions (Bowser and

Anderson 2018).

REFERENCES

Ahn, A.C., Tewari, M., Poon, C.S., and Phillips, R.S., 2006. The clinical applications of a systems approach. PLoS Medicine, 3 (7), 0956–0960. Alam, M.A., Maqbool, A., Nazir, M.M., Lateef, M., Khan, M.S., and Lindsay, D.S., 2015. Entamoeba infections in different populations of dogs in an endemic area of Lahore, Pakistan. Veterinary Parasitology, 207 (3–4), 216–219. Anholt, R.M., Stephen, C., and Copes, R., 2012. Strategies for collaboration in the interdisciplinary field of emerging zoonotic diseases. Zoonoses and Public Health, 59 (4), 229–240. Arksey, H. and O’Malley, L., 2005. Scoping studies: towards a methodological framework. International Journal of Social Research Methodology: Theory and Practice, 8 (1), 19–32. Bowser, N. and Anderson, N., 2018. Dogs (Canis familiaris) as sentinels for human infectious disease and application to Canadian populations: A Systematic Review. Veterinary Sciences, 5 (4), 83. Braun, C., Stangler, T., Narveson, J., and Pettingell, S., 2009. Animal-assisted therapy as a pain relief intervention for children. Complementary Therapies in Clinical Practice, 15 (2), 105– 109. Buhariwalla, F., Cann, B., and Marrie, T.J., 1996. A dog-related outbreak of Q fever. Clinical

infectious diseases : an official publication of the Infectious Diseases Society of America, 23 (4), 753–5. Canadian Animal Health Institute, 2017. Latest Canadian Pet Population Figures Released [online]. Available from: https://www.canadianveterinarians.net/documents/canadian-pet- population-figures-cahi-2017 [Accessed 22 Nov 2018]. Cascio, A., Bosilkovski, M., Rodriguez-Morales, A.J., and Pappas, G., 2011. The socio-ecology of zoonotic infections. Clinical Microbiology and Infection, 17 (3), 336–342. Chikweto, A., Bhaiyat, M.I., Tiwari, K.P., de Allie, C., and Sharma, R.N., 2012. Spirocercosis in owned and stray dogs in Grenada. Veterinary Parasitology, 190 (3–4), 613–616. Chikweto, A., Tiwari, K., Kumthekar, S., Stone, D., Louison, B., Thomas, D., Sharma, R., and Hariharan, H., 2013. Serologic detection of antibodies to Brucella spp. using a commercial ELISA in cattle in Grenada, West Indies. Tropical Biomedicine, 30 (2), 277–280. Chomel, B., 2011. Tick-borne infections in dogs-An emerging infectious threat. Veterinary Parasitology, 179 (4), 294–301. Chomel, B.B., 2014. Emerging and re-emerging zoonoses of dogs and cats. Animals, 4 (3), 434– 445. Cleaveland, S., Sharp, J., Abela-Ridder, B., Allan, K.J., Buza, J., Crump, J.A., Davis, A., Del Rio Vilas, V.J., De Glanville, W.A., Kazwala, R.R., Kibona, T., Lankester, F.J., Lugelo, A., Mmbaga, B.T., Rubach, M.P., Swai, E.S., Waldman, L., Haydon, D.T., Hampson, K., and Halliday, J.E.B., 2017. One health contributions towards more effective and equitable approaches to health in low- and middle-income countries. Philosophical Transactions of the Royal Society B: Biological Sciences, 372 (1725). Conrad, P.A., Meek, L.A., and Dumit, J., 2013. Operationalizing a one health approach to global health challenges. Comparative Immunology, Microbiology and Infectious Diseases, 36 (3), 211–216. Cortez-Aguirre, G.R., Jiménez-Coello, M., Gutiérrez-Blanco, E., and Ortega-Pacheco, A., 2018. Stray dog population in a city of Southern Mexico and its impact on the contamination of public areas. Veterinary Medicine International, 2018, 1–6. Davis, M.F., Rankin, S.C., Schurer, J.M., Cole, S., Conti, L., Rabinowitz, P., Gray, G., Kahn, L., Machalaba, C., Mazet, J., Pappaioanou, M., Sargeant, J., Thompson, A., Weese, S., and Zinnstag, J., 2017. Checklist for one health epidemiological reporting of evidence (COHERE). One Health, 4 (January), 14–21. Delahoy, M.J., Wodnik, B., McAliley, L., Penakalapati, G., Swarthout, J., Freeman, M.C., and Levy, K., 2018. Pathogens transmitted in animal feces in low- and middle-income countries. International Journal of Hygiene and Environmental Health, 221 (4), 661–676. Eckert, J. and Deplazes, P., 2004. Biological, epidemiological, and clinical aspects of Echinococcosis, a zoonosis of increasing concern. Clinical Microbiology Reviews, 17 (1), 107–135. Esteva, L., Vargas, C., and Vargas de León, C., 2017. The role of asymptomatics and dogs on leishmaniasis propagation. Mathematical Biosciences, 293, 46–55. Evans, J.A., Shim, J.M., and Ioannidis, J.P.A., 2014. Attention to local health burden and the global disparity of health research. PLoS ONE, 9 (4). Forde, M., Morrison, K., Dewailly, E., Badrie, N., and Robertson, L., 2011. Strengthening integrated research and capacity development within the Caribbean region. (Special Issue: 75

Global health research case studies: lessons from partnerships addressing health inequities.). BMC International Health and Human Rights, 11 (Suppl 2). Friedmann, E. and Son, H., 2009. The human-companion animal bond: How humans benefit. Veterinary Clinics of North America - Small Animal Practice, 39 (2), 293–326. Furuse, Y., 2019. Analysis of research intensity on infectious disease by disease burden reveals which infectious diseases are neglected by researchers. Proceedings of the National Academy of Sciences of the United States of America, 116 (2), 478–483. Gebreyes, W.A., Dupouy-Camet, J., Newport, M.J., Oliveira, C.J.B., Schlesinger, L.S., Saif, Y.M., Kariuki, S., Saif, L.J., Saville, W., Wittum, T., Hoet, A., Quessy, S., Kazwala, R., Tekola, B., Shryock, T., Bisesi, M., Patchanee, P., Boonmar, S., and King, L.J., 2014. The global one health paradigm: challenges and opportunities for tackling infectious diseases at the human, animal, and environment interface in low-resource settings. PLoS Neglected Tropical Diseases, 8 (11). Ghasemzadeh, I. and Namazi, S.H., 2015. Review of bacterial and viral zoonotic infections transmitted by dogs. Journal of Medicine and Life, 8 (4), 1–5. González Ramírez, M.T. and Landero Hernández, R., 2014. Benefits of dog ownership: Comparative study of equivalent samples. Journal of Veterinary Behavior, 9 (6), 311–315. Han, B., Kramer, A., and Drake, J., 2016. Global patterns of zoonotic disease in mammals. Trends Parasitol, 32 (7), 565–577. Häsler, B., Cornelson, L., Bennani, H., and Rushton, J., 2014. A review of the metrics for one health benefits. WHO chronicle, in press (2), 453–464. Häsler, B., Hiby, E., Gilbert, W., Obeyesekere, N., Bennani, H., and Rushton, J., 2014. A one health framework for the evaluation of rabies control programmes: a case study from Colombo City, Sri Lanka. PLoS Neglected Tropical Diseases, 8 (10). Heddle, R.. and Rowley, D., 1975. The antibacterial properties of dog IgA, IgM and IgG antibodies to vibrio cholerae. Immunologic Research, 29, 197–207. Himsworth, C.G., Jenkins, E., Hill, J.E., Nsungu, M., Ndao, M., Thompson, R.C.A., Covacin, C., Ash, A., Wagner, B.A., McConnell, A., Leighton, F.A., and Skinner, S., 2010. Short report: Emergence of sylvatic echinococcus granulosus as a parasitic zoonosis of public health concern in an indigenous community in Canada. American Journal of Tropical Medicine and Hygiene, 82 (4), 643–645. Hodgson, K. and Darling, M., 2011. Zooeyia: an essential component of ‘One Health’. The Canadian Veterinary Journal, 52 (2), 189–191. Hoffman, P.F., Schaetzl, R.J., Wreford Watson, J., and Zelinsky, W., 2016. North America | Countries, Regions, & Facts | Britannica.com [online]. Encyclopædia Britannica, inc. Available from: https://www.britannica.com/place/North-America [Accessed 15 Apr 2018]. International Monetary Fund, 2018. World Economic Outlook (October 2018) - Population Mexico [online]. web page. Available from: https://www.imf.org/external/datamapper/LP@WEO/OEMDC/ADVEC/WEOWORLD [Accessed 15 Jan 2019]. Jones, E.H., Hinckley, A.F., Hook, S.A., Meek, J.I., Backenson, B., Kugeler, K.J., and Feldman, K.A., 2018. Pet ownership increases human risk of encountering ticks. Zoonoses and Public Health, 65 (1), 74–79. Kahn, L.H., 2006. Confronting zoonoses, linking human and veterinary medicine. Emerging 76

Infectious Diseases, 12 (4), 556–561. Karesh, W.B., Dobson, A., Lloyd-smith, J.O., Lubroth, J., Dixon, M.A., Bennett, M., Aldrich, S., Harrington, T., Formenty, P., Loh, E.H., Machalaba, C.C., Thomas, M.J., and Heymann, D.L., 2012. Ecology of zoonoses : natural and unnatural histories. The Lancet, 380 (9857), 1936–1945. Kisiel, L.M., Jones-Bitton, A., Sargeant, J.M., Coe, J.B., Flockhart, D.T.T., Reynoso Palomar, A., Canales Vargas, E.J., and Greer, A.L., 2016. Owned dog ecology and demography in Villa de Tezontepec, Hidalgo, Mexico. Preventive Veterinary Medicine, 135, 37–46. Knobel, D.L., Maina, A.N., Cutler, S.J., Ogola, E., Feikin, D.R., Junghae, M., Halliday, J.E.B., Richards, A.L., Breiman, R.F., Cleaveland, S., and Njenga, M.K., 2013. Coxiella burnetii in humans, domestic ruminants, and ticks in rural Western Kenya. American Journal of Tropical Medicine and Hygiene, 88 (3), 513–518. Krecek, R., Drebot, M., Wood, H., Morrison, K., Forde, M., and Dewailly, E., 2012. Prevalence of Zoonotic Infections in the CARICOM Region: Regional Report for CARICOM. Krueger, W.S., Heil, G.L., Yoon, K.J., and Gray, G.C., 2014. No evidence for zoonotic transmission of H3N8 canine influenza virus among US adults occupationally exposed to dogs. Influenza and other Respiratory Viruses, 8 (1), 99–106. Larson, G. and Bradley, D.G., 2014. How much is that in dog years? The advent of canine population genomics. PLoS Genetics, 10 (1), 1–3. Lavan, R.P., King, A.I.M., Sutton, D.J., and Tunceli, K., 2017. Rationale and support for a One Health program for canine vaccination as the most cost-effective means of controlling zoonotic rabies in endemic settings. Vaccine, 35, 1668–1674. Leal-Castellanos, C.B., Garcia-Suarez, R., Gonzales-Figueroa, E., Fuentes-Allen, J.L., and Escobedo-De La Pena, J., 2003. Risk factors and the prevalence of leptospirosis infection in a rural community of Chiapas, Mexico. Epidemiology and Infection, 131 (3), S0950268803001201. Lebov, J., Grieger, K., Womack, D., Zaccaro, D., Whitehead, N., Kowalcyk, B., and MacDonald, P.D.M., 2017. A framework for one health research. One Health, 3, 44–50. Lefebvre, S.L., Waltner-Toews, D., Peregrine, A.S., Reid-Smith, R., Hodge, L., Arroyo, L.G., and Weese, J.S., 2006. Prevalence of zoonotic agents in dogs visiting hospitalized people in Ontario: Implications for infection control. Journal of Hospital Infection, 62 (4), 458–466. Leung, M.W., Yen, I.H., and Minkler, M., 2004. Community-based participatory research: A promising approach for increasing epidemiology’s relevance in the 21st century. International Journal of Epidemiology, 33 (3), 499–506. Li, G., Wang, R., Zhang, C., Wang, S., He, W., Zhang, J., Liu, J., Cai, Y., Zhou, J., and Su, S., 2018. Genetic and evolutionary analysis of emerging H3N2 canine influenza virus article. Emerging Microbes and Infections, 7 (1). Little, S.E., Heise, S.R., Blagburn, B.L., Callister, S.M., and Mead, P.S., 2010. Lyme borreliosis in dogs and humans in the USA. Trends in Parasitology, 26 (4), 213–218. Macpherson, C.N., 2012. Dogs, Zoonoses and Public Health. 2nd ed. CABI. Merck Veterinary Manual, 2019. Zoonotic Diseases - Public Health [online]. Available from: https://www.merckvetmanual.com/public-health/zoonoses/zoonotic-diseases [Accessed 15 Jan 2019]. Messenger, A.M., Barnes, A.N., and Gray, G.C., 2014. Reverse zoonotic disease transmission 77

(Zooanthroponosis): A systematic review of seldom-documented human biological threats to animals. PLoS ONE, 9 (2), 1–9. Millien, M.F., Pierre-Louis, J.B., Wallace, R., Caldas, E., Rwangabgoba, J.M., Poncelet, J.L., Cosivi, O., and Del Rio Vilas, V.J., 2015. Control of dog mediated human rabies in Haiti: No time to spare. PLoS Neglected Tropical Diseases, 9 (6), 1–10. Mtshali, K., Nakao, R., Sugimoto, C., and Thekisoe, O., 2017. Occurrence of Coxiella burnetii, Ehrlichia canis, Rickettsia species and Anaplasma phagocytophilum-like bacterium in ticks collected from dogs and cats in South Africa. Journal of the South African Veterinary Association, 1–6. National Research Council, 2009. Sustaining global surveillance and response to emerging zoonotic diseases. Washington, DC: The National Academies Press. O’Haire, M., 2010. Companion animals and human health: Benefits, challenges, and the road ahead. Journal of Veterinary Behavior: Clinical Applications and Research, 5 (5), 226–234. Ontario Agency for Health Protection and Promotion (Public Health Ontario), 2017. Companion animals and tick-borne diseases: A systematic review. Systematic Review. Toronto, Ontario: Queen’s Printer for Ontario. Organisation for Economic Cooperation and Development (OECD), 2018. Gross domestic spending on R&D [online]. Available from: https://data.oecd.org/rd/gross-domestic- spending-on-r-d.htm [Accessed 22 Nov 2018]. Otranto, D., Dantas-Torres, F., and Breitschwerdt, E.B., 2009. Managing canine vector-borne diseases of zoonotic concern: part two. Trends in Parasitology, 25 (5), 228–235. Pratt, N., Conan, A., and Rajeev, S., 2017. Leptospira seroprevalence in domestic dogs and cats on the Caribbean island of Saint Kitts. Veterinary Medicine International, 2017, Article ID 5904757. Pyett, P., 2002. Working together to reduce health inequalities: Reflections on a collaborative participatory approach to health research. Australian and New Zealand Journal of Public Health, 26 (4), 332–336. Rabozzi, G., Bonizzi, L., Crespi, E., Somaruga, C., Sokooti, M., Tabibi, R., Vellere, F., Brambilla, G., and Colosio, C., 2012. Emerging zoonoses: the ‘one health approach’. Safety and health at work, 3 (1), 77–83. Sargeant, J.M., Kelton, D.F., and O’Connor, A.M., 2014. Study designs and systematic reviews of interventions: Building evidence across study designs. Zoonoses and Public Health, 61 (SUPPL1), 10–17. Schurer, J.M., Mosites, E., Li, C., Meschke, S., and Rabinowitz, P., 2016. Community-based surveillance of zoonotic parasites in a ‘One Health’ world: A systematic review. One Health, 2, 166–174. Springer, A., Montenegro, V.M., Schicht, S., Pantchev, N., and Strube, C., 2018. Seroprevalence and current infections of canine vector-borne diseases in Nicaragua. Parasites & vectors, 11 (1), 585. Springer, J., 2017. The 2017-2018 APPA National Pet Owners Survey Debut. StataCorp. 2017. Stata Statistical Software: Release 15. College Station, T.S.L., 2017. Stata Statistical Software: Release 15 College Station, TX: StataCorp LLC [online]. 2017. Available from: https://www.stata.com/ [Accessed 15 Nov 2017]. Stephen, C., Artsob, H., Bowie, W.R., Drebot, M., Fraser, E., Leighton, T., Morshed, M., Ong, 78

C., and Patrick, D., 2004. Perspectives on emerging zoonotic disease research and capacity building in Canada. Canadian Journal of Infectious Diseases, 15 (6), 339–344. Stull, J.W., Brophy, J., and Weese, J.S., 2015. Reducing the risk of pet-associated zoonotic infections. Canadian Medical Association Journal, 187 (10), 736–743. Takashima, G.K. and Day, M.J., 2014. Setting the one health agenda and the human-companion animal bond. International Journal of Environmental Research and Public Health, 11 (11), 11110–11120. Taylor, L., 2013. Eliminating canine rabies: The role of public–private partnerships. Antiviral Research, 98 (2), 314–318. Taylor, L.H., Latham, S.M., and Woolhouse, M.E.J., 2001. Risk factors for human disease emergence. Philosophical Transactions of the Royal Society B: Biological Sciences, 356 (1411), 983–989. Tricco, A.C., Lillie, E., Zarin, W., O’Brien, K.K., Colquhoun, H., Levac, D., Moher, D., Peters, M.D.J., Horsley, T., Weeks, L., Hempel, S., Akl, E.A., Chang, C., McGowan, J., Stewart, L., Hartling, L., Aldcroft, A., Wilson, M.G., Garritty, C., Lewin, S., Godfrey, C.M., Macdonald, M.T., Langlois, E. V., Soares-Weiser, K., Moriarty, J., Clifford, T., Tunçalp, Ö., and Straus, S.E., 2018. PRISMA extension for scoping reviews (PRISMA-ScR): checklist and explanation. Annals of Internal Medicine. United Nations Development Programme, 2016. Human development report 2016. United Nations Development Programme. Vasco, K. and Graham, J.P., 2016. Detection of zoonotic enteropathogens in children and domestic animals in a semirural community in Ecuador, 82 (14), 4218–4224. Velasco-Villa, A., Mauldin, M.R., Shi, M., Escobar, L.E., Gallardo-Romero, N.F., Damon, I., Olson, V.A., Streicker, D.G., and Emerson, G., 2017. The history of rabies in the Western Hemisphere. Antiviral Research, 146, 221–232. Voorhees, I.E.H., Glaser, A.L., Toohey-Kurth, K., Newbury, S., Dalziel, B.D., Dubovi, E.J., Poulsen, K., Leutenegger, C., Willgert, K.J.E., Brisbane-Cohen, L., Richardson-Lopez, J., Holmes, E.C., and Parrish, C.R., 2017. Spread of canine influenza a(H3N2) virus, United States. Emerging Infectious Diseases, 23 (12), 1950–1957. White, A.M., Zambrana-Torrelio, C., Allen, T., Rostal, M.K., Wright, A.K., Ball, E.C., Daszak, P., and Karesh, W.B., 2017. Hotspots of canine leptospirosis in the United States of America. Veterinary Journal, 222, 29–35. WHO, FAO, and OIE, 2015. Rationale for investing in the global elimination of dog-mediated human rabies. WHO Press 20 Avenue Appia 1211 Geneva 27 Switzerland, 6–11. Woldehanna, S. and Zimicki, S., 2015. An expanded One Health model: Integrating social science and One Health to inform study of the human-animal interface. Social Science and Medicine, 129, 87–95. World Health Organization, 2012. Research priorities for zoonoses and marginalized infections. World Health Organization technical report series. Zicker, F., 2018. Promoting high quality research into priority health needs in Latin America and Caribbean, 1–3.

Table 3. 1 Final search strategy for the conduct of title/abstract screening in MEDLINE® via NCBI® to identify literature on canine zoonoses and vectorborne disease research in Canis familiaris in North America since the start of the 21st century

Database: MEDLINE® via NCBI© Search period: 2000 – 2018 Library: McLaughlin Library, University of Guelph Limits: Advanced Search Builder in Title/Abstract Filters activated Publication date (custom date range) 2000-01-01 to 2018-05-14; Species: Other Animals Languages: English, French, Spanish Text availability: Abstract Search terms: Domestic dog descriptor terms: “domestic dog” OR “Canis familiaris” OR canine OR chien OR perro AND Canine zoonotic and vectorborne pathogen descriptor terms: †Anaplasma OR Ancylostoma OR †Babesia OR Bacillus OR “Baylisascaris procyonis” OR “†Borrelia burgdorferi” OR Brucella OR “canine zoono*” OR Campylobacter OR Capnocytophaga OR Corynebacterium OR “Coxiella burnetii” OR “Cryptosporidium parvum” OR “Dipylidium caninum” OR “Echinococcus granulosus” OR “Echinococcus multilocularis” OR †Ehrlichia OR “Entamoeba histolytica” OR “Escherichia coli” OR “Giardia intestinalis” OR Helicobacter OR Influenza OR “Leishmania chagasi” OR “Leishmania infantum” OR Leptospira OR “Methicillin resistance staphylococcus aureus” OR “Microsporum canis” OR “Onchocerca lupi” OR Pasteurella OR Pseudomonas OR Proteus OR Rabies OR “†Rickettsia rickettsii” OR Salmonella OR “Sarcoptes scabiei” OR Spirocerca OR “Sporothrix schenckii” OR “Toxocara canis” OR “Toxoplasma gondii” OR “Trichinella spiralis” OR “Trypanosoma cruzi” OR “Uncinaria stenocephala” OR “Vibrio cholerae” OR “Yersinia enterocolitica” †Please note this tick-borne pathogen does not constitute a canine zoonotic pathogen (i.e., there is no direct or indirect transmission from dogs to humans). However, we have included it I our search string as it is of public health concern in some sovereign states and dependent territories in North America and can affect the health of both humans and dogs.

Inequality-adjusted Human Very Row Development North American Highb Mediumc Lowd Higha† Totals e Country Index Pathogen Categories for

Comprehensive List of all Pathogens Bacterial 272 36 3 1 312

Fungal 4 0 0 0 4

Parasitic 103 32 0 1 136

Viral 72 7 1 2 82

Column Totals 451 75 4 4 534

Five most Frequently Researched Zoonotic and Vectorborne Pathogens in Domestic Dogs Borrelia burgdorferi 58 4 1 1 64

Ehrlichia spp. 64 14 2 1 81

Influenza viruses 40 1 0 0 41

Leptospira spp. 42 10 2 0 54

Rabies virus 33 6 1 2 42

Column Totals 237 35 6 4 282

Study-Level

Dog-level 296 55 3 3 357

Pathogen-level 102 9 0 0 111

Dog- and pathogen-level 35 5 1 0 41

Column Totals 433 69 4 3 509

Main Research Methods at the Dog-Level Experimental Studies 69 6 0 0 75

Analytical Observational Studies 174 37 2 2 215

Descriptive Studies 88 17 2 1 108

Column Totals 331 60 4 3 398

Main Research Methods at the Pathogen-Level Development or validation of 29 0 0 0 29 laboratory methods and diagnostics Identification of virulence factors 14 1 0 0 15

Molecular biology 48 6 1 0 55 Pathophysiology and immunology of pathogen-host interaction 45 4 0 0 49

Phylogeny 31 7 0 0 38

Whole genome sequencing 5 0 0 0 5 Column Totals 172 18 1 0 191

Types of Domestic Dogs Included in Studies Domestic dogs bred for use in 71 1 0 0 72 experiments Free-roaming domestic dogs 4 5 1 1 11

Owned domestic dogs 194 40 3 2 239

Population ill-defined or unclear 55 5 1 1 62

Stray domestic dogs 14 21 0 0 35

Column Totals 338 72 5 4 419 Integrated Collaborative Approaches Listed as Part of Study Approach unclear or ill-defined 0 1 0 0 1

Collaborative approach 1 0 0 0 1

Community-based approach 0 3 0 0 3

Ecosystem approach to health 0 1 0 0 1

One health 3 3 0 0 6

Participatory epidemiology 0 0 0 0 0

Systems approach 0 0 0 0 0

No approach listed 429 64 4 3 500

Column Totals 433 72 4 3 512 aUnited States of America (USA) and Canada, bCosta Rica, Cuba, Grenada, Mexico, Panama, Saint Kitts and Nevis, Trinidad and Tobago, cGuatemala and Nicaragua, dHaiti †Puerto Rico is not listed on the IHDI rankings, however, as an unincorporated U.S. territory data pertaining to this country were included with the USA. eFor studies conducted in more than one North American country, (e.g., Canada and Mexico), the study was categorized twice. That is, for the above example, once under the “very high” IHDI, and once under the “high” IHDI. Therefore, the total number of studies categorized by IHDI was higher than the total number of studies considered eligible for data characterization. fAs of May 14, 2018

Figure 3. 1 PRISMA© flow chart detailing the number of title/abstract citations identified, duplicates removed, full texts included and excluded, and the reasons for their exclusion

Figure 3. 2 Map showing the number of eligible canine zoonoses and vectorborne disease studies of domestic dogs conducted in the sovereign states and dependent territories of North America between 2000 and 2018

CHAPTER 4

PREVALENCE AND GENETIC CHARACTERIZATION OF GIARDIA SPP. AND CRYPTOSPORIDIUM SPP. IN DOGS IN IQALUIT, NUNAVUT, CANADA

Danielle A. Julien, Jan M. Sargeant, Rebecca A. Guy, Karen Shapiro, Rachel K. Imai, Anna Bunce, Enooyaq Sudlovenick, Shu Chen, Jiping Li, and Sherilee L. Harper. This Chapter was published July 15, 2019 in Zoonoses and Public Health https://doi.org/10.1111/zph.12628

ABSTRACT

There are few epidemiologic studies on the role of dogs in zoonotic parasitic transmission in the Circumpolar North. The objectives of this study were to: (1) estimate the fecal prevalence of Giardia spp. and Cryptosporidium spp. in dogs; (2) investigate potential associations between the type of dog population and the fecal presence of Giardia spp. and Cryptosporidium spp.; and

(3) describe the molecular characteristics of Giardia spp. and Cryptosporidium spp. in dogs in

Iqaluit, Nunavut. We conducted two cross-sectional studies in July and September 2016. In July, the research team collected daily fecal samples for 3 days from each of 20 sled dogs. In

September, the team collected three fecal samples from each of 59 sled dogs, 111 samples from shelter dogs, and 104 from community dogs. We analyzed fecal samples for the presence of

Giardia spp., and Cryptosporidium spp. using rapid immunoassay and flotation techniques.

Polymerase chain reaction (PCR) and sequencing of target genes were performed on positive fecal samples. Overall, the fecal prevalence of at least one of the target parasites, when one fecal sample was chosen at random for all dogs, was 8.16% (95% CI: 5.52-11.92), and for Giardia spp. and Cryptosporidium spp. prevalence was 4.42% (95% CI: 2.58-7.49) and 6.12% (95% CI:

3.88-9.53), respectively. The odds of fecal Giardia spp. in sled dogs were significantly higher than in shelter and community dogs (OR 10.19 (CI: 1.16-89.35)). Sequence analysis revealed that 6 fecal samples were Giardia intestinalis, zoonotic assemblage B (n=2), and species-specific assemblages D (n=3), and E (n=1), and 5 fecal samples were Cryptosporidium canis. Giardia intestinalis is a known zoonotic genus; however, Cryptosporidium canis is rare in humans and, when present, usually occurs in immunosuppressed individuals. Dogs may be a potential source of zoonotic Giardia intestinalis assemblage B infections in residents in Iqaluit, Nunavut, Canada;

however, the direction of transmission is unclear.

IMPACTS

Our results provide important baseline data estimating the fecal prevalence of Giardia

spp. and Cryptosporidium spp. in dogs, which is intended to inform enteric illness

surveillance activities in Nunavut.

Canine feces collected in Iqaluit, Nunavut contained a zoonotic parasitic organism

Giardia intestinalis assemblage B. Other organisms identified were protozoan parasites

Cryptosporidium canis and Giardia intestinalis assemblages D and E.

The direction of Giardia intestinalis assemblage B transmission between dogs and

humans is unclear: dogs may be a potential source of Giardia infection in people, or dogs

may also acquire Giardia from humans in Iqaluit, Nunavut.

INTRODUCTION

Enteric illness is an important cause of morbidity and mortality causing substantial economic, human, and animal health impacts worldwide (Thomas et al., 2017). Enteric illness is characterized by vomiting and/or diarrhea and can be accompanied by fever, abdominal pain, and anorexia (Majowicz et al., 2008). Although symptoms are typically mild and self-limiting in high income countries, complications associated with enteric illness can be debilitating (Thomas et al. 2006).

Many pathogens can cause enteric illness, including bacteria (e.g., Salmonella spp.,

Campylobacter spp., and Vibrio spp.), viruses (e.g., Norovirus and Rotavirus), and protozoan parasites (e.g., Giardia spp. and Cryptosporidium spp.) (World Health Organization 2015).

Giardia spp. and Cryptosporidium spp. are among the most common protozoal parasites

implicated in enteric illness in humans and many species of mammals, including dogs (Lucio-

Forster et al. 2010, Fletcher et al. 2012). Furthermore, these parasites are the cause of considerable morbidities and mortalities globally (Fletcher et al., 2012; Snel et al., 2009). Human exposure to Giardia spp. and Cryptosporidium spp. can occur through many transmission pathways, including contact with infected people or animals, and the ingestion of water or food contaminated with human or animal fecal matter (Macpherson 2005). Pets, including dogs, are a known animal source of Giardia spp. and Cryptosporidium spp. in humans (Traub et al. 2004,

Xiao et al. 2007). Given the many ways in which people can be exposed, it is often difficult to determine the specific sources of parasitic infections (Lucio-Forster et al., 2010).

Globally, one of the highest incidences of self-reported enteric illness was reported in populations in Inuit Nunangat, including Iqaluit, Nunavut (Harper et al. 2015). Furthermore, research identified high prevalences of two parasites, Giardia spp. and Cryptosporidium spp., in the stools of human patients with diarrhea from the Qikiqtani Region of Nunavut (Iqbal et al.

2015). Molecular analysis and characterization of these parasites suggested human-human or, more likely, zoonotic transmission (Iqbal et al. 2015). Therefore, similar to other regions in

Canada, it is plausible that domestic animals, such as dogs, may be a potential source of human exposure to enteric parasites in Arctic Canada.

Inuit have a long and meaningful history of living in close contact with dogs (Qikiqtani

Inuit Association 2014). Historically, dogs were an integral part of Inuit life, and they continue to play crucial roles in the lives and culture for many Inuit, such as providing transportation, accompanying people when they travel on the land, as well as providing protection and companionship (Brook et al. 2010, Daveluy et al. 2011, Qikiqtani Inuit Association 2014,

Aenishaenslin et al. 2018). However, similar to other locations around the world, dogs may put people at risk of exposure to enteric pathogens (Goyette et al, 2014; Hotez, 2010; Salb et al.,

2008), including parasitic zoonoses (Dixon et al. 2008, Thivierge et al. 2016).

In First Nation populations in southern locales in Canada, studies have identified dogs as hosts of many genera of zoonotic parasites, including Giardia and Cryptosporidium (Himsworth et al., 2010; Jenkins et al., 2013; Schurer, Hill, Fernando, and Jenkins, 2012). In some of these more southern Indigenous communities, there is an increased risk of zoonotic infection due in part to a combination of factors, including free-roaming dog populations (Schurer et al. 2012) and limited access to health services and resources in some communities (Adelson 2005, King

2009). However, similar studies examining the potential role of dogs in zoonoses in Inuit communities are lacking, presenting a challenge in understanding the role these animals may play in the transmission of Giardia spp. and Cryptosporidium spp. in the Circumpolar North

(Kutz et al., 2009). Therefore, the goal of this research was to investigate dogs as a potential source of Giardia spp. and Cryptosporidium spp. infections in residents in Iqaluit, Nunavut. The objectives of this study were to: (1) estimate the fecal prevalence of Giardia spp. and

Cryptosporidium spp. in dogs; (2) investigate potential associations between the type of dog population and the fecal presence of Giardia spp. and Cryptosporidium spp.; and (3) describe the molecular characteristics of Giardia spp. and Cryptosporidium spp. in dogs in Iqaluit, Nunavut.

MATERIALS AND METHODS

Study Approach

The People, Animals, Water, and Sustenance (PAWS) project was developed to better understand which exposures might contribute to the burden of enteric illness in Iqaluit. This

project was a collaboration between researchers in the Arctic, non-governmental organizations, government stakeholders, and researchers at universities. Through extensive engagement and consultation, Nunavut-based partners identified untreated drinking water (Masina et al. 2019), clams (Manore 2018), and dogs as important potential sources of enteric illness in humans, and identified Cryptosporidium spp. and Giardia spp. as enteric pathogens of top concern. This formed the research focus of the PAWS project.

The project used EcoHealth and One Health approaches (Zinsstag et al. 2011, Rabinowitz and Conti 2013), which were critical to understanding the unique context of enteric illness in

Iqaluit, Nunavut and improving scientific knowledge of the interaction between water, food, and dogs in an Arctic setting. A central component of the PAWS project involved understanding

Inuit relationship to each of the water, food, and dog study components; this not only informed the conduct of the research but also provided a foundation from which to communicate research findings in culturally appropriate and locally relevant manners. The research described herein is a component of the PAWS project and is specifically focused on the “animal” element of that project.

The Nunavut Innovation and Research Institute approved the involvement of dogs in this study (Scientific Research License #0103116N-A). We did not require ethical approval from the

University of Guelph Research Ethics Board as this study did not involve human participants nor direct contact with animals.

Research Setting

We conducted cross-sectional studies in July and September 2016 in Iqaluit, the capital city and largest of 26 communities in the territory of Nunavut in Inuit Nunangat. Located on

Baffin Island, over 7,700 people reside in Iqaluit, 58.5% of whom identify as Indigenous, primarily Inuit (Statistics Canada 2016b) (Figure 1.).

Sampling Framework

The number of dogs needed to estimate a true prevalence of Giardia spp. and

Cryptosporidium spp. with an imperfect test was calculated with 95% confidence and 5% precision, using an assumed sensitivity of 89.2% (IDEXX Veterinary Diagnostics, Westbrook

2016). In the absence of previous studies reporting the prevalence of parasites in dogs in the

Arctic, an assumed true prevalence of 20% was applied based on previous studies investigating parasites in dogs in the provincial north and southern Northwest Territories, Canada (Bouzid,

Halai, Jeffreys, and Hunter, 2015; Salb et al., 2008; Schurer et al., 2012; Villeneuve et al., 2015), and on studies in the Arctic investigating the prevalence of Giardia spp. and Cryptosporidium spp. in diarrhoeic human patients of Baffin Island, Nunavut, Canada (Goldfarb et al. 2013, Iqbal et al. 2015). We used the sample size calculation to guide our decisions on sample size and the scope of the project. The calculated sample size was 284 dogs.

Dog Populations

We collected fecal samples (“samples”) from three dog populations: sled dogs, shelter dogs temporarily housed at the Iqaluit Humane Society (“shelter dogs”) and owned and/or free- roaming dogs (“community dogs”). In July 2016, we collected feces from sled dogs, and in

September 2016 we collected feces from sled, community, and shelter dog.

Sled Dogs: July and September 2016

From July 20-31, 2016, we conducted an initial cross-sectional study using a convenience population of sled dogs. The teams of every sled dog team owner in the community during the

July study period were eligible to participate. From September 12-22, 2016, we attempted a census study of sled dogs including the teams we researched in July. In both July and September, we collected fecal samples daily from each dog for three days. Data were collected pertaining to the team to which each sled dog belonged (“team”), the number of dogs in each team (“team size”), and the number of fecal samples (“samples”) collected from each dog for all sled dogs that we researched in July and September.

Shelter Dogs: September 2016

The Humane Society in Iqaluit is the only animal shelter in Nunavut. The length of stay of any dog at the shelter is highly variable. Shelter dogs may be returned to their owner, rehomed in Iqaluit, or relocated via inter-provincial adoption through the Society for the Prevention of

Cruelty to Animals (SPCA) in Western Quebec and through animal rescues in Ottawa at various intervals. From September 13-22, 2016, Humane Society staff and volunteers collected and packaged fresh fecal samples from shelter dogs for the research team to collect daily.

Community Dogs: September 2016

We conducted a convenience collection of fecal deposits in public access areas from

September 10-21, 2016. Similar to other studies, (Himsworth, Skinner, et al. 2010, Schurer et al.

2013), deposits were assumed to be canine feces, specifically that of community dogs in Iqaluit.

Fecal samples were collected by the research team using transect walk methods, modified from the World Society for the Protection of Animals guidelines (WSPA 2012). The research team conducted training sessions with local Inuit researchers to ensure general safety around free- roaming dogs and methods for accurate fecal sample collection. We divided geographical maps obtained from the City of Iqaluit into multiple contiguous quadrants (750m length x 500m

width). The research team collected fecal samples from randomly selected quadrants in public areas including parks, playgrounds, school properties, major roadways and thoroughfares, and open tundra.

Fecal Sample Collection, Storage, and Shipment

We aimed to collect the maximum feasible number of fecal samples from dogs up to the calculated sample size. Dog feces that were as fresh as possible were collected; feces that were dry and/or overly grey or white (an indication of age and desiccation) were rejected as per a previous study of environmental fecal sampling (Schurer et al. 2013). We were unable to formerly collect any information on deworming and/or other medical treatments of any dogs in this study. For each canine population, fecal sampling was from that deposited by dogs and collected in their environment, not rectally. We assumed that each fecal sample collected via environmental transect walks and from shelter dogs originated from one dog; therefore, in contrast to sled dogs, we collected only one fecal sample per shelter and community dog. We used previously unopened gloves to collect each fecal sample in a re-sealable plastic bag. Fecal samples were divided for parasite detection by rapid immunoassay and microscopy and were maintained between 2-8◦C prior to and during shipping when possible. At the end of the study period in July, one researcher travelled by plane with fecal samples transported on ice from

Iqaluit, Nunavut to Guelph, Ontario. In September, fecal samples were transported on ice at regular intervals from Iqaluit, Nunavut to Guelph, Ontario using one of two Iqaluit-based shipping companies.

Parasite Detection

To explore opportunities to increase diagnostic capacities in this remote Arctic community, and to maximize the likelihood of identifying Giardia spp. and Cryptosporidium spp., the authors chose to use a combination of microscopy and rapid immunoassay tests. In

Guelph, Ontario, each fecal sample was tested for Giardia- and Cryptosporidium-specific antigens by one researcher using two rapid immunoassay tests: 1) IDEXX SNAP® Giardia test for the detection of a Giardia-antigen, validated for use in dogs and cats (IDEXX Veterinary

Diagnostics, Westbrook 2016); and 2) Xpect™ Giardia/Cryptosporidium test for the simultaneous detection of Giardia and/or Cryptosporidium antigens, validated for use in humans

(ThermoFisher Scientific, 2016). Detection of Giardia and Cryptosporidium antigens in fecal samples was presumed to indicate that the animal had Giardia trophozoites or cysts and/or

Cryptosporidium endogenous stages in the intestine or oocysts in the feces. A different researcher conducted sucrose wet mounts to detect cysts of Giardia spp. or oocysts of

Cryptosporidium species present in the feces.

Rapid Immunoassay Tests

The IDEXX SNAP® Giardia (for the detection of any Giardia antigen) and Xpect™

Giardia/Cryptosporidium (for the detection of Giardia intestinalis (G. intestinalis) and

Cryptosporidium parvum antigens) tests were carried out as per manufacturer recommendations

(IDEXX Veterinary Diagnostics, Westbrook 2016, Thermofisher Scientific 2016). Deviations from the product inserts included an increased length of time between fecal sample collection and analysis (n=4 weeks in July and n=2 weeks in September), as well as periodically substandard storage of fecal samples. We refrigerated fecal samples immediately after collection,

but some fecal samples might have been subject to periods of ambient temperature during transport given the distance from Nunavut to southern Ontario.

Sucrose Wet Mount Microscopy

The Ontario Veterinary College puddle technique was used to test fecal samples for

Cryptosporidium spp. oocysts and Giardia spp. cysts (Trotz-Williams et al. 2005). Briefly, after thorough mechanical mixing of each fecal sample, a small amount of fecal material

(approximately 40 mg) was added to a drop of sucrose solution (specific gravity 1.32) on a microscope slide. The sucrose and fecal material were mixed using a fresh applicator stick on the slide and a coverslip applied (Trotz-Williams et al. 2005). The entire coverslip was examined immediately for the presence of Giardia spp. cysts and Cryptosporidium spp. oocysts. A fecal sample was considered positive for Giardia and Cryptosporidium if at least one (oo)cyst was detected on a 22mm2 coverslip examined at 400× magnification. Fecal samples may have been exposed to periods of freeze/thaw due the climate in September in Iqaluit, Nunavut. The typical sensitivity of this method is estimated to be approximately 50 oocysts/cysts per gram feces when examining undiluted, fresh feces.

Molecular Analyses

DNA Extraction

Samples that tested positive for Giardia or Cryptosporidium using immunoassays or microscopy were further processed for DNA extraction and molecular analysis at the

Agricultural and Food Laboratory, University of Guelph, Ontario, Canada. The laboratory was blind to the results of the two immunoassay tests and the microscopy test. PCR was conducted to detect the presence of both parasites on each sample regardless of whether samples were positive

for either Giardia spp., Cryptosporidium spp., or both on the parasitological tests.

Fecal samples (1.0 g) were suspended in 4.5 mL Tween-PBS and subjected to sucrose gradient floatation and centrifugation to capture Cryptosporidium oocysts and Giardia cysts.

(Oo)cysts suspended in lysis buffer were subjected to freeze/thaw lysis and DNA was purified using two rounds of chloroform/isoamyl alcohol extraction prior to further purification using the

DNeasy Blood and Tissue Kit (Qiagen). To maximize analytical sensitivity of detection, we also extracted total genomic DNA directly from fecal samples (0.2 g) using a PowerSoilTM DNA

Isolation Kit (MO BIO Laboratories, QIAGEN Inc., Valencia, CA) with modifications

(Appendix 4.1).

Nested PCR

Gene targets for the detection of Cryptosporidium spp. were Cryptosporidium small subunit ribosomal (SSU) rRNA (18s) and Cryptosporidium 60 kDa glycoprotein (gp60). Gene targets for Giardia spp. were beta-giardin (bg), glutamate dehydrogenase (gdh), triose phosphate isomerase (tpi), and Giardia 18s ribosomal RNA gene. The gene targets, primers, and cycling conditions used for the molecular analyses are presented in Appendix 4.1. Target genes were amplified using a two-step nested PCR procedure, as described in Appendix 4.1.

Sequencing

PCR amplification fragments from PCR-positive fecal samples identified by gel electrophoresis were purified using NucleoFast® 96 PCR clean-up kit according to the manufacturer’s protocol (Macherey-Nagel, Duren, Germany). Purified PCR fragments were sequenced at the Agriculture and Food Laboratory, University of Guelph, using an ABI 3730

Genetic Analyzer (Applied Biosystems). The raw sequences were analyzed using ABI PrismTM

Sequencing Analysis software V5 (Applied Biosystems 2000) to obtain a high-quality consensus sequence for each fecal sample (Q>20). The consensus sequences were queried against NCBI

GenBank® using the Basic Logic Alignment Search Tool (BLAST) (Altschup et al. 1990) to compare with publicly available sequences. Species and/or genotype identification was determined based on the highest pairwise similarities.

Statistical Analysis

Statistical analyses were performed using the statistical software STATA Intercooled 15

(StataCorp. 2017. Stata Statistical Software: Release 15. College Station, TX: StataCorp LLC).

We evaluated statistical significance with a cut-point for statistical significance of p<0.05. We conducted the following analyses with 95% confidence intervals (CI):

The fecal prevalence of either Giardia spp., Cryptosporidium spp., or both parasites using

a parallel interpretation (i.e., we interpreted a test positive fecal sample to be that which

tested positive on at least one of the three Giardia-specific tests, on at least one of the two

Cryptosporidium-specific tests, or on at least one of all five parasite tests) across all

microscopy and immunoassay tests for the following populations:

the aggregated dog level for sled dogs, where a positive dog is one with at least one

positive fecal sample (any parasite test) among the three fecal samples;

the fecal sample level when one sample was chosen at random for sled dogs;

the fecal sample level for community;

the fecal sample level for shelter dogs; and

the overall prevalence of at least one parasite in all fecal samples, when one sample was

chosen at random for sled dogs.

To determine if there was variation in the fecal prevalence of Giardia spp. and Cryptosporidium spp. among parasitological tests, analyses were conducted separately for each test for:

the aggregated dog level for sled dogs;

the fecal sample level for community dogs; and

the fecal sample level for shelter dogs.

We used univariable logistic regression models to assess the association between dog populations and the fecal presence of Giardia spp. and Cryptosporidium spp. The binary dependent variables were the presence of Giardia spp. and/or Cryptosporidium spp. based on parallel interpretation across parasitological tests. The independent variables were the type of dog populations researched in September (i.e., sled, shelter, and community dogs). We made fecal samples from the sled dog population comparable to the other populations of dogs by randomly choosing one out of the three collected fecal samples for each sled dog.

We performed descriptive statistics on the team size. The linearity of the variable team size was assessed by plotting the continuous variable against the log-odds of the outcome using lowess curves (i.e., locally weighted regression for smoothed scatterplots) and by examining the significance of a quadratic term and its main effect in each of two multi-level models. To account for the non-independence of the sled dog data in a two-level hierarchical structure, mixed effects logistic regression models were attempted as individual fecal samples were nested within dogs and dogs within teams. There were too few data, however, to fit mixed effects logistic regression models. Therefore, we fitted univariable logistic regression models to investigate the association between team size and the presence of Giardia spp. and/or

Cryptosporidium spp. in sled dog feces sampled in September 2016. Again, we used one

100

randomly selected fecal sample per sled dog.

RESULTS

We collected 452 fecal samples from 294 dogs in July and September 2016: 60 samples from 20 sled dogs in July; 177 samples from 59 sled dogs in September; 104 from community dogs in September; and 111 from shelter dogs in September. Sled dogs belonged to six distinct teams ranging in size from 6 to 16 dogs per team, with a team average of 10.9 dogs per team. The range of Giardia spp. and Cryptosporidium spp. prevalence across sled dog teams was 0.00% to

14.58% and 0.00% to 13.79%, respectively. The fecal prevalence of Giardia spp. and

Cryptosporidium spp. in each dog population, and the variation in fecal prevalence of these parasites among parasitological tests, are shown in Tables 4.1 and 4.2. Although at least one dog in each population had at least one fecal sample that tested positive for either Giardia or

Cryptosporidium on at least one of the parasitological tests, there was variability among tests.

Overall, the total fecal prevalence at the sample level of at least one parasite across all dog populations in Iqaluit, when one sample was chosen at random, was 8.16% (95% CI: 5.52-11.92), of Giardia spp. was 4.42% (95% CI: 2.58-7.49), and of Cryptosporidium spp. was 6.12% (95%

CI: 3.88-9.53). Dog population type was significantly associated with Giardia spp. presence (p- value = 0.04), but not with the presence of Cryptosporidium spp. (p-value = 0.81). Specifically, the odds of Giardia spp. based on one random fecal sample per sled dog (OR 10.19 (95% CI: 1.16-

89.35)) was higher than the odds of Giardia spp. in shelter dogs (Table 4.3). For sled dogs, there was no significant association between team size and the fecal presence of Giardia spp. nor

Cryptosporidium spp. (Table 4.4).

101

Summaries of the results of the parasitology tests and PCR analyses are shown in Tables

4.5 and 4.6. A fecal sample that tested positive for Giardia spp. but not Cryptosporidium spp. on one or more of the parasitological tests would be tested for both parasites using PCR; PCR could identify Giardia DNA, confirming the results of the parasitological tests, but it could also amplify Cryptosporidium DNA, indicating a false-negative result on the initial parasitological tests. Of the 25 samples for which Giardia spp. tested positive by immunoassays, analysis by

PCR, yielded 13 (52%) samples with amplification of the targeted amplicons for Giardia spp.

(Table 4.5). Sequence analysis on six of these 13 PCR amplicons confirmed specific G. intestinalis assemblage: three fecal samples were assemblage D, one fecal sample was assemblage E, and two fecal samples were zoonotic assemblage B (Table 4.6). Results of the amplification of the genes beta-giardin (bg) and the species-specific marker glutamate dehydrogenase (gdh) following nested PCR indicated similar numbers of amplicons compared to the amplification of genes at the other markers (tpi and 18S gene markers). However, seven out of the 13 amplicons were detected at the Giardia 18S rRNA (18S) gene, more than half of which were not detected at the other gene loci (Table 4.6). The discrepancy (i.e., N=13 amplicons and only n=6 genotyped samples) was due to: (1) Giardia spp. could not be identified because of unreadable sequence data; or (2) the PCR amplicons showed no genetic relationship to Giardia spp.

Following nested PCR of Cryptosporidium gene targets, 22 amplicons were obtained from the 18S gene only. Sequence analysis revealed that DNA amplicons from five fecal samples belonged to the species-specific group Cryptosporidium canis (Xiao et al. 1999) (Table 4.6).

The discrepancy (i.e., N=22 amplicons and only n=5 genotyped samples) was due to: (1)

102

Cryptosporidium spp. could not be identified because of unreadable sequence data; or (2) the

PCR amplicons showed no genetic relationship to Cryptosporidium spp. Not surprisingly, the gp60 gene target did not amplify DNA in the Cryptosporidium canis positive samples as the

PCR primers targeting this highly polymorphic gene are specific to Cryptosporidium parvum and

Cryptosporidium hominis.

DISCUSSION

The results of this study showed that a small number of feces collected from dogs in

Iqaluit, Nunavut, contained a zoonotic parasitic organism Giardia intestinalis assemblages B.

Other organisms identified were protozoan parasites Cryptosporidium canis and Giardia intestinalis assemblages D and E. Assemblage D, is transmissible between domestic and wild canids, foxes, cattle, chinchillas, and kangaroos (Heyworth 2016). Assemblage E has been found predominantly in cloven-hoofed domestic mammals such as cattle, water buffaloes, sheep, goats, and pigs, but not in dogs (Yaoyu and Xiao 2011). Although the majority of the parasites we identified typically infect dogs and other animals rather than humans, G. intestinalis assemblage

B (Giardia enterica (Jenkins et al. 2013) ) is a recognized zoonotic pathogen of public health significance, and has been implicated in diarrheal diseases in both dogs and humans (Traub et al.,

2003; Tysnes, Skancke, and Robertson, 2014; Yaoyu and Xiao, 2011). Previous epidemiologic studies on Giardia spp. and/or Cryptosporidium spp. in dogs in more southern Indigenous communities in non-Arctic locations have been conducted primarily in the western Canadian provinces and the Northwest Territories (Salb et al. 2008, Himsworth, Skinner, et al. 2010,

Bryan et al. 2011, Schurer et al. 2012, 2013); as such, our study was the first to investigate the presence of these parasites in the feces of dogs in Inuit Nunangat.

103

The prevalence of Cryptosporidium spp. was higher than Giardia spp. in September. This finding differs from previous studies on dogs in other communities across Canada (Bryan et al.,

2011; Himsworth et al., 2010b; Schurer et al., 2012). In previous studies conducted in more southern, non-Arctic regions of Canada, the prevalence of Cryptosporidium spp. was generally low and the prevalence of Giardia spp. was higher than that of Cryptosporidium spp. in dogs

(Himsworth et al., 2010; McDowall et al., 2011a; Schurer et al., 2013). However, despite the research conducted to date in more southern, non-Arctic regions of Canada, the epidemiology of cryptosporidiosis in animals, including dogs, is largely unknown (Jenkins et al. 2013), and does not currently exist for dogs in Inuit Nunangat (Thivierge et al. 2016). In immune competent dogs, Cryptosporidium infections are usually self-limiting and do not require treatment (Bowman and Lucio-Forster 2010). Therefore, despite a clear understanding of the epidemiology of

Cryptosporidium spp. in dogs, our study does not provide evidence to suggest that dogs in

Iqaluit, Nunavut may be at an increased risk of diarrheal disease from Cryptosporidium canis infection.

The overall prevalence of Giardia spp. was lower than the majority of publications in which similar research methods were employed in non-Arctic Indigenous communities in the

Northwest Territories, remote Northern Saskatchewan, and in rural or remote communities in

Saskatchewan and Alberta (Salb et al. 2008, Himsworth, Skinner, et al. 2010, Schurer et al.

2012, 2013). The variation in the prevalence of Giardia spp. in more southern, non-Arctic regions of Canada as compared to that found in the Inuit Nunangat may be due to differences in geography, ecology, the number and types of dog populations, culture, governance, and colonial history. Furthermore, irrespective of the region in which fecal samples were collected, detection

104

of parasite presence in canine samples can be affected by poor sample integrity or test sensitivities, variation in canine dietary composition, and the intermittent shedding of Giardia cysts in feces, which is a particular limitation to quantifying an accurate prevalence estimate

(Yaoyu and Xiao 2011). Therefore, the measured prevalences may be subject to some uncertainty.

While parallel interpretation and multiday fecal sampling increased diagnostic sensitivity, there are some reasons to suggest that our results underestimate the true prevalence of these parasites in Iqaluit. First, there were delays in the shipment and storage of samples because of the remote geographic location in which our study took place. Although (oo)cysts are capable of surviving environmental stressors (Lemos et al. 2005), both rapid immunoassay tests protocols recommend that fecal samples be stored at 2–8◦C or frozen prior to testing (IDEXX Veterinary

Diagnostics, Westbrook 2016, Thermofisher Scientific 2016) and this was not always possible with our samples. Second, we collected and analyzed single rather than multiday samples from community and shelter dogs. Although this method is commonly employed in other canine studies in more southern, non-Arctic regions of Canada (Himsworth, Skinner, et al. 2010,

Schurer et al. 2012, 2013), Giardia spp. trophozoites and cysts may not be shed in the feces of infected dogs. Consequently, the Companion Animal Parasite Council recommends testing multiple samples from intermittently or consistently diarrheic dogs for Giardia spp. to increase the likelihood of visualizing its presence in feces (CAPC Vet, 2017). The fecal immunoassays would be expected to detect a Giardia spp. infection despite the lack of shedding of intact parasites (Olson et al. 2010). Finally, there were numerical differences among parasitological tests and discordance between parasitological test results and PCR results. Certainly, some of

105

these discrepancies could be explained by less than optimal sample conditions; both exposure to freezing temperatures before collection and unavoidable periods at room temperature during transport may result in degraded antigens, damaged cyst/oocyst walls affecting flotation and, perhaps, impact integrity of any isolated DNA from these samples.

Given the fecal-oral route of transmission of Giardia spp. and Cryptosporidium spp., we hypothesized that higher densities of dogs would create an environment conducive for dog-to- dog transmission of (oo)cysts. While other research supports this hypothesis (Esch and Petersen,

2013; Kostopoulou et al., 2017), we did not find a significant association between dog team size and fecal presence of either parasite in sled dogs. It is possible that our findings represent the true relationship in Iqaluit, or that fecal parasite presence may be dependent on other underlying factors not assessed as part of this study. These could include variations in sled dog team management practices (e.g., treatments, diets) and demographic data (e.g., sex, age), the effects of which may be team-variant. Further studies should examine management practices and demographic data in dogs in Iqaluit to determine the association of such factors with the fecal presence of enteric parasites.

The overall sample level odds of Giardia spp. in feces collected from sled dogs was higher than the odds of Giardia spp. in shelter dogs. This could be the result of differences in the prevalence of this parasite among the different canid populations (Claerebout et al. 2009, Bouzid et al. 2015, Pallant et al. 2015), or could have been influenced by our assumption that each stool sample collected from the Iqaluit Humane Society represented one dog. Furthermore, clustering of dogs within sled dog teams and within the shelter could have had an effect on prevalence; however, when we evaluated team as a random effect it was not statistically significant (p<0.05)

106

and the associated variance components were extremely small (< 1.0X10-3). Sled dogs are managed and kept in separate teams away from the residential areas of the city, such that there is little contact with both the public and other dogs within this Arctic region of Canada. Therefore, there may be fewer opportunities for parasite transmission to or from other populations of dogs and humans (Feng and Xiao 2011).

The prevalence estimates of Giardia spp. and Cryptosporidium spp. varied broadly across parasitological tests. The diagnosis of Giardia spp. using fecal flotation can be difficult as cysts are small and similar in appearance to many pseudoparasites such as yeast, which can result in an underestimation or overestimation of prevalence (Olson et al. 2010). For the rapid immunoassays, both manufacturers report high sensitivities and specificities: the IDEXX

SNAP® Giardia test boasts 89.2% sensitivity and 100% specificity, whereas the Xpect™

Giardia/Cryptosporidium test has 95.8-96.4% sensitivity and 98.5% specificity (IDEXX

Veterinary Diagnostics, Westbrook 2016, Thermofisher Scientific 2016). However, the Xpect™

Giardia/Cryptosporidium test was developed to detect G. intestinalis and C. parvum antigens, which could explain the discordance between negative parasitological Cryptosporidium spp. tests and positive molecular tests, which isolated C. canis DNA. The reason for the higher prevalence of Giardia spp. identified by the Xpect™ Giardia/Cryptosporidium test as compared to the

IDEXX SNAP® Giardia test is unknown. However, plausible explanations for test variation include different test-specific antigens and sample integrity (Van den Bossche et al. 2015).

Future studies validating the use of Xpect™ Giardia/Cryptosporidium tests for the detection of these parasites in canine feces would be beneficial for increasing rapid immunoassay test capacities in remote communities such as Iqaluit, Nunavut.

107

In our study, there was discordance between the parasitological and molecular findings.

In this study, DNA was amplified by PCR for one of the parasites even if the preceding parasitological tests were negative for that parasite. Other researchers have concluded that discordance among testing modalities is common (Decock, Cadiergues, Larcher, Vermot, and

Franc, 2003; Dryden et al., 2006; Geurden et al., 2008; Leonhard et al., 2007; McDowall et al.,

2011a; Olson et al., 2010), and that identifying and genotyping G. intestinalis can be challenging

(Lebbad et al., 2010; Leonhard et al., 2007; McDowall et al., 2011a), all of which may indicate that our prevalence estimates are likely underestimates. Our study highlights some of the realistic challenges that exist with collecting fecal samples in a remote Arctic locale, maintaining correct sample storage conditions, and facilitating rapid analysis at a centralized southern laboratory.

LIMITATIONS

There are some limitations to our study. Our sample size was based on the assumption of random sampling and we carried out convenience sampling. However, the sample size was used as a guide to inform project scope, and not as an absolute number. As feces were collected by convenience sampling, these data may not be representative of all dogs in Iqaluit, Nunavut.

CONCLUSION

Dogs represent an integral part of Inuit life in the Canadian Arctic (Qikiqtani Inuit

Association 2014). Through multidisciplinary research collaboration, we have increased our understanding of zoonotic parasitic infections at the human-dog-environment interface. We presented baseline data that indicate both Giardia spp. and Cryptosporidium spp. were present in at least one canine fecal sample in each dog population in this Arctic region of Canada. Giardia spp. were less prevalent than previously identified in dogs in other more southern Indigenous 108

communities in Canada. We confirmed the presence of Giardia intestinalis, zoonotic assemblage

B (n=2), and species-specific assemblages D (n=3), and E (n=1), and species Cryptosporidium canis (n=5) in the Arctic. Although Cryptosporidium canis may infect humans, this occurs rarely

(Bowman & Lucio-Forster, 2010) and usually only in immunocompromised individuals (Xiao et al. 2007). Dogs may acquire these parasites from food sources, other dogs, or humans, and in turn dogs may be a source of G. intestinalis assemblage B exposure to other dogs or to humans, potentially causing enteric illness. Regardless of geographic location, human contact with the feces of dogs (i.e., touching feces or its ingestion) can pose health risks because feces may contain microorganisms, including parasites, that are pathogenic to humans (Himsworth,

Skinner, et al. 2010, Hotez 2010, Schurer et al. 2012, 2013).

REFERENCES

Adelson, N. (2005). The embodiment of inequity: Health disparities in Aboriginal Canada. Canadian Journal of Public Health, 96(2), 45–61. https://doi.org/10.17269/cjph.96.1490 Aenishaenslin, C., Brunet, P., Lévesque, F., Gouin, G. G., Simon, A., Saint-Charles, J., … Ravel, A. (2018). Understanding the connections between dogs, health and Inuit through a mixed- methods study. EcoHealth. https://doi.org/10.1007/s10393-018-1386-6 Altschup, S. F., Gish, W., Miller, W., Myers, E. W., & Lipman, D. J. (1990). Basic local alignment search tool. Journal of Molecular Biology, (215), 403–410. Applied Biosystems. (2000). Applied Biosystems DNA sequencing analysis software user guide. Thermofisher Scientific, Waltham USA. Bouzid, M., Halai, K., Jeffreys, D., & Hunter, P. R. (2015). The prevalence of Giardia infection in dogs and cats, a systematic review and meta-analysis of prevalence studies from stool samples. Veterinary Parasitology, 207(3–4), 181–202. https://doi.org/10.1016/j.vetpar.2014.12.011 Bowman, D. D., & Lucio-Forster, A. (2010). Cryptosporidiosis and giardiasis in dogs and cats: Veterinary and public health importance. Experimental Parasitology, 124(1), 121–127. https://doi.org/10.1016/j.exppara.2009.01.003 Brook, R. K., Kutz, S. J., Millins, C., Veitch, A. M., Elkin, B. T., & Leighton, T. (2010). Evaluation and delivery of domestic animal health services in remote communities in the Northwest Territories: A case study of status and needs. The Canadian Veterinary Journal, 51(10), 1115–1122. Retrieved from https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2942049/

109

Bryan, H. M., Darimont, C. T., Paquet, P. C., Ellis, J. A., Goji, N., Gouix, M., & Smits, J. E. (2011). Exposure to infectious agents in dogs in remote coastal British Columbia: Possible sentinels of diseases in wildlife and humans. Canadian Journal of Veterinary Research, 75(1), 11–17. Cacciò, S. M., Thompson, R. C. A., McLauchlin, J., & Smith, H. V. (2005). Unravelling Cryptosporidium and Giardia epidemiology. Trends in Parasitology, 21(9), 430–437. https://doi.org/10.1016/j.pt.2005.06.013 Claerebout, E., Casaert, S., Dalemans, A. C., De Wilde, N., Levecke, B., Vercruysse, J., & Geurden, T. (2009). Giardia and other intestinal parasites in different dog populations in Northern Belgium. Veterinary Parasitology, 161(1–2), 41–46. https://doi.org/10.1016/j.vetpar.2008.11.024 Companion Animal Parasite Council | CAPC Vet. (2017). Retrieved December 13, 2017, from https://www.capcvet.org/ Daveluy, M., Lévesque, F., & Ferguson, J. (2011). Humanizing security in the Arctic. (M. Daveluy, F. Lévesque, & J. Ferguson, Eds.). Edmonton, Alberta: CCI Press and IPSSAS. Decock, C., Cadiergues, M. C., Larcher, M., Vermot, S., & Franc, M. (2003). Comparison of two techniques for diagnosis of giardiasis in dogs. Parasite, 10(1), 69–72. https://doi.org/10.1051/parasite/2003101p69 Dixon, B. R., Parrington, L. J., Parenteau, M., Leclair, D., Santín, M., & Fayer, R. (2008). Giardia duodenalis and Cryptosporidium spp. in the intestinal contents of ringed seals (Phoca hispida) and bearded seals (Erignathus barbatus) in Nunavik, Quebec, Canada. Journal of Parasitology, 94(5), 1161–1163. https://doi.org/10.1645/GE-1485.1 Dryden, M. W., Payne, P. A., & Smith, V. (2006). Accurate diagnosis of Giardia spp. and proper fecal examination procedures. Veterinary Therapeutics : Research in Applied Veterinary Medicine, 7(1), 4–14. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/16598679 Esch, K. J., & Petersen, C. A. (2013). Transmission and epidemiology of zoonotic protozoal diseases of companion animals. Clinical Microbiology Reviews, 26(1), 58–85. https://doi.org/10.1128/CMR.00067-12 Feng, Y., & Xiao, L. (2011). Zoonotic potential and molecular epidemiology of Giardia species and giardiasis †. Clinical Microbiology Reviews, 24(1), 110–140. https://doi.org/10.1128/CMR.00033-10 Fletcher, S. M., Stark, D., Harkness, J., & Ellis, J. (2012). Enteric protozoa in the developed world: A public health perspective. Clinical Microbiology Reviews, 25(3), 420–449. https://doi.org/10.1128/CMR.05038-11 Geurden, T., Berkvens, D., Casaert, S., Vercruysse, J., & Claerebout, E. (2008). A Bayesian evaluation of three diagnostic assays for the detection of Giardia duodenalis in symptomatic and asymptomatic dogs. Veterinary Parasitology, 157(1–2), 14–20. https://doi.org/10.1016/j.vetpar.2008.07.002 Goldfarb, D. M., Dixon, B., Moldovan, I., Barrowman, N., Mattison, K., Zentner, C., … Slinger, R. (2013). Nanolitre real-time PCR detection of bacterial, parasitic, and viral agents from patients with diarrhoea in Nunavut, Canada. International Journal of Circumpolar Health, 72(1), 1–8. https://doi.org/10.3402/ijch.v72i0.19903 Goyette, S., Cao, Z., Libman, M., Ndao, M., & Ward, B. J. (2014). Seroprevalence of parasitic zoonoses and their relationship with social factors among the Canadian Inuit in Arctic

110

regions. Diagnostic Microbiology and Infectious Disease, 78(4), 404–410. https://doi.org/10.1016/j.diagmicrobio.2013.08.026 Harper, S. L., Edge, V. L., Ford, J., Thomas, M. K., Pearl, D. L., Shirley, J., & McEwen, S. A. (2015). Acute gastrointestinal illness in two Inuit communities: Burden of illness in Rigolet and Iqaluit, Canada. Epidemiology and Infection, 143(14), 3048–3063. https://doi.org/10.1017/S0950268814003744 Heyworth, M. F. (2016). Giardia duodenalis genetic assemblages and hosts. Parasite, 23, 13. https://doi.org/10.1051/parasite/2016013 Himsworth, C. G., Skinner, S., Chaban, B., Jenkins, E., Wagner, B. A., Harms, N. J., … Hill, J. E. (2010). Short report: Multiple zoonotic pathogens identified in canine feces collected from a remote Canadian indigenous community. American Journal of Tropical Medicine and Hygiene, 83(2), 338–341. https://doi.org/10.4269/ajtmh.2010.10-0137 Hotez, P. J. (2010). Neglected infections of poverty among the indigenous peoples of the Arctic. PLoS Neglected Tropical Diseases, 4(1). https://doi.org/10.1371/journal.pntd.0000606 IDEXX Veterinary Diagnostics, Westbrook, M. U. (2016). SNAP Giardia Test | IDEXX Veterinary Diagnostics. Retrieved October 13, 2016, from https://www.idexx.com/small- animal-health/products-and-services/snap-giardia-test.html Iqaluit: Qikiqtani Inuit Association. (2014). Qikiqtani Truth Commission. Thematic Reports and Special Studies 1950–1975. Thematic Reports and Special Studies. Iqbal, A., Goldfarb, D. M., Slinger, R., & Dixon, B. R. (2015). Prevalence and molecular characterization of Cryptosporidium spp. and Giardia duodenalis in diarrhoeic patients in the Qikiqtani Region, Nunavut, Canada. International Journal of Circumpolar Health, 74(2), 1–9. https://doi.org/10.3402/ijch.v74.27713 Jenkins, E. J., Castrodale, L. J., de Rosemond, S. J. C., Dixon, B. R., Elmore, S. A., Gesy, K. M., … Thompson, R. C. A. (2013). Tradition and transition: parasitic zoonoses of people and animals in Alaska, northern Canada, and Greenland. Advances in parasitology (Vol. 82). Elsevier. https://doi.org/10.1016/B978-0-12-407706-5.00002-2 King, M. (2009). An overall approach to health care for Indigenous Peoples. Pediatric Clinics of North America, 56(6), 1239–1242. https://doi.org/10.1016/j.pcl.2009.09.005 Kostopoulou, D., Claerebout, E., Arvanitis, D., Ligda, P., Voutzourakis, N., Casaert, S., & Sotiraki, S. (2017). Abundance, zoonotic potential and risk factors of intestinal parasitism amongst dog and cat populations: The scenario of Crete, Greece. Parasites & Vectors, 10(1), 43. https://doi.org/10.1186/s13071-017-1989-8 Kutz, S. J., Jenkins, E. J., Veitch, A. M., Ducrocq, J., Polley, L., Elkin, B., & Lair, S. (2009). The Arctic as a model for anticipating, preventing, and mitigating climate change impacts on host-parasite interactions. Veterinary Parasitology, 163(3), 217–228. https://doi.org/10.1016/j.vetpar.2009.06.008 Lebbad, M., Mattsson, J. G., Christensson, B., Ljungstrom, B., Backhans, A., Andersson, J. O., & Svord, S. G. (2010). From mouse to moose: Multilocus genotyping of Giardia isolates from various animal species. Veterinary Parasitology, 168(3–4), 231–239. https://doi.org/10.1016/j.vetpar.2009.11.003 Lemos, V., Graczyk, T. K., Alves, M., Lobo, M. L., Sousa, M. C., Antunes, F., & Matos, O. (2005). Identification and determination of the viability of Giardia lamblia cysts and Cryptosporidium parvum and Cryptosporidium hominis oocysts in human fecal and water

111

supply samples by fluorescent in situ hybridization (FISH) and monoclon. Parasitology Research, 98(1), 48–53. https://doi.org/10.1007/s00436-005-0018-6 Leonhard, S., Pfister, K., Beelitz, P., Wielinga, C., & Thompson, R. C. A. (2007). The molecular characterisation of Giardia from dogs in southern Germany. Veterinary Parasitology, 150(1–2), 33–38. https://doi.org/10.1016/j.vetpar.2007.08.034 Lucio-Forster, A., Griffiths, J. K., Cama, V. A., Xiao, L., & Bowman, D. D. (2010). Minimal zoonotic risk of cryptosporidiosis from pet dogs and cats. Trends in Parasitology, 26(4), 174–179. https://doi.org/10.1016/j.pt.2010.01.004 Macpherson, C. N. L. (2005). Human behaviour and the epidemiology of parasitic zoonoses. International Journal for Parasitology, 35(11–12), 1319–1331. https://doi.org/10.1016/j.ijpara.2005.06.004 Majowicz, S. E., Hall, G., Scallan, E., Adak, G. K., Gauci, C., Jones, T. F., … Sockett, P. (2008). A common, symptom-based case definition for gastroenteritis. Epidemiology and Infection, 136(7), 886–894. https://doi.org/10.1017/S0950268807009375 Manore, A. (2018). Investigating foodborne Cryptosporodium and Giardia in clams harvested near Iqaluit, Nunavut. MSc Thesis Dissertation. University of Guelph. University of Guelph. Retrieved from http://hdl.handle.net/10214/14091 Masina, S., Shirley, J., Allen, J., Sargeant, J. M., Guy, R. A., Wallis, P. M., … Harper, S. L. (2019). Weather, environmental conditions, and waterborne Giardia and Cryptosporidium in Iqaluit, Nunavut. Journal of Water Health, 17(1), 84–97. https://doi.org/10.2166/wh.2018.323 McDowall, R. M., Peregrine, A. S., Leonard, E. K., Lacombe, C., Lake, M., Rebelo, A. R., & Cai, H. Y. (2011). Evaluation of the zoonotic potential of Giardia duodenalis in fecal samples from dogs and cats in Ontario. Canadian Veterinary Journal, 52(12), 1329–1333. Olson, M. E., Leonard, N. J., & Strout, J. (2010). Prevalence and diagnosis of Giardia infection in dogs and cats using a fecal antigen test and fecal smear. Canadian Veterinary Journal, 51(6), 640–642. https://doi.org/10.1111/mve.12199 Pallant, L., Barutzki, D., Schaper, R., & Thompson, R. C. A. (2015). The epidemiology of infections with Giardia species and genotypes in well cared for dogs and cats in Germany. Parasites & Vectors, 8(1), 2. https://doi.org/10.1186/s13071-014-0615-2 Rabinowitz, P., & Conti, L. (2013). Links among human health, animal health, and Ecosystem Health. Annual Review of Public Health. https://doi.org/10.1146/annurev-publhealth- 031912-114426 Salb, A. L., Barkema, H. W., Elkin, B. T., Thompson, R. C. A., Whiteside, D. P., Black, S. R., … Kutz, S. J. (2008). Dogs as sources and sentinels of parasites in humans and wildlife, Northern Canada. Emerging Infectious Diseases, 14(1), 60–63. https://doi.org/10.3201/eid1401.071113 Schurer, J. M., Hill, J. E., Fernando, C., & Jenkins, E. J. (2012). Sentinel surveillance for zoonotic parasites in companion animals in indigenous communities of Saskatchewan. American Journal of Tropical Medicine and Hygiene, 87(3), 495–498. https://doi.org/10.4269/ajtmh.2012.12-0273 Schurer, J. M., Ndao, M., Skinner, S., Irvine, J., Elmore, S. A., Epp, T., & Jenkins, E. J. (2013). Parasitic zoonoses: One Health surveillance in Northern Saskatchewan. PLoS Neglected Tropical Diseases, 7(3). https://doi.org/10.1371/journal.pntd.0002141

112

Shahiduzzaman, M., & Daugschies, A. (2012). Therapy and prevention of cryptosporidiosis in animals. Veterinary Parasitology, 188(3–4), 203–214. https://doi.org/10.1016/j.vetpar.2012.03.052 Snel, S. J., Baker, M. G., Kamalesh, V., French, N., & Learmonth, J. (2009). A tale of two parasites: The comparative epidemiology of cryptosporidiosis and giardiasis. Epidemiology and Infection, 137(11), 1641–1650. https://doi.org/10.1017/S0950268809002465 Sotiriadou, I., Pantchev, N., Gassmann, D., & Karanis, P. (2013). Molecular identification of Giardia and Cryptosporidium from dogs and cats. Parasite, 20, 8. https://doi.org/10.1051/parasite/2013008 StataCorp. 2017. Stata Statistical Software: Release 15. College Station, T. S. L. (n.d.). Stata Statistical Software: Release 15 College Station, TX: StataCorp LLC. Retrieved November 15, 2017, from https://www.stata.com/ Statistics Canada. (2016). Statistics Canada. (2016). Retrieved from http://www12.statcan.gc.ca/census-recensement/2016/dp- pd/prof/details/page.cfm?Lang=E&Geo1=CSD&Code1=5915022&Geo2=PR&Code2=59& Data=Count&SearchText=Vancouver&SearchType=Begins&SearchPR=01&B1=All&Geo Level=PR&GeoCode=5915022&TABID=1 Thermofisher Scientific, W. U. (2016). XpectTM Giardia/Cryptosporidium Test. Retrieved October 13, 2016, from https://www.thermofisher.com/order/catalog/product/R2450520 Thivierge, K., Iqbal, A., Dixon, B., Dion, R., Levesque, B., Cantin, P., … Yansouni, C. P. (2016). Cryptosporidium hominis is a newly recognized pathogen in the Arctic region of Nunavik, Canada: Molecular characterization of an outbreak. PLoS Neglected Tropical Diseases, 10(4), 1–11. https://doi.org/10.1371/journal.pntd.0004534 Thomas, M. K., Majowicz, S. E., MacDougall, L., Sockett, P. N., Kovacs, S. J., Fyfe, M., … Jones, A. Q. (2006). Population distribution and burden of acute gastrointestinal illness in British Columbia, Canada. BMC Public Health, 6, 1–11. https://doi.org/10.1186/1471-2458- 6-307 Thomas, M. K., Murray, R., Nesbitt, A., & Pollari, F. (2017). The incidence of acute gastrointestinal illness in Canada, foodbook survey 2014-2015. Canadian Journal of Infectious Diseases and Medical Microbiology, 2017. https://doi.org/10.1155/2017/5956148 Traub, R. J., Monis, P. T., Robertson, I., Irwin, P., Mencke, N., & Thompson, R. C. A. (2004). Epidemiological and molecular evidence supports the zoonotic transmission of Giardia among humans and dogs living in the same community. Parasitology, 128(3), 253–262. https://doi.org/10.1017/S0031182003004505 Traub, R. J., Robertson, I. D., Irwin, P., Mencke, N., Monis, P., & Thompson, R. C. A. (2003). Humans, dogs, and parasitic zoonoses - Unravelling the relationships in a remote endemic community in northeast India using molecular tools. Parasitology Research, 90(SUPPL. 3), 156–157. https://doi.org/10.1007/s00436-003-0925-3 Trotz-Williams, L. A., Martin, S. W., Martin, D., Duffield, T., Leslie, K. E., Nydam, D. V., … Peregrine, A. S. (2005). Multiattribute evaluation of two simple tests for the detection of Cryptosporidium parvum in calf faeces. Veterinary Parasitology, 134(1–2), 15–23. https://doi.org/10.1016/j.vetpar.2005.06.023 Tysnes, K. R., Skancke, E., & Robertson, L. J. (2014). Subclinical Giardia in dogs: A veterinary conundrum relevant to human infection. Trends in Parasitology.

113

https://doi.org/10.1016/j.pt.2014.08.007 Van den Bossche, D., Cnops, L., Verschueren, J., & Van Esbroeck, M. (2015). Comparison of four rapid diagnostic tests, ELISA, microscopy and PCR for the detection of Giardia lamblia, Cryptosporidium spp. and Entamoeba histolytica in feces. Journal of Microbiological Methods, 110, 78–84. https://doi.org/10.1016/j.mimet.2015.01.016 Villeneuve, A., Polley, L., Jenkins, E., Schurer, J., Gilleard, J., Kutz, S., … Gagné, F. (2015). Parasite prevalence in fecal samples from shelter dogs and cats across the Canadian provinces. Parasites & Vectors, 8(1), 281. https://doi.org/10.1186/s13071-015-0870-x World Health Organization. (2015). WHO estimates of the global burden of foodborne diseases: foodborne disease burden epidemiology reference group 2007-2015 (No. 9789241565165). Geneva, Switzerland. WSPA. (2012). Surveying roaming dog populations: guidelines on methodology. Companion & Working Animals Unit, 20. Xiao, L., Cama, V. A., Cabrera, L., Ortega, Y., Pearson, J., & Gilman, R. H. (2007). Possible transmission of Cryptosporidium canis among children and a dog in a household. Journal of Clinical Microbiology, 45(6), 2014–2016. https://doi.org/10.1128/JCM.00503-07 Xiao, L., Morgan, U. M., Limor, J., Arrowood, M., Shulaw, W., Fayer, R., … Escalante, A. (1999). Genetic diversity within Cryptosporidium parvum and Related Cryptosporidium species. Applied and Environmental Microbiology, 65(8), 3386–3391. Yaoyu, F., & Xiao, L. (2011). Zoonotic potential and molecular epidemiology of Giardia species and giardiasis. Clinical Microbiology Reviews, 24(1), 110–140. https://doi.org/10.1128/CMR.00033-10 Zinsstag, J., Schelling, E., Waltner-Toews, D., & Tanner, M. (2011). From “one medicine” to “one health” and systemic approaches to health and well-being. Preventive Veterinary Medicine, 101(3–4), 148–156. https://doi.org/10.1016/j.prevetmed.2010.07.003

114

Figure 4. 1 A map indicating the country Canada (outlined in black), the territory of Nunavut (darker green), and the study location, the territorial capital Iqaluit

115

Dog population No. of No. of Parasite Prevalence (%) Analysis dogs samples (95% CI) type Sled dogs July 20 60 Giardia and 25.00 (9.91-50.26) †Aggregate Cryptosporidium d dog level Giardia or 35.00 (16.44-59.57) Cryptosporidium Giardia 30.00 (13.07-55.00) Cryptosporidium 30.00 (13.07-55.00)

Sled dogs 59 177 Giardia and 11.86 (5.64-23.28) †Aggregate September Cryptosporidium d dog level Giardia or 27.12 (17.08-40.19) Cryptosporidium Giardia positive 16.95 (9.20-29.14) Cryptosporidium 22.03 (13.04-34.76) positive

Sled dogs July 20 20 Giardia and 15.00 (4.40-40.38) ‡Fecal Cryptosporidium sample Giardia or 20.00 (7.00-45.37) level i.e., Cryptosporidium one sample Giardia positive 15.00 (4.40-40.38) chosen at Cryptosporidium 20.00 (7.00-45.37) random for positive sled dogs

116

Sled dogs 59 59 Giardia and 3.39 (0.81-13.04) ‡Fecal September Cryptosporidium sample Giardia or 11.86 (5.64-23.28) level i.e., Cryptosporidium one sample Giardia positive 8.47 (3.48-19.22) chosen at Cryptosporidium 6.78 (2.49-17.14) random for positive sled dogs

Community 104 104 Giardia and 1.92 (0.47-7.52) §Fecal dogs in Cryptosporidium sample September level Giardia or 6.73 (3.20-13.60) Cryptosporidium Giardia positive 3.85 (1.43-9.95) Cryptosporidium 4.81 (1.99-11.18) positive

Shelter dogs in 111 111 Giardia and 0.00 (0.00-0.00) §Fecal September Cryptosporidium sample Giardia or 5.41 (2.42-11.64) level Cryptosporidium Giardia positive 0.90 (0.12-6.29) Cryptosporidium 4.50 (1.86-10.50) positive †Fecal prevalence of Giardia spp. and Cryptosporidium spp. at the aggregated dog level; i.e., dogs were considered parasite-positive if at least one fecal sample was positive on at least one parasite-specific test. ‡Fecal prevalence of Giardia spp. and Cryptosporidium spp. at the fecal sample level, when one sample out of three was chosen at random using an online random number generator. § Fecal prevalence of Giardia spp. and Cryptosporidium spp. at the sample level; i.e., samples were considered parasite-positive if positive on at least one parasite-specific test.

117

IDEXX Xpect™ Microscopy Xpect™ Microscopy Giardia Giardia Giardia Cryptosporidium Cryptosporidium

Sled dogs July† % (95%CI) 15.00 30.00 5.00 25.00 5.00 n=20 (3.21-37.89) (11.89-54.28) (0.12-24.87) (8.66-49.10) (0.12-24.87)

Sled dogs September† 3.39 13.56 3.39 10.17 13.56 % (95%CI) (0.41-11.71) (6.04-24.98) (0.41-11.71) (3.82-20.83) (6.04-24.98) n=59 Shelter dogs‡ % 0.00 0.00 0.90 3.60 0.90 (95%CI) (0.00-3.27) (0.00-3.27) (0.02-4.92) (0.99-8.97) (0.02-4.92) n=111 Community dogs‡ 0.00 1.92 1.92 1.92 2.88 % (95%CI) (0.00-3.48) (0.23-6.77) (0.23-6.77) (0.23-6.77) (0.60-8.20) n=104 †Fecal prevalence of Giardia spp. and Cryptosporidium spp. at the aggregated dog level; i.e., dogs were considered parasite-positive if at least one fecal sample was positive parasite-specific tests. ‡Fecal prevalence of Giardia spp. and Cryptosporidium spp. at the sample level; i.e., samples were considered parasite-positive if positive on parasite-specific tests.

118

Variable Estimate Odds Model N Variable SE p * 95% CI ref (β) (eβ) Giardia spp.† 274 Community Shelter 1.48 1.13 0.19 4.40 0.49-40.03 dogs dogs Sled dogs§ Shelter 2.32 1.11 0.04 10.19 1.16-89.35 dogs Community Sled -0.84 0.69 0.23 0.43 0.11-1.68 dogs dogs Cryptosporidium 274 Community Shelter 0.07 0.65 0.92 1.07 0.30-3.81 spp. ‡ dogs dogs Sled dogs§ Shelter 0.43 0.69 0.53 1.54 0.40-5.97 dogs Community Sled -0.36 0.69 0.20 0.69 0.18-2.69 dogs dogs †Model 1 with dependent variable Giardia spp. ‡Model 2 with dependent variable Cryptosporidium spp. §One sample out of three chosen at random for sled dog September dog population *Wald’s p-value of the odds ratio

119

Estimate Model n Variable SE p * OR(eβ) 95% CI (β) Giardia spp. † 177 Team size 0.25 0.14 0.08 1.29 0.97-1.70

Cryptosporidium spp. 177 Team size 0.04 0.15 0.80 1.04 0.78-1.39 ‡ †Model 1 with dependent variable Giardia spp. ‡Model 2 with dependent variable Cryptosporidium spp. §One sample out of three chosen at random for sled dog September dog population *Wald’s p-value of the odds ratio

120

Rapid Samples tested Numerical differences Immunoassay/Fecal PCR for parasites between Float (i.e., Parasit) Positive (n=42† samples) PCR/Parasit Results Results +ve = 25 7 7/25 (28.00%) Giardia spp. ‡ -ve = 17 6§ 6/17 (35.29%)§ +ve = 33 19 19/33 (57.58%) Cryptosporidium spp. -ve = 9 3§ 3/9 (33.33%)§ † 42 fecal samples were positive for either Giardia spp., Cryptosporidium spp., or both on parasitological tests. The overall prevalence of parasite presence in canine feces for the four populations of dogs was 9.29% (95%CI: 6.93-12.35) ‡ One of the Giardia (beta-giardin) positives was obtained on the PCR assay of Goulden EK (thesis 2003) (Appendix 4.1) § Discordant results between parasitological test results and targeted amplicons identified by PCR

121

Table 4. 6 The number (N) of Cryptosporidium spp. and Giardia spp. PCR amplicons for dog fecal samples from Iqaluit, Nunavut in July, and September 2016. The number (n) of C. canis species and the number and type of G. intestinalis assemblages sequenced from amplicons at each gene locus are also presented

PCR amplicons

(N) Giardia spp. Giardia assemblages sequenced at gene loci (n)

bg † 18S rRNA‡ tpi§ gdh ¶ N=13a Assemblage B Assemblage B Assemblage B Assemblage B n=1 n=1 n=0 n=0

Assemblage D Assemblage D Assemblage D Assemblage D n=0 n=3 n=0 n=0 Assemblage E Assemblage E Assemblage E Assemblage E n=0 n=1 n=0 n=0 Cryptosporidium Cryptosporidium species sequenced at gene loci (n) spp. gp60 ¥ 18S rRNA š N=22b C. canis n=0 C. canis n=5 a Only 6 of 13 samples for which assemblage information was available. That is, sequencing of Giardia intestinalis was not conclusive for the other 7 samples b Only 5 of 22 samples for which assemblage information was available. That is, sequencing of Cryptosporidium spp. was not conclusive for the other 17 samples † Beta-giardin (bg) gene locus ‡ Giardia 18s ribosomal RNA (18S) gene locus § Triose phosphate isomerase (tpi) gene locus ¶ Glutamate dehydrogenase (gdh) gene locus ¥ Cryptosporidium 60 kDa glycoprotein (gp60) gene locus šCryptosporidium small subunit ribosomal (SSU) rRNA (18S) gene locus

122

CHAPTER 5

OUCH! A CROSS-SECTIONAL STUDY INVESTIGATING SELF- REPORTED HUMAN EXPOSURE TO DOG BITES IN RURAL AND URBAN HOUSEHOLDS IN SOUTHERN ONTARIO, CANADA

Danielle A. Julien, Jan M. Sargeant, Catherine Filejski, and Sherilee L. Harper. This Chapter was published May 17, 2020 in Zoonoses and Public Health https:// DOI: 10.1111/zph.12719

123

ABSTRACT

This study investigated self-reported dog bites in humans in rural and urban households in southern Ontario, Canada. Our objectives were to determine, and compare, the incidence of dog bites in rural and urban households, and to describe the profile of bite victims, biting dogs, and the proportion of biting dogs that respondents self-reported as being not up to date on rabies vaccination. We conducted a cross-sectional observational study using an online questionnaire.

The 2,006 respondents, each representing one household, included 1,002 rural and 1,004 urban residences. The incidence risk of at least one person in the household being bitten over the previous year in rural households (6.09% per year) was less than in urban households (10.76% per year). In 53.20% of households from which at least one person had been bitten within the past year, only a single person had been bitten. Mostly, victims were 25 to 34 years old

(21.67%), male (54.19%), and playing with or interacting with the biting dog at the time of the incident (59.11%). Most biting dogs were 3 to 5 years old (32.02%), males (53.69%), and unleashed (76.85%). Based on self-reporting by respondents, 83.33% of respondent-owned biting dogs were vaccinated against rabies at the time of the biting incident. Irrespective of dog ownership, the odds of an individual in a rural household being bitten by a dog were 0.53 (95%

CI: 0.38 – 0.73) the odds for an individual in an urban household. Dog bites constitute a serious, yet preventable, public health concern that requires targeted, community-specific efforts. Public health organizations could consider findings in developing messaging, particularly as we highlight biting dogs reported by their owners as not up to date on rabies vaccination.

IMPACTS

Individuals in both rural and urban households reported that household members had 124

experienced dog bites. However, irrespective of dog ownership, individuals in urban

households were more likely to be bitten than individuals in rural households.

Results highlight characteristics of bite victims including victim age and gender, and the

anatomical location of the bite; and biting dog age, sex, rabies vaccination status, and

circumstances surrounding the bite, as self-reported by respondents.

Despite provincial legal requirements for canine rabies vaccination in Canada, there were

dogs reported by their owners as not up to date on rabies vaccination, highlighting a

potentially rabies-vulnerable subset of the canine population in southern Ontario, Canada.

INTRODUCTION

Human exposure to dog bites represents an important public health concern that is often under-reported (Bottoms et al., 2014; Clarke and Fraser, 2013a; Macpherson, 2013). Some of the more important concerns surrounding dog bites are the repercussions of physical and emotional trauma experienced by bite victims, and less commonly, though no less importantly, the potential risk of transmission of certain zoonotic pathogens, including Capnocytophaga spp., Pasteurella spp., Methicillin-resistant Staphylococcus aureus, Clostridium tetani, as well as rabies (Centers for Disease Control and Prevention, 2017; Macpherson, 2012). Furthermore, biting incidents also constitute an important One Health issue due to the interdependence of human and animal health in complex social-ecological interactions, as well as the need for collaborative coordination with regard to their prevention (Rock et al., 2017).

Rabies is an infectious and zoonotic disease caused by a lyssavirus variant (Wunner &

Briggs, 2010). Transmission of the virus to humans occurs through salivary contamination of breaks in the skin, most commonly as a result of bites inflicted by infected animals, including dogs

125

(Hampson et al., 2015). Infection is almost always fatal following the onset of clinical symptoms

(WHO et al., 2015). Globally, domestic dogs remain the main reservoir and vector of rabies transmission to humans (Macpherson, 2012; Wunner & Briggs, 2010). However, there have been no reported human cases resulting from dog bite exposures occurring in Ontario, Canada since the

1960s (Middleton et al., 2015). Despite the public health significance of rabies, and the potential for its prevention through vaccination, there are gaps in public knowledge regarding rabies awareness, the importance of avoiding animal bites, and appropriate health-seeking behaviours

(Franka et al., 2013; Herbert et al., 2012; Taylor et al., 2017).

An estimated 4.7 million people are bitten by dogs in the United States of America

(USA) each year (Matthias et al., 2015). Of these, approximately 20% require medical attention, with 20 to 30 deaths each year (Matthias et al., 2015; Jeffrey J. Sacks et al., 2000). In Canada, on average, one to two human deaths result from dog bites annually (Raghavan, 2008). Although dog bites are a public health concern and mechanism for the transmission of zoonoses, there have been few studies evaluating the incidence of dog bites in Canada (Bottoms et al., 2014;

Raghavan et al., 2014; Szpakowski et al., 1989). Accordingly, there is a need for information detailing Canadian dog bites, between and within communities (Raghavan, 2008).

Among a human population of approximately 36 million people, over 7 million dogs are owned in Canada with approximately 41% of households owning at least one dog as a pet

(Canadian Animal Health Institute (CAHI), 2017). Non-dog owning individuals may also be in contact with dogs through contact with the pets of friends or neighbours (Westgarth et al., 2007).

While dogs contribute to social, emotional, and physical well-being (Hodgson & Darling, 2011), the high number of dogs sharing close space with humans can also result in the potential for dog

126

bite incidents (Shuler et al., 2008). Determining the factors that contribute to dog bites can be challenging as they are often complex and multifactorial, involving characteristics specific to the victim (e.g., age, gender, and injuries), the biting dog (e.g., age, sex, circumstance, and health status), and the context within which the bite occurs (e.g., geographic location, dog-owning or dog-free household, and human-animal interaction) (Oxley et al., 2018; Shuler et al., 2008).

Identifying factors that determine the occurrence of dog bites is useful to those interested in human and animal health, public health policy, and veterinary and medical services (Middleton et al., 2015).

Assessing zoonotic disease risk is a prerequisite for the development of effective public health policy, programs, and zoonotic disease prevention strategies (Day et al., 2012 and Stull et al., 2012). In Ontario, dog bites are reportable by law and follow up of dog bite incidents includes investigation and documentation of the rabies vaccination status of the animal by local public health units (Ontario Ministry of Health and Long-Term Care, 2019). Data regarding human exposures to dog bites thus provide useful indicators for compliance with canine rabies vaccination requirements, as well as potential human exposure to certain canine zoonoses.

Dog ownership, and the interactions between humans and dogs in rural households may differ from those in urban households. Nevertheless, the majority of studies to-date have focused on urban or semi-rural environments, (Bottoms et al., 2014; Lang and Klassen, 2005; Raghavan,

2008; Shuler et al., 2008; Szpakowski et al., 1989; Westgarth et al., 2007), and few have compared human exposures to dog bites between rural and urban residents This presents a gap in our knowledge of this One Health issue, particularly regarding the varied contexts within which dog bite incidents occur.

127

Therefore, our study objectives were to: (a) determine the incidence of dog bites, at the household-level, as self-reported by respondents in rural and urban southern Ontario; (b) describe the profile of victims, profile of biting dogs, and the proportion of biting dogs not up to date on rabies vaccination at the time of the bite incident; and (c) compare the incidence of dog bites between rural and urban households in southern Ontario, Canada.

METHODS

Study Design, Questionnaire Development, Validation and Administration

We conducted a cross-sectional observational study. An online questionnaire was constructed to obtain information regarding dog ownership, dog bites, and dogs’ rabies vaccination status. A copy of the questionnaire can be requested from the first author. Questions were developed in consultation with stakeholders from academia and one public health government organization in Ontario, Canada. The questionnaire was pretested on two occasions.

The first pre-test was conducted in July 2014, at which time the questionnaire was emailed to individuals known to the authors with varying educational backgrounds, location of residence

(rural and urban households in southern Ontario), and dog-ownership status (n=12 individuals invited; 12 participated). Individuals were asked to complete the questionnaire and provide feedback on layout, length and general organization, level of difficulty in understanding questions including use of language and grammar, and flow, including skip patterns. The second pre-test, utilizing the online-accessible questionnaire, was conducted in August 2014 and included individuals with various demographics (n= 15 individuals invited; 7 participated).

Similarly, individuals were asked to provide feedback on layout, length and general organization,

128

and skip patterns. The final questionnaire was available online from August 21 to September 4,

2014.

The current study comprises a subset of data from a larger study utilizing the questionnaire results. Herein, we report household-level data including dog ownership, characteristics of respondent-owned dogs, human exposure to dog bites during the previous year, characteristics of the victims and biting dogs including canine rabies vaccination status as self- reported by respondents, and demographics.

Location of Study

Located in east-central Canada, Ontario is the second largest and most populous province in Canada, with a population of 13.4 million people in 2016, which accounts for 38.3% of the

Canadian population (Statistics Canada, 2017). Rural households account for 14.10% of the provincial household population (Statistics Canada, 2012b). Southern Ontario is the most densely populated region of the province (MacInnes et al., 2001). Southern Ontario was chosen as there are dog-owning and dog-free households in rural and urban communities and previous research pertaining to canine zoonoses has been conducted in this region (Stull et al., 2012,

2013).

Study Population

This study was approved by the Research Ethics Board at the University of Guelph

(REB# 14JN028). The target study population were individuals in dog-owning and dog-free households in rural and urban communities in Ontario, Canada. Rural and urban communities were defined as per the Population Centre (POPCTR) Census Dictionary (Statistics Canada,

2012a)). An online survey agency located in Toronto, Ontario (Dynata™ (formerly

129

ResearchNow™)) was enlisted to recruit individuals by email, stratified by their rural and urban residential status. This agency has been used previously for health-related studies (Ng &

Sargeant, 2012, 2013). Using the services of this company allowed the authors to structure sampling to obtain equal numbers of respondents from rural and urban households in southern

Ontario using pre-specified quota fields. Respondents for the current study were randomly recruited from a database of 118,400 Dynata™ panelists in southern Ontario. Provincial data indicates that close to ninety percent of residents in Ontario have Digital Subscriber Line (DSL) broadband internet access (Government of Canada, 2011). A financial incentive (10 Air Miles points) was given to respondents. No more than one adult per household was sampled, without replacement.

Sample Size

Sample size calculations were performed to determine a study sample of sufficient power to detect a difference in the number of dog-owning and dog-free households in rural and urban households in southern Ontario. Using estimates of urban household dog ownership at 50%

(Perrin, 2009; Stull et al., 2012) and a slightly higher dog ownership in rural communities (60%), with a confidence of 95% and power of 80%, the sample size per group was calculated as 408 dog-owning and 408 dog-free households, for a total of 816 respondents in each residential location. Recruitment involved individuals enrolled with the survey agency sampling frame who met the following inclusion criteria: 18 years of age or older, able to read English, and had resided in Ontario for at least 12 months prior to the start of the study.

Statistical Methods

130

We performed descriptive statistics and logistic regression analyses using STATA

Intercooled 15 (StataCorp. 2017. Stata Statistical Software: Release 15. College Station, TX:

StataCorp LLC). We excluded missing information and “I prefer not to answer” responses from analyses.

Survey Respondents and Dog Ownership: Descriptive Statistics

Respondent-level variables were described for all respondents and included: residential location (i.e. urban or rural), age, gender, whether there was at least one respondent-owned dog in the household, the total number of household occupants including dependents (i.e. persons under the age of 18 years), and gross household income. The proportion of dog-owning households out of the total number of households was estimated for each residential location.

Dog-level variables were described for owned dogs by dog-owning respondents only, and included the number of respondent-owned dogs in households as well as their: age, sex, breed, spay or neuter status, rabies vaccination status within the three years prior to the start of the questionnaire (i.e. (1) yes, the dog had been vaccinated, (2) no, the dog had not been vaccinated, or (3) the respondent was unsure whether the dog had been vaccinated against rabies within the three years prior to the questionnaire), and the most recent year of vaccination, as self-reported by respondents. For age ranges, the mid-point of the age range was calculated by subtracting the lower number of the range from the greater number and halving this result. This result was then added to the lower number of the range. For all descriptive data, percentages were reported.

Measures of Dog Bite Frequency: Descriptive Statistics

For the purposes of this study, a bite was defined as any cut, wound, tear, and/or breaking of the skin caused by the dog’s teeth. The term ‘incident’ was used to describe an event in which

131

at least one occupant of a respondent’s household had been bitten by any dog (their dog or someone else’s) during the past year. The incidence risk of human exposure to dog bites in rural and urban households was calculated by dividing the total number of households in which at least one household member had been bitten by any dog during the one-year period, by the total number of households surveyed. This was completed for all households and for each residential location (i.e. urban and rural groups of households). Incidence was assumed despite the cross- sectional approach to sampling because of the peracute nature of dog bites.

Additionally, we described the profile of all bite victims and all biting dogs pertaining to whether the biting dog was owned by the household (i.e. respondent-owned) or not. The biting incident could have occurred within or outside of the household. Victim-level variables, at the individual level, included the number of household members bitten, their age (in years) and gender, whether or not victims were playing or interacting with the dog at the time of the incident, and the anatomic location of the dog bite. Respondents were able to choose as many anatomic locations as were relevant to the bite in question from a predetermined list. Finally, we described the profile of all biting dogs including: the age and sex of the biting dog, the proportion of biting dogs not up to date on rabies vaccination as self-reported by respondents, and whether the dog was on or off leash at the time of the incident.

Measures of Association

We used occurrence of a dog bite at the household level (i.e. one or more bites within the household during the past year) as the dependent variable and dog ownership (i.e. one or more dogs owned by household) and residential location (i.e. urban and rural groups of households) as independent variables. We performed two univariable logistic regressions to calculate odds ratios

132

(OR) and 95% confidence intervals (95% CI) to determine whether a significant difference in dog bites existed between (1) rural and urban households in southern Ontario, and (2) between dog-owning and dog-free households. Additionally, we used a multivariable model to examine the effect of income and number of household occupants on the association of being bitten with residential location. We assessed model fit using the Hosmer-Lemeshow goodness-of-fit test

(Hosmer & Lemeshow, 1980).

Effect Modification

We investigated whether the effect of residential location on human exposure to dog bites differed depending on the presence or absence of dog ownership at the household level. We constructed a multivariable logistic regression model with a dependent variable of incidents of dog bites, independent variables of residential location and dog ownership, and with an interaction term between residential location and dog ownership. The interaction term was retained in the model if statistically significant at p<0.05 and reported with the ORs of main effects. Otherwise, only the ORs of main effects in the model, with 95% CI, were reported.

RESULTS

Survey Respondents and Dog Ownership: Descriptive Statistics

A total of 2,006 respondents were recruited to include 1,002 rural and 1,004 urban respondents from a random sample of 118,400 survey agency panelists in southern Ontario.

Respondent demographic information is presented in Table 5.1. Demographics were similar to reported statistics for the province, with numerically more females (50.70%) represented than males (48.80%), and varied from Ontario census data with respect to the following elements: average (mean) household size of 2.52 individuals in our study compared to 2.60 in the census,

133

and median category for annual household income between $40,000 and $79,999 CAD (30.96%) in our study compared to median household total income of $66,358 in the census (Statistics

Canada, 2012c). Our age distribution could not be compared to census data as the census includes all age ranges beginning from birth onwards and our study respondents were restricted to adults (18 years old and above) (Table 5.1). Overall, 48.60% of all respondents owned at least one dog. Of the dog-owning households, most only included one dog (70.87%). Respondent- owned dogs were most frequently adults between the ages of six to ten years old (30.95%), female (51.79%), purebred (60.42%), and spayed or neutered (79.08%) (Table 5.2). In the study population, 51.45% of rural households owned at least one dog, compared to 46.05% of urban households (OR=1.24, 95% CI = 1.04 - 1.48, p=0.02). The majority of dog owners reported that their dog(s) had been vaccinated for rabies within the three years prior to the start of the questionnaire (88.18%). However, 8.01% of respondents indicated their owned dogs were unvaccinated, and 3.34% were unsure about their dog’s rabies vaccination status (Table 5.2).

Measures of Dog Bite Frequency: Descriptive Statistics

Overall, 169 respondents, each representing one household, reported that at least one household occupant had been bitten by any dog (their dog or someone else’s) during the past year (Table 5.3). In some households, respondents indicated more than one person had been bitten by any dog to a total of 203 victims. At the household-level, the incidence risk of dog bites was 8.42% per year (Table 5.3). The incidence risk of dog bites was 6.09% per year for rural and

10.76% per year for urban households respectively. The profile of bite victims and biting dogs, categorized by whether the biting dog was owned by the household (i.e. respondent-owned) or not, is presented in Table 5.4. There was a high frequency of biting dogs that were not owned by

134

the respondents’ household. There were differences in biting dog and victim profiles where the dog was respondent-owned versus those where the dog was not owned by the respondent. Due to the way in which the survey was constructed, respondents were not able to describe how they obtained information about biting dogs that were not owned by the respondents’ household. In

53.20% of dog bite incidents, one household person was bitten. In 46.80% of households, two or more individuals experienced dog bites (Table 5.4). Most frequently, (21.67%), bite victims were young adults between the ages of 25 to 34 years (overall age range, 2 years to 82.5 years), male (54.19%), and playing with or interacting with the biting dog at the time of the incident

(59.11%) (Table 5.4). Most victims were bitten on the hand (42.86%). While data differed numerically depending on ownership, biting dogs were most frequently reported as being adults

3 to 5 years old (range, 0.1 to 24 years) and male (53.69%). Finally, based on self-reporting by respondents, 5.91% of all biting dogs, and 7.58% of those owned by the respondent’s household, were not-up to date on rabies vaccination. In 29.56% of all biting incidents, victims were unsure about the rabies vaccination status of the biting dog, particularly when it was not owned by the respondents’ household (Table 5.4).

Measures of Association

In the univariable model, the odds of an individual in a rural household being bitten by a dog were 0.53 (95% CI: 0.38 – 0.73, p<0.001) times the odds for an urban household (Table

5.5). In the second univariable model, the odds of an individual being bitten by a dog were 2.81

(95% CI: 1.99 - 3.97, p<0.001) times higher in dog-owning households than dog-free households. Estimates did not vary substantially when dog ownership was included in a multivariable model including the occurrence of a dog bite at the household level (i.e. one or

135

more bites within the household during the past year) as the dependent variable, and residential location as an independent variable. Neither income nor number of household occupants was significantly associated with human exposure to dog bites, and the inclusion of these variables did not change the magnitude or direction of the association between residential location and human exposure to dog bites (data not shown). Furthermore, there was no significant interaction between independent variables residential location and dog ownership (95% CI: 0.35 - 1.44, p=0.34) (Table 5.5). In each of the regression models, our data did not fit the model well

(Hosmer-Lemeshow goodness-of-fit (χ2 p<0.001)).

DISCUSSION

We used a cross-sectional observational study design and an online questionnaire of rural and urban southern Ontario respondents to determine the incidence risk of dog bites at the household level in rural and urban households, describe the profile of bite victims, biting dogs, and the proportion of biting dogs not up to date on rabies vaccination, and determine if there were significant differences in dog bites between rural and urban households in southern Ontario,

Canada. Obtaining information about dog ownership and canine rabies vaccination status in the general dog population can be challenging (Bottoms et al., 2014). Our study highlights three important findings. Firstly, dog bites are occurring in southern Ontario and, while there are biting incidents in both rural and urban households, irrespective of dog ownership, urban respondents had a higher odds of being bitten than rural respondents. Secondly, the characteristics of bite victims and biting dogs provided some important data regarding who was bitten (victim age, gender, and anatomic distribution of the bite), the biting dog (age, sex, and whether rabies vaccination was up to date or not), and the circumstances surrounding the bite (e.g., play and

136

provocation), relative to whether the biting dog was respondent-owned or not. Finally, we identified proportions of respondent-owned and biting dogs in southern Ontario that were unvaccinated and not-up to date on rabies vaccination, respectively, as self-reported by respondents. Few studies have evaluated domestic dog demography in southern Ontario

(Bottoms et al., 2014; Leslie et al., 1994; Stull et al., 2012; Szpakowski et al., 1989), and even fewer have determined the odds of an individual in a rural household being bitten by a dog as compared with an individual being bitten in an urban household (Bottoms et al., 2014).

Therefore, our study provides important data that informs a previous gap in the research.

While a higher proportion of rural households owned dogs, the odds of an individual being bitten by a dog in a rural household were half that of an urban household. This is a surprising finding given the contrasting data from other studies in southern Ontario and globally

(Bottoms et al., 2014; Mbilo et al., 2017; Ngugi et al., 2018). One Canadian study suggested that dogs in rural areas may be more likely to roam freely when outdoors and are more likely to be used for protection and as working animals on the property (e.g., farm dogs), resulting in increased opportunities for human-dog interaction and contact, including dog bites (Bottoms et al., 2014). However, that study was based on public health data and so, being possibly based on the more severe biting events, may have highlighted a difference in the risk of such severe events between rural and urban settings. However, as our results vary from those previously reported, our unique findings should be interpreted with caution. It is plausible that dogs in urban settings in southern Ontario may have varied access to yards or green space within which to exercise and interact with other dogs and people, reside in smaller homes than their rural counterparts as a consequence of the built urban environment, and may stay indoors for longer periods of time due

137

to urban norms. It is possible that these factors could lead to negative behaviours in dogs, such as biting, resulting from their inactivity and isolation (Tiira & Lohi, 2015). There may also be human-specific factors that explain our findings. We gathered information regarding number of persons in the household, presence of dependents, and income for both dog-owning and non-dog owning households. Many victims who were exposed to bites were bitten outside of their households. However, we did not collect these data (i.e. number of persons in outside households, presence of dependents in outside households, and outside household income) as part of this study. Furthermore, if we only regarded dog-owning households as a subset, we would not have enough power to detect an effect of residential location on human exposure to dog bites, even if an effect of residential location was truly there. Thus, further investigations of potential risk factors associated with dog bites, specifically in urban households, is warranted.

This presents a valuable opportunity for multidisciplinary collaboration for the investigation of dog bites as a significant One Health issue (Rock et al., 2017). Such collaborations may involve social scientists, ecologists, and animal welfare and behaviour specialists to more completely understand why dog bites occur and the potential environmental influences on their occurrence

(Lapinski et al., 2015; Oxley et al., 2018).

In our study, the incidence risk of human exposure to dog bites was estimated for households in which at least one person had been bitten during a one-year period. This provided information on the incidence of dog bites in two types of residential locations: urban and rural in several geographic locations all over southern Ontario. Our household-based method varies from that previously used in one study in southern Ontario in which data from individual bites, rather than

138

household level data, reported to public health had been assessed and from which an incidence rate of dog bites was reported (Bottoms et al., 2014). It is unlikely that the high incidence risk of dog bites in our study is due to differences in respondent perception of incident definitions or sampling bias, as we defined ‘bite’ for respondents such that we collected data on all bites that broke the skin. As the study conducted by Bottoms et al., was reliant on public health data, it is assumed that bite victims sought health care (indicative of more severe bites) and that the attending physician or other health care professional reported the incident to public health. Therefore, there can be no direct comparison between our study and theirs.

While there are many studies that focus on the potential aspects associated with biting injury (Bottoms et al., 2014; Clarke & Fraser, 2013; Kahn et al., 2004; Ngugi et al., 2018; Patrick

& O’Rourke, 1998; Raghavan, 2008), there is often limited evidence regarding the influences of and potential factors relating to the time preceding dog bites (Oxley et al., 2018). Studies that investigate the circumstances before a bite incident occurs would be beneficial to informing this gap in knowledge. In our study, biting dogs were most frequently male, which is similar to other findings (Overall & Love, 2011; Shuler et al., 2008; Szpakowski et al., 1989) and off leash at the time of the bite which parallels other publications (Lunney et al., 2011; Mbilo et al., 2017; Ngugi et al., 2018; Ortega-Pacheco et al., 2007). Interestingly, in contrast to other research, our study found that most biting dogs were not owned by the household (Bottoms et al., 2014; Georges &

Adesiyun, 2008; Pfortmueller et al., 2013; J J Sacks et al., 1996). One possible explanation for this difference is that owners of dogs may be less likely to self-report biting by their own dog(s) or downplay the event as compared to biting by other dogs. In one study in Ontario, more than 90% of respondents indicated that if bitten by a wild animal they would call or see a doctor, yet only

139

39% of the same population indicated they would do the same if bitten by their own pet (Goodwin et al., 2002). This finding could be a function of fear of wildlife or perception of the severity of wildlife diseases as compared with diseases from ones’ own dog but does highlight that circumstance can determine health care seeking behaviours.

Adult males were most frequently bitten, which parallels other studies (Bottoms et al.,

2014; Mbilo et al., 2017; Overall & Love, 2011; Raghavan, 2008; J J Sacks et al., 1996;

Szpakowski et al., 1989). The most frequently bitten anatomical location were hands, followed by the feet and lower legs. Previous research has demonstrated that aggression in dogs is closely associated with the location of the bite on the victim’s body and the human-dog dynamic prior to the incident (Overall & Love, 2011; Oxley et al., 2018). That is, studies have found that victims bitten on upper extremities such as the hands and torso, were more likely to have approached the biting dog, whereas victims with injury to the lower body (e.g., feet, lower legs), were more likely to have been approached by the offending dog (Messam et al., 2008; Oxley et al., 2018).

Our finding that 48.60% of households owned at least one dog is comparable to, but slightly higher than the 39% reported in the USA (Langley, 2009) and 42.8% in Canada (Stull et al., 2012). Our household dog-owning estimate is similar to that of one previous study conducted in southern Ontario in which 42.8% of all respondents owned at least one dog (Stull et al., 2012).

Estimates from the Canadian Animal Health Institute (CAHI) pertaining to the number of dog- owning households in the province of Ontario indicates that 35.0% of households own at least one dog (Canadian Animal Health Institute (CAHI), 2012). Our data indicated that in southern

Ontario, the proportion of dog-owning households is numerically higher than that of the total provincial proportion; however, this difference was not assessed for statistical significance. We

140

found a statistically significant difference in dog ownership between rural and urban households.

Our finding is different from previous studies in which dog ownership was higher in urban than in rural areas (Leslie et al., 1994; Ortega-Pacheco et al., 2007; Stull et al., 2012), but is similar to a study conducted in communities outside of North America (Knobel et al., 2008). Intuitively, our finding of a higher proportion of dog-owning households in rural than in urban areas may be expected as rural residents are more likely than urban residents to own livestock and other animals, including dogs, as a part of their livelihoods and or rural custom (Leslie et al., 1994).

Nevertheless, this finding reflects the geographic heterogeneity of dog ownership in this part of

Ontario, which can be considered for public health policy and community-specific educational programs regarding dog ownership.

In the province of Ontario, dogs three months of age and older are legally required to be vaccinated against rabies (Service Ontario e-Laws 1990a, 1990). Considering this provincial regulatory requirement, as well as the severity of rabies, we highlight three important findings from our study concerning canine rabies vaccination: (1) there were proportions of respondent- owned dogs that were reported, by their owners, as being either unvaccinated, or the owners were unsure of their dog’s rabies vaccination status; (2) there were also proportions of respondent- owned biting dogs reported as not up to date on rabies vaccination; and, finally, (3) there were proportions of biting dogs for which respondents were unsure of canine rabies vaccination status, particularly when the biting dog was not owned by the respondent’s household. This last finding may highlight the way in which victims conceptualize diseases: victims may have been unaware of either the importance of canine rabies vaccination as it pertains to human and canine health or

141

the severity of rabies as a disease outcome. Two previous studies of public health unit data indicated lower rabies vaccination rates in dogs than were identified in our study (Bottoms et al.,

2014; Szpakowski et al., 1989). Additionally, when compared to validated public health unit data for the province (Filejski, C. (2019, May 15). Personal communication), which reported an overall vaccination rate of 68.90% for owned (dogs that were not stray), respondents in our study indicated a numerically higher respondent-owned biting dog vaccination rate; however, this difference was not assessed for statistical significance. This shows that self-reported data may be subject to inaccuracies and as highlighted in our study, if considered in isolation, can falsely over-inflate the proportion of respondent-owned biting dogs that are up to date on rabies vaccination. Furthermore, as the validated public health unit information probably represents more accurate rabies vaccination rates in owned biting dogs for the entire province of Ontario, it is likely that in our study, the proportion of respondent-owned biting dogs for which an “unsure” rabies vaccination status was indicated, were actually biting dogs that were unvaccinated against the virus.

Both unvaccinated dogs and dogs not up to date on rabies vaccination reflect public noncompliance with provincial regulatory requirements. Plausible explanations for our findings that some respondent owned dogs were either unvaccinated against rabies or not up to date on rabies vaccination include owner complacency, or that owners are unaware of the provincial mandate (Bottoms et al., 2014; Filejski, 2016). Overall, our study results are useful as they preceded the recent resurgence of rabies in terrestrial wildlife reservoirs in southern Ontario

(Canadian Food Inspection Agency, 2017). There were no identified cases of rabies in terrestrial mammals in Ontario in 2013 or 2014; however, evidence from whole genome sequencing, suggests that racoon rabies was circulating in and translocated from racoon populations in the United States

142

for a considerable period prior to the identification of the first cases linked to the emergence of the raccoon rabies outbreak in Ontario in 2015 (Lobo et al., 2018). In 2015, 2016, and 2017 there were

11, 259, and 129 confirmed cases in terrestrial animals, respectively (Canadian Food Inspection

Agency, 2017). Whereas the majority of confirmed terrestrial cases were identified in racoons and skunks, two confirmed cases were reported in domestic cats between 2016 and 2017 (Canadian

Food Inspection Agency, 2017). This finding highlights the potential for spillover from rabies in wildlife to rabies in domestic pets, particularly in unvaccinated and therefore vulnerable subsets of the canine population, which, from our study findings, do exist in a province that was previously referred to as the “rabies capital of North America” (Filejski, 2016).

LIMITATIONS

This study was conducted using an online questionnaire and survey agency which provided an efficient means of accessing rural and urban populations that historically have low response rates with other types of survey administration methods (Bottoms et al., 2014; Clarke and Fraser, 2013b). However, there were some limitations. Firstly, there may be selection bias regarding the way in which respondents were accessed for the study: that is, respondents were drawn from a source population that differed from the general public. The response rate for the survey was unknown. As we purposively selected by residential location, and therefore have information regarding both rural and urban southern Ontario respondents, we would not expect complete representativeness as the census does not stratify by residential location. However, comparing respondent demographics to the Ontario census data provided some context of our study population. Secondly, there may be recall bias associated with the data; respondents were asked to recall biting incidents within the year prior to the start of the study, which could have

143

resulted in differences in the accuracy or completeness of their recollections. Additionally, although we collected information on biting dogs that were not owned by the respondent’s household, we did not ask respondents how they acquired their information about this subset of dogs. This could also add to a lack of accuracy or completeness of recollections. Thirdly, our study findings may reflect social desirability bias wherein respondents answered questions in a manner in which they perceived would be received most favourably by others. Finally, the true incidence of dog bites in southern Ontario may be underestimated. Despite the legal requirement to report dog bites, as well as the potentially significant health outcomes, underreporting exists

(Bottoms et al., 2014; Raghavan, 2008; Shuler et al., 2008; Szpakowski et al., 1989).

CONCLUSION

Dog bites represent a significant, yet preventable, public health challenge (Shuler et al.,

2008). The results of our study indicate that, in southern Ontario, Canada, dog bites are occurring more frequently in urban than rural households, and within a particular demographic. As our findings differ from previous studies, these data should be interpreted with caution. In Ontario, the threat of rabies transmission remains, and it may be beneficial for public health to consider our study findings for targeted messaging. Previous research has indicated that even though policies related to rabies control are considered important for human and animal health, they often neglect the added value of collaborative approaches including One Health (Rock et al.,

2017). Veterinarians are not typically aware of, nor do they routinely document, the health status of pet owners; similarly, physicians do not usually make inquiries about pet ownership or the species of animals owned (Stull et al., 2012). In cases of zoonotic disease risk in general, and dog bite injuries specifically, it is necessary for both human and veterinary health professionals

144

to be aware of this information in order to diagnose, treat, and prevent public health challenges to dogs, their owners, and the broader community.

REFERENCES

Bottoms, K., Trotz-Williams, L., Hutchison, S., MacLeod, J., Dixon, J., Berke, O., & Poljak, Z. (2014). An evaluation of rabies vaccination rates among canines and felines involved in biting incidents within the Wellington-Dufferin-Guelph Public Health Department. Zoonoses and Public Health, 61(7), 499–508. https://doi.org/http://dx.doi.org/10.1111/zph.12101 Canadian Animal Health Institute (CAHI). (2012). Population of dogs by province. Canadian Animal Health Institute (CAHI). (2017). Latest Canadian pet population figures released. Retrieved from https://www.canadianveterinarians.net/documents/canadian-pet- population-figures-cahi-2017 Canadian Food Inspection Agency. (2017). Rabies in Canada. Retrieved July 23, 2019, from http://www.inspection.gc.ca/animals/terrestrial-animals/diseases/reportable/rabies/rabies-in- canada/eng/1356156989919/1356157139999 Centers for Disease Control and Prevention. (2017). Preventing dog bites. Retrieved April 23, 2018, from https://www.cdc.gov/features/dog-bite-prevention/ Clarke, N. M., & Fraser, D. (2013). Animal control measures and their relationship to the reported incidence of dog bites in urban Canadian municipalities. The Canadian Veterinary Journal, 54(2), 145–149. Filejski, C. (2016). The changing face of rabies in Canada. Canada Communicable Disease Report, 42(6), 118–120. https://doi.org/10.14745/ccdr.v42i06a01 Franka, R., Smith, T. G., Dyer, J. L., Wu, X., Niezgoda, M., & Rupprecht, C. E. (2013). Current and future tools for global canine rabies elimination. Antiviral Research, 100(1), 220–225. https://doi.org/10.1016/j.antiviral.2013.07.004 Georges, K., & Adesiyun, A. (2008). An investigation into the prevalence of dog bites to primary school children in Trinidad. BMC Public Health, 8(1), 85. https://doi.org/10.1186/1471- 2458-8-85 Goodwin, R., Werker, D. H., Hockin, J., Ellis, E., & Roche, A. (2002). A survey of knowledge, attitudes, and practices of dog and cat owners with respect to vaccinating their pets against rabies, Ottawa-Carleton, Ontario, July 2000. Canada Communicable Disease Report= Releve Des Maladies Transmissibles Au Canada, 28(1), 1–6. Government of Canada. (2011). Canadian radio-television and telecommunications commission: Table 2.1.1 Broadband availability by technology and province/territory, 2010. Retrieved November 19, 2019, from https://crtc.gc.ca/eng/publications/reports/broadband/bbreport1111.htm#t2.1.1 Hampson, K., Coudeville, L., Lembo, T., Sambo, M., Kieffer, A., Attlan, M., … Zinsstag, J. (et al). (2015). Estimating the global burden of endemic canine rabies. PLoS Neglected Tropical Diseases, 9(4), e0003709. Herbert, M., Basha S, R., & Thangaraj, S. (2012). Community perception regarding rabies prevention and stray dog control in urban slums in India. Journal of Infection and Public 145

Health, 5(6), 374–380. https://doi.org/10.1016/j.jiph.2012.05.002 Hodgson, K., & Darling, M. (2011). Zooeyia: an essential component of “One Health.” The Canadian Veterinary Journal, 52(2), 189–191. Hosmer, D. W., & Lemeshow, S. (1980). Goodness of fit tests for the multiple logistic regression model. Communications in Statistics - Theory and Methods, 9(10), 1043–1069. https://doi.org/10.1080/03610928008827941 Kahn, A., Robert, E., Piette, D., De Keuster, T., Lamoureux, J., & Levêque, A. (2004). Prevalence of dog bites in children: a telephone survey. European Journal of Pediatrics, 163(7), 424–424. https://doi.org/10.1007/s00431-004-1456-3 Knobel, D. L., Laurenson, M. K., Kazwala, R. R., Boden, L. A., & Cleaveland, S. (2008). A cross-sectional study of factors associated with dog ownership in Tanzania. BMC Veterinary Research, 4(1), 5. Lang, M. E., & Klassen, T. (2005). Dog bites in Canadian children: a five-year review of severity and emergency department management. Canadian Journal of Emergency Medicine, 7(5), 309–314. Langley, R. L. (2009). Human fatalities resulting from dog attacks in the United States, 1979- 2005. Wilderness and Environmental Medicine, 20(1), 19–25. https://doi.org/10.1580/08- WEME-OR-213.1 Lapinski, M. K., Funk, J. A., & Moccia, L. T. (2015). Recommendations for the role of social science research in one health. Social Science & Medicine (1982), 129, 51–60. https://doi.org/10.1016/j.socscimed.2014.09.048 Leslie, B. E., Meek, A. H., Kawash, G. F., & McKeown, D. B. (1994). An epidemiological investigation of pet ownership in Ontario. The Canadian Veterinary Journal, 35(4), 218– 222. Lobo, D., DeBenedet, C., Fehlner-Gardiner, C., Nadin-Davis, S., Anderson, M., Buchanan, T., … Hopkins, J. (2018). Raccoon rabies outbreak in Hamilton, Ontario: A progress report. Canada Communicable Disease Report, 44(5), 116–121. https://doi.org/10.14745/ccdr.v44i05a05 Lunney, M., Jones, A., Stiles, E., & Waltner-Toews, D. (2011). Assessing human-dog conflicts in Todos Santos, Guatemala: Bite incidences and public perception. Preventive Veterinary Medicine, 102(4), 315–320. https://doi.org/10.1016/j.prevetmed.2011.07.017 MacInnes, C. D., Smith, S. M., Tinline, R. R., Ayers, N. R., Bachmann, P., Ball, D. G. A., … Voigt, D. R. (2001). Elimination of rabies from red foxes in eastern Ontario. Journal of Wildlife Diseases, 37(1), 119–132. https://doi.org/10.7589/0090-3558-37.1.119 Macpherson, C. N. (2012). Dogs, Zoonoses and Public Health (2nd ed.). CABI. Matthias, J., Templin, M., Jordan, M. M., & Stanek, D. (2015). Cause, setting and ownership analysis of dog bites in Bay County, Florida from 2009 to 2010. Zoonoses and Public Health, 62(1), 38–43. https://doi.org/10.1111/zph.12115 Mbilo, C., Léchenne, M., Hattendorf, J., Madjadinan, S., Anyiam, F., & Zinsstag, J. (2017). Rabies awareness and dog ownership among rural northern and southern Chadian communities - analysis of a community-based, cross-sectional household survey. Acta Tropica, 175, 100–111. https://doi.org/10.1016/j.actatropica.2016.06.003 Messam, L. L. M. M., Kass, P. H., Chomel, B. B., & Hart, L. A. (2008). The human–canine environment: A risk factor for non-play bites? The Veterinary Journal, 177(2), 205–215.

146

https://doi.org/10.1016/j.tvjl.2007.08.020 Middleton, D., Johnson, K. O., Rosatte, R. C., Hobbs, J. L., Moore, S. R., Rosella, L., & Crowcroft, N. S. (2015). Human rabies post-exposure prophylaxis and animal rabies in Ontario, Canada, 2001-2012. Zoonoses and Public Health, 62(5), 356–364. https://doi.org/10.1111/zph.12155 Ng, V., & Sargeant, J. M. (2012). A stakeholder-informed approach to the identification of criteria for the prioritization of zoonoses in Canada. PLoS ONE, 7(1). https://doi.org/10.1371/journal.pone.0029752 Ng, V., & Sargeant, J. M. (2013). A quantitative approach to the prioritization of zoonotic diseases in North America: A health professionals’ perspective. PLoS ONE, 8(8). https://doi.org/10.1371/journal.pone.0072172 Ngugi, J. N., Maza, A. K., Omolo, O. J., & Obonyo, M. (2018). Epidemiology and surveillance of human animal-bite injuries and rabies post-exposure prophylaxis, in selected counties in Kenya, 2011-2016. BMC Public Health, 18(1), 1–9. https://doi.org/10.1186/s12889-018- 5888-5 Ontario Ministry of Health and Long-Term Care. (2019). Management of potential rabies exposures guideline, 2019. Retrieved from https://www.bchu.org/QuickLinks/Documents/Management_of_Potential_Rabies_Exposure s_2018_en.pdf Ortega-Pacheco, A., Rodriguez-Buenfil, J. C., Bolio-Gonzalez, M. E., Sauri-Arceo, C. H., Jiménez-Coello, M., & Forsberg, C. L. (2007). A survey of dog populations in urban and rural areas of Yucatan, Mexico. Anthrozoos, 20(3), 261–274. https://doi.org/10.2752/089279307X224809 Overall, K. L., & Love, M. (2011). Special Report Dog bites to humans — demography, epidemiology, injury, and risk. Journal of the American Veterinary Medical Association (JAVMA), 218(112), 1923–1934. https://doi.org/10.2460/javma.2001.218.1923 Oxley, J. A., Christley, R., & Westgarth, C. (2018). Contexts and consequences of dog bite incidents. Journal of Veterinary Behavior: Clinical Applications and Research, 23, 33–39. https://doi.org/10.1016/j.jveb.2017.10.005 Patrick, G. R., & O’Rourke, K. M. (1998). Dog and cat bites: epidemiologic analyses suggest different prevention strategies. Public Health Reports, 113(3), 252–257. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/9633872%0Ahttp://www.pubmedcentral.nih.gov/arti clerender.fcgi?artid=PMC1308678 Perrin, T. (2009). The business of urban animals survey: The facts and statistics on companion animals in Canada. Canadian Veterinary Journal, 50(1), 48–52. Pfortmueller, C. A., Efeoglou, A., Furrer, H., & Exadaktylos, A. K. (2013). Dog bite injuries: primary and secondary emergency department presentations—a retrospective cohort study. The Scientific World Journal, 2013, 1–6. https://doi.org/10.1155/2013/393176 Raghavan, M. (2008). Fatal dog attacks in Canada, 1990-2007. The Canadian Veterinary Journal, 49(6), 577–581. Raghavan, M., Martens, P. J., & Burchill, C. (2014). Exploring the relationship between socioeconomic status and dog-bite injuries through spatial analysis. Rural and Remote Health, 14(3), 2846. Rock, M. J., Rault, D., & Degeling, C. (2017). Dog-bites, rabies and One Health: Towards

147

improved coordination in research, policy and practice. Social Science and Medicine, 187, 126–133. https://doi.org/10.1016/j.socscimed.2017.06.036 Sacks, J J, Kresnow, M., & Houston, B. (1996). Dog bites: how big a problem? Injury Prevention: Journal of the International Society for Child and Adolescent Injury Prevention, 2(1), 52–54. https://doi.org/10.1136/ip.2.1.52 Sacks, Jeffrey J., Sinclair, L., Gilchrist, J., Golab, G. C., & Lockwood, R. (2000). Breeds of dogs involved in fatal human attacks in the United States between 1979 and 1998. Journal of the American Veterinary Medical Association, 217(6), 836–840. https://doi.org/10.2460/javma.2000.217.836 Service Ontario e-Laws 1990a. (1990). Health Protection and Promotion Act, Regulation 567: Rabies Immunization. Retrieved July 19, 2019, from https://www.ontario.ca/laws/regulation/900567 Shuler, C. M., DeBess, E. E., Lapidus, J. A., & Hedberg, K. (2008). Canine and human factors related to dog bite injuries. Journal of the American Veterinary Medical Association (JAVMA), 232(4), 542–546. https://doi.org/10.2460/javma.232.4.542 StataCorp. 2017. Stata Statistical Software: Release 15. College Station, T. S. L. (n.d.). Stata Statistical Software: Release 15 College Station, TX: StataCorp LLC. Retrieved November 15, 2017, from https://www.stata.com/ Statistics Canada. (2012a). Census Dictionary Catalogue no. 98-301-X. https://doi.org/92-566-X Statistics Canada. (2012b). Focus on Geography Series, 2011 Census. Statistics Canada Catalogue no. 98-310-XWE2011004. Ottawa, Ontario. Analytical products, 2011 Census. Last updated October 24, 2012. Retrieved March 15, 2019, from https://www12.statcan.gc.ca/census-recensement/2011/as-sa/fogs-spg/Facts-pr- eng.cfm?Lang=Eng&GK=PR&GC=35 Statistics Canada. (2012c). Ontario (Code 35) and Canada (Code 01) (table). Census Profile. 2011 Census. Statistics Canada Catalogue no. 98-316-XWE. Ottawa. Released October 24, 2012. Retrieved November 19, 2019, from https://www12.statcan.gc.ca/nhs-enm/2011/dp- pd/prof/details/Page.cfm?Lang=E&Geo1=PR&Code1=35&Data=Count&SearchText=Onta rio&SearchType=Begins&SearchPR=01&A1=All&B1=All&GeoLevel=PR&GeoCode=10 Statistics Canada. (2017). Ontario [Province] and Canada [Country] (table). Census Profile. 2016 Census. Statistics Canada Catalogue no. 98-316-X2016001. Ottawa. Released November 29, 2017. Retrieved March 14, 2019, from https://www12.statcan.gc.ca/census- recensement/2016/dp-pd/prof/index.cfm?Lang=E Stull, J. W., Peregrine, A. S., Sargeant, J. M., & Weese, J. S. (2012). Household knowledge, attitudes and practices related to pet contact and associated zoonoses in Ontario, Canada. BMC Public Health, 12(1), 553. https://doi.org/10.1186/1471-2458-12-553 Stull, J. W., Peregrine, A. S., Sargeant, J. M., & Weese, J. S. (2013). Pet husbandry and infection control practices related to zoonotic disease risks in Ontario, Canada. BMC Public Health, 13(1), 520. https://doi.org/10.1186/1471-2458-13-520 Szpakowski, N. M., Bonnett, B. N., & Martin, S. W. (1989). An epidemiological investigation into the reported incidents of dog biting in the City of Guelph. The Canadian Veterinary Journal, 30, 937–942. Taylor, L. H., Hampson, K., Fahrion, A., Abela-Ridder, B., & Nel, L. H. (2017). Difficulties in estimating the human burden of canine rabies. Acta Tropica, 165, 133–140.

148

https://doi.org/10.1016/j.actatropica.2015.12.007 Tiira, K., & Lohi, H. (2015). Early life experiences and exercise associate with canine anxieties. PLoS ONE, 10(11), 1–16. https://doi.org/10.1371/journal.pone.0141907 Westgarth, C., Pinchbeck, G. L., Bradshaw, J. W. S., Dawson, S., Gaskell, R. M., & Christley, R. M. (2007). Factors associated with dog ownership and contact with dogs in a UK community. BMC Veterinary Research, 3(1), 5. https://doi.org/10.1186/1746-6148-3-5 WHO, FAO, & OIE. (2015). Rationale for investing in the global elimination of dog-mediated human rabies. WHO Press 20 Avenue Appia 1211 Geneva 27 Switzerland, 6–11. Retrieved from http://www.oie.int/eng/RABIES2015/img/WHO-OIE- FAO_Rationale_Rabies_2015_2.pdf Wunner, W. H., & Briggs, D. J. (2010). Rabies in the 21st century. PLoS Neglected Tropical Diseases, 4(3), 4–6. https://doi.org/10.1371/journal.pntd.0000591

149

Table 5. 1 Descriptive demographic information from an online questionnaire of all respondents (N=2,006) including rural (n=1,002) and urban (n=1,004) in southern Ontario, Canada

Variable Frequency (%) Residential location (n=2,006) Urban 1,004 (50.05) Rural 1,002 (49.95) Age of respondents (n=2,006) 18 - 24y 121 (6.03) 25 - 34y 293 (14.61) 35 - 44y 279 (13.91) 45 - 54y 399 (19.89) 55 - 64y 514 (25.62) >65y 389 (19.39) Respondent gender (n=2,006) Female 1,017 (50.70) Male 979 (48.80) Own at least one dog (n=2,006) Yes 975 (48.60) No 1,025 (51.10) Total number of household occupants (n=2,006) 1 295 (14.71) 2 954 (47.56) 3 319 (15.90) 4 285 (14.21) 5 110 (5.48) More than 5 28 (1.40) Dependentsa in household (n=2,006) Yes 472 (23.53) No 1,517 (75.62) Gross household incomeb(n=2,006) <20,000 81 (4.04) 20,000 - 39,999 280 (13.96) 40,000 - 79,999 621 (30.96) 80,000 - 120,000 465 (23.18) >120,000 249 (12.41) aPersons less than 18 years of age bBefore taxes in Canadian (CDN) dollars ($)

150

Variable Frequency (%) Number of owned dogs in household (n=975) 1 691 (70.87) 2 216 (22.15) 3 38 (3.90) 4 15 (1.54) 5 4 (0.41) More than 5 4 (0.41) Ages of owned dogs (n=1,286) Puppy under 3 months 14 (1.09) Puppy 3 to 6 months 28 (2.18) Juvenile 7 to 11 months 34 (2.64) Adult 12 months to under 3 years 227 (17.65) Adult 3 to 5 years 353 (27.45) Adult 6 to 10 years 398 (30.95) Adult >10 years 224 (17.42) Unsure 3 (0.23) Sex (n=1,286) Female 666 (51.79) Male 620 (48.21) Breeda (n=1,286) Purebred 777 (60.42) Mixed breed 467 (36.31) Spayed or neutered (n=1,286) Yes 1,017 (79.08) No 257 (19.98) Self-reported rabies vaccination status of owned dogs within the last 3 years (“Has your dog been vaccinated for rabies in the last three years?) (n=1,286) Yes 1,134 (88.18) No 103 (8.01) Unsure 43 (3.34) Time since last rabies vaccine (n=1,134 Within the last 1 year 449 (39.59) Within the last 2 years 408 (35.98) Within the last 3 years 162 (14.29) More than 3 years ago 69 (6.08) Unsure 41 (3.62)

151

aFor this survey, dogs were categorized as pure-bred if they were breeds with documented pedigrees (e.g., German shepherd, Rottweiler and others); mixed breed dogs were those mixed with one or more other breed types or for which the breed was unknown (e.g., labradoodle, Shih-poo and others)

152

Household incidence Household incidence riska riska of at least one Variables of not being bitten by Totals household member being dog: no. (%) bitten by dog: no. (%) Residential area Rural residents 61 (6.09) 934 (93.21) 1002 (49.95) Urban residents 108 (10.76) 869 (86.55) 1004 (50.05) Total responses 169 (8.42) 1,803 (89.88) 2,006 Dog-owning households Rural residents 43 (8.35) 469 (91.07) 515 (52.82) Urban residents 77 (16.74) 368 (80.00) 460 (47.18) Total responses 120 (12.31) 837 (85.85) 975 Dog-free households Rural residents 18 (3.70) 465 (95.68) 486 (47.41) Urban residents 31 (5.75) 497 (92.21) 539 (52.59) Total responses 49 (4.78) 962 (93.85) 1,025 aIncidence risk of dog bites in rural and urban households was calculated by dividing the total number of households in which at least one household member had been bitten by any dog during the one-year period, by the total number of households surveyed for each residential location.

153

Was the biting a dog owned by the respondent or the respondents’ household? Yes (column %) No (column %) Total (column %) Victim-level Variables Number of household occupants exposed to dog bites during the year prior 1 28 (42.42) 80 (60.61) 108 (53.20) 2 14 (21.21) 32 (24.24) 46 (22.66) 3 18 (27.27) 9 (6.82) 27 (13.30) 4 6 (9.09) 6 (4.55) 12 (5.91) 5 0 (0.00) 5 (3.79) 10 (4.93) Total responses (row %) b 66 (32.51) 132 (65.02) 203 Victim’s age (years old) 0-4 1 (1.52) 4 (3.03) 5 (2.46) 5-9 2 (3.03) 8 (6.06) 10 (4.93) 10-14 4 (6.06) 15 (11.36) 19 (9.36) 15-24 11 (16.67) 21 (15.91) 32 (15.76) 25-34 16 (24.24) 28 (21.21) 44 (21.67) 35-44 7 (10.61) 11 (8.33) 18 (8.87) 45-54 6 (9.09) 18 (13.64) 24 (11.82) 55-64 12 (18.18) 20 (15.15) 32 (15.76) 65 and older 5 (7.58) 6 (4.55) 11 (5.42) Unsure 0 (0.00) 0 (0.00) 5 (2.46) Total responses (row %) b 64 (32.51) 131 (65.02) 203 Victim’s gender Male 28 (42.42) 77 (58.33) 110 (54.19) Female 38 (57.58) 54 (40.91) 92 (45.32) Total responses (row %) b 66 (32.51) 131 (65.02) 203 Was the victim playing or interacting with the dogs at the time of the bite? Yes 54 (81.82) 66 (50.00) 120 (59.11) No 11 (16.67) 59 (44.70) 70 (34.48) Unsure 1 (1.52) 7 (5.39) 13 (6.40) Total responses (row %) b 66 (32.51) 132 (65.02) 203 Anatomic distribution of bite Foot 9 (13.64) 19 (14.39) 29 (14.29) Lower leg 9 (13.64) 39 (29.55) 49 (24.14) Upper leg 2 (3.03) 13 (9.85) 16 (7.88) Lower body (lower trunk) 1 (1.52) 6 (4.55) 8 (3.94) Upper body (upper trunk) 3 (4.55) 3 (2.27) 6 (2.96) 154

Hand 37 (56.06) 49 (37.12) 87 (42.86) Lower arm 7 (10.61) 15 (11.36) 22 (10.84) Upper arm 2 (3.03) 3 (2.27) 5 (2.46) Neck 2 (3.03) 0 (0.00) 2 (0.99) Face 2 (3.03) 3 (2.27) 5 (2.46) Unsure 1 (1.52) 1 (0.76) 2 (0.99) Total responses (row %)b 66 (32.51) 132 (65.02) 203 Age of biting dog Puppy<3 months old 1 (1.52) 2 (1.52) 8 (3.94) Prepubescent 3 to 5 months 3 (4.55) 3 (2.27) 6 (2.96) Pubescent 6 to 11 months 3 (4.55) 6 (4.55) 9 (4.43) Adult 12 months to under 3 15 (22.73) 22 (16.67) 37 (18.23) years Adult dog 3 – 5 years 16 (24.24) 49 (37.12) 65 (32.02) Adult dog 6 – 10 years 21 (31.82) 14 (10.61) 35 (17.24) Adult dog >10 years 6 (9.09) 1 (0.76) 7 (3.45) Unsure 1 (1.52) 34 (25.76) 35 (17.24) Total responses (row %) b 66 (32.51) 131 (65.02) 203 Sex of biting dog Male 36 (54.55) 68 (51.52) 109 (53.69) Female 30 (45.45) 37 (28.03) 67 (33.00) Unsure 0 (0.00) 27 (20.45) 27 (13.30) Total responses (row %) b 66 (32.51) 132 (65.002) 203 Was the biting dog up to date on rabies vaccination? (to the best of the respondents’ knowledge) Dog up-to-date 55 (83.33) 76 (57.58) 131 (64.53) Dog not up to date 5 (7.58) 7 (5.30) 12 (5.91) Unsure 6 (9.09) 49 (37.12) 60 (29.56) Total responses (row %) b 66 (32.51) 132 (65.02) 203 Was the biting dog on leash or off leash at the time of the bite? Dog on leash at time of bite 12 (18.18) 26 (19.70) 41 (20.20) Dog off leash at time of bite 54 (81.82) 100 (75.76) 156 (76.85) Unsure 0 (0.00) 6 (4.55) 6 (2.96) Total responses (row %) b 66 (32.51) 132 (65.02) 203 aFor the purposes of this study, a dog bite was defined as any cut, wound, tear, or breaking of human skin caused by the dog's teeth. A biting incident at the household-level is defined as one or more occupants being bitten by any dog including those respondent-owned and those not owned by the household

155

Table 5. 5 Univariable and multivariable models to determine whether a significant difference in dog bites existed between rural and urban households in southern Ontario and between dog-owning and dog-free households. Data were collected from an online questionnaire of N=2,006 respondents (n=1,002 rural and n=1,004 urban) in southern Ontario, Canada

Odds Estima Model N Variable SE p * ratio 95% CI te (β) (eβ) Univariable 1,972 Residential location Urban Ref. Rural -0.64 0.17 <0.001 0.53 0.38 - 0.73 Univariable 1,968 Dog ownership Dog-free Ref. Dog-owning 1.03 1.18 <0.001 2.81 1.99 - 3.97 Multivariable 1,968 Residential location Urban Ref. Rural -0.72 0.17 <0.001 0.49 0.35 - 0.68 Dog ownership Dog-free Ref. Dog-owning 1.08 0.18 <0.001 2.96 2.09 - 4.19 *Wald’s p-value of the odds ratio

156

CHAPTER 6

WHAT DO THEY KNOW? A CROSS-SECTIONAL STUDY TO ASSESS AWARENESS OF CANINE ZOONOSES IN RURAL AND URBAN COMMUNITIES IN SOUTHERN ONTARIO, CANADA

157

ABSTRACT

Effective mitigation of canine zoonoses is partially reliant on public awareness of canine zoonotic disease risk. As such, we: (1) described respondent awareness, knowledge, and levels of concern regarding canine zoonoses, (2) described possible pathways of respondent exposure to canine zoonoses through animal contact, and (3) determined if awareness of canine zoonoses differed between rural and urban respondents in southern Ontario, Canada. We conducted a cross-sectional observational study using an online questionnaire of 1,002 rural and 1,004 urban residents. Most respondents were aware of canine zoonoses (55.88%). Of the 1,121 respondents who aware of canine zoonoses, 83.05% indicated rabies was a canine zoonoses. However, there were some who were unsure, (13.92%), and some who did not think that rabies could cause disease in humans (2.50%). Generally, respondents did not come into frequent direct contact with dogs outside of their homes. Of dog-owning respondents, most reported their dogs could come into contact with wildlife (53.03%), specifically, raccoons (79.12%), skunks (78.25), and mice (76.06%). Overall, 93.64% of dog owners used veterinarians; however, only 30.23% reported ever being provided with any information about canine zoonoses by their veterinarian.

There were no differences in awareness of canine zoonoses between rural and urban respondents in three populations: the total study population (OR=1.17, p=0.21, 95% CI: 0.92-1.49); dog- owning respondents (OR=1.13, p=0.50, 95% CI: 0.80-1.60); and dog-owning respondents who used a veterinarian (OR=1.06, p=0.76, 95% CI: 0.74-1.51). Our findings highlight that while many respondents reported awareness of canine zoonoses, there were some respondents who were unsure of common zoonoses, including rabies. Furthermore, our results highlight the need

158

for enhanced canine zoonoses public health education strategies. Finally, veterinary engagement with clients about canine zoonoses is essential and does occur but can be improved.

IMPACTS

Our findings contribute to the literature on public awareness and knowledge of canine

zoonoses, possible pathways of exposure to canine zoonoses, and assessment of

differences in awareness between rural and urban communities, which may be useful to

inform public health strategies.

Collaborative public health strategies that consider reasons for lack of awareness in the

public as well as the broader contexts within which the public is situated may be

informative.

Veterinary engagement with clients about canine zoonoses does occur, however this

engagement can be improved by considering the limitations and benefits of existing

resources.

INTRODUCTION

Over 60% of infectious diseases affecting humans and approximately 75% of emerging human infectious diseases are zoonotic, meaning that they are naturally transmissible between animals and humans (Taylor et al. 2001a). Because zoonotic pathogens circulate between animals, humans, and within the environment, they constitute an important One Health issue and have been associated with epidemics in humans and epizootics in animals (World Health

Organization 2005, Narrod et al. 2012).

Globally, dogs are one of the most common household pets, and have been for many centuries (Blaisdell, 1999; Davis et al., 2007; Downes, Canty, & More, 2009; Fielding et al.,

159

2012; Knobel, Laurenson, Kazwala, Boden, & Cleaveland, 2008a; Meyer & Forkman, 2014;

Olmert, 2010; Stull, Peregrine, Sargeant, & Weese, 2012a; Wilkin et al., 2016). In Canada, there are over seven million pet dogs (Canadian Animal Health Institute, 2017). Pet dogs are an important part of Canadian society and the most recent estimate of the proportion of dog-owning households indicates an increase from 32.3% in 2011, (Wilkin et al. 2016), to approximately

41% in 2017 (Canadian Animal Health Institute, 2017). In the southern region of the province of

Ontario, it is estimated that over 68% of households own at least one dog, which is higher than the Canadian national average (Stull, Peregrine, Sargeant, & Weese, 2013). Dogs provide companionship and have a positive influence on health outcomes, through increased physical activity, enjoyment, social support, and enhanced immune response (Westgarth et al. 2007,

Hodgson and Darling 2011). Furthermore, studies have shown that irrespective of dog ownership, interacting with dogs may support people to live happier and healthier lives (Herzog

2011, Saunders et al. 2017). However, dogs have the potential to act as sources of zoonotic pathogens (Bowser and Anderson 2018). The different roles that dogs play in communities and society broadly (e.g., working dogs, non-companion dogs including stray and feral dogs, and pet dogs) affect their potential for zoonotic disease transmission, as well as our ability to prevent and control these diseases (Bingham et al. 2010).

Canine zoonoses comprise an emerging public health issue, particularly as a growing population of dogs may increase the frequency with which people are in contact with dogs, and therefore be exposed to zoonotic pathogens (Bingham et al. 2010, Belay et al. 2017). Previous evidence has shown dogs in Canada, and in Ontario in particular, can be important sources of zoonoses; these include zoonoses transmitted directly, for example leptospirosis, salmonellosis,

160

and bite-associated bacterial infections, and zoonoses transmitted via an indirect route including

Echinococcus multilocularis and leishmaniasis (Lefebvre et al. 2006, Morshed et al. 2006, Alton et al. 2009, Leonard et al. 2011, Stull et al. 2013, Skelding et al. 2014, Bouchard et al. 2015,

Mercer et al. 2016, Bowser and Anderson 2018, Kotwa et al. 2019).

Many risks associated with the transmission of contact-related canine zoonoses (e.g., leptospirosis, methicillin resistant staphylococcus aureus, Pasteurella spp. (Ghasemzadeh and

Namazi 2015)) can be controlled (i.e., measures applied to prevent transmission once the disease is established), and may even be prevented (i.e., measures to hinder the occurrence of disease), with basic hygiene practices including hand-washing, removing dog excreta from the environment, deworming, and tick and flea prevention (Kiflu et al., 2016; Stull et al., 2013). One of the main ways to protect against zoonoses is to be consistently vigilant about control measures

(Cripps 2000). However, in the public there may be a lack of, or variations in, awareness of the existence of canine zoonoses, their potential modes of transmission, and ways to prevent these diseases. Despite this, there has been very little research conducted in southern Ontario regarding the public’s awareness of the risks dogs may pose as potential sources of zoonoses, the frequency of human contact with dogs, and methods to prevent disease transmission (Snedeker, Anderson,

Sargeant, & Weese, 2013; Stull et al., 2012a, 2013).

In addition, there is disproportion in dog-ownership between rural and urban communities (Leslie, Meek, Kawash, & McKeown, 1994; Stull et al., 2012), which may suggest there are also differences in canine zoonotic disease transmission, risk, and public awareness of these types of disease. However, to our knowledge, no studies to date have investigated the comparative awareness of canine zoonoses between rural and urban communities in southern

161

Ontario, Canada. Human contact with dogs and public awareness of canine zoonoses may differ between rural and urban communities. Community-specific differences in contact, awareness, and knowledge of canine zoonoses have the potential to influence the ways in which public health messaging is developed, to whom it is directed, and the success of zoonotic disease public health control and prevention strategies (Damborg et al. 2016).

Therefore, the goal of this study was to assess potential contact with zoonotic pathogens and knowledge of canine zoonoses, and to compare public awareness of canine zoonoses between rural and urban households in southern Ontario, Canada. Our objectives were to: (1) describe respondent awareness, knowledge, and levels of concern regarding canine zoonoses; (2) describe the possible pathways of respondent exposure to canine zoonoses through contact including (a) human contact with dogs, (b) owned dog contact with wildlife, and (c) owned dog contact with the feces of other dogs and/or wildlife; and (3) determine if public awareness of canine zoonoses differed between rural and urban respondents in southern Ontario, Canada.

METHODS

Study Design, Questionnaire Development, and Administration

This research was part of a larger cross-sectional observational study investigating canine zoonoses in rural and urban communities in southern Ontario, Canada. Briefly, an online questionnaire was developed to obtain information pertaining to the one-year prior to the conduct of this study. The questionnaire was pre-tested on two occasions with different groups of individuals known to the authors. Individuals in each group had variations in awareness of topic content. Details on the development and pre-testing of the questionnaire are available elsewhere

(Chapter 5). The section of the larger questionnaire presented herein focused on public

162

awareness, knowledge and levels of concern about canine zoonoses, human contact with dogs outside of households, and canine contact with wildlife. A combination of twelve questions with single and multiple-choice answer options were used. Following pre-tests and the implementation of feedback, access to the online questionnaire was available between August 21 to September 4, 2014. The questionnaire can be provided via request from the first author. This study was approved by the Research Ethics Board (REB) at the University of Guelph (REB#

14JN028).

Study Location

Located in east-central Canada, the province of Ontario encompasses 136,907 square kilometers and has an estimated population of 13.4 million inhabitants (Statistics Canada 2017c).

The province comprises two regions: southern Ontario and northern Ontario, which differ by population, terrain, number of major roads, amount of wilderness, and natural resources.

Although southern Ontario is more populous – nearly 95% of the Ontario population resides in southern Ontario – it comprises only about 15% of the land mass of Ontario (Statistics Canada

2017c). The northern limit of southern Ontario is demarcated by the convergence of the Mattawa and Ottawa rivers below the Quebec border and east of Lake Nipissing (Horn et al. 2019). This region was chosen for this study as it is the most densely populated region of the province with the greatest agricultural activity, (MacInnes et al. 2001), and includes both rural and urban communities.

Study Population

The target population was rural and urban residents of southern Ontario. To obtain our sample population and to administer the questionnaire, we used an online survey agency located

163

in Toronto, Ontario. This service has previously been used for health-related studies (Ng and

Sargeant 2012, 2013). Utilizing the services of this company allowed us to structure our sampling to obtain equal numbers of participants from rural and urban communities in southern

Ontario using pre-specified quota fields. The questionnaire link was made available to everyone in the source population, that is, all residents of Ontario in the survey agency’s database, until close to equal proportions of rural and urban respondents were achieved based on the targeted sample size. Eligibility criteria were applied using four questions at the start. Eligible participants included individuals who were 18 years of age and older, read English, had resided in southern Ontario for at least one year at the start of the study, and resided in either rural or urban southern Ontario.

Sample Size

We calculated the sample size for the conduct of the multiple components of the questionnaire, as opposed to basing the calculation of sample size on a specific hypothesis, to determine a study sample of sufficient power to detect a difference in dog-owning and dog-free households in rural and urban communities in southern Ontario. We utilized the most recent data available for the geographical location of interest which estimated urban household dog ownership at approximately 50% (Perrin, 2009; Stull et al., 2012). We assumed a slightly higher proportion of dog ownership in rural communities (60%) and estimated the study sample size using a confidence of 95% and power of 80%. We calculated 408 individuals per household type

(dog owning versus not) for a total of 816 individuals from each of the rural and urban communities, respectively. Place of residence (i.e., rural or urban) was determined by two

164

questions at the beginning of the questionnaire. A single adult respondent answered questions on behalf of their household, and household level sampling was without replacement.

Statistical Methods

Data were analyzed using STATA Intercooled 15 (StataCorp. 2017. Stata Statistical

Software: Release 15. College Station, TX: StataCorp LLC). Descriptive statistics were performed for all variables. We excluded missing information and “I prefer not to answer” responses from descriptive statistics and statistical analyses.

Descriptive Statistics:

Respondent Demographics

For this study, rural and urban populations were defined using the Population Centre and

Rural Area Classifications, 2011 (Statistics Canada 2011). That is, population centres (i.e., urban areas) comprised at least 1,000 inhabitants with a population density of at least 400 individuals per square kilometer. Anything outside of this was defined as rural (Statistics Canada 2011).

Other respondent demographic information collected included gender, age, highest level of education, dog ownership, whether or not the respondent lived on an active farm (that is, a farm, ranch or other agricultural operation that produced at least one of the following products intended for sale: livestock, poultry, animal products), and whether the respondent, or any household members, owned any pets other than dogs where they lived.

Respondent Awareness, Knowledge, and Levels of Concern Regarding Canine Zoonoses

For the purposes of this study, awareness was used to refer to those respondents having generalized knowledge about the existence of canine zoonoses. Knowledge of canine zoonoses was based on an assessment of the ability of respondents to correctly identify known canine

165

zoonotic pathogens or diseases (Trevethan, 2017). Awareness of canine zoonoses was assessed by asking whether respondents were aware of any diseases that humans could get from dogs

(Trevethan, 2017). Respondents could indicate “yes,” “no,” “unsure,” or that they “preferred not to answer” this question. For statistical analyses, we dichotomized this variable into “aware of canine zoonoses” (yes / no); “unsure” and “I prefer not to answer” responses were excluded. In addition, all respondents were asked to indicate their general concern about canine zoonoses using a five-point Likert Scale. To assess knowledge of canine zoonoses, we presented respondents with a list of zoonotic pathogens and other disease conditions, and where possible, their common names including: adrenal insufficiency (Addison’s disease), hyperadrenocorticism

(Cushing’s disease), canine distemper virus (hard pad disease), Echinococcus multilocularis

(alveolar hydatid disease), giardiasis (beaver fever), dirofilariasis (heartworm), canine infectious tracheobronchitis (kennel cough), leishmaniasis (dumdum fever), Borrelia burgdorferi (Lyme disease), rabies (hydrophobia), salmonellosis, and toxoplasmosis, and asked them to indicate which of those they believed was a disease of dogs that could cause disease in humans. This list of infectious pathogens and diseases was developed based on their inclusion in previous studies,

(Leonard et al., 2011; Stull et al., 2013; Stull et al., 2012), as well as our intent to present respondents with zoonotic and non-zoonotic pathogens, and vectorborne pathogens (some of which are zoonotic i.e., leishmaniasis and some of which are not i.e., Borrelia burgdorferi (Lyme disease)), which they may have heard of, or encountered, through veterinary and/or human medical appointments. Furthermore, using a pre-specified list of options, all respondents were asked to indicate ways they could control or prevent diseases that humans could get from dogs, and the resources they would choose to use in order to learn more about these types of diseases.

166

For dog-owning respondents only, we inquired whether they used a veterinarian and if so, whether their veterinarian had ever provided them with any information about canine zoonoses.

Finally, we asked whether any of their dogs had been previously diagnosed, by a veterinarian, as having a canine zoonosis.

Possible Pathways of Exposure to Canine Zoonoses

We assessed possible pathways of respondent exposure to canine zoonoses by asking each respondent, regardless of dog-owning status, if they came into contact with dogs outside of their households, how often, and where contact occurred. For this last question, respondents were able to choose as many places as applied from a pre-specified list. For the purposes of this survey, “contact” with a dog was defined as a dog that was close enough to touch. For dog- owning respondents only, direct and indirect owned dog contact was assessed in two ways: First, we asked dog-owning respondents whether any of their dogs had been in areas where they could come into direct contact with wildlife. Then, dog-owning respondents were asked to indicate, from a pre-specified list of eight wildlife including racoons, foxes, skunks, bats, mice, coyotes, voles, and rats, which animals their dogs could come into direct contact with and which their dogs hunted. If wildlife their dogs frequently came into contact with was not listed, respondents had the option of choosing “other”. For this questionnaire “hunt” was defined to mean wildlife that their dog had chased and killed for any reason. This list was generated from studies indicating wildlife as either reservoirs of, or intermediate hosts of, canine zoonoses in Canada or the province of Ontario including rabies, Echinococcus multilocularis, and leptospirosis

(Combes et al., 2012; Gesy, Hill, Schwantje, Liccioli, & Jenkins, 2013; Jardine, Campbell,

Nemeth, Ojkic, & Oesterle, 2017; Liccioli et al., 2013; Lindsay, Ojkic, Jardine, Nicholson, &

167

Prescott, 2010; MacInnes et al., 2001; Moynihan, 1966; Prescott, 2008; Sobey et al., 2013;

Stevenson, Goltz, & Massé, 2018; Stull, Brophy, & Weese, 2015). Finally, regarding indirect contact, we asked dog-owning respondents whether their dogs came into contact with the feces of other dogs or wildlife.

Associations:

We performed logistic regression analyses to calculate odds ratios (OR) and 95% confidence intervals (95% CI) to determine whether respondent awareness of canine zoonoses

(yes / no) differed by residential location (rural / urban) in southern Ontario. The analyses included the potential confounders of respondent’s age and gender as forced variables and was conducted for three populations: (1) all respondents, (2) dog-owning respondents, and (3) dog- owning respondents who used a veterinarian. We assessed model fit using the Hosmer and

Lemeshow goodness-of-fit test (Hosmer and Lemeshow 1980).

RESULTS

Descriptive Statistics:

Respondent Demographics

Overall, 2,006 respondents participated in the questionnaire (n=1,002 (49.95%) rural and n=1,004 (50.05%) urban). The majority of respondents were female (n=1,017; 50.70%), between the ages of 55 – 56 years (n=514; 25.62%), held a university degree, certificate, or diploma

(n=749; 37.34%), and did not own dogs (n=1,025; 51.25%) (Table 6.1).

Respondent Awareness, Knowledge, and Levels of Concern Regarding Canine Zoonoses

More than half of all respondents (n=1,121; 55.88%) were aware of diseases that humans could get from dogs (Table 6.2); however, nearly a quarter (n=445; 22.18%) were unsure. The

168

majority of respondents who indicated they were aware of diseases of dogs that humans could get, indicated some general level of concern regarding canine zoonoses (n=978; 87.24%).

However, some, (n=280; 64.97%), respondents who indicated they were not aware of diseases of dogs that humans could get, responded that they had some general level of concern regarding such diseases. Of the eight pathogens and other disease conditions listed, the majority of respondents were “unsure” whether the pathogen or disease was zoonotic (Table 6.2). Of the respondents who indicated they were aware of diseases of dogs that humans could get, n=931;

83.05% indicated that they thought rabies was a canine zoonoses. However, there were some who were unsure (n=156; 13.92%) and some who did not think that rabies could cause disease in humans (n=28; 2.50%). Regarding the control and prevention of canine zoonoses, many respondents indicated they were unsure of the ways to do so (n=1950; 97.21%). However, many respondents who indicated they were unsure, also selected other answer options (e.g., bathing dogs on a regular basis (n=1699; 84.70%) and using flea preventives (n=1625; 81.01%) (Table

6.2). Of 913 dog-owning respondents who used a veterinarian, n=657; 71.96% indicated a willingness to learn about canine zoonoses from their veterinarian. Of dog-owning respondents who used a veterinarian, only 30.23% (n=276) indicated that a veterinarian had previously provided them with information about diseases of dogs that humans could get. The majority

(69.55%) indicated that they had never, or were unsure as whether they had ever, received such information (Table 6.2). Of all respondents, (n=513; 25.57%) indicated a willingness to learn about canine zoonoses from their family physician. Of all respondents the majority, n=1298;

64.71%, chose the internet to learn more about canine zoonoses.

Possible Pathways of Exposure to Canine Zoonoses

169

Many respondents came into contact with dogs outside of their households with n=570;

29.20%, indicating they did so less than once per week (Table 6.3). Most respondents encountered dogs outside of their households that belonged to their friends and family (n=1382;

73.98%) (Table 6.3). Of dog-owning respondents, 53.03% (n=517) indicated their dogs had been in areas where they could come into direct contact with wildlife (Table 6.3). Respondents reported their dogs could most frequently come into contact with racoons (n=542 (79.12)), closely followed by skunks (n=536; 78.25) and mice (n=521; 76.06%) (Table 6.3). Many respondents indicated their dogs had hunted other wildlife (n=41; 22.65%) and mice (n=85;

16.31%). Finally, regarding indirect contact, 49.33% (n=481) of dog-owning respondents reported that dogs came into contact with the feces of other dogs or wildlife (Table 6.3).

Associations:

Logistic regression analysis of the relationship between respondent awareness of canine zoonoses (yes / no) and residential location (rural / urban) in southern Ontario, including the potential confounders of respondent’s age and gender as forced variables are shown in Table 6.4.

There was no significant difference in awareness of canine zoonoses between rural and urban respondents in the total study population (OR=1.17, p=0.21, 95%CI: 0.92-1.49), neither was there a difference in awareness between rural and urban dog-owning respondents (OR=1.13, p=0.50, 95%CI: 0.80-1.60), nor was there a difference in awareness between rural and urban respondents who were dog-owning respondents who used a veterinarian (OR=1.06, p=0.76,

95%CI: 0.74-1.51) (Table 6.4). The p-values for the Hosmer and Lemeshow goodness-of-fit test

(Hosmer and Lemeshow 1980) for the three logistic regression analysis were 0.59, 0.85, and

0.74, respectively (Table 6.4), which indicated that our models fit the data well.

170

DISCUSSION

In this study, we described respondent awareness, knowledge, and levels of concern regarding canine zoonoses, the possible pathways of canine zoonoses through animal contact, and whether awareness of canine zoonoses differed between rural and urban respondents in southern Ontario, Canada. The majority of respondents indicated that they were aware of diseases of dogs that could cause disease in humans. However, when provided with a pre- specified list, a majority of respondents were also unsure about what constituted a canine zoonotic pathogen and/or disease. Surprisingly, there were some respondents who indicated they were not aware of diseases of dogs that humans could get but also indicated some level of general concern regarding canine zoonoses as defined by the researcher. Furthermore, of those respondents who were not aware of canine zoonoses, some indicated they thought rabies was indeed a disease of dogs that could cause disease in humans. These data present some difficulty for discerning explicit respondent awareness of canine zoonoses. Generally, respondents did not come into frequent direct contact with dogs outside of their homes. Owned dog contact with wildlife occurred frequently with racoons, skunks, and mice and the majority of owned dogs do come into contact with the feces of other dogs or wildlife. Finally, respondent awareness of canine zoonoses did not differ by residential location (rural / urban) for any of the three respondent levels assessed.

Currently, Echinococcus multilocularis, giardiasis, leishmaniasis, rabies, salmonellosis, and toxoplasmosis are of varying public health concern, with several of these diseases being reportable in humans and dogs in Canada (Skelding et al. 2014, Evason et al. 2019, James et al.

2019, Kotwa et al. 2019). While these zoonoses are important to the health of dogs and the

171

public, we found considerable variation in respondents’ abilities to correctly identify canine zoonotic agents and diseases from the list provided which, from a public health perspective, could be cause for some concern. There were respondents who seemed well-versed in their knowledge of canine zoonoses, but the majority did not know, or were unsure of specific canine pathogens and diseases that were zoonotic, and/or were zoonotic via a vectorborne route of transmission. A proportion of respondents either did not know or were unsure that rabies was zoonotic. This constitutes a concerning finding, as it highlights the existence of a subset of the public, whether dog-owning or not, who lack the appropriate knowledge of rabies as a serious zoonosis that is almost always fatal (WHO et al. 2015). Leishmaniasis and Echinococcus multilocularis can also cause grave disease in dogs with the potential to cause disease in humans.

The former is a progressive wasting disease of humans and dogs and is often fatal if left untreated (Duprey et al. 2006). While there are few studies documenting its occurrence in dogs in Canada broadly, and in the province of Ontario specifically, sporadic cases of visceral leishmaniasis have been detected in foxhounds and other breeds of dogs in Ontario with no travel history between 2000 and 2003 (Duprey et al. 2006).

Echinococcus multilocularis has been recently described as emergent in southern

Ontario, where it was previously not known to occur (Skelding et al. 2014, Kotwa et al. 2019).

In areas where Echinococcus multilocularis is endemic in wild canids in southern Ontario, there is potential for spill over into owned canid populations, and thus potential risks for human infection with this zoonotic parasite via a canine transmission route (Kotwa et al. 2019). Risks may arise when dogs are allowed to roam freely without supervision, when there is inconsistent deworming of dogs, and when dogs are allowed to consume rodents or wild canid feces (Kotwa

172

et al. 2019). However, only 5.8% of respondents correctly identified leishmaniasis as a zoonotic disease and even fewer (4.4%) had knowledge of Echinococcus multilocularis. This is to be reasonably expected as there is mixed evidence regarding Echinococcus multilocularis as zoonotic via a domestic canine transmission route. Our findings may be beneficial to consider in the implementation of appropriate public health strategies including educational efforts that seek to improve public knowledge of serious diseases of dogs, such as leishmaniasis and

Echinococcus multilocularis, that can be potentially transmitted to humans. While public health efforts based on evidence-based data are crucial, (Brownson et al. 2009), it may also be beneficial to conduct evaluations to assess the value of public health strategies and educational programs to determine improvements, for instance, in public knowledge of these types of canine zoonoses, as a consequence of program implementation (Smith and Ory 2014).

Due to their closely shared environments with humans, pet dogs can expose humans to zoonotic pathogens both directly (e.g., through injury, petting, licking) and indirectly (e.g., via excreta in the environment and contamination of food sources) (Westgarth et al. 2007, Damborg et al. 2016). The high proportion of all respondents reporting contact with dogs outside of their households, owned dog contact with wildlife, and owned dog contact with the feces of other dogs and wildlife, suggest potential direct and indirect risks for the transmission of canine zoonoses. For example, Echinococcus multilocularis is most likely transmitted to dogs when they consume the feces of foxes or coyotes (Kotwa et al. 2019), and in our study potential owned dog contact with coyotes and foxes was frequently reported, at 47.15% and 61.17% respectively.

Echinococcus multilocularis causes alveolar echinococcus (AE) a chronic infection in humans which is fatal, if left untreated (Kotwa et al. 2019). As one of the definitive hosts, domestic dogs

173

can appear otherwise healthy while harbouring adult-stage larvae, and excrete eggs in their feces which, once ingested, can be infective to humans (Kotwa et al. 2019). Public education targeted at the continued importance of removing canine feces from the environment, as well as need to monitor, and if possible, discourage owned canine interaction with feces in the environment, may be beneficial from a public health perspective to reduce potential risks of zoonotic transmission.

The risk of transmission of infective zoonotic pathogens to humans from dogs is not only possible through contact with canine feces, it is exacerbated by the frequent close contact between humans and dogs including sleeping with dogs, kissing and allowing dogs to lick faces, or sharing a bed with dogs (Chomel and Sun 2011, Stull et al. 2012). Indeed, among dog-owners in the United States, 56% reported sleeping with their dogs in their beds (Chomel and Sun 2011).

The transmission of canine zoonoses to humans resulting from humans sleeping with their pets is uncommon (Chomel and Sun 2011). Yet, previous studies have also demonstrated that pet owners, including dog owners, are at an increased risk of encountering ticks, and possibly developing tickborne zoonoses, as a consequence of having dogs in their households

(Rabinowitz et al. 2007, Jones et al. 2018). Furthermore, while some vectorborne diseases in dogs are not zoonotic, dogs can serve as sentinels warning of vectors and endemic conditions suitable for vectorborne disease risk in humans (e.g., Lyme disease) (Rabinowitz et al. 2007).

Thus, dog owners, should be made aware of potential risks through their closely shared environments with dogs, and consult their veterinarians, physicians, and where appropriate, public health personnel for control and prevention strategies for canine zoonoses (Chomel and

Sun 2011, Stull et al. 2015, Jones et al. 2018).

174

Veterinarians constitute important resources for risk reduction (Stull et al., 2015). In our study, most dog owners indicated they would use their veterinarian as a resource of canine zoonotic information; however, it is interesting that just under thirty percent of dog owners would not choose to use their veterinarian to acquire this information. Overall, most respondents indicated that if they wanted to learn more about diseases of dogs that could cause disease in humans, they would most frequently choose the internet. From the findings of two previous studies, veterinarians were considered the most important source of information regarding canine zoonoses (Bingham et al., 2010a; Stull et al., 2012). From our study, we cannot comment on the preference or importance of veterinarians to respondents, as neither of these descriptors was specifically assessed; however, our data highlight two important opportunities. The first is that there is a need for veterinarians to more frequently engage with clients by initiating collaborative discussion about canine zoonoses during routine consultations in a way that is easily understood by clients (Cornell and Kopcha 2007, Coe et al. 2008). There are plausible reasons why veterinarians may not be adequately communicating information regarding canine zoonoses to clients, including: (1) schedules that do not allow the time within which veterinarians may engage with clients effectively about canine zoonotic disease, (2) the assumption by veterinarians that clients already have access to credible information or know enough about canine zoonoses, (3) the belief that common canine zoonoses encountered in Ontario do not pose a significant threat to dog owners, and/or (4) the potential that the importance on the communication of canine zoonoses is not emphasized effectively enough in the veterinary school curriculum (Bingham et al. 2010). Some methods for client engagement and knowledge translation might include providing simple and clear information about primary canine zoonoses

175

in southern Ontario in client “goodie bags” and/or clearly displaying relevant information in clinic waiting rooms (Bingham et al., 2010; Stull et al., 2012). The second is the opportunity for veterinarians to highlight to clients the importance of publicly available, credible information.

An example of such a public resource of information is the Worms and Germs Blog

(https://www.wormsandgermsblog.com/).

We found was no significant difference in awareness between rural and urban respondents. Thus, public health strategies surrounding public education of canine zoonoses may be useful for rural and urban communities in southern Ontario alike. As canine zoonoses are diseases of dogs that can infect humans, it may also be beneficial for veterinarians, physicians, and public health professionals to collaborate, under the philosophy of One Health (Zinsstag et al. 2011), to develop public health education programs aimed at controlling and preventing canine zoonoses in southern Ontario.

LIMITATIONS

There are some limitations in our study. Given the source population from which the study sample was drawn, as opposed to randomly selecting individuals from the general public, there may be selection bias relating to participant recruitment. Our study, therefore, assumed that the rural and urban participants are representative of the rural and urban general population in southern Ontario, Canada. As data were gathered through the use of an online questionnaire, respondents needed to have access to a computer and the internet, were not able to ask for clarification of any questions, and they could have used the internet to access information about pathogens and/or diseases unfamiliar to them as a resource in answering survey questions. The effects of selection and response bias on the results of this study are unknown. Additionally,

176

there is a possibility that limits of recall affected the way in which respondents answered questions. For example, respondents were asked to report whether their veterinarian had ever provided any information about diseases of dogs that can cause disease in humans, which depending on how recent such information exchange occurred, could either be recalled accurately by the respondent, or not. Furthermore, the way in which some respondents answered questions indicates bias in the way certain questions were designed. Despite pilot testing prior to the final launch of the questionnaire, such bias in question design could have been due to ambiguous questions or vague wording. For instance, ambiguous questions could have led respondents to understand the question in a different manner than was intended and subsequently, to answer a different question than was intended. Finally, our data may reflect social desirability bias in that some respondents may have chosen to answer questions in a manner in which they felt others would favour.

CONCLUSION

This study described public knowledge and awareness of canine zoonoses, possible pathways of canine zoonoses through animal contact, and whether there were differences in the awareness of canine zoonoses in rural and urban communities. While the majority of respondents were aware of diseases of dogs that humans could get, many were not able to correctly identify specific and important canine zoonoses. Additionally, some respondents were unsure about some of the ways they could control or prevent the transmission of canine zoonoses. Our findings also highlight the potential opportunity to improve veterinary engagement with clients in the discussion of canine zoonoses as well as the importance of knowledge translation of such information.

177

REFERENCES Alton, G. D., Berke, O., Reid-Smith, R., Ojkic, D., & Prescott, J. F. (2009). Increase in seroprevalence of canine leptospirosis and its risk factors, Ontario 1998-2006. Canadian Journal of Veterinary Research, 73(3), 167–175. Belay, E. D., Kile, J. C., Hall, A. J., Barton-Behravesh, C., Parsons, M. B., Salyer, S., & Walke, H. (2017). Zoonotic disease programs for enhancing global health security. Emerging Infectious Diseases, 23(13), S65–S70. https://doi.org/10.3201/eid2313.170544 Bingham, G. M., Budke, C. M., & Slater, M. R. (2010). Knowledge and perceptions of dog- associated zoonoses: Brazos County, Texas, USA. Preventive Veterinary Medicine, 93(2– 3), 211–221. https://doi.org/10.1016/j.prevetmed.2009.09.019 Blaisdell, J. D. (1999). The rise of man’s best friend: The popularity of dogs as companion animals in late eighteenth century London as reflected by the dog tax of 1796. Anthrozoös, 12(2), 76–87. https://doi.org/10.2752/089279399787000363 Bouchard, C., Leonard, E., Koffi, J. K., Pelcat, Y., Peregrine, A., Chilton, N., Rochon, K., Lysyk, T., Lindsay, L. R., & Ogden, N. H. (2015). Special report: The increasing risk of Lyme disease in Canada. Canadian Veterinary Journal, 56(7), 693–699. Bowser, N., & Anderson, N. (2018). Dogs (Canis familiaris) as sentinels for human infectious disease and application to Canadian populations: A Systematic Review. Veterinary Sciences, 5(4), 83. https://doi.org/10.3390/vetsci5040083 Brownson, R. C., Fielding, J. E., & Maylahn, C. M. (2009). Evidence-based public health: A fundamental concept for public health practice. Annual Review of Public Health, 30(1), 175–201. https://doi.org/10.1146/annurev.publhealth.031308.100134 Canadian Animal Health Institute. (2017). Latest Canadian Pet Population Figures Released. https://www.canadianveterinarians.net/documents/canadian-pet-population-figures-cahi- 2017 Chomel, B. B., & Sun, B. (2011). Zoonoses in the bedroom. Emerging Infectious Diseases, 17(2), 167–172. https://doi.org/10.3201/eid1702.101070 Coe, J. B., Adams, C. L., & Bonnett, B. N. (2008). A focus group study of veterinarians’ and pet owners’ perceptions of veterinarian-client communication in companion animal practice. Journal, 233(7). Combes, B., Comte, S., Raton, V., Raoul, F., Boué, F., Umhang, G., & Favier, S. (2012). Echinococcus multilocularis in urban coyotes, Alberta, Canada. Emerging Infectious Diseases, 18(10), 2059–2063. Cornell, K. K., & Kopcha, M. (2007). Client-veterinarian communication: Skills for client centered dialogue and shared decision making. Veterinary Clinics of North America: Small Animal Practice, 37(1), 37–47. https://doi.org/10.1016/j.cvsm.2006.10.005 Cripps, P. J. (2000). Veterinary education, zoonoses and public health: A personal perspective. Acta Tropica, 76(1), 77–80. https://doi.org/10.1016/S0001-706X(00)00094-2 Damborg, P., Broens, E. M., Chomel, B. B., Guenther, S., & Pasmans, F. (2016). Bacterial zoonoses transmitted by household pets : State-of-the-art and future perspectives for targeted research and policy actions. Journal of Comparative Pathology, 155(1), S27–S40. https://doi.org/10.1016/j.jcpa.2015.03.004 Davis, B. W., Alie, K., Fielding, W. J., Morters, M., & Galindo, F. (2007). Preliminary observations on the characteristics of the owned dog population in Roseau, Dominica. 178

Journal of Applied Animal Welfare Science, 10(2), 141–151. https://doi.org/10.1080/10888700701313520 Downes, M., Canty, M. J., & More, S. J. (2009). Demography of the pet dog and cat population on the island of Ireland and human factors influencing pet ownership. 92, 140–149. https://doi.org/10.1016/j.prevetmed.2009.07.005 Duprey, Z. H., Steurer, F. J., Rooney, J. A., Kirchhoff, L. V., Jackson, J. E., Rowton, E. D., & Schantz, P. M. (2006). Canine visceral leishmaniasis, United States and Canada, 2000-2003. Emerging Infectious Diseases, 12(3), 440–446. https://doi.org/10.3201/eid1203.050811 Evason, M., Stull, J. W., Pearl, D. L., Peregrine, A. S., Jardine, C., Buch, J. S., Lailer, Z., O’Connor, T., Chandrashekar, R., & Weese, J. S. (2019). Prevalence of Borrelia burgdorferi, Anaplasma spp., Ehrlichia spp. and Dirofilaria immitis in Canadian dogs, 2008 to 2015: A repeat cross-sectional study. Parasites and Vectors, 12(1), 1–11. https://doi.org/10.1186/s13071-019-3299-9 Fielding, W. J., Gall, M., Green, D., & Eller, W. S. (2012). Care of dogs and attitudes of dog owners in Port-au-Prince, the Republic of Haiti. Journal of Applied Animal Welfare Science, 15(3), 236–253. https://doi.org/10.1080/10888705.2012.683760 Gesy, K., Hill, J. E., Schwantje, H., Liccioli, S., & Jenkins, E. J. (2013). Establishment of a European-type strain of Echinococcus multilocularis in Canadian wildlife. Parasitology, 140(9), 1133–1137. https://doi.org/10.1017/S0031182013000607 Ghasemzadeh, I., & Namazi, S. H. (2015). Review of bacterial and viral zoonotic infections transmitted by dogs. Journal of Medicine and Life, 8(4), 1–5. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5319273/pdf/SIJMedLife-08-04-01.pdf Herzog, H. (2011). The impact of pets on human health and psychological well-being : fact, fiction, or hypothesis? Current Directions in Psychological Science, 20(4), 236–239. https://doi.org/https://doi.org/10.1177/0963721411415220 Hodgson, K., & Darling, M. (2011). Zooeyia: an essential component of “One Health.” The Canadian Veterinary Journal, 52(2), 189–191. Horn, M., Ewen, G., & Wise, S. F. (2019). Ontario. Encyclopædia Britannica, Inc. https://www.britannica.com/place/Ontario-province Hosmer, D. W., & Lemeshow, S. (1980). Goodness of fit tests for the multiple logistic regression model. Communications in Statistics - Theory and Methods, 9(10), 1043–1069. https://doi.org/10.1080/03610928008827941 James, C. A., Pearl, D. L., Lindsay, L. R., Peregrine, A. S., & Jardine, C. M. (2019). Risk factors associated with the carriage of Ixodes scapularis relative to other tick species in a population of pet dogs from southeastern Ontario, Canada. Ticks and Tick-Borne Diseases, 10(2), 290–298. https://doi.org/10.1016/j.ttbdis.2018.10.004 Jardine, C. M., Campbell, G. D., Nemeth, N. M., Ojkic, D., & Oesterle, P. T. (2017). Comparison of reverse-transcription real-time PCR and immunohistochemistry for the detection of canine distemper virus infection in raccoons in Ontario, Canada. Journal of Veterinary Diagnostic Investigation, 30(2), 319–323. https://doi.org/10.1177/1040638717751825 Jones, E. H., Hinckley, A. F., Hook, S. A., Meek, J. I., Backenson, B., Kugeler, K. J., & Feldman, K. A. (2018). Pet ownership increases human risk of encountering ticks. Zoonoses and Public Health, 65(1), 74–79. https://doi.org/10.1111/zph.12369

179

Kiflu, B., Abdurahaman, M., Alemayehu, H., & Eguale, T. (2016). Investigation on public knowledge , attitude and practices related to pet management and zoonotic canine diseases in Addis Ababa , Ethiopia. Ethiopian Veterinary Journal, 20(1), 67–78. https://doi.org/http://dx.doi.org/10.4314/evj.v20i1.5 Knobel, D. L., Laurenson, M. K., Kazwala, R. R., Boden, L. A., & Cleaveland, S. (2008). A cross-sectional study of factors associated with dog ownership in Tanzania. BMC Veterinary Research, 4(1), 5. Kotwa, J. D., Isaksson, M., Jardine, C. M., Campbell, G. D., Berke, O., Pearl, D. L., Mercer, N. J., Osterman-Lind, E., & Peregrine, A. S. (2019). Echinococcus multilocularis infection, southern Ontario, Canada. Emerging Infectious Diseases, 25(2), 265–272. https://doi.org/10.3201/eid2502.180299 Lefebvre, S. L., Waltner-Toews, D., Peregrine, A. S., Reid-Smith, R., Hodge, L., Arroyo, L. G., & Weese, J. S. (2006). Prevalence of zoonotic agents in dogs visiting hospitalized people in Ontario: Implications for infection control. Journal of Hospital Infection, 62(4), 458–466. https://doi.org/10.1016/j.jhin.2005.09.025 Leonard, E. K., Pearl, D. L., Finley, R. L., Janecko, N., Peregrine, A. S., Reid-Smith, R. J., & Weese, J. S. (2011). Evaluation of pet-related management factors and the risk of Salmonella spp. carriage in pet dogs from volunteer households in Ontario (2005-2006). Zoonoses and Public Health, 58(2), 140–149. https://doi.org/10.1111/j.1863- 2378.2009.01320.x Leslie, B. E., Meek, A. H., Kawash, G. F., & McKeown, D. B. (1994). An epidemiological investigation of pet ownership in Ontario. The Canadian Veterinary Journal, 35(4), 218– 222. Liccioli, S., Duignan, P. J., Lejeune, M., Deunk, J., Majid, S., & Massolo, A. (2013). A new intermediate host for Echinococcus multilocularis: The southern red-backed vole (Myodes gapperi) in urban landscape in Calgary, Canada. Parasitology International, 62(4), 355– 357. https://doi.org/10.1016/j.parint.2013.03.007 Lindsay, L. R., Ojkic, D., Jardine, C., Nicholson, V. M., & Prescott, J. F. (2010). Longitudinal study on the seroprevalence of avian influenza, leptospirosis, and tularemia in an urban population of raccoons (Procyon lotor) in Ontario, Canada. Vector-Borne and Zoonotic Diseases, 11(1), 37–42. https://doi.org/10.1089/vbz.2009.0209 MacInnes, C. D., Smith, S. M., Tinline, R. R., Ayers, N. R., Bachmann, P., Ball, D. G. A., Calder, L. A., Crosgrey, S. J., Fielding, C., Hauschildt, P., Honig, J. M., Johnston, D. H., Lawson, K. F., Nunan, C. P., Pedde, M. A., Pond, B., Stewart, R. B., & Voigt, D. R. (2001). Elimination of rabies from red foxes in eastern Ontario. Journal of Wildlife Diseases, 37(1), 119–132. https://doi.org/10.7589/0090-3558-37.1.119 Mercer, N. J., Gottstein, B., Peregrine, A. S., Walters, J. M., Boggild, A. K., Wallace, D., Trotz- Williams, L. A., & Osterman-Lind, E. (2016). Public Health follow-up of suspected exposure to Echinococcus multilocularis in Southwestern Ontario. Zoonoses and Public Health, 64(6), 460–467. https://doi.org/10.1111/zph.12326 Meyer, I., & Forkman, B. (2014). Dog and owner characteristics affecting the dog-owner relationship. Journal of Veterinary Behavior: Clinical Applications and Research, 9(4), 143–150. https://doi.org/10.1016/j.jveb.2014.03.002 Morshed, M. G., Scott, J. D., Fernando, K., Geddes, G., McNabb, A., Mak, S., & Durden, L. A.

180

(2006). Distribution and characterization of Borrelia burgdorferi isolates from Ixodes scapularis and presence in mammalian hosts in Ontario, Canada. Journal of Medical Entomology, 43(4), 762–773. https://doi.org/10.1603/0022- 2585(2006)43[762:DACOBB]2.0.CO;2 Moynihan, W. A. (1966). Rabies in Ontario. Canadian Journal of Public Health, 57(6), 243– 248. https://doi.org/10.4135/9781446215159.n120 Narrod, C., Zinsstag, J., & Tiongco, M. (2012). One health framework for estimating the economic costs of zoonotic diseases on society. EcoHealth, 9(2), 150–162. https://doi.org/10.1007/s10393-012-0747-9 Ng, V., & Sargeant, J. M. (2012). A stakeholder-informed approach to the identification of criteria for the prioritization of zoonoses in Canada. PLoS ONE, 7(1). https://doi.org/10.1371/journal.pone.0029752 Ng, V., & Sargeant, J. M. (2013). A quantitative approach to the prioritization of zoonotic diseases in North America: A health professionals’ perspective. PLoS ONE, 8(8). https://doi.org/10.1371/journal.pone.0072172 Ogden, N. H., Bouchard, C., Badcock, J., Drebot, M. A., Elias, S. P., Hatchette, T. F., Koffi, J. K., Leighton, P. A., Lindsay, L. R., Lubelczyk, C. B., Peregrine, A. S., Smith, R. P., & Webster, D. (2019). What is the real number of Lyme disease cases in Canada? BMC Public Health, 19(1), 1–12. https://doi.org/10.1186/s12889-019-7219-x Olmert, M. (2009). Made for each other: The biology of the Human-Animal Bond. Da Capo Press. Perrin, T. (2009). The business of urban animals survey: The facts and statistics on companion animals in Canada. Canadian Veterinary Journal, 50(1), 48–52. Prescott, J. (2008). Canine leptospirosis in Canada: A veterinarian’s perspective. Cmaj, 178(4), 397–398. https://doi.org/10.1503/cmaj.071092 Rabinowitz, P. M., Gordon, Z., & OdoFin, L. (2007). Pet-related infections. American Family Physician, 76(9). Saunders, J., Parast, L., Babey, S. H., & Miles, J. V. (2017). Exploring the differences between pet and non-pet owners: Implications for human-animal interaction research and policy. PLoS ONE, 12(6), 1–15. https://doi.org/10.1371/journal.pone.0179494 Skelding, A., Brooks, A., Stalker, M., Mercer, N., De Villa, E., Gottstein, B., & Peregrine, A. S. (2014). Hepatic alveolar hydatid disease (Echinococcus multilocularis) in a boxer dog from southern Ontario. Canadian Veterinary Journal, 55(6), 551–553. Smith, M. L., & Ory, M. G. (2014). Measuring success: evaluation article types for the Public Health Education and Promotion Section of Frontiers in Public Health. Frontiers in Public Health, 2(111). Snedeker, K. G., Anderson, M. E. C., Sargeant, J. M., & Weese, J. S. (2013). A Survey of Canadian Public Health Personnel Regarding Knowledge, Practice and Education of Zoonotic Diseases. Zoonoses and Public Health, 60(7), 519–525. https://doi.org/10.1111/zph.12029 Sobey, K., Silver, A., Beresford, A., Bruce, L., Brown, L., Beath, A., Allan, M., Fehlner- Gardiner, C., Bachmann, P., Buchanan, T., Stevenson, B., Gibson, M., Donovan, D., Rosatte, R. C., Davies, J. C., Lawson, K., & Bennett, K. (2013). Aerial distribution of Onrab ® baits as a tactic to control rabies in raccoons and striped skunks in Ontario,

181

Canada. Journal of Wildlife Diseases, 45(2), 363–374. https://doi.org/10.7589/0090-3558- 45.2.363 StataCorp. 2017. Stata Statistical Software: Release 15. College Station, T. S. L. (n.d.). Stata Statistical Software: Release 15 College Station, TX: StataCorp LLC. 2017. Retrieved November 15, 2017, from https://www.stata.com/ Statistics Canada. (2011). Population centre (POPCTR). https://www12.statcan.gc.ca/census- recensement/2011/ref/dict/geo049a-eng.cfm Statistics Canada. (2017). Ontario [Province] and Canada [Country] (table). Census Profile. 2016 Census. Statistics Canada Catalogue no. 98-316-X2016001. Ottawa. Released November 29, 2017. https://www12.statcan.gc.ca/census-recensement/2016/dp- pd/prof/index.cfm?Lang=E Stevenson, B., Goltz, J., & Massé, A. (2018). Preparing for and responding to recent incursions of racoon rabies variant into Canada. Canada Communicable Disease Report, 42(6), 125– 129. https://doi.org/10.14745/ccdr.v42i06a03 Stull, J. W., Brophy, J., & Weese, J. S. (2015). Reducing the risk of pet-associated zoonotic infections. Canadian Medical Association Journal, 187(10), 736–743. https://doi.org/10.1503/cmaj.150274 Stull, J. W., Peregrine, A. S., Sargeant, J. M., & Weese, J. S. (2012). Household knowledge, attitudes and practices related to pet contact and associated zoonoses in Ontario, Canada. BMC Public Health, 12(1), 553. https://doi.org/10.1186/1471-2458-12-553 Stull, J. W., Peregrine, A. S., Sargeant, J. M., & Weese, J. S. (2013). Pet husbandry and infection control practices related to zoonotic disease risks in Ontario, Canada. BMC Public Health, 13(1), 520. https://doi.org/10.1186/1471-2458-13-520 Taylor, L. H., Latham, S. M., & Woolhouse, M. E. J. (2001). Risk factors for human disease emergence. Philosophical Transactions of the Royal Society B: Biological Sciences, 356(1411), 983–989. https://doi.org/10.1098/rstb.2001.0888 Trevethan, R. (2017). Deconstructing and Assessing Knowledge and Awareness in Public Health Research. Frontiers in Public Health, 5(August), 16–19. https://doi.org/10.3389/fpubh.2017.00194 Westgarth, C., Pinchbeck, G. L., Bradshaw, J. W. S., Dawson, S., Gaskell, R. M., & Christley, R. M. (2007). Factors associated with dog ownership and contact with dogs in a UK community. BMC Veterinary Research, 3(1), 5. https://doi.org/10.1186/1746-6148-3-5 Whitfield, Y., Johnson, K., Hobbs, L., Middleton, D., Dhar, B., & Vrbova, L. (2017). Descriptive study of enteric zoonoses in Ontario, Canada, from 2010 - 2012. BMC Public Health, 17(1), 1–7. https://doi.org/10.1186/s12889-017-4135-9 WHO, FAO, & OIE. (2015). Rationale for investing in the global elimination of dog-mediated human rabies. WHO Press 20 Avenue Appia 1211 Geneva 27 Switzerland, 6–11. http://www.oie.int/eng/RABIES2015/img/WHO-OIE-FAO_Rationale_Rabies_2015_2.pdf Wilkin, C. L., Fairlie, P., Ezzedeen, S. R., Wilkin, C. L., Fairlie, P., & Ezzedeen, S. R. (2016). Who let the dogs in ? A look at pet-friendly workplaces. International Journal of Workplace Health Management, 9(1), 96–109. https://doi.org/https://doi.org/10.1108/IJWHM-04-2015- 0021 World Health Organization. (2005). The control of neglected zoonotic diseases: A route to poverty alleviation: report of a joint WHO/DFID-AHP meeting, 20 and 21 September 2005

182

(Issue September 2005). www.who.int/zoonoses/Report_Sept06.pdf Zinsstag, J., Schelling, E., Waltner-Toews, D., & Tanner, M. (2011). From “one medicine” to “one health” and systemic approaches to health and well-being. Preventive Veterinary Medicine, 101(3–4), 148–156. https://doi.org/10.1016/j.prevetmed.2010.07.003

Table 6. 1 Descriptive statistics pertaining to respondent characteristics from an online cross- sectional questionnaire conducted in southern Ontario, Canada

Variable Total responses (N)a Frequency (%) Respondent household location 2,006 Rural 1,002 (49.95) Urban 1,004 (50.05)

Respondent gender 2,006 Female 1,017 (50.70) Male 979 (48.80)

Age of respondents 2,006 18 - 24y 121 (6.03) 25 - 34y 293 (14.61) 34 - 44y 279 (13.91) 45 - 54y 399 (19.89) 55 - 64y 514 (25.62) >65y 389 (19.39)

What is your highest level of education? 2,006 Elementary school 35 (1.74) High school diploma, certificate or equivalent 503 (25.07) College, trade or other non-university certificate 676 (33.70) University degree, certificate or diploma 749 (37.34)

Do you or any member of your household currently own a dog(s) or have owned a dog(s) within the last 12 months? 2,000 Yes 975 (48.75) No 1,025 (51.25)

Do you live or have lived on an active farmb within the last 12 months? 1,996 Yes 108 (5.41) No 1,878 (94.09)

Do you or your household members own any pets, other than dog(s), where you live? 1,974 Yes 759 (38.45) No 1,215 (61.55) 183

aTotal number of respondents who answered the question bAn active farm was defined for respondents as a farm, ranch, or other agricultural operation that produces at least one of the following products for sale: livestock, poultry, animal products

Variables Total responses (N) a Frequency (%) All respondents (N=2,006) Are you aware of any diseases that humans can get from dogs? 2,006 Yes 1,121 (55.88) No 431 (21.49) Unsure 445 (22.18)

How concerned are you generally about diseases that humans can get 2,006 from dogs? b Very concerned 141 (7.03) Concerned 229 (11.42) Somewhat concerned 384 (19.14) Minimally concerned 850 (42.37) Not at all concerned 340 (16.95) Unsure 54 (2.69)

For each of the diseases listed, please choose which of the following you believe is a disease of dogs that can cause disease in humans 2,006 Adrenal insufficiency (Addison’s Disease) Yes 114 (5.68) No 348 (17.35) Unsure 1,528 (76.17)

Hyperadrenocorticism (Cushing’s Disease) Yes 107 (5.33) No 347 (17.30) Unsure 1,536 (76.57)

Canine Distemper (Hard Pad Disease) Yes 225 (11.22) No 521 (25.97) Unsure 1,246 (62.11)

Echinococcus Multilocularis (Alveolar Hydatid Disease)c Yes 89 (4.44) No 242 (12.06) 184

Unsure 1,659 (82.70)

Giardiasis (Beaver Fever)c Yes 298 (14.86) No 238 (11.86) Unsure 1,454 (72.48)

Heartworm (Dirofilariasis) Yes 352 (17.55) No 520 (25.92) Unsure 1,116 (55.63)

Canine Infectious Tracheobronchitis (Kennel cough) Yes 242 (12.06) No 594 (29.61) Unsure 1,155 (57.58)

Leishmaniasis (Dumdum fever)c Yes 116 (5.78) No 269 (13.41) Unsure 1,602 (79.86)

Lyme disease (Lyme Arthritis) Yes 743 (37.04) No 297 (14.81) Unsure 949 (47.31)

Rabies (Hydrophobia) c Yes 1,468 (73.18) No 73 (3.64) Unsure 447 (22.28)

Salmonellosis c Yes 483 (24.08) No 185 (9.22) Unsure 1,320 (65.80)

Toxoplasmosis c Yes 328 (16.35) No 187 (9.32) Unsure 1,470 (73.28)

In your opinion, what are some of the ways you can control or prevent diseases that humans can get from dogs? (please choose as many as apply) b 2,006

185

Wash hands thoroughly (with soap and water) after contact with dogs 1,491 (74.33) De-worm dogs 1,598 (76.66) Bathe dogs on a regular basis 1,699 (84.70) Remove dog feces the environment 1,577 (78.61) Use flea preventives 1,625 (81.01) Use tick preventives 1,643 (81.90) Routine veterinary care including vaccination 1,518 (75.67) All of the above 712 (35.49) Unsure 1,950 (97.21)

If you wanted to learn more about diseases that humans can get from dogs, which of the following resources would you choose? (please choose as many as apply) b 2,006 Veterinarian 1,162 (57.93) Family physician 513 (25.57) School or work 39 (1.94) Colleagues or friends 123 (6.13) Public health personnel 409 (20.39) Internet 1298 (64.71) All of the above 338 (16.85) Other resources 18 (0.90) Unsure [which resources they would use] 23 (1.15)

Dog-owning respondents only (N=975) Do you use a veterinarian for your dogs? 975 Yes 913 (93.64) No 38 (3.90)

Has your veterinarian ever provided you with any information about diseases that humans can get from dogs? 913 Yes 276 (30.23) No 450 (49.29) Unsure 185 (20.26)

Have any of the dogs in your household been diagnosed with a disease that humans can also get? 975 Yes 37 (3.79) No 882 (90.46) Unsure 50 (5.13) aTotal number of respondents who answered the question bRespondents were able to choose as many answers as applied cZoonotic pathogen or disease via an indirect or direct transmission route *Classified as a zoonosis. Seroprevalence in dogs is not a direct indication of zoonotic risk to humans but is a measure of entomological risk (i.e., tick-borne infection) (Ogden et al. 2019)

186

Variable Total responses (N) a Frequency (%) All respondents (N=2,006) How often do you come into contact with dogs outside of your household? b 1,952 Less than once per week 570 (29.20) Once a week 349 (17.88) Twice a week 199 (10.19) Three times a week 201 (10.30) Four times a week 143 (7.33) More than five times a week 348 (17.83) No contact with dogs outside household 131 (6.71) Unsure 11 (0.56)

Where do you come into contact with dogs outside of your household? (please choose as many as apply) c 1,868 Through job, school, or volunteer position 162 (8.67) Parks or walking trails 901 (48.23) Dogs of friends and family 1382 (73.98) Stray dogs 73 (3.91) Other 149 (7.98) Unsure 24 (1.28)

Dog-owning respondents (N=975) and number of owned dogs (N=1345) How many dogs live or have lived in your household within the past 12 months? 975 1 691 (70.87) 2 216 (22.15) 3 38 (3.90) 4 15 (1.54) 5 4 (0.41) 6 3 (0.31) 7 0 (0.00) 8 0 (0.00) 9 0 (0.00) 10 or more dogs 1 (0.10) In the last 12 months, has your dog(s) been in areas where wildlife could come into contact d with them? 975 Yes 517 (53.03) No 411 (42.15) Unsure 38 (3.90)

187

If yes (for all the dogs that you listed) please choose the wildlifed that your dog(s) could come into contact with (please choose as many as apply) c 685 Racoons 542 (79.12) Foxes 419 (61.17) Skunks 536 (78.25) Bats 312 (45.55) Mice 521 (76.06) Coyotes 323 (47.15) Voles 240 (35.04) Rats 210 (30.66) Other wildlife 181 (26.42) Unsure 33 (4.82)

Does your dog hunt e this wildlife? Racoons 542 Yes 34 (6.27) No 477 (88.01) Unsure 30 (5.54)

Foxes 419 Yes 14 (3.34) No 379 (90.45) Unsure 25 (5.97)

Skunks 536 Yes 36 (6.72) No 477 (88.99) Unsure 22 (4.10)

Bats 312 Yes 5 (1.60) No 291 (93.27) Unsure 16 (5.13)

Mice 521 Yes 85 (16.31) No 401 (76.97) Unsure 34 (6.53)

Coyotes 323 Yes 7 (2.17) No 303 (93.81) Unsure 12 (3.72

188

Voles 240 Yes 38 (15.83) No 177 (73.75) Unsure 24 (10.00)

Rats 210 Yes 24 (11.43) No 163 (77.62) Unsure 23 (10.95)

Other wildlife 181 Yes 41 (22.65) No 132 (72.93) Unsure 6 (3.31)

Does your dog(s) come into contact f with the stool (feces) of other dogs or wildlife? 975 Yes 481 (49.33) No 324 (33.23) Unsure 161 (16.51) aTotal number of respondents who answered the question b “Contact with dogs outside of the household” was defined as the respondent being close enough to touch dog outside of their home with which they were unfamiliar c Respondents were able to choose as many answers as applied d “Contact with wildlife” was defined as wildlife that was or had been close enough for the respondent’s dog to touch e “hunt” was defined as wildlife that the respondents’ dog had chased and or killed for fun and or to eat f “Contact with feces” was defined for respondents to mean feces (stool) that was close enough for their dog to touch

189

Table 6. 4 Logistic regression analyses to determine whether awareness of canine zoonoses differed between rural and urban respondents in southern Ontario at three levels: 1) for all respondents, 2) dog-owning respondents, and 3) dog-owning respondents who used a veterinarian. Potential confounders were forced into each model. Data were collected from an online cross- sectional questionnaire conducted in southern Ontario, Canada

Hosmer- Variable β SE Pa OR (eβ) 95% CI Lemeshow Goodness-of-fit Model 1: All respondents (N=1,554) Residential location p=0.59 Urban Ref. Rural 0.16 0.12 0.21 1.17 0.92 – 1.49 Respondent age 18 – 24 years Ref. 25 – 34 years -0.35 0.26 0.18 0.70 0.41 – 1.18 35 – 44 years -0.29 0.27 0.30 0.75 0.44 – 1.26 45 – 54 years 0.01 0.27 0.96 1.01 0.60 – 1.70 55 – 64 years -0.07 0.26 0.78 0.93 0.56 – 1.55 65 and older -0.22 0.27 0.42 0.80 0.47 – 1.37 Respondent gender Male Ref. Female -0.06 0.12 0.63 0.95 0.75 – 1.19 Model 2: Dog-owning respondents only (N=771) Residential location p=0.85 Urban Ref. Rural 0.12 0.18 0.50 1.13 0.80 – 1.60 Respondent age 18 – 24 years Ref. 25 – 34 years -0.52 0.34 0.13 0.60 0.31 – 1.16 35 – 44 years -0.38 0.35 0.28 0.69 0.34 – 1.37 45 – 54 years 0.01 0.36 0.97 1.01 0.50 – 2.04 55 – 64 years -0.14 0.35 0.69 0.87 0.44 – 1.72 65 and older -0.33 0.38 0.39 0.72 0.34 – 1.52 Respondent gender Male Ref. Female -0.02 0.17 0.89 0.98 0.71 – 1.35 Model 3: Dog-owning respondents who used a veterinarian (N=740) Residential location p=0.74 Urban Ref. Rural 0.06 0.18 0.76 1.06 0.74 – 1.51 Respondent age 190

18 – 24 years Ref. 25 – 34 years -0.52 0.36 0.15 0.60 0.30 – 1.20 35 – 44 years -0.42 0.37 0.25 0.65 0.32 – 1.35 45 – 54 years 0.15 0.37 0.68 0.86 0.42 – 1.78 55 – 64 years -0.19 0.36 0.60 0.83 0.41 – 1.68 65 and older -0.38 0.40 0.34 0.68 0.31 – 1.49 Respondent gender Male Ref. Female -0.08 0.17 0.65 0.93 0.66 – 1.29

191

CHAPTER 7

WHO LET THE DOGS IN? AN EPIDEMIOLOGICAL STUDY QUANTIFYING DOMESTICALLY SOURCED AND IMPORTED DOGS IN SOUTHERN ONTARIO, CANADA

192

ABSTRACT

Dogs are reservoirs for many zoonoses. In southern Ontario, Canada, minimal data exist on the sources from which domestic dogs are acquired (i.e., domestic or imported). The objectives of this study were to (1) describe the proportions of domestically sourced and imported dogs in southern Ontario, Canada, (2) describe the characteristics of newly acquired dogs including their province/country of origin, accompanying health documentation, and respondent opinion regarding disease risks from different sources, and (3) determine whether a difference in the proportion of imported dogs exists between rural and urban households in southern Ontario, Canada. We conducted a cross-sectional observational study using an online questionnaire. A total of 2,006 respondents (1,002 rural and 1,004 urban), each representing one household, participated. Over the previous seven-year period, 731 (36.44%) respondents domestically sourced at least one dog, with 684 providing information regarding 962 dogs.

Domestically sourced dogs were frequently puppies three to five months old (25.05%), male

(51.87%), found via a breeder (30.98%), and sourced from within Ontario (92.93%). As self- reported by respondents, 63.52% of domestically sourced dogs greater than three months of age were vaccinated against rabies. Over the same period, individuals from 55 of 2,006 households

(2.74%) imported at least one dog. Imported dogs were frequently under three months of age

(29.09%), male (58.18%), and found via a breeder (32.73%). Most imported dogs originated from the USA (n=29 of 55 (52.73%)). Rabies vaccination in dogs three months and older is provincially required in Ontario and is also required for importation of a dog into Canada; however, some imported dogs over the age of three months were unvaccinated (7.69%).

Accounting for potential confounders, the odds of importing at least one dog in an urban

193

household was 1.93 (95% CI: 1.03-3.63) times that in a rural household. These observations may inform community-specific public health strategies, under the authority of the Canadian Food

Inspection Agency, around canine importation.

IMPACTS

There are unregulated risks pertaining to domestic sourcing and importation of dogs thus

providing potential opportunities for the spread of disease among canine and human

populations.

While many imported dogs over three months of age were vaccinated against rabies as

self-reported by respondents, some were unvaccinated, and in some puppies under three

months were immunized highlighting potentially rabies naive canine populations.

These baseline data may be informative to public health education and mitigation

strategies regarding domestic sourcing and importation of canines while considering the

importance and distinction between rural and urban communities.

INTRODUCTION

There are many reasons why the movement and relocation of dogs exists (Anderson et al.

2019). The relocation of dogs encompasses domestically sourcing dogs from within a country or importing dogs from other countries. In Canada, reasons for domestically sourcing and importing dogs include commercial use for financial gain, scientific research, shows or exhibitions, and special training (Canadian Food Inspection Agency 2018). Additionally, dogs may be imported or relocated by welfare organizations including rescues and shelters, and privately by the public for companionship, or compassionate reasons (Galanis et al. 2019).

194

Over 7 million dogs are owned as pets across Canada (Canadian Animal Health Institute

2017) and evidence suggests dog ownership differs between rural and urban households (Leslie et al. 1994). It is estimated that close to 6,200 dogs were imported into Canada from 29 countries between 2013 and 2014 (Anderson et al., 2016). However, imported dogs may pose risks to human health, local dogs, and other animal populations as reservoirs of pathogens (McQuiston et al. 2008, Davidson and Robertson 2012). Such risks include the potential spread of canine- specific and zoonotic diseases, originating in foreign countries, that may not be endemic or may be rare in Canada. For example, while human exposure to Brucella canis from dogs is rare, canine importation into Canada has recently been linked to the first reported human case of B. canis in British Columbia (Galanis et al. 2019). Echinococcus multilocularis in wild and domestic canid populations in southern Ontario can cause alveolar echinococcosis in humans. At least three cases of humans with alveolar echinococcosis have occurred in Ontario since 2014

(Government of Ontario 2018). Most recently, molecular characterization of cestodes in dogs with alveolar echinococcosis without travel history suggests E. multilocularis of possible

European origin (Kotwa et al. 2019). Thus, both B. canis and E. multilocularis can lead to the emergence of new public health challenges in dogs and in people, through canine importation

(Galanis et al. 2019, Kotwa et al. 2019). Furthermore, there are currently no regulations for relocation of dogs within and between provinces in Canada (Canadian Food Inspection Agency

2018). Therefore, there may also be risks associated with inter-provincial and inter-regional relocation of imported dogs (Anderson et al., 2016; Galanis et al., 2019).

The Canadian Food Inspection Agency and the Canada Border Services Agency are the two agencies responsible for the regulation of canine importations into Canada (Canadian Food

195

Inspection Agency 2018). The Canadian Food Inspection Agency establishes the import requirements for all animals, including dogs, and animal products entering Canada as well as guidelines for the humane transport of all animals (Canadian Food Inspection Agency 2018). The

Canada Border Services Agency inspects all animals entering Canada at a border crossing

(Canada Border Services Agency 2018). Currently, there are minimal regulations in place for canine importation; dogs over three months of age require proof of rabies vaccination or a veterinary certificate indicating the animal originated from a country recognized by Canada as being free from rabies (Anderson et al., 2016). Commercial dogs eight months and under are required to have an import permit issued by the Canadian Food Inspection Agency (Canadian

Food Inspection Agency 2018).

The Canada Border Services Agency can detain, confiscate, or refuse entry of any animal if it is suspected of being sick or infected with an infectious organism or disease, does not have the necessary permits/certifications, or if the animal has been transported in an unsafe or inhumane way (Canadian Animal Health Institute 2017). However, dogs may be incubating diseases that may be undetectable and can therefore be missed by visual inspection. Furthermore, while rabies vaccination in dogs over the age of three months is a requirement, unvaccinated dogs can still enter the country contingent upon vaccination within two weeks, at the owners’ expense (Anderson et al., 2016).

The issue of canine zoonoses spread through the relocation of dogs comprises an important One Health challenge due to the potential social-ecological impact of importations or relocations on endemicities of disease in dogs, humans, and resultant alterations to the reservoirs and vectors in ecosystems shared by both species in rural and urban communities alike.

196

Collaborations between human, animal, and environmental health professionals have been proposed, utilizing the One Health concept, to respond to the threats of Rhipicephalus sanguineus ticks and E. multilocularis through the importation of dogs in the United Kingdom and Canada, respectively (Hansford et al. 2017, Kotwa et al. 2019).

Each year, a large number of dogs are imported into Canada from other countries

(Anderson et al., 2016; Anderson et al., 2019). It is plausible that the proportion of imported dogs may differ between rural and urban communities. Quantifying the proportion by residential location is important for public health education. Therefore, our objectives were to: (1) describe the proportions of dogs domestically sourced and imported in households in southern Ontario,

Canada, (2) describe the characteristics of domestically sourced and imported dogs as pets in southern Ontario, including where they were sourced or imported from, any health documentation that accompanied them, and opinions regarding risk of diseases from domestically sourcing and importing dogs, and (3) determine whether a difference in the proportion of imported dogs exists between rural and urban households in southern Ontario,

Canada.

METHODS

Geographic Location

Ontario is the second largest and most populous province in Canada with over 14 million residents (Statistics Canada 2018). Southern Ontario comprises close to 95% of the province’s total population which equates to one-third of the total Canadian population (Statistics Canada

2017d). The northern limit of southern Ontario is demarcated by the convergence of the Mattawa

197

and Ottawa rivers below the Quebec border and east of Lake Nipissing (Horn et al. 2019).

Southern Ontario includes both rural and urban communities (Statistics Canada 2017d).

Study Population and Sample Size Calculation

The Research Ethics Board (REB) for human use in research at the University of Guelph

(REB# 14JN028) approved the conduct of the study. The target population was rural and urban residents of southern Ontario. A research panel recruitment agency located in Toronto, Ontario,

Canada (Dynata™ (formerly ResearchNow™)) was enlisted to recruit individuals by email stratified by residential status. Recruitment involved providing the link to the questionnaire to an in-house database of 118,400 southern Ontario panelists meeting the following inclusion criteria:

Individuals who had resided in southern Ontario for at least one year at the start of the study, read English, and were 18 years of age and older. Specific quotas were used to ensure that sampling groups were of equal size based on location. A financial incentive (10 Air Miles points) was given to each respondent.

Data presented for the current study comprise a subset from a larger cross-sectional observational study conducted to acquire information about canine zoonoses in rural and urban communities. The sample size was calculated for the conduct of a larger canine zoonoses project to detect a difference between the proportion of dog-owning and dog-free households in rural and urban communities in southern Ontario. The study sample size was calculated using an estimated prevalence for dog-owning households of 50% (Perrin, 2009; Stull et al., 2012), prevalence of non-owning dog households of 60%, α=95%, and β=80% for a total of 408 respondents (i.e., households) per group and 816 respondents (i.e., households) per residential

198

location. One adult answered the questionnaire on behalf of their household, which was sampled independently from other panelists without replacement.

Questionnaire Data Collection

Details regarding the development of the questionnaire can be found elsewhere (Chapter

5). A copy of the questionnaire can be requested from the first author. Pilot testing of the questionnaire was conducted among a subset of the intended study population on two occasions.

First, a web address for the questionnaire was emailed to 12 individuals, known to the research team, with varying levels of educational background and location of residence (rural and urban in Ontario). All 12 individuals completed the questionnaire and provided feedback on the time required to complete the questionnaire, level of ease and difficulty of worded questions, and the general (logical and organizational) flow. Modifications to the questionnaire were made on the basis of pilot participant feedback. During the second pre-test, conducted one month later, 15 individuals known to the research team were invited; seven participated with additional revisions based on feedback. The online questionnaire was distributed to a panel of respondents between

August 21 to September 4, 2014.

The section of the questionnaire pertaining to the current study was open to all respondents, regardless of current dog ownership status, and comprised thirty-two structured questions to obtain household-level data. Questions were developed collaboratively between scientists in academia and one public health government organization in Ontario. Respondents were provided with the following options when answering questions: yes, no, unsure of the answer, or prefer not to answer. Household demographic information included residential location (i.e., rural or urban as defined by the Population Centre and Rural Area Classifications

199

(Statistics Canada 2011)), total number of household occupants, and gross household income.

All respondents (regardless whether they currently owned a dog) were asked whether they had domestically sourced one or more dogs or imported one or more dogs during the seven years prior to the start of the questionnaire. Respondents were then asked to provide information on each of the dogs that they had acquired during that period (domestically sourced or imported). A period of seven years was chosen to recognize the long incubation time of some canine zoonoses.

Respondents who had domestically sourced and/or imported at least one dog were asked to report the following information for each dog: the age of the dog when they acquired it, the sex of the dog, the year they got the dog, province/territory/country from which the dog was acquired, how they found the dog (i.e., breeder, adoption agency, charity, dog rescue organization, family member, friend, humane society (or shelter), social networking site, website advertisement), whether the dog was vaccinated against rabies when they got it (self-reported by respondents), whether the dog developed any diseases their veterinarian felt the dog brought from its province/territory/country of origin, whether the dog was screened for any diseases before they got the dog, whether any documentation (e.g., Rabies Vaccination Certificates,

Veterinary Certificate of Health or other) accompanied the dog and, if so, which documents

(respondents could choose as many options from a pre-specified list as applied). Additionally, respondents were asked to provide their opinion regarding whether there were any potential health risks as a result of getting a dog from within or outside of Canada. Respondents, answering on behalf of their household, who had imported dogs were also asked to choose from a pre-specified list the reason(s) for getting their dog(s) from outside of Canada. For this question, respondents could choose as many options as applied.

200

Data Analysis

We used STATA Intercooled 15 (StataCorp. 2017. Stata Statistical Software: Release

15. College Station, TX: StataCorp LLC) for descriptive and analytical statistics. The proportions and characteristics of dogs domestically sourced within Canada and imported from outside of the country were tabulated. Additionally, canine rabies vaccination, as self-reported by respondents, was tabulated by age of domestically sourced and imported dogs (i.e., dog under three months old, or dog over three months old).

We used logistic regression analysis to determine whether a difference in the odds of importing dogs exists between rural and urban households. The analysis included only households in which one or more dogs had been acquired in the seven years prior to the questionnaire administration. Two potential confounders at the household level were assessed: number of household occupants and gross household income. If adding or removing a variable resulted in a greater than 20% change in the model β-coefficients, the variable was considered a confounder and remained in the model (Dohoo et al. 2010). Odds ratios (ORs) with associated

95% confidence intervals (95% CI), were reported. To evaluate whether our model fit the data, the Hosmer-Lemeshow goodness-of-fit test (Hosmer and Lemeshow 1980) was assessed. We excluded “I prefer not to answer” responses and missing information from the analysis.

RESULTS

A total of 2,006 (1,002 rural and 1,004 urban) southern Ontario respondents, each representing one household, completed the questionnaire. Household demographics for respondents in each residential location (i.e., rural and urban southern Ontario) are shown in

Table 7.1. Overall, 50.05% of respondents were from urban households, and 49.95% were from

201

rural areas. Most frequently, respondents were from households occupied by two persons

(47.56%) and with a gross annual income (before taxes) between 40,000 to 70,000 Canadian dollars (Table 7.1). Without census data stratified by community status, for our study sample we assumed that the rural and urban respondents were representative of the rural and urban general population in southern Ontario, Canada. This is presented in Chapter 5.

Over a seven-year period, 731 (36.44%) respondents domestically sourced at least one dog. When asked if they would be willing to provide information on the domestically sourced dogs, 47 of the 731 respondents (i.e., 6.43%) declined. Therefore, information was obtained from

684 households regarding 962 dogs domestically sourced as pets within Canada within the seven-year period. Of the 684 respondents, 209 domestically sourced more than one dog (Table

7.2). The mean number of dogs domestically sourced was 1.4 (minimum=1, maximum=10). The characteristics of domestically sourced dogs, including their province of origin, and any health documentation that accompanied them, are shown in Table 7.2. Domestically sourced dogs were frequently puppies three to five months old (25.05%), male (51.87%), found via a breeder

(30.98%), and sourced from within Ontario (92.93%). As self-reported by respondents, 63.52% of domestically sourced dogs over the age of three months were vaccinated against rabies at the time they were acquired (Table 7.2). We also found 35.50% (71 of 200) of all sourced puppies under the age of three months were vaccinated against rabies and 63.25% (484 of 762) of all dogs at least three months of age and older (i.e., those that were required to be vaccinated), were vaccinated (Table 7.2). Furthermore, there were many households within which the domestically sourced dog was either unvaccinated or in which respondents were unsure of the dog’s rabies vaccination status (Table 7.2).

202

A small proportion of respondents reported their dog had developed diseases as diagnosed by a veterinarian from the province/territory of origin (4.97%). Just over one third of respondents reported their domestically sourced dogs had been screened for diseases before they acquired the dog (36.99%). The majority of respondents indicated a Rabies Vaccination

Certificate accompanied their dog (72.20%), despite there being no health documentation requirements for domestically sourcing dogs in Canada. Furthermore, 64.10% (75 of 117) of domestically sourced dogs under the age of three months were accompanied with a Rabies

Vaccination Certificate (Table 7.2). Overall, of 2,006 respondents, 39.43% reported that, in their opinion, there were potential health risks to humans associated with getting a dog from within

Canada (Table 7.2).

Of 2,006 respondents, 55 (2.74 %), reported they had imported at least one dog, with 39 respondents providing information about 55 dogs imported within the seven-year period. The mean number of dogs imported was 1.4 (minimum=1, maximum=10) (Table 7.3). Dogs were imported from eight countries or regions including: China, Costa Rica, Finland, France, India,

South America, Sri Lanka, and the United States of America (USA) (Table 7.3). For nine dogs, respondents did not report the country or state of origin. Most imported dogs were acquired from the USA (n=29 of 55 (52.73%)). The majority of imported dogs were puppies under three months of age (29.09%), male (58.18%), and found via the use of a breeder (32.73%), and many respondents indicated that they chose to import dogs because either friends or family had previously done so (30.77%) (Table 7.3). For imported dogs, 92.31% of dogs over three months of age were vaccinated against rabies when the respondent acquired the dog. However, 50% (8 of 16) of imported puppies under the age of three months were also vaccinated against the virus

203

(Table 7.3). Only 92.31% of dogs that should have been vaccinated against rabies (i.e., over three months of age) were vaccinated, as self-reported by respondents.

Few respondents (15.38%) indicated their imported dog(s) had developed diseases from the country of origin and close to eighty percent of respondents reported their imported dog(s) had been screened for diseases before importation (Table 7.3). Most imported dogs over the age of three months were accompanied with a Rabies Vaccination Certificate (86.49%); however,

50% (2 of 4) were puppies under three months old (Table 7.3). Over sixty-percent (62.36%) of all respondents (n=2,006) indicated they felt there were health risks associated with getting dogs from outside of the country, and 72.88% indicated that if there were known health risks to humans, they would avoid getting dogs from outside of the country in the future (Table 7.3). Of respondents who imported at least one dog, just over half (50.90%) indicated they believed there were health risks concomitant with importing dogs, and 49.09% would avoid importing dogs in the future.

Of 763 respondents who acquired one or more dogs in the seven-year period, 7.21% (55 of 763) imported at least one dog, and 92.79% (708 of 763) of respondents only domestically sourced at least one dog. Data pertaining to the importation of at least one dog was used for logistic regression models to meet objective three. The odds ratio for importing at least one dog in urban households compared to rural households was 1.93 (95% CI: 1.03-3.63) (Table 7.4).

Neither of the potential confounders results in a 20% change in the  coefficient. However, the

Hosmer and Lemeshow goodness-of-fit test indicated that our data fit the model well when potential confounders were included (Hosmer-Lemeshow goodness-of-fit (χ2 p=0.13)).

204

Therefore, we made the post priori decision to report the odds ratio including the potential confounders.

DISCUSSION

This study was conducted to investigate domestic sources and importations of dogs as pets in southern Ontario, Canada. There are many published studies pertaining to canine importation in European countries (Gould et al. 2000, Torgerson and Craig 2009, Menn et al.

2010, Mira et al. 2018). In Canada, while there is an Importation Working Group, albeit, without official standing or sanction, there are few published studies that pertain to the subject (Anderson et al., 2019), and an absence of studies comparing canine importation within rural and urban households. In the current study, we provide evidence to fill in some of the current gaps in knowledge. First, we quantified the proportion of domestically sourced and imported dogs into southern Ontario and reported the provinces and countries of origin over a period of seven years.

Second, we presented characteristics of domestically sourced and imported dogs including their rabies vaccination status as self-reported by respondents. Finally, our findings suggest there may be a difference in the importation of dogs between rural and urban households in southern

Ontario. These data may be used for community-specific public health education programs that require active community involvement. Such programs may actively focus on a multidisciplinary approach that recognizes different communities will have different needs based on their level of commitment, pre-existing programs, and available resources to enhance educational and mitigation strategies around the importation of dogs.

There are potential risks involved with the relocation of dogs within and between countries (Polak 2019). While the majority of dogs in this study were domestically sourced

205

within Canada, conceivably the risks to southern Ontario dogs from domestic sourcing still exists through unregulated domestic relocation. Examples of such risks have been previously postulated regarding the migration of E. multilocularis and Anaplasma americanum in Canada

(Mercer et al. 2016, Evason et al. 2019, Kotwa et al. 2019). There are currently no regulations or surveillance systems in place for domestically sourcing dogs in Canada, and therefore no health certificates are required (Canadian Food Inspection Agency 2018). However, many respondents indicated they obtained health certificates at the time of acquiring domestically sourced dogs.

There are two possible explanations for this: (1) respondents may not be aware of the definitions of and/or circumstances under which documentation is usually required (i.e., for imported dogs) and therefore may have been mistaken or inaccurate in their feedback, and (2) if domestically sourced dogs were indeed accompanied with health certificates, they may have been initially imported into the country and then domestically sourced within Ontario, initially imported into another province and domestically sourced into Ontario, or respondents may have been provided with a summary of veterinary visits including vaccinations and de-worming and assumed this to be a health certificate. Furthermore, more respondents of domestically sourced dogs stated that the dogs were accompanied with a Rabies Vaccination Certificate than reported that their domestically sourced dogs were vaccinated against rabies. These data present some difficulty in being able to discern the accuracy of respondent feedback regarding canine rabies vaccination in domestically sourced dogs.

In our study, the majority of imported dogs were from the United States, and specifically from the southern states of Florida, Mississippi, and Tennessee. Certain pathogens with the potential to cause disease in dogs including Ehrlichia canis, Dirofilaria immitis, Borrelia

206

burgdorferi, and canine influenza H3N8 are endemic within these states (Anderson, Crawford,

Dubovi, Gibbs, & Hernandez, 2013; Atkins et al., 2014; Seaman, Kania, Hegarty, Legendre, &

Breitschwerdt, 2004; Tzipory, Crawford, & Levy, 2010). Therefore, dogs imported from the southern United States could pose disease risks to local non-endemic dog populations in southern

Ontario, Canada. However, current regulations for importation of dogs do not address the risk posed by the introduction of rare and non-endemic species of pathogens, including zoonoses with the potential to become endemic (McQuiston et al. 2008, Jenkins et al. 2011).

In the United States, recommendations have been proposed which could feasibly reduce potential risks of canine disease via an importation route. For instance, the Association of Shelter

Veterinarians (ASV) and the American Heartworm Association (AHA) recommend serological testing of dogs six months and older for microfilariae and heartworm antigen prior to importation and exportation (Polak 2019). Furthermore, the American Animal Hospital Association (AAHA) recommends that dogs originating from certain countries such as South Korea and China should be inoculated against and screened for canine influenza, and those from the Mediterranean should be assessed for Leishmania spp. (Polak 2019). Changes to existing Canadian regulations similar to those recommended by the ASV, AHA, and AAHA could help to mitigate the potential disease risks associated with the relocation of dogs, but may be hindered by cost, existing capacities, and political priorities (McQuiston et al. 2008).

In our study, the majority of imported dogs were accompanied by Rabies Vaccination

Certificates. This is not surprising, as Rabies Vaccination Certificates are required by the Federal

Government of Canada in order to cross the border (Canadian Food Inspection Agency 2018).

However, it is concerning that some respondents were unsure of the canine rabies vaccination

207

status of their imported dogs and some respondents reported having unvaccinated imported dogs.

There are inherent risks for the entry of canine rabies into Canada through importation including when: (1) there is a loss of follow up in confirming rabies vaccination in imported dogs that are unvaccinated upon entry, and (2) canine rabies vaccination certificates are unverified.

Enforcing follow up of canine rabies vaccination in unvaccinated imported dogs presents a challenge. While there are some existing capacities in place, including the provincial legal requirement for rabies vaccination of dogs under the Health Protection and Promotion Act

(Service Ontario e-Laws 1990a), ensuring owner compliance would require notification of public health units by Canada Border Services Agency of the need for follow-up post importation.

Furthermore, while unvaccinated dogs must be vaccinated for rabies at the owner’s expense and reported to the CFIA within two weeks, (Anderson et al., 2016), there is the potential that despite legal requirements in Ontario, imported unvaccinated dogs may be relocated to another province during that time frame and could remain unvaccinated. It is possible that some imported dogs may have been exempted from proof of rabies vaccination if their country of origin was classified as “rabies free”, as stipulated by federal regulation (Canadian Food Inspection Agency

2018). However, the “rabies-free” status of countries, as reported by members states of the

World Health Organization, is heavily dependent on robust, accurate, and active rabies surveillance systems which may have changed, may not be in place, or may not provide the most up-to-date information. For these reasons, previously “rabies-free” countries may therefore be miscategorized (McQuiston et al. 2008). If this miscategorization is indeed the case, it highlights an unidentified risk of canine rabies to local dog populations particularly regarding imported dogs who are not seen by veterinarians.

208

Our findings showed that rabies vaccines were administered to imported puppies that were less than three months of age. Rabies vaccination failure can occur in puppies and may be due to immature immune systems or maternal antibodies which inhibit the seroconversion to rabies vaccine in puppies less than three months of age (Mansfield et al. 2004). There is evidence to suggest that during mass rabies vaccination campaigns, particularly in rabies endemic countries and regions of the world, the World Health Organization requires that every dog, even those under the age of three months, be vaccinated (Morters et al. 2015). However, our study did not capture data pertaining to the reason(s) some puppies were vaccinated before the recommended age. Future epidemiological studies investigating the reasons why some imported dogs are vaccinated against rabies before the recommended age, and the circumstances surrounding their entry into the country may inform this gap in knowledge.

Previous studies have reported significant differences in dog ownership as well as the transmission of dog-associated zoonoses between rural and urban residential locations which may be as a consequence of differences in rural and urban lifestyles and cultures (Leslie et al.

1994, Bottoms et al. 2014). In our study, there was an increase in the odds of importing dogs into urban households as compared with the odds of importing dogs into rural households. Based on previous findings, it is plausible that an increased proportion of imported dogs into urban households may indicate an increase in the potential for transmission of dog-associated zoonoses in urban areas. Future interventions may reasonably include educating veterinarians and other health professionals, breeders, and rescue organizations about some of the potential risks regarding canine importation. Collaborative surveillance and communication within and between animal and human health organizations may help to mitigate canine-specific and canine zoonotic

209

diseases via the relocation of dogs into and throughout Canada (Anderson et al., 2019; Kotwa et al., 2019).

LIMITATIONS

Study respondents, each representing one household, were accessed by providing an online link of the questionnaire to Dynata™ panelists. Therefore, individuals who did not have internet access, were not panelists of Dynata™ (formerly ResearchNow™), or were panelists but not available to participate in the questionnaire during the two-week period the questionnaire was available, were not in this study. Furthermore, purposive selection of respondents led to an over-representation of rural households which may have different demographics than urban.

Second, while an online questionnaire provided an easily accessible platform for those with internet access, and an efficient means of gathering data, respondents did not have the ability to inquire about, nor could they clarify any questions. Third, respondents were asked to provide information about dogs they domestically sourced or imported within the seven years prior to the conduct of the study. While this period was chosen in recognition of the long incubation time of some canine zoonoses, the length of time for recall may have limited respondents’ abilities to recount accurate information regarding the sourcing of dogs and other information collected about the dogs. Finally, social desirability bias may be a factor in our findings as respondents may have answered questions in a way they perceived to be more socially acceptable than would have been their true response, resulting in either an over- or underestimation of study results. For instance, it is plausible that respondents overestimated the vaccination status of imported dogs, as well as the number of domestically sourced and imported dogs accompanied with Rabies

Vaccination Certificates, which could affect how well our study results may be generalized.

210

CONCLUSION

Information pertaining to the demographics of domestically sourced and imported dogs, whether they were screened for any diseases prior to provincial entry, and whether any health documentation accompanied them, is important for public health and can be used to identify potential risks and gaps in current knowledge. In our study, we identified three major findings:

(1) due to the large numbers of dogs that are acquired through domestic sources, there may be the need for policy that pertains to regulating and monitoring the domestic relocation of dogs in

Canada; (2) some dogs are entering the country that are unvaccinated or ineffectually vaccinated and could be carrying other diseases not currently being monitored; and (3) it may be beneficial to consider community-specific education regarding risks associated with canine importation.

REFERENCES

Anderson, M., Douma, D., Kostiuk, D., Filejski, C., Rusk, R., Weese, J. S., … Rajzman, C. (2016). Report of the Canadian National Canine Importation Working Group. Retrieved from https://www.canadianveterinarians.net/documents/canadian-canine-importation- working-group-report Anderson, M., Stull, J. W., & Weese, J. S. (2019). Impact of dog transport on high-risk infectious diseases. Veterinary Clinics of North America: Small Animal Practice, 49(4), 615–627. https://doi.org/10.1016/j.cvsm.2019.02.004 Anderson, T. C., Crawford, P. C., Dubovi, E. J., Gibbs, E. P. J., & Hernandez, J. A. (2013). Prevalence of and exposure factors for seropositivity to H3N8 canine influenza virus in dogs with influenza-like illness in the United States. Journal of the American Veterinary Medical Association, 242(2), 209–216. https://doi.org/10.2460/javma.242.2.209 Atkins, C. E., Murray, M. J., Olavessen, L. J., Burton, K. W., Marshall, J. W., & Brooks, C. C. (2014). Heartworm “lack of effectiveness” claims in the Mississippi delta: Computerized analysis of owner compliance - 2004-2011. Veterinary Parasitology, 206(1–2), 106–113. https://doi.org/10.1016/j.vetpar.2014.08.013 Bottoms, K., Trotz-Williams, L., Hutchison, S., MacLeod, J., Dixon, J., Berke, O., & Poljak, Z. (2014). An evaluation of rabies vaccination rates among canines and felines involved in biting incidents within the Wellington-Dufferin-Guelph Public Health Department. Zoonoses and Public Health, 61(7), 499–508. https://doi.org/http://dx.doi.org/10.1111/zph.12101 Canada Border Services Agency. (2018). Travelling with animals. Retrieved June 20, 2019, from https://www.cbsa-asfc.gc.ca/travel-voyage/animals-animaux-eng.html 211

Canadian Animal Health Institute. (2017). Latest Canadian Pet Population Figures Released. Retrieved November 22, 2018, from https://www.canadianveterinarians.net/documents/canadian-pet-population-figures-cahi- 2017 Canadian Food Inspection Agency. (2018). Importing or travelling with domestic dogs. Retrieved June 16, 2019, from http://www.inspection.gc.ca/animals/terrestrial- animals/imports/policies/live-animals/pets/dogs/eng/1331876172009/1331876307796 Davidson, R. K., & Robertson, L. J. (2012). European pet travel: Misleading information from veterinarians and government agencies. Zoonoses and Public Health, 59(8), 575–583. https://doi.org/10.1111/j.1863-2378.2012.01499.x Dohoo, I. R., Stryhn, H., & Martin, S. W. (2010). Veterinary Epidemiologic Research (2nd ed.). Charlottetown, PEI: VER Inc. Evason, M., Stull, J. W., Pearl, D. L., Peregrine, A. S., Jardine, C., Buch, J. S., … Weese, J. S. (2019). Prevalence of Borrelia burgdorferi, Anaplasma spp., Ehrlichia spp. and Dirofilaria immitis in Canadian dogs, 2008 to 2015: A repeat cross-sectional study. Parasites and Vectors, 12(1), 1–11. https://doi.org/10.1186/s13071-019-3299-9 Galanis, E., Trerise, S., Ahmed-Bentley, J., Deans, G., & Fraser, E. (2019). Brucellosis and other diseases imported with dogs. BC Medical Journal (Vol. 61). Retrieved from https://www.bcmj.org/sites/default/files/public/BCMJ_Vol61_No4-bc-cdc.pdf Gould, D. J., Murphy, K., Rudorf, H., & Crispin, S. M. (2000). Canine monocytic ehrlichiosis presenting as acute blindness 36 months after importation into the UK. Journal of Small Animal Practice, 41(6), 263–265. https://doi.org/10.1111/j.1748-5827.2000.tb03937.x Government of Ontario. (2018). Infectious diseases protocol appendix A: disease specific chapters. Hansford, K. M., Phipps, L. P., Cull, B., Pietzsch, M. E., & Medlock, J. M. (2017). Rhipicephalus sanguineus importation into the UK: Surveillance, risk, public health awareness and One Health response. Veterinary Record, 180(5), 119. https://doi.org/10.1136/vr.104061 Horn, M., Ewen, G., & Wise, S. F. (2019). Ontario. Retrieved July 18, 2019, from https://www.britannica.com/place/Ontario-province Hosmer, D. W., & Lemeshow, S. (1980). Goodness of fit tests for the multiple logistic regression model. Communications in Statistics - Theory and Methods, 9(10), 1043–1069. https://doi.org/10.1080/03610928008827941 Jenkins, E. J., Schurer, J. M., & Gesy, K. M. (2011). Old problems on a new playing field: Helminth zoonoses transmitted among dogs, wildlife, and people in a changing northern climate. Veterinary Parasitology, 182(1), 54–69. https://doi.org/10.1016/j.vetpar.2011.07.015 Kotwa, J. D., Isaksson, M., Jardine, C. M., Campbell, G. D., Berke, O., Pearl, D. L., … Peregrine, A. S. (2019). Echinococcus multilocularis infection, southern Ontario, Canada. Emerging Infectious Diseases, 25(2), 265–272. https://doi.org/10.3201/eid2502.180299 Leslie, B. E., Meek, A. H., Kawash, G. F., & McKeown, D. B. (1994). An epidemiological investigation of pet ownership in Ontario. The Canadian Veterinary Journal, 35(4), 218– 222. Mansfield, K. L., Sayers, R., Fooks, A. R., Burr, P. D., & Snodgrass, D. (2004). Factors affecting

212

the serological response of dogs and cats to rabies vaccination. Veterinary Record, 154(14), 423–426. https://doi.org/10.1136/vr.154.14.423 McQuiston, J. H., Wilson, T., Harris, S., Bacon, R. M., Shapiro, S., Trevino, I., … Marano, N. (2008). Importation of dogs into the United States: Risks from rabies and other zoonotic diseases. Zoonoses and Public Health, 55(8–10), 421–426. https://doi.org/10.1111/j.1863- 2378.2008.01117.x Menn, B., Lorentz, S., & Naucke, T. J. (2010). Imported and travelling dogs as carriers of canine vector-borne pathogens in Germany. Parasites & Vectors, 3(February 2000), 34. https://doi.org/10.1186/1756-3305-3-34 Mercer, N. J., Gottstein, B., Peregrine, A. S., Walters, J. M., Boggild, A. K., Wallace, D., … Osterman-Lind, E. (2016). Public Health follow-up of suspected exposure to Echinococcus multilocularis in Southwestern Ontario. Zoonoses and Public Health, 64(6), 460–467. https://doi.org/10.1111/zph.12326 Mira, F., Purpari, G., Lorusso, E., Di Bella, S., Gucciardi, F., Desario, C., … Guercio, A. (2018). Introduction of Asian canine parvovirus in Europe through dog importation. Transboundary and Emerging Diseases, 65(1), 16–21. https://doi.org/10.1111/tbed.12747 Morters, M. K., McNabb, S., Horton, D. L., Fooks, A. R., Schoeman, J. P., Whay, H. R., … Cleaveland, S. (2015). Effective vaccination against rabies in puppies in rabies endemic regions. Veterinary Record, 177(6), 150. https://doi.org/10.1136/vr.102975 Perrin, T. (2009). The business of urban animals survey: The facts and statistics on companion animals in Canada. Canadian Veterinary Journal, 50(1), 48–52. Polak, K. (2019). Dog transport and infectious disease risk: An international perspective. Veterinary Clinics of North America - Small Animal Practice, 49(4), 599–613. https://doi.org/10.1016/j.cvsm.2019.02.003 Seaman, R. L., Kania, S. A., Hegarty, B. C., Legendre, A. M., & Breitschwerdt, E. B. (2004). Comparison of results for serologic testing and a polymerase chain reaction assay to determine the prevalence of stray dogs in eastern Tennessee seropositive to Ehrlichia canis. American Journal of Veterinary Research, 65(9), 1200–1203. https://doi.org/10.2460/ajvr.2004.65.1200 StataCorp. 2017. Stata Statistical Software: Release 15. College Station, T. S. L. (n.d.). Stata Statistical Software: Release 15 College Station, TX: StataCorp LLC. Retrieved November 15, 2017, from https://www.stata.com/ Statistics Canada. (2011). Population centre (POPCTR). Retrieved July 18, 2019, from https://www12.statcan.gc.ca/census-recensement/2011/ref/dict/geo049a-eng.cfm Statistics Canada. (2017). Population size and growth in Canada: Key results from the 2016 Census. Retrieved July 4, 2019, from https://www150.statcan.gc.ca/n1/daily- quotidien/170208/dq170208a-eng.htm Statistics Canada. (2018). Canada at a glance 2018: Statistics Canada, CANSIM table 051-0005. Retrieved July 4, 2019, from https://www150.statcan.gc.ca/n1/pub/12-581-x/2018000/pop- eng.htm Stull, J. W., Peregrine, A. S., Sargeant, J. M., & Weese, J. S. (2012). Household knowledge, attitudes and practices related to pet contact and associated zoonoses in Ontario, Canada. BMC Public Health, 12(1), 553. https://doi.org/10.1186/1471-2458-12-553 Torgerson, P. R., & Craig, P. S. (2009). Risk assessment of importation of dogs infected with

213

Echinococcus multilocularis into the UK. Veterinary Record, 165(13), 366–368. https://doi.org/10.1136/vr.165.13.366 Tzipory, N., Crawford, P. C., & Levy, J. K. (2010). Prevalence of Dirofilaria immitis, Ehrlichia canis, and Borrelia burgdorferi in pet dogs, racing greyhounds, and shelter dogs in Florida. Veterinary Parasitology, 171(1–2), 136–139. https://doi.org/10.1016/j.vetpar.2010.03.016

214

Table 7. 1 Descriptive proportions of household demographics from an online questionnaire investigating the domestic sourcing and importation of dogs as pets in southern Ontario, Canada

Residential location in

southern Ontario Number of responses Rural Urban (%) Total number of household occupantsa 1 112 (11.18) 183 (18.23) 295 (14.71) 2 558 (55.69) 396 (39.44) 954 (47.56) 3 154 (15.37) 165 (16.43) 319 (15.90) 4 117 (11.68) 168 (16.73) 285 (14.21) 5 or more 57 (5.69) 81 (8.07) 138 (6.88) Total number of households 1,002 1,004 2,006 Gross household incomeb Less than 20,000 32 (3.19) 49 (4.88) 81 (4.04) 20,000 - 39,999 145 (14.47) 135 (13.45) 280 (13.96) 40,000 - 79,999 310 (30.94) 311 (30.98) 621 (30.96) 80,000 - 120,000 226 (22.55) 239 (23.80) 465 (23.18) Greater than 120,000 114 (11.38) 135 (13.45) 249 (12.41) Unsure 8 (0.80) 11 (1.10) 19 (0.95) Total number of households 1,002 1,004 2,006 a Including yourself, how many individuals live in your household? b Before taxes and deductions, in what range is the total annual (per year) household income in Canadian dollars ($)

215

Table 7. 2 Descriptive characteristics of domestically sourced dogs as pets from provinces/territories within Canada

Variable Number of responses (%) Did you (the respondent representing the household) get any dogs from within Canada within the last 7 years? Yes 731 (36.44) No 1,254 (62.51) Unsure 15 (0.75) Total number of households 2,006 Number of dogs domestically sourced by households 1 475 (69.44) 2 163 (23.83) 3 38 (5.56) More than 3 8 (1.17) Total number of respondents who provided information 684 This section pertains to characteristics of 962 domestically sourced dogs as reported by 684 households What was the age of the dog when you got him/her? Puppy under 3 months 200 (20.79) Juvenile 3 to 5 months 241 (25.05) Juvenile Older 6 to 11 months 133 (13.83) Adult 12 months to under 3 years 146 (15.18) Adult 3 to 5 years 147 (15.28) Adult 6 to 10 years 74 (7.69) Adult >10 years 13 (1.35) Unsure 8 (0.83) Total number of dogs 962 Sex of the dog Female 461 (47.92) Male 499 (51.87) Total number of dogs 962 What year did you get your dog? 2007 167 (17.36) 2008 82 (8.52) 2009 99 (10.29) 2010 103 (10.71) 2011 103 (10.71) 2012 117 (12.16) 2013 121 (12.58) 2014 69 (7.17) Unsure 96 (9.98) Total number of dogs 962 216

What was the province or territory where you got your dog from? Alberta 3 (0.31) British Columbia 13 (1.35) Manitoba 10 (1.04) New Brunswick 2 (0.21) Newfoundland and Labrador 2 (0.21) Nova Scotia 5 (0.52) Ontario 894 (92.93) Prince Edward Island 2 (0.21) Quebec 27 (2.81) Saskatchewan 4 (0.42) Northwest Territories 0 (0.00) Nunavut 0 (0.00) Yukon 0 (0.00) Total number of dogs 962 How did you find your dog? Breeder 298 (30.98) Adoption agency 53 (5.51) Charity 7 (0.73) Dog rescue organization 62 (6.44) Family member 97 (10.08) Friend 194 (20.17) Humane Society (or shelter) 97 (10.08) Social networking site 24 (2.49) Website advertisement 103 (10.71) Unsure 25 (2.60) Total number of dogs 962 Was the dog vaccinated against rabies when you got it? Yes 560 (58.21) Proportion of puppies under 3 months vaccinated 71 of 200 (35.50) against rabies Proportion of puppies over 3 months vaccinated against 484 of 762 (63.52%) rabies No 298 (30.98) Unsure 103 (10.17) Total number of dogs 962 This section pertains to household information as reported by respondents Since you got your dog(s), have any of them developed any diseases that either you or your veterinarian felt the dog(s) got from its province/territory of origin? Yes 34 (4.97) No 632 (92.40) Unsure 18 (2.63) Total number of respondents who provided information 684

217

Were any of the dogs that you got within Canada screened for any diseases before you got the dog? Yes 253 (36.99) No 250 (36.55) Unsure 181 (26.46) Total number of respondents who provided information 684 Did you get any documentation (e.g., Rabies Vaccination Certificates, Veterinary Certificate of Health and others) for any of the dogs that you got within Canada? Yes 434 (63.45) No 188 (27.49) Unsure 62 (9.06) Total number of respondents who provided information 684 For each dog that was domestically sourced, please indicate the health documentation that accompanied the doga Rabies Vaccination Certificate (RVC) 452 (72.20) Proportion of dogs under 3 months of age with RVC 75 of 117 (64.10) Proportion of dogs over 3 months of age with RVC 375 of 509 (73.67) Veterinary Certificate of Health 429 (68.53) Import Permit 27 (4.31) Other documentation Lifetime Registration Document 107 (17.09) Microchip or Tattoo Document 223 (35.62) Certificate of Pure Breeding 174 (27.80) Unsure 51 (8.15) Total number of respondents who provided information 626 In your opinion, are there any potential health risks to humans associated with getting a dog(s) from within Canada? Yes, there are some 673 (33.55) Yes, there are many 118 (5.88) No, there are no health risks to humans 618 (30.81) Unsure 586 (29.21) Total number of households 2,006 aRespondents were able to choose as many certificates and/or documents as applied

218

Table 7. 3 Descriptive characteristics of dogs imported as pets from outside of Canada into southern Ontario during a seven-year period

Variable Number of responses (%) Did you get any dogs from outside of Canada in the last 7 years? Yes 55 (2.74) No 1,915 (95.46) Unsure 27 (1.35) Total number of households 2006 Number of dogs imported by households 1 32 (82.05) 2 5 (12.82) 3 1 (2.56) More than 3 1 (2.56) Total number of respondents who provided information 39 This section pertains to characteristics of 55 dogs imported by 39 households What was the age of the dog when you got him/her? Puppy under 3 months 16 (29.09) Juvenile 3 to 5 months 8 (14.55) Juvenile Older 6 to 11 months 9 (16.36) Adult 12 months to under 3 years 9 (16.36) Adult 3 to 5 years 8 (14.55) Adult 6 to 10 years 4 (7.27) Adult >10 years 1 (1.82) Total number of dogs 55 Sex of the dog Female 23 (41.82) Male 32 (58.18) Total number of dogs 55 What year did you get your dog? 2007 13 (23.64) 2008 5 (9.09) 2009 9 (16.36) 2010 3 (5.45) 2011 5 (9.09) 2012 3 (5.45) 2013 5 (9.09) 2014 12 (21.82) Total number of dogs 55 What is the State (if USA) or country where you got the dog from China 2 (3.64) Costa Rica 1 (1.82) Finland 1 (1.82) France 2 (3.64) 219

India 1 (1.82) South America 1 (1.82) Sri Lanka 1 (1.82) United States of America (USA) Arizona 1 (1.82) Florida 5 (9.09) Georgia 1 (1.82) Iowa 1 (1.82) Kansas 2 (3.64) Los Angeles 1 (1.82) Louisiana 2 (3.64) Michigan 4 (7.27) Minnesota 1 (1.82) Mississippi 1 (1.82) New York 2 (3.64) Ohio 2 (3.64) Pennsylvania 2 (3.64) Tennessee 1 (1.82) State not specified by respondent 3 (5.45) Total number of dogs imported from USA 29 (52.73) Total number of dogs 55 How did you find your dog? Breeder 18 (32.73) Adoption agency 8 (14.55) Charity 3 (5.45) Dog rescue organization 5 (9.09) Family member 4 (7.27) Friend 6 (10.91) Humane Society (or shelter) 4 (7.27) Social networking site 0(0.00) Website advertisement 7 (12.73) Total number of dogs 55 Was the dog vaccinated against rabies when you got it? Yes 44 (80.00) Proportion of puppies under 3 months vaccinated 8 of 16 (50.00) against rabies Proportion of puppies over 3 months vaccinated against 36 of 39 (92.31) rabies No 9 (16.36) Unsure 2 (3.64) Total number of dogs 55 This section pertains to household information as reported by respondents Since you got your dog(s), have any of them developed any diseases that either you or your veterinarian felt the dogs(s) got from its country of origin outside of Canada? 220

Yes 6 (15.38) No 33 (84.62) Total number of respondents who provided information 39 Were any of the dogs that you got outside of Canada screened for any diseases before you got the dog? Yes 29 (74.36) No 7 (17.95) Unsure 3 (7.69) Total number of respondents who provided information 39 Did you get any documentation (e.g., Rabies Vaccination Certificates, Veterinary Certificate of Health and others) for any of the dogs that you got outside of Canada? Yes 30 (76.92) No 5 (12.82) Unsure 3 (7.69) Total number of respondents who provided information 39 For each dog that was domestically sourced, please indicate the health documentation that accompanied the doga Rabies Vaccination Certificate (RVC) 32 (86.49) Proportion of dogs under 3 months of age with RVC 2 of 4 (50.00) Proportion of dogs over 3 months of age with RVC 30 of 33 (90.91) Veterinary Certificate of Health 28 (75.68) Import Permit 21 (56.76) Other documentation Lifetime Registration Document 9 (24.32) Microchip or Tattoo Document 17 (45.95) Certificate of Pure Breeding 11 (29.73) Unsure 0 (0.00) Total number of respondents who provided information 37 What is/are the reason(s) for you getting a dog(s) from outside of Canada? b I feel better by helping s dog(s) from another state/country 8 (20.51) My friends/family have done so, and I heard about it through 12 (30.77) them I traveled abroad and wanted to rescue a dog(s) in the 3 (7.69) state/country I was in There are no available dogs of this kind in Canada 6 (15.38) I wanted to help save the lives of dogs 4 (10.26) Other 12 (30.77) Unsure 2 (5.13) Total number of respondents who provided information 39 This section pertains to questions asked of all questionnaire respondents In your opinion, are there any potential health risks to humans associated with getting a dog(s) from outside of Canada? Yes, there are some 776 (38.68) Yes, there are many 475 (23.68) 221

No, there are no health risks to humans 153 (7.63) Unsure 592 (29.51) Total number of respondents who provided information 2,006 If there were health risks to humans, would you avoid getting a dog(s) outside of Canada in the future? Yes 1,462 (72.88) No 205 (10.22) Unsure 323 (16.10) Total number of respondents who provided information 2,006 aRespondents were able to choose as many certificates and/or documents as applied b Respondents were able to choose as many options as applied

222

Hosmer- Odds Estimate Lemeshow N Variable SE P ratio 95% CI (β) Goodness (eβ) of Fit (P) 763 Residential location Urban Ref. Rural -0.63 0.29 0.03 0.53 0.30 - 0.94 <0.001

658 Residential location Urban Ref. Rural -0.66 0.32 0.04 0.52 0.28 – 0.97 0.13

Total no. household occupants 1 Ref. 2 -0.08 0.52 0.88 0.92 0.33 – 2.57 3 0.52 0.53 0.33 1.69 0.59 – 4.80 4 -0.39 0.63 0.53 0.68 0.19 – 2.32 5 or more -1.77 1.11 0.11 0.17 0.02 – 1.51

Gross household income Less than 20,000 Ref. 20,000 - 39,999 0.30 0.84 0.72 1.35 0.26 – 7.00 40,000 - 79,999 0.04 0.82 0.96 1.05 0.21 – 5.19 80,000 - 120,000 -0.07 0.84 0.94 0.93 0.18 – 4.88 Greater than 120,000 0.55 0.86 0.52 1.73 0.32 – 9.32

223

CHAPTER 8

DISCUSSION AND CONCLUDING CHAPTER

224

OVERVIEW

While dogs confer many benefits upon humans including companionship, well-being, and healthy behaviours (McNicholas et al. 2005, Friedmann and Son 2009, Herzog 2011, Hodgson and Darling 2011, Sable 2013), they can also directly and indirectly transmit certain zoonotic pathogens to humans. Canine zoonoses transmitted from dogs to humans include Echinococcus multilocularis, Giardia intestinalis assemblage B, Leptospira spp., and the rabies virus (Alton et al. 2009, Chomel and Sun 2011, Damborg et al. 2016, Bowser and Anderson 2018). These particular zoonoses can cause diseases ranging in severity from moderate to fatal. Dogs and humans have historically shared close living environments which have evolved more recently in modern urbanized society (Chomel and Sun 2011). Aside from the rabies virus, dogs may not currently represent the most apparent, or even concerning animal species that transmits zoonoses.

However, given their close relationship with humans, and growing population, particularly in

North America, dogs are positioned to become sources of potentially increasingly important zoonoses in the future. Further complicating the issue of canine zoonoses, is that while these diseases occur at the human-animal interface, some can also be sustained within the environment in vector hosts and wildlife reservoirs (Karesh et al. 2012). A growing body of research pertains to canine zoonoses in many parts of the world including North America. However, gaps in our knowledge exist. In particular, the geographical incidence, prevalence, and risk factors contributing to the development and transmission of canine zoonoses may differ between and among communities and by geography. Furthermore, there are gaps in our understanding of public knowledge and awareness of canine zoonoses. Thus, research is needed to determine where (geographically) canine zoonoses research is being conducted in North America, to

225

determine the incidence of known and suspected canine zoonoses in remote and non-remote locales and to explore public knowledge of canine zoonoses. This dissertation added to the growing body of canine zoonotic research by: 1) examining canine zoonoses research trends among North American countries (Chapters 2 and 3); 2) estimating the prevalence of Giardia spp. and Cryptosporidium spp. in canine feces in one Inuit community in remote Inuit Nunangat

(Chapter 4); and investigating public health challenges related to dogs in rural and urban communities in southern Ontario, Canada (Chapters 5, 6, and 7). We directly applied One Health principles (Zinsstag et al. 2011, Rabinowitz and Conti 2013) to the research conducted as part of

Chapter 4. Furthermore, we investigated whether a One Health approach was included within the objectives and/or methods of canine zoonotic studies in Chapters 2 and 3. Finally, while the One

Health approach was neither applied to nor operationalized within Chapters 5, 6, or 7, we recognize human exposures to dog bites, public knowledge and awareness of canine zoonoses, and the importation and domestic movements of dogs into and within Canada constitute important public health and One Health challenges.

KEY FINDINGS AND RECOMMENDATIONS

In Chapter 3, we conducted a scoping review to identify and characterize the available published literature on canine zoonoses in domestic dogs in North America since the start of the

21st century, including whether specific collaborative integrated approaches to research (e.g.,

One Health, Ecosystem Health, and others) were reported in the study objectives and/or methods sections. Findings suggest that five known and potential canine zoonotic pathogens have been most frequently researched in North America since the beginning of the 21st century: Ehrlichia spp., Borrelia burgdorferi, Leptospira spp., rabies virus, and influenza viruses. Furthermore,

226

most canine zoonotic research in North America has been conducted in “very high” and “high”

Inequality-adjusted Human Development Index (IHDI) countries. Our findings address a previous gap in knowledge regarding where and how many canine zoonotic studies were conducted within the last 17 years in North America. Importantly, findings from our scoping review identify zoonotic pathogens that have received the most attention from researchers within the period but are not necessarily an indication of disease burden in dogs, nor do they necessarily correlate with disability-adjusted life years in humans in this part of the world. Indeed, there are some infectious diseases and disease-causing pathogens that attract high as well as low research attention regardless of disease burden (Furuse 2019).

In Chapter 4, we estimated the fecal prevalence of Giardia spp. and Cryptosporidium spp. in dogs, investigated potential associations between type of dog population (sled, Humane

Society, and community) and fecal presence of Giardia spp. and Cryptosporidium spp., and described the molecular characteristics of Giardia spp. and Cryptosporidium spp. in dogs in

Iqaluit, Nunavut, Canada. This study emphasized the importance of community-led and community-driven research: Giardia spp. and Cryptosporidium spp. were identified by the community as pathogens of research importance. Community members were engaged from study inception to conclusion. Results indicated that, similar to findings from other parts of Canada,

Giardia spp., including the recognized zoonotic pathogen Giardia intestinalis assemblage B, and canine-specific Cryptosporidium canis, were present in the feces of some dogs in Iqaluit,

Nunavut. Other Giardia strains identified were Giardia intestinalis assemblages D and E. As a direct consequence of this research, knowledge translation materials including a poster and

227

handbooks (project-specific and sled-dog specific) summarizing research methods and findings were produced with input and contributions from the community (Appendix 4.2).

To provide the data for Chapters 5, 6, and 7, we conducted a cross-sectional online questionnaire to explore community and dog-related factors for canine zoonoses in rural and urban southern Ontario households. The investigation of public health challenges related to canines in both rural and urban communities in southern Ontario was important to understand previously unreported comparative risks associated with dogs to improve communication with dog owners and the broader public. Our aims were to determine whether targeted community- specific public health communication about canine zoonoses is needed, as well as to identify opportunities for collaboration between physicians and veterinarians to further the One Health goal of healthy pets and people.

In Chapter 5, we confirmed that dog bites as self-reported by respondents continue to occur which is consistent with the findings of previous studies in southern Ontario (Szpakowski et al. 1989, Bottoms et al. 2014). Furthermore, community-specific factors related to the dog bite incidence indicate that, irrespective of dog ownership, the odds of an individual being bitten by any dog (respondent-owned or not) in urban households was higher than that of individuals in rural households. This project also highlighted characteristics of bite victims and biting dogs.

Specific to whether the biting dog was owned by the household or not, we captured the circumstances surrounding the bite (e.g., play versus provocation). Our study highlighted that, despite provincial requirements (Service Ontario e-Laws 1990a), there were some biting dogs who were not up-to-date on rabies vaccination, while some had never been vaccinated against this serious and fatal virus.

228

In Chapter 6, we described respondent knowledge, awareness, and levels of concern regarding canine zoonoses, and possible pathways of respondent exposure to canine zoonoses through animal contact. As defined within our study, animal contact included human contact with dogs, owned dog contact with wildlife, and owned dog contact with the feces of other dogs and/or wildlife. Furthermore, we evaluated whether the awareness of canine zoonoses differed among three populations of respondents (i.e., (1) all respondents, (2) dog-owning respondents only, and (3) dog-owning respondents who used veterinarians)) in rural and urban households in southern Ontario, Canada. Results highlighted that, although a proportion of survey respondents were familiar with diseases of dogs that can cause disease in humans (canine zoonoses), many were not aware of, or lacked knowledge of these types of diseases. Moreover, there were no differences in awareness of canine zoonoses among the three populations of respondents.

Considering dogs are owned in nearly half of all Canadian households (Canadian Animal Health

Institute 2017), our findings emphasized the need for general public health education to improve public knowledge of canine zoonoses and control transmission. Finally, this study underlined the importance of knowledge exchange between veterinarians and dog owners. Communication between veterinarians and dog owners did occur but could be improved.

Finally, in Chapter 7, we described the proportions of newly acquired dogs that were domestically sourced and imported, their characteristics including where they were sourced/imported from and accompanying health documentation, and respondent opinions regarding disease risks related to sources of dogs. We also explored whether a difference in the proportion of imported dogs existed between rural and urban households in southern Ontario.

Previous to this study, data were scarce regarding the number, type, and origins of domestically

229

sourced and imported dogs into Canada (Anderson et al. 2016, 2019), and into southern Ontario in particular. Imported dogs can carry and transmit canine-specific and/or zoonotic pathogens that are uncommon or rare in Canada (Anderson et al. 2019). The domestic movement of dogs within Canada could pose similar risks. Most dogs in our study were acquired by respondents domestically from within Ontario, Canada. Yet there are currently no regulations or surveillance systems in place to monitor the movement of domestically sourced dogs. According to Canadian import requirements, rabies vaccination is the only required proof of immunization. Despite minimal requirements, some dog owners in southern Ontario do not comply with the mandatory provincial rabies vaccination policy which can put local domestic dog and human populations at potential risk.

KEY THEMES

This section of the dissertation discussion and concluding chapter highlights three noteworthy drivers for the conduct of this PhD, and themes common to each of the five research projects contributing to this dissertation. These drivers are: the importance of geography in the epidemiologic investigation of canine zoonoses; public health education and knowledge translation of empirical research evidence; and finally, consideration of One Health in addressing canine zoonoses.

Canine zoonoses are a geographic challenge. That is, they differ in their geographic endemicity and their impact on the health of people and dogs around the world, and within different provinces and communities across Canada (Alton et al. 2009, Chomel 2014, Bouchard et al. 2015, Damborg et al. 2016). For this dissertation, epidemiological studies were conducted in rural, urban, and remote communities in Canada to investigate risks that may contribute to the

230

transmission of canine zoonoses between dogs and people. Regardless of geographical location, culture, or type of community, dogs represent a way of life for humans. The human-dog bond can include companionship, protection, transportation, and familial support (Herzog 2011). Thus, the role of dogs is diverse and transformative; today, in the western world, in addition to being kept outside, many dogs commonly reside in homes and sleep in beds with humans (Chomel and

Sun 2011). In Inuit culture, working qimmiit accompany individuals and families on the land for hunting and the acquisition of country food. Dogs and humans are also closely linked in an epidemiological sense; they share zoonotic protozoan parasites (e.g., Giardia intestinalis assemblage B, Cryptosporidium parvum) (Xiao and Feng 2008, Yaoyu and Xiao 2011), dogs act as sentinels for zoonotic diseases in humans (Day et al. 2012), and dogs contribute to, and are indicative of, ecosystem health (Paul et al. 2010). Recognition of the fact that dogs can be sources of disease in humans is apparent in some populations, but needs to be improved; without public recognition, canine zoonoses can be misunderstood, underappreciated, under-reported and underrecognized.

The translation of empirical research findings into public health education is crucial. The purpose of the epidemiological studies conducted as part of this dissertation was to address gaps within the existing canine zoonotic literature. Our results provide novel information for health professionals and the public that is contextualized within existing research evidence. Improving professional and public education about the incidence, prevalence, and potential risks associated with canine zoonoses may help to highlight the importance of these types of diseases.

Furthermore, we anticipate that our research may also provide a platform from which to develop public health policy and incite proactive changes in preventive behaviours regarding the

231

transmission of canine zoonoses. Knowledge translation of empirical research provides an effective means through which to engage government (e.g., public health units, Ministries), non- governmental organizations (e.g., Humane Societies, shelters), regulatory bodies, academia, and the broader public in research that may otherwise be restricted to those in academia and academic institutions – a direct antithesis of the philosophy of One Health as applied to the conduct of health research. One of the main drivers for this dissertation was public engagement with research. Regarding Chapter 4 (Prevalence and genetic characterization of Giardia spp. and Cryptosporidium spp. in dogs in Iqaluit, Nunavut, Canada), knowledge translation materials in the form of posters, oral presentations, and handbooks were collaboratively developed for local public health groups and the public to engage with scientific findings in diverse and useful ways. An example of knowledge translation document developed as part of dissertation research can be found in Appendix 4.2. Furthermore, to share the results with the scientific community, we submitted three dissertation chapters for publication. Two chapters have been published and one is under peer review. It is our intention to submit the other two research chapters that contribute to this dissertation. However, more can and should be done. Communicating the importance of controlling and preventing canine zoonoses is necessary across age groups, communities, and various disciplines. The International One Health for One Planet Education

Initiative (1 Hope), fosters learning about One Health and empirical research findings at all levels of formal and informal education

(https://www.onehealthcommission.org/en/programs/one_health_education_task_force/). Some additional knowledge translation materials that could have been considered as follow up activities related to the dissertation results include: (1) Collaborating with animal behaviourists

232

and social scientists to create multimedia Whiteboard Animation Videos in grade 4 to 6 language depicting common characteristics of biting dogs. For example, biting dog age, sex, and warning signs to look for when playing or interacting with dogs, evidence based statistics of the incidence of dog bites in southern Ontario, the importance of vaccinating dogs against rabies, and recommendations for bite avoidance (Chapter 5); (2) Partnering with public health units and non- profit organizations such as the Canadian Veterinary Medical Association, to develop simple, concise, and colour-appropriate data visualization tools, such as infographics. Infographics can be useful to display common canine zoonoses, the importance of dialogue between veterinarians and the public, and which diseases are important for the public to discuss with their veterinarians and physicians (Chapter 6); finally, in collaboration with any canine importation working groups/bodies of the future, and the Centre for Public Health and Zoonoses, and students in

Applied Arts in Media Studies at the University of Guelph, develop One Health podcasts highlighting the risks to humans and dogs from the relocation of dogs (i.e., those domestically sourced and imported) and recommendations for mitigating those risks (Chapter 7). Due to time restrictions of a PhD degree, I am unfortunately not able to implement these ideas and suggestions. However, they constitute possible considerations for future graduate students in epidemiology with an interest in public health issues related to dogs.

The case for the convergence of human, animal, and environmental health is profound.

Dogs can act as known and novel, direct and indirect sources of zoonoses. Furthermore, dogs in modern society are uniquely positioned in their closeness to humans and their abundance within the environment to asymptomatically carry and even transmit potentially serious zoonoses. In an

Ontario study conducted in 2004, Salmonella spp., Campylobacter spp., Malassezia

233

pachydermatis, Clostridium difficile, multi-drug resistant Staphylococcus aureus (MRSA), and other potentially zoonotic agents, were isolated from 80% of asymptomatic therapy dogs

(Lefebvre et al. 2006). Given the complexities of zoonoses, the philosophy of One Health allows us to consider addressing global, national, and local challenges of infectious and zoonotic disease in an integrated and holistic manner (Harrison et al. 2019). Furthermore, as a systems-level approach to health, (Harrison et al. 2019), One Health challenges the historically siloed and traditional reductionism approaches in medicine by considering the health of humans and animals within their wider ecological context (Zinsstag et al. 2011, King 2014). The idea of the

One Health concept is appealing, it makes implicit sense, and is warranted for all of the reasons mentioned. However, the philosophy of One Health is often difficult to implement and is constrained by other facets including, time, organization, and limitations of inter-organizational bureaucracy (Schurer et al. 2016). Despite constraints, the One Health philosophy underscores an opportunity for collaboration between veterinary, medical, and public health professionals within communities to address the challenges of zoonoses. All of the studies conducted in this dissertation highlighted the need for collaboration within the health sector and consider One

Health, which cannot be ignored as an important collaborative approach to the conduct of health research. The diverse roles of dogs, their closely shared environments with humans, and their role as known and potential sources of zoonotic pathogens provides the rationale from which to explore the health of dogs and humans in an integrated manner.

LIMITATIONS

Our research has some limitations. Geography may moderate the impact of dog ownership on human health (Saunders et al. 2017). Previous evidence also suggests the

234

endemicities of some canine zoonoses are influenced by natural and built environments, culture, the movements of dogs, and geographical factors (Lambin et al. 2010). We conducted canine zoonotic research in three different geographical locations: Arctic Canada (Chapter 4) and among rural and urban respondents in southern Ontario, Canada (Chapters 5, 6, and 7). We explored potential canine zoonoses in the Arctic and investigated issues related to dogs and public health in rural and urban southern Ontario, Canada. Our findings are therefore distinct geographically and present almost entirely non-overlapping canine zoonotic information.

Furthermore, although valuable in highlighting key baseline information, the design of our study in the Arctic did not allow us to investigate information regarding the source(s) of Giardia and

Cryptosporidium in dogs. Indeed, with more resources and time, further studies investigating the incidence of human illness due to Giardia intestinalis assemblage B that is attributable to dogs are needed. These types of source attribution studies would move our understanding forward regarding the source(s) of this parasite in Iqaluit, Nunavut, Canada.

We conducted research for Chapters, 5, 6, and 7 to identify community-level and public health issues related to dogs in two comparative communities. However, we did not discern what prior knowledge, if any, respondents may have had pertaining to bite avoidance, whether biting dogs were repeat offenders, and what psychological, economic, and/or cultural beliefs respondents may have had around human exposures to dog bites and canine rabies vaccination. It is important to explore prior knowledge and psychological beliefs surrounding bite avoidance as these variables may affect what precautions, if any, an individual may take to avoid being bitten by a dog. Economic and/or cultural beliefs may have some influence on the built environment in which a respondent resides and spends his/her time (e.g., presence or absence of green spaces,

235

including dog parks), and therefore have some effect on the risk of a biting incident. While we identified statistical differences between households in different geographies, our study findings pertaining to dog bites differ from those previously reported. Indeed, we employed different methodologies than those included in previous studies. While online questionnaires have benefits

(convenient, ease of use for both researchers and respondents, can be inexpensive, fast, and flexible), by employing this mode of questionnaire delivery, we were limited, for instance, to those individuals who were panelists on the online survey agency Dynata™ (formerly

ResearchNow™)) and to those panelists who had access to the internet at the time our questionnaire was available. Future studies can improve on our methodology by distributing the questionnaire to a wider demographic while maintaining the advantages of an online modality.

For instance, posting the questionnaire link on social media sites, within public online forums, and listservs. Future studies that incorporate similar methodologies are needed to inform whether direct application of our findings to targeted public health messaging is appropriate.

Regarding knowledge transfer and translation of materials, although a lot more could have been done to disseminate the results (as described in the previous section) extensive knowledge translation was not possible within the structure of my graduate program.

The multifactorial influences on the endemicities of canine zoonoses emphasize the need for integrated control strategies. Interestingly, including studies in this dissertation, few research endeavours of canine zoonoses have directly employed and operationalized One Health in research. Indeed, few studies have considered the enormous potential role of companion animals, including dogs, in One Health (Day 2011). Although our research provided valuable insight into public health issues related to dogs in three geographical areas, due to time, organizational, and

236

funding limitations, only one of the studies was part of a larger One Health endeavour (Julien et al. 2019). Though desirable, the adoption of One Health is not necessarily an easy task – it takes time, prioritizing community trust, engagement, and empowerment (Cleaveland, Sharp, Abela-

Ridder, Allan, Buza, Crump, Davis, Del Rio Vilas, de Glanville, et al. 2017). International agencies such as the World Health Organization, World Organization for Animal Health, and

Food and Agricultural Organization, have collectively employed and implemented a One Health framework for the global elimination of canine-mediated rabies by 2030 (World Health

Organization et al. 2015), but One Health frameworks have not yet been developed for other canine zoonoses. There are reasons why other zoonoses do not garner as much international concern and response: the first is that for many zoonoses, there is low potential for sustained animal-to-human transmission and therefore low potential of spread with the movements of animals and people. The second, is that while many zoonoses can cause morbidities in animals and humans, rabies is the only zoonosis that is almost always fatal. Prevention of human deaths provides a strong impetus to consider and apply integrated approaches to health. These factors can reduce the immediate awareness and concern regarding canine zoonoses thereby affecting consideration for the One Health approach in health research directed at canine zoonoses other than canine-mediated rabies.

FUTURE DIRECTIONS

Future work should explore data collected in Chapter 3 in the conduct of highly focused studies, such as systematic reviews to identify, appraise and synthesize empirical evidence regarding, for instance: 1) an analysis of the canine zoonotic disease burden due to human infections in the sovereign states and dependent territories of North America regarding

237

Ehrlichia spp., or Borrelia burgdorferi or Leptospira spp., rabies virus, or influenza viruses. This could provide necessary information regarding how important the five most researched canine zoonotic pathogens are to the region-specific disease burden in human beings and/or in dogs and/or 2) the prevalence of direct and indirect canine zoonoses (as listed above) in domestic dogs in low and/or medium IHDI countries in North America.

We suggest that future research in Iqaluit, Nunavut be led and driven by the community.

Building from our community-based study (Chapter 4), future studies could investigate the direction of transmission of Giardia intestinalis assemblage B among dogs and humans through qualitative and quantitative epidemiological studies. Under the philosophy of One Health, such a future study may prioritize the investigation of the environment (biota including soil in and around homes where dogs are kept and sled dog teams), husbandry (food, health management practices), and collect feces directly from owned dogs to inform the baseline data from Chapter

4. If dogs are a potential exposure for acute gastrointestinal illness in humans, it may be prudent for the community to determine culturally appropriate and sensitive public health strategies for mitigation of risk in this human population.

Our findings from Chapter 5 may inform the development of community-specific public health education strategies, but also inform mixed methods studies to determine what people know about dog bite avoidance (e.g., how to act around dogs unfamiliar to them, how to prevent dog bites, and most appropriate health-seeking behaviours when bitten). Furthermore, it would be appropriate to determine why owners of dogs are not compliant with rabies vaccination requirements. That is, what psychological, economic, cultural, and other beliefs may influence canine rabies vaccination compliance in southern Ontario, Canada.

238

Among respondents in our study, there were some who were aware of canine zoonoses; however, improvements are needed. There are therefore opportunities to build capacity within our public health and educational systems. Low levels of knowledge and awareness of zoonoses is likely due to inadequate communication between veterinary and human health professionals and the public (Cripps 2000). Indeed, physicians can be taught how to engage with patients about pets in the family, and when they do, this can improve communication, highlight relevant and important information, and strengthen patient-centered rapport and cooperation between physicians and their patients (Hodgson et al. 2017). While recent research has been conducted to engage physicians in One Health approaches to patient care, including the use of pet-centered educational tools (Hodgson 2019), future participatory action research studies may benefit from engaging both veterinarians and physicians in the collaborative development of simple tools that empower their clients and patients, respectively. This may include focusing on the importance of the human-animal bond and on One Health. One Health is relevant to common zoonoses (rabies, leptospirosis, leishmaniasis, Toxocara spp., Giardia spp.,) but should also include injuries

(human exposures to dog bites and others), socio-economic resources for families, and environmental impacts on the health of animals and people (e.g., chemical pollutants and other contaminants) (Hodgson 2019). Not only does the collaborative development of educational tools have the advantage of bringing veterinarians and physicians together at the start of a project, it potentially benefits their continued alliances into the future.

As data gathered in Chapter 7 were restricted to southern Ontario respondents, future studies may focus on what pathogens are likely to circulate between provinces and could be imported through the sourcing of dogs into Canada. Plausibly, digital datasets detailing pet dog

239

movements may be combined with spatial epidemiological data to infer pathogen movement patterns across Canada. Currently, Statistics Canada does not collect information regarding the number of dogs as pets in households nor the relocation (importation or domestic movement) of dogs into and across Canada. However, the Canadian Animal Health Institute (CAHI) does collect household dog ownership statistics (Canadian Animal Health Institute 2017)). Other potential datasets that inform spatial epidemiology studies may include, social media, air and shipping statistics, and personal Global Positioning System (GPS) data.

CONCLUSION

This chapter synthesized key data describing canine zoonoses in the context of three geographic locations in Canada with key relevance to veterinarians, physicians, public health professionals, and the public. Data pertaining to canine zoonotic pathogens in North America, the role of dogs as potential sources of Giardia spp., and Cryptosporidium spp., in Iqaluit,

Nunavut, Canada, and the incidence of dog bites, prevalence of public knowledge and awareness of canine zoonoses, and sourcing of dogs in southern Ontario, Canada, was intended to offer important information informing previous gaps in knowledge. Addressing gaps in knowledge is useful for informing future research, for public education and the development of public health mitigation strategies regarding the control and prevention of canine zoonoses. Dogs provide many benefits that have become intrinsically woven into societal fabric. Research contributing to this dissertation provided evidence for some potential public health risks associated with dogs. It is evident that public health issues related to dogs exist in rural, urban, and remote communities in Canada. Importantly, it would be prudent to consider the broader context of communities including their history with dogs, culture, and differences in public perceptions of risks

240

associated with canine zoonoses when considering education and mitigation strategies. Finally, despite some challenges, together there is value in operationalizing One Health as a pragmatic approach to achieving multiple objectives and overcoming economic, political, and social barriers to the control and prevention of canine zoonoses.

REFERENCES

Alton, G. D., Berke, O., Reid-Smith, R., Ojkic, D., & Prescott, J. F. (2009). Increase in seroprevalence of canine leptospirosis and its risk factors, Ontario 1998-2006. Canadian Journal of Veterinary Research, 73(3), 167–175. Anderson, M., Douma, D., Kostiuk, D., Filejski, C., Rusk, R., Weese, J. S., Bourque, T., Lee- Fuller, C., & Rajzman, C. (2016). Report of the Canadian National Canine Importation Working Group. https://www.canadianveterinarians.net/documents/canadian-canine- importation-working-group-report Anderson, M. E. C., Stull, J. W., & Weese, J. S. (2019). Impact of dog transport on high-risk infectious diseases. Veterinary Clinics of North America: Small Animal Practice, 49(4), 615–627. https://doi.org/10.1016/j.cvsm.2019.02.004 Bottoms, K., Trotz-Williams, L., Hutchison, S., MacLeod, J., Dixon, J., Berke, O., & Poljak, Z. (2014). An evaluation of rabies vaccination rates among canines and felines involved in biting incidents within the Wellington-Dufferin-Guelph Public Health Department. Zoonoses and Public Health, 61(7), 499–508. https://doi.org/http://dx.doi.org/10.1111/zph.12101 Bouchard, C., Leonard, E., Koffi, J. K., Pelcat, Y., Peregrine, A., Chilton, N., Rochon, K., Lysyk, T., Lindsay, L. R., & Ogden, N. H. (2015). Special report: The increasing risk of Lyme disease in Canada. Canadian Veterinary Journal, 56(7), 693–699. Bowser, N., & Anderson, N. (2018). Dogs (Canis familiaris) as sentinels for human infectious disease and application to Canadian populations: A Systematic Review. Veterinary Sciences, 5(4), 83. https://doi.org/10.3390/vetsci5040083 Canadian Animal Health Institute. (2017). Latest Canadian Pet Population Figures Released. https://www.canadianveterinarians.net/documents/canadian-pet-population-figures-cahi- 2017 Chomel, B. B. (2014). Emerging and re-emerging zoonoses of dogs and cats. Animals, 4(3), 434–445. https://doi.org/10.3390/ani4030434 Chomel, B. B., & Sun, B. (2011). Zoonoses in the bedroom. Emerging Infectious Diseases, 17(2), 167–172. https://doi.org/10.3201/eid1702.101070 Cleaveland, S., Sharp, J., Abela-Ridder, B., Allan, K. J., Buza, J., Crump, J. A., Davis, A., Del Rio Vilas, V. J., de Glanville, W. A., Kazwala, R. R., Kibona, T., Lankester, F. J., Lugelo, A., Mmbaga, B. T., Rubach, M. P., Swai, E. S., Waldman, L., Haydon, D. T., Hampson, K., & Halliday, J. E. B. (2017). One Health contributions towards more effective and equitable approaches to health in low- and middle-income countries. Philosophical Transactions of the Royal Society B: Biological Sciences, 372(1725), 20160168. 241

https://doi.org/10.1098/rstb.2016.0168 Cripps, P. J. (2000). Veterinary education, zoonoses and public health: A personal perspective. Acta Tropica, 76(1), 77–80. https://doi.org/10.1016/S0001-706X(00)00094-2 Damborg, P., Broens, E. M., Chomel, B. B., Guenther, S., & Pasmans, F. (2016). Bacterial zoonoses transmitted by household pets : State-of-the-art and future perspectives for targeted research and policy actions. Journal of Comparative Pathology, 155(1), S27–S40. https://doi.org/10.1016/j.jcpa.2015.03.004 Day, M. J. (2011). One health: the importance of companion animal vector-borne diseases. Parasites & Vectors, 4(1), 302–302. https://doi.org/http://dx.doi.org/10.1186/1756-3305-4- 49 Day, M. J., Breitschwerdt, E., Cleaveland, S., Karkare, U., Khanna, C., Kirpensteijn, J., Kuiken, T., Lappin, M. R., McQuiston, J., Mumford, E., Myers, T., Palatnik-de-Sousa, C. B., Rubin, C., Takashima, G., & Thiermann, A. (2012). Surveillance of zoonotic infectious disease transmitted by small companion animals. Emerging Infectious Diseases, 18(12), e1–e1. https://doi.org/10.3201/eid1812.120664 Friedmann, E., & Son, H. (2009). The human-companion animal bond: How humans benefit. Veterinary Clinics of North America - Small Animal Practice, 39(2), 293–326. https://doi.org/10.1016/j.cvsm.2008.10.015 Furuse, Y. (2019). Analysis of research intensity on infectious disease by disease burden reveals which infectious diseases are neglected by researchers. Proceedings of the National Academy of Sciences of the United States of America, 116(2), 478–483. https://doi.org/10.1073/pnas.1814484116 Harrison, S., Kivuti-bitok, L., Macmillan, A., & Priest, P. (2019). EcoHealth and One Health : A theory-focused review in response to calls for convergence. Environment International, 132(February), 105058. https://doi.org/10.1016/j.envint.2019.105058 Herzog, H. (2011). The impact of pets on human health and psychological well-being : fact, fiction, or hypothesis? Current Directions in Psychological Science, 20(4), 236–239. https://doi.org/https://doi.org/10.1177/0963721411415220 Hodgson, K. (2019). Commentary Engaging family physicians in one health. 254(11), 1267– 1269. Hodgson, K., & Darling, M. (2011). Zooeyia: an essential component of “One Health.” The Canadian Veterinary Journal, 52(2), 189–191. Hodgson, K., Darling, M., Freeman, D., & Monavvari, A. (2017). Asking About Pets Enhances Patient Communication and Care : A Pilot Study. https://doi.org/10.1177/0046958017734030 Julien, D. A., Sargeant, J. M., Guy, R. A., Shapiro, K., Imai, R. K., Bunce, A., Sudlovenick, E., Chen, S., Li, J., & Harper, S. L. (2019). Prevalence and genetic characterization of Giardia spp. and Cryptosporidium spp. in dogs in Iqaluit, Nunavut, Canada. Zoonoses and Public Health, June, zph.12628. https://doi.org/10.1111/zph.12628 Karesh, W. B., Dobson, A., Lloyd-smith, J. O., Lubroth, J., Dixon, M. A., Bennett, M., Aldrich, S., Harrington, T., Formenty, P., Loh, E. H., Machalaba, C. C., Thomas, M. J., & Heymann, D. L. (2012). Ecology of zoonoses : natural and unnatural histories. The Lancet, 380(9857), 1936–1945. https://doi.org/10.1016/S0140-6736(12)61678-X King, L. J. (2014). Combating the Triple Threat: The need for a One Health approach. One

242

Health, 3–15. https://doi.org/10.1128/microbiolspec.oh-0012-2012 Lambin, E. F., Tran, A., Vanwambeke, S. O., Linard, C., & Soti, V. (2010). Pathogenic landscapes: Interactions between land, people, disease vectors, and their animal hosts. International Journal of Health Geographics, 9(1), 54. https://doi.org/10.1186/1476-072X- 9-54 Lefebvre, S. L., Waltner-Toews, D., Peregrine, A. S., Reid-Smith, R., Hodge, L., Arroyo, L. G., & Weese, J. S. (2006). Prevalence of zoonotic agents in dogs visiting hospitalized people in Ontario: Implications for infection control. Journal of Hospital Infection, 62(4), 458–466. https://doi.org/10.1016/j.jhin.2005.09.025 McNicholas, J., Gilbey, A., Rennie, A., Ahmedzai, S., Dono, J., & Ormerod, E. (2005). Pet ownership and human health: a brief review of evidence and issues. BMJ, 331(7527), 1252– 1254. https://doi.org/10.1136/bmj.331.7527.1252 Paul, M., King, L., & Carlin, E. P. (2010). Zoonoses of people and their pets: a US perspective on significant pet-associated parasitic diseases. Trends in Parasitology, 26(4), 153–154. https://doi.org/10.1016/j.pt.2010.01.008 Rabinowitz, P., & Conti, L. (2013). Links among human health, animal health, and Ecosystem Health. Annual Review of Public Health. https://doi.org/10.1146/annurev-publhealth- 031912-114426 Sable, P. (2013). The pet connection: An attachment perspective. Clinical Social Work Journal, 41(1), 93–99. https://doi.org/10.1007/s10615-012-0405-2 Saunders, J., Parast, L., Babey, S. H., & Miles, J. V. (2017). Exploring the differences between pet and non-pet owners: Implications for human-animal interaction research and policy. PLoS ONE, 12(6), 1–15. https://doi.org/10.1371/journal.pone.0179494 Schurer, J. M., Mosites, E., Li, C., Meschke, S., & Rabinowitz, P. (2016). Community-based surveillance of zoonotic parasites in a ‘One Health’ world: A systematic review. One Health, 2, 166–174. https://doi.org/10.1016/j.onehlt.2016.11.002 Service Ontario e-Laws 1990a. (1990). Health Protection and Promotion Act, Regulation 567: Rabies Immunization. https://www.ontario.ca/laws/regulation/900567 Szpakowski, N. M., Bonnett, B. N., & Martin, S. W. (1989). An epidemiological investigation into the reported incidents of dog biting in the City of Guelph. The Canadian Veterinary Journal, 30, 937–942. World Health Organization, Organization International des Epizooties, & Nations, F. and A. O. of the U. (2015). Rationale for investing in the global elimination of dog-mediated human rabies. Report of the Rabies Global Conference, Geneva, Switzerland. Xiao, L., & Feng, Y. (2008). Zoonotic cryptosporidiosis. FEMS Immunology and Medical Microbiology, 52(3), 309–323. https://doi.org/10.1111/j.1574-695X.2008.00377.x Yaoyu, F., & Xiao, L. (2011). Zoonotic potential and molecular epidemiology of Giardia species and giardiasis. Clinical Microbiology Reviews, 24(1), 110–140. https://doi.org/10.1128/CMR.00033-10 Zinsstag, J., Schelling, E., Waltner-Toews, D., & Tanner, M. (2011). From “one medicine” to “one health” and systemic approaches to health and well-being. Preventive Veterinary Medicine, 101(3–4), 148–156. https://doi.org/10.1016/j.prevetmed.2010.07.003

243

APPENDICES

244

Appendix 2. 1 Publicly available online information regarding canine zoonoses and vectorborne diseases from relevant region-specific organizations

Organization Website Canadian Food http://www.inspection.gc.ca/animals/terrestrial- Inspection Agency animals/diseases/reportable/eng/1303768471142/1303768544412 (CFIA) Centre for https://www.canada.ca/en/public-health/services/infectious- Foodborne, diseases/centre-food-borne-environmental-zoonotic-infectious- Environmental and diseases.html Zoonotic Infections (via the Public Health Agency of Canada (PHAC) Pan American Health https://www.paho.org/salud-en-las-americas-2017/?p=1235 Organization (PAHO) US Centers for https://www.cdc.gov/ncezid/stories- Disease Control and features/browse/subjects/zoonotic-diseases.html Prevention (CDC) World Health https://www.who.int/neglected_diseases/ISBN9789241508568_ok.pdf Organization (WHO) World Organization https://www.oie.int/doc/ged/D8633.PDF for Animal Health (OIE)

245

Appendix 2. 2 Explanation and elaboration (“guidance”) document for reviewers for title/abstract (Level 1) screening This guidance document contains questions and answer options for three levels: level 1 pertains to title and abstract eligibility screening; level 2 full text publication screening, and level 3 for data-charting. Level 1: Title, abstract, and index terms will be screened for relevance using the following questions, with the response options “yes”, “no”, and “unclear”. Keywords pertaining to the question are listed where relevant for clarity: 1. Is the citation an obvious duplicate? 2. Was the study conducted in North America1? 3. Does the title/abstract investigate canine zoonoses in the primary target population of domestic dogs (i.e., Canis familiaris)? 4. Does the title/abstract describe primary research2 ? Reviewer Decision: - If the reviewer answer is “no” to question 1, and “yes” or “unclear” to questions 1, 2 or 3, the article will move forward into the full text level 2 screening

- Studies will be excluded if both reviewers agree that the answer is “no” to any of the above questions. 1Anguilla; Antigua and Barbuda; Aruba; The Bahamas; Barbados; Belize; Bermuda; Bonaire; British Virgin Islands; Canada; Cayman Islands; Clipperton Island; Costa Rica; Cuba; Curacao; Dominica; Dominican Republic; El Salvador; Federal Dependencies of Venezuela; Greenland; Grenada; Guadeloupe; Guatemala; Haiti; Honduras; Jamaica; Martinique; Mexico; Montserrat; Navassa Island; Nicaragua; Nueva Esparta; Panama; Puerto Rico; Saba; San Andres and Providencia; Saint Barthelemy; Saint Kitts and Nevis; Saint Lucia; Saint Martin; Saint Pierre and Miquelon; Saint Vincent and the Grenadines; Sint Eustatius; Sint Maarten; Trinidad and Tobago; Turks and Caicos Islands; United States; and the United States Virgin Islands. If some studies list the province (Canada) and state (USA) but do not for whatever reason list the country, the following are links to the 13 Canadian provinces: https://www.canada.ca/en/immigration-refugees-citizenship/services/new-immigrants/prepare-life- canada/provinces-territories.html and, 50 USA states: https://state.1keydata.com/state-abbreviations.php 2 Primary research is defined as original scientific reports of research findings. It is research that is published based on original observations, surveys, interviews, and experimentation. The basic aim of primary research is to learn something new that can be replicated and validated by experts in a field of study. Examples of publications that are not primary research (e.g. Literature reviews, meta- analyses/review articles; editorials; chapters in books (some); encyclopedia articles).

246

Appendix 2. 3 Explanation and elaboration (“guidance”) document for reviewers for full text (Level 2) screening Level 2: Screening will be conducted on full text publications for studies that meet the “yes” or “unclear” answer to level 1 screening questions. The following questions will be used for level 2 eligibility screening with answers “yes” or “no” only. Studies will be excluded if both reviewers are in agreement in answering “no” to any of the following questions:

1. Could we find the full text? 2. Is this an obvious duplicate? 3. Is the full text publication a journal article or conference proceeding (>500 words)? 4. Is the full text article or conference proceeding (>500 words) describing a primary research study? 5. Is the full text article available in English, French or Spanish? 6. Has the primary research been published or presented (e.g., conference proceedings (> 500 words)) within the period 2000 – present? 7. Does the full text research investigate one or more canine zoonoses of interest? 8. Has the full text research been conducted in North America? 9. Is the study at the dog-level or pathogen-level where the zoonotic pathogen was isolated from a dog? 10. In the full text publication, are domestic dogs the target population?

Full Text Screening (Level 2 – Eligibility Screening Form) Question Options Action and Keywords 1.Could we find the full Please select one. (i.e., text?  Yes radio question in  No [EXCLUDE] DistillerSR)

2.Is this an obvious Please select one. (i.e., duplicate?  Yes [EXCLUDE] radio question in  No DistillerSR)

3.Is the full text Please select one. (i.e., publication a journal  Yes radio question in article or conference  No [EXCLUDE] DistillerSR) proceeding (>500 words)? Keywords: Primary research is defined as original scientific reports of research findings. e.g., research article, clinical report, case study, dissertation, books (some), interviews; manuscripts; papers;

247

4.Is the full text article Please select one. (i.e., or conference  Yes radio question in proceeding (>500  No [EXCLUDE] DistillerSR) words) describing a primary research study? (Variable = pubtype) 5.Is the full text article Please select one. (i.e., available in English,  Yes radio question in French or Spanish?  No [EXCLUDE] DistillerSR)

6.Has the primary Please select one. (i.e., research been published  Yes radio question in or presented (e.g.,  No [EXCLUDE] DistillerSR) conference proceedings (> 500 words)) within the period 2000 – Keywords: note the year the article present? was published 7.Does the full text Please select one. (i.e., research investigate one  Yes radio question in or more canine zoonoses  No [EXCLUDE] DistillerSR) of interest? Keywords: Anaplasma OR Ancylostoma OR Babesia OR Bacillus “Baylisascaris procyonis” OR “Borrelia burgdorferi” OR Brucella OR Campylobacter OR Capnocytophaga OR “Coxiella burnetii” OR Corynebacterium OR “Cryptosporidium parvum” OR “Dipylidium caninum” OR “Echinococcus granulosus” OR “Echinococcus multilocularis” OR Ehrlichia OR “Entamoeba histolytica” OR “Escherichia coli” OR “Giardia intestinalis” OR Helicobacter OR Influenza OR “Leishmania chagasi” OR “Leishmania infantum” OR Leptospira OR “Methicillin resistance staphylococcus aureus” OR “Microsporum canis” OR “Onchocerca lupi” OR Pasteurella OR Proteus OR Pseudomonas OR Rabies OR “Rickettsia rickettsii” OR Salmonella OR “Sarcoptes scabiei” OR Spirocerca OR “Sporothrix schenckii” OR “Toxocara canis” OR “Toxoplasma gondii” OR “Trichinella spiralis” OR “Trypanosoma cruzi” OR “Uncinaria stenocephala” OR

248

“Vibrio cholerae” OR “Yersinia enterocolitica”

8.Has the full text Please select one. (i.e., research been conducted  Yes radio question in in North America?  No [EXCLUDE]] DistillerSR)

Keywords: Anguilla; Antigua and Barbuda; Aruba; The Bahamas; Barbados; Belize; Bermuda; Bonaire; British Virgin Islands; Canada; Cayman Islands; Clipperton Island; Costa Rica; Cuba; Curacao; Dominica; Dominican Republic; El Salvador; Federal Dependencies of Venezuela; Greenland; Grenada; Guadeloupe; Guatemala; Haiti; Honduras; Jamaica; Martinique; Mexico; Montserrat; Navassa Island; Nicaragua; Nueva Esparta; Panama; Puerto Rico; Saba; San Andres and Providencia; Saint Barthelemy; Saint Kitts and Nevis; Saint Lucia; Saint Martin; Saint Pierre and Miquelon; Saint Vincent and the Grenadines; Sint Eustatius; Sint Maarten; Trinidad and Tobago; Turks and Caicos Islands; United States; and the United States Virgin Islands.

If some studies list the province (Canada) and state (USA) but do not for whatever reason list the country, the following are links to the 13 Canadian provinces: https://www.canada.ca/en/immigrat ion-refugees- citizenship/services/new- immigrants/prepare-life- canada/provinces-territories.html

and, 50 USA states: https://state.1keydata.com/state- abbreviations.php 9.Is the study at the dog- Please select one. (i.e., level or pathogen-level  Yes radio question in where the zoonotic  No [EXCLUDE]] DistillerSR) pathogen was isolated from a dog? Keywords: Pathogen-level can include studies of canine zoonoses 249

specific to the agents of disease: bacteria; viruses; parasites; fungi

10. In the full text Please select one. (i.e., publication, are  Yes radio question in domestic dogs the target  No [EXCLUDE] DistillerSR) population?

250

Appendix 2. 4 Explanation and elaboration (“guidance”) document for reviewers for data- charting (Level 3 screening) Level 3 Data-Charting Form Relevant data will be extracted from full text publications using the following questions. Keywords pertaining to the question are listed where relevant for clarity:

1. Is the full text publication a journal article or conference proceeding (>500 words)? 2. Is the full text article or conference proceeding (>500 words) describing a primary research study? 3. Is the full text article available in English, French or Spanish? 4. Has the primary research been published or presented (e.g., conference proceedings (> 500 words)) within the period 2000 – present? 5. Does the full text research propose to investigate one or more canine zoonoses of interest? 6. Has the full text research been conducted in North America? 7. Is the study at the dog-level or pathogen-level where the zoonotic pathogen was isolated from a dog? 8. Is the dog-level study approach described by authors? 9. Does the full publication list the type(s) of domestic dogs as the target population? 10. Is the general focus of the pathogen-level study described? 11. Was any type of integrated collaborative approach listed as part of the study (e.g., in the objectives or methods)?

251

Full Text Data Extraction (Level 3 – Data-Charting Form) Question Options Action and Keywords 1. Is the full text Please select one. (i.e., radio publication a journal  Yes, journal article question in DistillerSR) article or conference  Yes, conference proceeding proceeding (>500 (>500 words) Keywords: Primary research is defined as original scientific reports of words)? research findings. (Variable = e.g., research article, clinical report, primres) case study, dissertation, books (some), interviews; manuscripts; papers; 2. Is the full text Please select one. (i.e., radio article or conference  Yes, journal article question in DistillerSR) proceeding (>500  Yes, conference proceeding words) describing a (>500 words) primary research study? (Variable = pubtype) 3. Is the full text Please select one. (i.e., radio article available in  Yes, in English question in DistillerSR) English, French or  Yes, in French Spanish?  Yes, in Spanish (Variable = language) 4. Has the primary Please select one. (i.e., radio research been  Yes, 2000 question in DistillerSR) published or  Yes, 2001 presented (e.g.,  Yes, 2002 conference  Yes, 2003 Keywords: note the year the article was published proceedings (> 500  Yes, 2004 words)) within the  Yes, 2005 period 2000 –  Yes, 2006 present? (Variable =  Yes, 2007 year)  Yes, 2008

 Yes, 2009  Yes, 2010  Yes, 2011  Yes, 2012  Yes, 2013  Yes, 2014  Yes, 2015  Yes, 2016  Yes, 2017

252

 Yes, 2018

5. Does the full text Please select all that apply. research propose to  Yes, Anaplasma (i.e., checkbox option in investigate one or  Yes, Ancylostoma DistillerSR) more canine  Yes, Babesia zoonoses of interest?  Yes, Bacillus (Anthrax) Keywords: Anaplasma OR Ancylostoma OR Babesia OR Bacillus (Variable=disease)  Yes, Baylisascaris procyonis “Baylisascaris procyonis” OR  Yes, Borrelia burgdorferi “Borrelia burgdorferi” OR Brucella OR Campylobacter OR Capnocytophaga (Lyme disease) OR “Coxiella burnetii” OR  Yes, Brucella Corynebacterium OR  Yes, Campylobacter “Cryptosporidium parvum” OR “Dipylidium caninum” OR  Yes, Capnocytophaga “Echinococcus granulosus” OR  Yes, Corynebacterium “Echinococcus multilocularis” OR Ehrlichia OR “Entamoeba histolytica”  Yes, Coxiella burnetii (Q OR “Escherichia coli” OR “Giardia fever) intestinalis” OR Helicobacter OR  Yes, Cryptosporidium parvum Influenza OR “Leishmania chagasi” OR “Leishmania infantum” OR  Yes, Dipylidium caninum Leptospira OR “Methicillin resistance (Flea tapeworm) staphylococcus aureus” OR “Microsporum canis” OR “Onchocerca  Yes, Echinococcus granulosus lupi” OR Pasteurella OR Proteus OR (Hydatid worm) Pseudomonas OR Rabies OR  Yes, Echinococcus “Rickettsia rickettsii” OR Salmonella OR “Sarcoptes scabiei” OR Spirocerca multilocularis (Tapeworm) OR “Sporothrix schenckii” OR  Yes, Ehrlichia “Toxocara canis” OR “Toxoplasma (canine rickettsiosis; canine gondii” OR “Trichinella spiralis” OR “Trypanosoma cruzi” OR “Uncinaria hemorrhagic stenocephala” OR “Vibrio cholerae” fever; canine typhus; OR “Yersinia enterocolitica” tracker dog disease; tropical canine pancytopenia)  Yes, Entamoeba histolytica  Yes, Escherichia coli (E.coli; Colibacillosis)  Yes, Giardia intestinalis (Giardia duodenalis; Giardia lamblia; Giardosis; Lambliasis; Lambliosis)  Yes, Helicobacter  Yes, Influenza (Canine influenza; dog flu)  Yes, Leishmania chagasi (Visceral leishmaniasis)

253

 Yes, Leishmania infantum (Visceral leishmaniasis)  Yes, Leptospira (Lepto)  Yes, Methicillin resistance staphylococcus aureus (MRSA)  Yes, Microsporum canis (Ringworm)  Yes, Onchocerca lupi  Yes, Pasteurella  Yes, Proteus  Yes, Pseudomonas  Yes, Rabies  Yes, Rickettsia rickettsii (Rocky Mountain Spotted Fever)  Yes, Salmonella  Yes, Sarcoptes scabiei (Mange; Sarcoptic mange; scabies)  Yes, Spirocerca (Canine Spirocercosis)  Yes, Sporothrix schenckii  Yes, Toxocara canis (Roundworm)  Yes, Toxoplasma gondii  Yes, Trichinella spiralis (Trichinosis)  Yes, Trypanosoma cruzi (Chagas disease)  Yes, Uncinaria stenocephala (Hookworm)  Yes, Vibrio cholerae (Cholera)  Yes, Yersinia enterocolitica

6. Has the full text Please select all that apply. research been  Yes, Anguilla conducted in North  Yes, Antigua and Barbuda Keywords: Anguilla; Antigua and Barbuda; Aruba; The Bahamas; America? (Variable  Yes, Aruba Barbados; Belize; Bermuda; Bonaire; = country)  Yes, The Bahamas British Virgin Islands; Canada; Cayman Islands; Clipperton Island;  Yes, Barbados Costa Rica; Cuba; Curacao; Dominica;  Yes, Belize Dominican Republic; El Salvador; 254

 Yes, Bermuda Federal Dependencies of Venezuela; Greenland; Grenada; Guadeloupe;  Yes, Bonaire Guatemala; Haiti; Honduras; Jamaica;  Yes, British Virgin Islands Martinique; Mexico; Montserrat; Navassa Island; Nicaragua; Nueva  Yes, Canada Esparta; Panama; Puerto Rico; Saba;  Yes, Cayman Islands San Andres and Providencia; Saint  Yes, Clipperton Island Barthelemy; Saint Kitts and Nevis; Saint Lucia; Saint Martin; Saint Pierre  Yes, Costa Rica and Miquelon; Saint Vincent and the  Yes, Cuba Grenadines; Sint Eustatius; Sint Maarten; Trinidad and Tobago; Turks  Yes, Curacao and Caicos Islands; United States; and  Yes, Dominica the United States Virgin Islands.

 Yes, Dominican Republic If some studies list the province  Yes, El Salvador (Canada) and state (USA) but do not  Yes, Federal Dependencies of for whatever reason list the country, the following are links to the 13 Venezuela Canadian provinces:  Yes, Greenland https://www.canada.ca/en/immigration- refugees-citizenship/services/new-  Yes, Grenada immigrants/prepare-life-  Yes, Guadeloupe canada/provinces-territories.html  Yes, Guatemala and, 50 USA states:  Yes, Haiti https://state.1keydata.com/state-  Yes, Honduras abbreviations.php  Yes, Jamaica  Yes, Martinique  Yes, Mexico  Yes, Montserrat  Yes, Navassa Island  Yes, Nicaragua  Yes, Nueva Esparta  Yes, Panama  Yes, Puerto Rico  Yes, Saba  Yes, San Andres and Providencia  Yes, Saint Barthelemy  Yes, Saint Kitts and Nevis  Yes, Saint Lucia  Yes, Saint Martin  Yes, Saint Pierre and Miquelon  Yes, Saint Vincent and the Grenadines  Yes, Sint Eustatius  Yes, Sint Maarten  Yes, Trinidad and Tobago 255

 Yes, Turks and Caicos Islands  Yes, United States  Yes, United States Virgin Islands.

7. Is the study at the Please select one. dog-level or  Yes, at the dog-level (linked to pathogen-level where questions 8 & 9) Keywords: Pathogen-level can include studies of the zoonotic  Yes, at the pathogen-level canine zoonoses specific to the agents pathogen was (linked to question 10) of disease: bacteria; viruses; parasites; isolated fungi from a dog? (Variable = level)

256

8. Is the dog-  Yes, outbreak investigation Please select all that apply. level study approach  Yes, descriptive study: Case described by report *select this ONLY if authors?  Yes, descriptive study: Case author(s) state that a case series* series was conducted.  Yes, ONLY descriptive Keywords: statistics presented: for Descriptive studies are used to example, anything describe phenomena. Descriptive DESCRIBING data e.g., studies do not have a comparison (control) group estimating proportions, prevalence, incidence -Case-reports (study describes rare WITHOUT comparisons condition or an unusual manifestation of a more common [canine zoonotic]  Yes, analytical experiment disease(s) in dogs), (AE1): challenge trial of -Case-series reports (study describes occurrence of or usual clinical intervention to prevent presentation of canine zoonotic  Yes, analytical experiment condition/ disease) and, (AE2): challenge trial of -Descriptive surveys (study estimates frequency and distribution of selected intervention to treat outcomes (i.e., canine zoonoses) in  Yes, analytical experiment defined canine population)). (AE3): natural disease trial of Experimental study designs - the intervention to prevent allocation of ‘study units’ to  Yes, analytical experiment intervention groups is under the control (AE4): natural disease trial of of the investigator

intervention to treat Observational study designs - the  Yes, observational study allocation of ‘study units’ to intervention groups is not under the (OBS1): intervention to control of the investigator; relate prevent naturally occurring exposures to  Yes, observational study natural disease occurrence (OBS2): intervention to treat  Yes, observational study (OBS3): evaluation of risk factors for disease  Yes, observational study (OBS4): evaluation of mechanisms of disease/virulence  Yes, observational study (OBS5): diagnostic test development/evaluation  Yes, but study approach ill- defined or unclear  No, it is not described/unclear

257

9.Does the full Please select all that apply. publication list the  Yes, owned domestic dogs type(s) of domestic  Yes, free-roaming domestic dogs as the target dogs population?  Yes, stray domestic dogs (Variable =  Yes, dogs bred for and/or used targpop) in experiments  Yes, domestic dog population ill-defined or unclear

10.Is the general Please select all that apply. focus of the  Yes, molecular biology (MB) pathogen-level study  Yes, phylogeny (PH) Keywords: Pathogen-level can include studies of described?  Yes, whole genome canine zoonoses specific to the sequencing (GS) following agents of disease: bacteria;  Yes, identification of virulence viruses; parasites; fungi factors (VF) -Molecular biology (for instance phage typing or serotyping of bacteria,  Yes, development or validation describing surface proteins or antigens of laboratory methods and of viruses, characterization of nucleic acids diagnostics (LM) (DNA; RNA));  Yes, pathophysiology and immunology of pathogen-host -Phylogeny (molecular epidemiology);

interaction (IP) -Whole genome sequencing;  Yes, but categorical focus is ill-defined or unclear -Identification of virulence factors;

 No, it is not described/unclear -Development or validation of laboratory methods and diagnostics;

-Pathophysiology and immunology of pathogen-host interaction (e.g., evaluating interleukin).

Molecular biology: investigates the molecular basis of biological activity within cells; looks at interactions between nucleic acids DNA and RNA and proteins as well as the regulation of these interactions

Molecular epidemiology (specific to canine zoonoses in domestic dogs): the contribution of potential genetic and environmental risk factors, identified at the molecular level, to the etiology, distribution, and prevention of disease within domestic dogs and across domestic dog populations 11.Was any type of Please select all that apply. integrated  Yes, Collaborative Approach 258

collaborative  Yes, Community-Based Keywords: One Health, EcoHealth, Systems approach; Participatory approach listed as Approach Epidemiology, Community-Based part of the study  Yes, EcoHealth Research; Collaborative approach (e.g., in the  Yes, One Health objectives or  Yes, Participatory methods)? Epidemiology  Yes, Systems Approach  Yes, but approach ill-defined or unclear  No

259

Appendix 2. 5 Comprehensive list of canine zoonotic and vectorborne pathogens identified with the scoping review

Percent Studies Focusing on Individual Pathogens Frequency (%) Anaplasma spp. 11 2.17 Ancylostoma spp. 13 2.56 Babesia spp. 13 2.56 Baylisascaris procyonis 2 0.39 Borrelia burgdorferi 38 7.5 Brucella spp. 9 1.78 Campylobacter spp. 2 0.39 Capnocytophaga spp. 2 0.39 Corynebacterium spp. 7 1.38 Echinococcus granulosus 1 0.2 Ehrlichia spp. 46 9.07 Escherichia coli 33 6.51 Helicobacter spp. 2 0.39 Influenza spp. 39 7.69 Leishmania chagasi 3 0.59 Leishmania infantum 17 3.35 Leptospira 49 9.66 Methicillin resistance staphylococcus aureus (MRSA) 5 0.99 Microsporum canis 1 0.2 Onchocerca lupi 5 0.99 Pasteurella spp. 1 0.2 Pseudomonas spp. 16 3.16 Rabies 41 8.09 Rickettsia rickettsii 6 1.18 Salmonella spp. 6 1.18

260

Sarcoptes scabiei 5 0.99 Spirocerca spp. 1 0.2 Sporothrix schenckii 1 0.2 Toxocara canis 3 0.59 Toxoplasma gondii 7 1.38 Trichinella spiralis 2 0.39 Trypanosoma cruzi 22 4.34 Total 409 80.66 Percent Studies of Pathogen Combinations Frequency (%) MRSA, Pseudomonas spp. 1 0.2 Anaplasma spp., Babesia spp., Borrelia burgdorferi, Ehrlichia spp. 1 0.2

Anaplasma spp., Babesia spp., Borrelia burgdorferi, Ehrlichia spp., 1 0.2 influenza spp., Toxoplasma spp. Anaplasma spp., Babesia spp., Borrelia burgdorferi, Ehrlichia spp., 3 0.59 Rickettsia rickettsii Anaplasma spp., Babesia spp., Ehrlichia spp. 2 0.39 Anaplasma spp., Babesia spp., Ehrlichia spp., Rickettsia rickettsii 2 0.39 Anaplasma spp., Borrelia burgdorferi 1 0.2 Anaplasma spp., Borrelia burgdorferi, Campylobacter spp., Ehrlichia 1 0.2 spp., Toxoplasma gondii Anaplasma spp., Borrelia burgdorferi, Cryptosporidium parvum, 1 0.2 Ehrlichia spp., Giardia intestinalis, Leptospira spp., Toxocara canis Anaplasma spp., Borrelia burgdorferi, Ehrlichia spp. 9 1.78 Anaplasma spp., Borrelia burgdorferi, Ehrlichia spp., Leptospira spp., 1 0.2 Rickettsia rickettsii Anaplasma spp., Borrelia burgdorferi, Ehrlichia spp., Rickettsia 2 0.39 rickettsii Anaplasma spp., Ehrlichia spp. 5 0.99 Ancylostoma spp., Babesia spp., Borrelia burgdorferi, Ehrlichia spp., 1 0.2 Rickettsia rickettsii Ancylostoma spp., Campylobacter spp., Cryptosporidium parvum, 1 0.2 Giardia intestinalis, Salmonella spp., Toxocara canis

261

Ancylostoma spp., Campylobacter spp., Cryptosporidium parvum, Echinococcus multilocularis, Helicobacter spp., Salmonella spp., 1 0.2 Toxocara canis Ancylostoma spp., Dipylidium caninum, Giardia intestinalis, Toxocara 3 0.59 canis Ancylostoma spp., Dipylidium caninum, Giardia intestinalis, Toxocara 1 0.2 canis, Uncinaria stenocephala Ancylostoma spp., Dipylidium caninum, Echinococcus granulosus, 1 0.2 Toxocara canis Ancylostoma spp., Dipylidium caninum, Toxocara canis 1 0.2 Ancylostoma spp., Giardia intestinalis, Toxocara canis 1 0.2 Ancylostoma spp., Toxocara canis 6 1.18 Ancylostoma spp., Toxocara canis, Trypanosoma cruzi 1 0.2 Ancylostoma spp., Uncinaria stenocephala 1 0.2 Babesia spp., Borrelia burgdorferi, Ehrlichia spp., Rickettsia rickettsii 1 0.2 Babesia spp., Ehrlichia spp., Leishmania infantum, Rickettsia rickettsii 1 0.2 Bacillus spp., Corynebacterium spp., Escherichia coli, MRSA 1 0.2 Bacillus spp., Corynebacterium spp., Escherichia coli, Proteus spp., 1 0.2 Pseudomonas spp. Bacillus spp., Dipylidium caninum 1 0.2 Borrelia burgdorferi, Ehrlichia spp. 1 0.2 Borrelia burgdorferi, Ehrlichia spp., Rickettsia rickettsii 3 0.59 Brucella spp., Corynebacterium spp., Helicobacter spp., Pasteurella 1 0.2 spp., Pseudomonas spp. Brucella spp., Escherichia coli, Proteus spp., Pseudomonas spp. 1 0.2 Campylobacter spp., Helicobacter spp. 1 0.2 Campylobacter spp., Cryptosporidium parvum, Echinococcus 1 0.2 granulosus, Giardia intestinalis, Toxocara canis Campylobacter spp., Escherichia coli, Salmonella spp. 1 0.2 Campylobacter spp., Giardia intestinalis, Salmonella spp. 1 0.2 Leishmania chagasi, Leishmania infantum, Trypanosoma cruzi 1 0.2 Corynebacterium spp., Escherichia coli, Pasteurella spp. 1 0.2 Corynebacterium spp., Pseudomonas spp. 1 0.2 Cryptosporidium parvum, Echinococcus granulosus, Giardia intestinalis, Toxocara canis, Toxoplasma gondii, Uncinaria 1 0.2 stenocephala Cryptosporidium parvum, Echinococcus multilocularis, Giardia 1 0.2 intestinalis, Toxocara canis, Toxoplasma gondii, Trichinella spiralis Cryptosporidium parvum, Dipylidium caninum, Giardia intestinalis, 1 0.2 Salmonella spp.

262

Escherichia coli, MRSA, Pseudomonas spp. 1 0.2 Escherichia coli, MRSA, Salmonella spp. 1 0.2 Escherichia coli, Helicobacter spp. 1 0.2 Escherichia coli, Pasteurella spp., Proteus spp., Pseudomonas spp. 1 0.2 Escherichia coli, Proteus spp. 5 0.99 Escherichia coli, Proteus spp., Pseudomonas spp. 6 1.18 Escherichia coli, Proteus spp., Salmonella spp. 1 0.2 Escherichia coli, Pseudomonas spp. 2 0.39 Escherichia coli, Salmonella spp. 3 0.59 Leishmania infantum, Toxoplasma gondii, Trypanosoma cruzi 1 0.2 Leishmania infantum, Trypanosoma cruzi 1 0.2 Influenza spp., Leptospira spp. 1 0.2 Leptospira spp., Toxoplasma gondii, Trypanosoma cruzi 1 0.2 Leptospira spp., Trypanosoma cruzi 1 0.2 Proteus spp., Pseudomonas spp. 1 0.2 Rabies, Toxoplasma gondii 1 0.2 Toxoplasma gondii, Trypanosoma cruzi 1 0.2 Total 98 19.44

263

Appendix 4. 1 Laboratory Methods for the Molecular Detection and Characterization of Giardia spp. and Cryptosporidium spp. in canine fecal samples from Iqaluit Nunavut Canada Molecular Analysis: Detection and Genotyping of Cryptosporidium and Giardia

Sample preparation and DNA extraction

Fecal samples (1.0 g) were suspended in 4.5 mL Tween-PBS and subjected to sucrose gradient floatation and centrifugation for capturing Cryptosporidium oocysts and Giardia cysts from the samples. The recovered (oo)cysts were suspended in 550 μL of CTAB lysis buffer containing 25 μL Proteinase K solution (MO BIO Laboratories, Qiagen Inc., Valencia, CA).

Samples were incubated with shaking at 65°C for 30 min. Six freeze-thaw cycles were performed by placing the sample tubes in liquid nitrogen for 5 min, followed by 65°C in a water bath for 5 min. Samples were boiled (10 minutes), cooled on ice (10 minutes), and centrifuged at

18000 xg (5 minutes) to obtain 550 μL supernatant. Supernatants were subjected to two rounds of chloroform/isoamyl alcohol purification. Treated supernatants (420 μL) were further purified using the DNeasy Blood and Tissue Kit (MO BIO Laboratories, Qiagen Inc., Valencia, CA) following the manufacturer’s protocol for “Purification of Total DNA from Plant/Animal

Tissue”. The DNA was eluted in 100 µL of AE buffer. To maximize sensitivity of detection we also extracted total genomic DNA directly from fecal samples (0.2 g) using a PowerSoilTM DNA

Isolation Kit (MO BIO Laboratories, Qiagen Inc., Valencia, CA) following the kit protocol.

PCR amplification and sequencing of gene targets for Cryptosporidium and Giardia

The PCR reaction (50 µL) contained 1x GoTaq® Green Master Mix (Promega), 0.4 pmol/μL each of the primers, 0.1 μg/μL of BSA, and 10 µL template DNA. PCR thermal cycling was conducted using a GeneAmpTM PCR System 9700 (Applied Biosystems). The following thermal cycling conditions were used: an initial incubation at 95°C for 10 minutes; 45 cycles of 264

20 seconds at 95°C; 30 seconds at 51-66°C (Table 1 for specifics); and 60 seconds (45 seconds for Cryptosporidium 18S rDNA) at 72°C followed by a final incubation at 72°C for 7 minutes and holding at 4°C until next step. The first PCR products were then diluted 40 times and used as templates for nested PCR. The nested PCR reaction (25 µL) contained 1x HotStarTaq master mix (MO BIO Laboratories, Qiagen Inc., Valencia, CA) , 0.2 pmol/μL each of the primers, and 2

µL template DNA. The cycling conditions for nested PCR were: an initial incubation at 95°C for

10 minutes; 35 cycles of 20 seconds at 95°C; 30 seconds at 52-62°C (Table 1); and 45 seconds

(60 seconds for Cryptosporidium GP60) at 72°C, followed by a final incubation at 72°C for 7 minutes and holding at 4°C until further analysis. The PCR products were separated by electrophoresis and detected using SYBR Safe-stained 2.0% agarose gels.

DNA sequencing and sequence analysis

PCR fragments were purified using NucleoFast® 96 PCR clean-up kit according to the manufacturer’s protocol (Macherey-Nagel, Duren, Germany). The purified PCR fragments were sequenced at the Agriculture and Food Laboratory, University of Guelph, with the same primers as for the nested PCR using an ABI 3730 Genetic Analyzer (Applied Biosystems). The raw sequences were analyzed using ABI PrismTM Sequencing Analysis software V5 (Applied

Biosystems) to obtain a high-quality consensus sequence for each sample (Q>20). The consensus sequences were queried against NCBI GenBank using Basic Logic Alignment Search Tool

(BLAST) to obtain species and/or genotype identification.

265

Table 1. Polymerase chain reaction (PCR) primers for amplification and sequencing of various gene targets of Cryptosporidium spp., and Giardia spp. Amplicon Annealing Gene nPCR Primer name Primer sequence Reference Size Tm Chen S and Li J, Agriculture and Food Laboratory 18S , rDNA EF AFL_18SF GCA AAT TAC CCA ATC CTA ATA C 610 52°C University a of Guelph – developed for this study ER AFL_18SR* AG GAG TAA GGA ACA ACC TCC AFL_18SN1- IF ATCCTAATACAGGGAGGTAGT 598 52°C F C IR AFL_18SR* AG GAG TAA GGA ACA ACC TCC (Feng et al. GP60 b EF LX0374 TTACTCTCCGTTATAGTCTCC 925 51°C 2009) ER LX0375r GGAAGGAASGATGTATCTGA IF AL3532 TCCGCTGTATTCTCAGCC 886 55°C IR AL3534 GCAGAGGAACCAGCATC (Robertson bg c EF bg-G7 AAGCCCGACGACCTCACCCGCAGTGC 753 bp 66°C et al. 2007) ER bg-G759 GAGGCCGCCCTGGATCTTCGAGACGAC IF bg-NF-Lalle GAACGAGATCGAGGTCCG 511 bp 55°C 266

IR bg-NR-Lalle CTCGACGAGCTTCGTGTT (Feng and TPI d EF AL3543 AAATIATGCCTGCTCGTCG 605 bp 59°C Xiao 2011) G ER AL3546 CAAACCTTITCCGCAAACC IF AL3544 CCCTTCATCGGIGGTAACTT 530 bp 59°C IR AL3545 GTGGCCACCACICCCGTGCC (Read et al. gdh e EF GDHeF TCAACGTYAAYCGYGGYTTCCGT NA 54°C 2004) ER GDHiR GTTRTCCTTGCACATCTCC IF GDHiF CAGTACAACTCYGCTCTCGG 432 bp 54°C IR GDHiR GTTRTCCTTGCACATCTCC (Leonhard 18S et al. 2007, rDNA EF RH11 CATCCGGTCGATCCTGCC 292 bp 62°C Gillhuber f et al. 2013) ER RH4R AGTCGAACCCTGATTCTCCGC IF Giar-F GACGCTCTCCCCAAGGAC 180 bp 62°C IR Giar-R CTGCGTCACGCTGCTCG *The reverse primer was modified from Xiao et al 2009; C= Cryptosporidium G= Giardia a subunit 18 ribosomal RNA (ssu-rRNA) for Cryptosporidium b Cryptosporidium 60 kDa glycoprotein (gp60) gene c beta-giardin gene locus for Giardia d triose phosphate isomerase gene for Giardia e glutamate dehydrogenase gene for Giardia f subunit 18 ribosomal RNA (ssu-rRNA) for Giardia EF external forward; ER external reverse; IF internal forward; inner reverse

267

REFERENCES Biosystems, A. (2000). Applied Biosystems DNA Sequencing Analysis Software User Guide. Biosystems. Feng, Y., Li, N., Duan, L., & Xiao, L. (2009). Cryptosporidium genotype and subtype distribution in raw wastewater in Shanghai, China: Evidence for possible unique Cryptosporidium hominis transmission. Journal of Clinical Microbiology, 47(1), 153–157. http://doi.org/10.1128/JCM.01777-08 Feng, Y., & Xiao, L. (2011). Zoonotic potential and molecular epidemiology of Giardia species and giardiasis. Clinical Microbiology Reviews, 24(1), 110–140. http://doi.org/10.1128/CMR.00033-10 Gillhuber, J., Pallant, L., Ash, A., Thompson, R. C. A., Pfister, K., & Scheuerle, M. C. (2013). Molecular identification of zoonotic and livestock-specific Giardia-species in faecal samples of calves in Southern Germany. Parasites and Vectors, 6(346), 1–6. http://doi.org/10.1186/1756-3305-6-346 †Goulden, E. K. (2003). Development of a DNA microarray-based method for detection of multiple water and foodborne pathogens. Master’s of Science Thesis. University of Guelph. September, 2003. National Library of Canada. Ottawa, Canada ISBN: 0-612-90649-3. Leonhard, S., Pfister, K., Beelitz, P., Wielinga, C., & Thompson, R. C. A. (2007). The molecular characterisation of Giardia from dogs in southern Germany. Veterinary Parasitology, 150(1–2), 33–38. http://doi.org/10.1016/j.vetpar.2007.08.034 Read, C. M., Monis, P. T., & Thompson, R. C. A. (2004). Discrimination of all genotypes of Giardia duodenalis at the glutamate dehydrogenase locus using PCR-RFLP. Infection, Genetics and Evolution, 4(2), 125–130. http://doi.org/10.1016/j.meegid.2004.02.001 Robertson, L. J., Forberg, T., Hermansen, L., Hamnes, I. S., & Gjerde, B. (2007). Giardia duodenalis cysts isolated from wild moose and reindeer in Norway: Genetic characterization by PCR-RFLP and sequence analysis at two genes. Journal of Wildlife Diseases, 43(4), 576–585.

†Reference for the additional Giardia PCR assay (one was detected positive and counted in the result table, but not sequenced)

268

Appendix 4. 2 The People, Animals, Water and Sustenance Project - Sled Dog Summary

269

270

271

272

273

274

275

276

277

278

279

280

281

282

Appendix 5. 1 Questionnaire for human exposures to dog bites in southern Ontario, Canada 1. Do you or any member of your household currently own a dog(s) or have owned a dog(s) within the last 12 months? a. Yes [ ] b. No [ ] (Please go to question 5) c. I prefer not to answer [ ] (Please go to question 5)

2. How many dogs live or have lived in your household within the past 12 months? a. 1 [ ] b. 2 [ ] c. 3 [ ] d. 4 [ ] e. 5 [ ] f. 6 [ ] g. 7 [ ] h. 8 [ ] i. 9 [ ] j. 10 or more [ ] k. Unsure [ ] (Please go to question 6) l. I prefer not to answer [ ] (Please go to question 6)

3. Please provide the name(s) of your dog(s) in the space below. If you do not feel comfortable providing their names, you may list each dog with a number (e.g., dog 1, dog 2 etc.).

The names of your dog(s) will not be provided in the data, it is asked here for ease of completing the survey.

a. The name(s) of my dog(s) are/were:

b. I prefer not to answer [ ] (Please go to question 6)

4. Please fill in the table below with all the dogs that do or have lived in your household during the past 12 months. For each dog that you own, please choose from the options given. Please note for the purposes of this survey: - An “outdoor only dog” means any dog that does not live inside of your home (e.g., eats, sleeps, plays and stays outdoors) 283

- An “indoor only dog” means any dog that only goes outdoors to urinate and pass stool (feces) but otherwise stays inside the house - For age of dog in months: 0.1 = 1 month…, 0.3 = 3 months…, 0. 11 = 11 months and a 12-month-old dog = 1 year *Two examples have been placed in the table for your information

Breed Vaccina Current of dog Year of Spayed/ Indoor ted for age in (Name Outdoo Indoor last Gender Neutere and rabies Dog Months of r only only rabies of dog d Outdoo within or breed/ dog dog vaccinat r dog the last Years Mixed ion 3 years breed) Mixed Lucy 0.5 Male Yes Yes Yes No No 2014 breed

Jack Alfie 4 Russell Female No No No Yes Yes 2011 Terrier

5. What is the main reason why you do not own any dogs? a. I do not like dogs [ ] b. I lack the time to take care of a dog [ ] c. I lack the space to take care of a dog [ ] d. I do not see the necessity of owning a dog [ ] e. I have not yet replaced a previous dog that died or disappeared [ ] f. Owning a dog is against my cultural and/or religious views [ ] g. Dogs are too expensive to obtain and look after [ ] h. I am worried about diseases that I can get from dogs [ ] i. Other (specify)

j. Unsure [ ] k. I prefer not to answer [ ] *Please note for the purposes of this survey, “contact” means a dog that is or has been close enough for you to touch

6. How often do you come into contact with dogs outside of your household? a. Less than once a week [ ] b. Once a week [ ] c. Twice a week [ ] 284

d. Three times a week [ ] e. Four times a week [ ] f. More than five times a week [ ] g. I do not have contact with dogs outside of my home [ ] (Please go to question 8) h. Unsure [ ] (Please go to question 7) i. I prefer not to answer [ ] (Please go to question 8)

*Please note for the purposes of this survey, “contact” means a dog that is or has been close enough for you to touch

7. Where do you come into contact with dogs outside of your household? a. Through job, school or volunteer position b. Parks or walking trails c. Dogs of friends and family d. Stray dogs e. Other (specify)

f. Unsure g. I prefer not to answer Please note: For the purposes of this survey, a “bite” is defined as any cut, wound, tear or breaking of the skin caused by the dog's teeth.

8. Have you or anyone in your household been bitten by any dog (either your dog or someone else’s dog) within the last 12 months? a. Yes [ ] b. No [ ] (Please go to question 13) c. Unsure [ ] (Please go to question 13) d. I prefer not to answer [ ] (Please go to question 13)

9. Below, please list the total number of people (e.g., including you or anyone in your household) bitten by any dog (either your dog or someone else’s dog) within the last 12 months? a. The total number of people bitten in the last 12 months is:

b. Unsure [ ] (Please go to question 13) c. I prefer not to answer [ ] (Please go to question 13)

285

10. Please complete the following table with information specific to the person and the dog involved at the time the bite(s) occurred. (Provide information for all bites within the past 12 months, starting with the most recent bite, until all bites are described or there are no more rows in the table) PN: Please add in highlighted words in blue above

Important notes: - For age of dog in months: 0.1 = 1 month…, 0.3 = 3 months…, 0. 11 = 11 months and a 12-month-old dog = 1 year - Examples of parts of the body bitten by a dog(s): foot, lower leg, upper leg, lower body, upper body, hand, lower arm, upper arm, neck or face - Rabies prophylaxis means a series of vaccinations that are given to a person after they have been bitten by a dog suspected of having rabies *Two examples have been placed in the table for your information As a reminder this is a strictly confidential survey

Was the Was the Was the Was the person dog on dog dog up to playing or leash or Gender of owned by Age of Gender of date on interactin off leash Age of the you or dog dog rabies g with the at the person person your vaccinatio dog at the time of household n? time of the bite? ? the bite? Owned by Off leash Female 0.3 Male Yes No 15-24 household Not owned by On leash Male 9 years Female Unsure Yes 35-44 my household

11. What part(s) of the person’s body were bitten? a. Foot [ ] b. Lower leg [ ] c. Upper leg [ ] d. Lower body (trunk) [ ] e. Upper body (trunk) [ ] f. Hand [ ] g. Lower arm [ ] h. Upper arm [ ] i. Neck [ ] j. Face [ ] 286

k. Unsure [ ] l. I prefer not to answer [ ] 12. For this bite occurrence, what action was taken Thoroug hly Sought washed medical the care wound from a with Rabies medical Rabies soap and prophyla health prophyla Contacte No I prefer Location water xis was Called I am not practitio xis was d my action not to of Bite and recomm animal sure ner (e.g., offered veterinar was answer attended ended control doctor, and ian taken to the but not nurse) or received wound received went to at home hospital (e.g., emergen using a cy first aid kit)

Please note: For the purposes of this survey, a “bite” is defined as any cut, wound, tear or breaking of the skin caused by the dog's teeth.

13. Have any of your dogs bitten someone who is not a member of your household in the past 12 months? a. Yes [ ] b. No [ ] (Please go to question 18) c. Unsure [ ] (Please go to question 18) d. I prefer not to answer [ ] (Please go to question 18)

14. Below, please list the total number of people, not belonging to your household, bitten by your dog within the last 12 months a. The total number of people bitten in the last 12 months is:

b. Unsure [ ] (Please go to question 18) c. I prefer not to answer [ ] (Please go to question 18)

15. Please complete the following table with information specific to the person and the dog involved at the time the bite(s) occurred. 287

(Provide information for all bites within the past 12 months, starting with the most recent bite, until all bites are described or there are no more rows in the table) Important notes: - For age of dog in months: 0.1 = 1 month…, 0.3 = 3 months…, 0. 11 = 11 months and a 12 month old dog = 1 year - Examples of options for parts of the body bitten: foot, lower leg, upper leg, lower body, upper body, hand, lower arm, upper arm, neck or face - Rabies prophylaxis means a series of vaccinations that are given to a person after they have been bitten by a dog suspected of having rabies

*Two examples have been placed in the table for your information

As a reminder this is a strictly confidential survey

Was the Was the Was the person dog on dog up to playing or leash or Age of Gender of Gender of date on interacting Age of dog off leash at person the person dog rabies with the the time of vaccinatio dog at the the bite? n? time of the bite? Off leash Female 0.3 Male Yes No 15-24 On leash 35-44 Male 9 years Female Unsure Yes

16. What part(s) of the person’s body were bitten? a. Foot [ ] b. Lower leg [ ] c. Upper leg [ ] d. Lower body (trunk) [ ] e. Upper body (trunk) [ ] f. Hand [ ] g. Lower arm [ ] h. Upper arm [ ] i. Neck [ ] j. Face [ ] k. Unsure [ ] l. I prefer not to answer [ ] 17. For this bite occurrence, what action was taken?

288

Thorou ghly Sought washed medical the care wound from a with medical Rabies soap health Rabies prophyl Locatio and practiti prophyl Contact No I prefer axis was Called I am n of water oner axis was ed my action not to recomm animal not sure Bite and (e.g., offered veterina was answer ended control attende doctor, and rian taken but not d to the nurse) received received wound or went at home to (e.g., hospital using a emerge first aid ncy kit)

Please note: For the purposes of this survey, a “bite” is defined as any cut, wound, tear or breaking of the skin caused by the dog's teeth. 18. Please choose your level of agreement for each of the options below if dealing with dog bites in minors (That is, persons less than 18 years of age).

Level of Agreement

I prefer Strongly Strongly not to Disagree Neutral Agree Unsure Option disagree agree answer

I would contact my primary health care provider or

go to the emergency department of a hospital I would contact a family

member, friend or neighbour

289

I would do

nothing I would thoroughly wash and

attend to the wound at home I would

contact a veterinarian I would contact

animal control Please note: For the purposes of this survey, a “bite” is defined as any cut, wound, tear or breaking of the skin caused by the dog's teeth.

19. Please choose your level of agreement for each of the options below if dealing with dog bites in adults (That is, persons 18 years of age and older). Level of Agreement

I prefer Strongly Strongly not to Disagree Neutral Agree Unsure Option disagree agree answer

I would contact my primary health care provider or

go to the emergency department of a hospital I would contact a family

member, friend or neighbour I would do

nothing I would thoroughly wash and

attend to the wound at home 290

I would contact a veterinaria n I would contact

animal control

291

Appendix 6. 1 Questionnaire for knowledge and awareness of diseases that humans can get from dogs in southern Ontario, Canada

1. Are you aware of any diseases that humans can get from dogs? a. Yes [ ] b. No [ ] c. Unsure [ ] d. I prefer not to answer [ ]

2. Do you use a veterinarian for your dog(s)? a. Yes [ ] b. No [ ] (Please go to question 4) c. Unsure [ ] (Please go to question 4) d. I prefer not to answer [ ] (Please go to question 4)

3. Has your veterinarian ever provided you with any information about diseases that humans can get from dogs? a. Yes [ ] b. No [ ] c. Unsure [ ] d. I prefer not to answer [ ]

4. How concerned are you generally about diseases that humans can get from dogs? a. Very concerned [ ] b. Concerned [ ] c. Somewhat concerned [ ] d. Minimally concerned [ ] e. Not at all concerned [ ] f. Unsure [ ] g. I prefer not to answer [ ]

Please note for the purposes of this survey, “contact” means wildlife that is or has been close enough for your dog to touch

5. In the last 12 months, have your dog(s) been in areas where wildlife could come into contact with them? a. Yes [ ] b. No [ ] (Please go to question 8) c. Unsure [ ] (Please go to question 8) d. I prefer not to answer [ ] (Please go to question 8)

292

6. If yes, please choose the wildlife that your dog (name or dog number) could come into contact with. a. Raccoons [ ] b. Foxes [ ] c. Skunks [ ] d. Bats [ ] e. Mice [ ] f. Coyotes [ ] g. Voles [ ] h. Rats [ ] i. Other (specify)

j. Unsure [ ] k. I prefer not to answer [ ]

Please note for the purposes of this survey, “hunt” means wildlife that your dog has chased and killed for fun and or to eat 7. Does your dog hunt this wildlife?

Does your dog hunt this wildlife? Wildlife Yes No Unsure I prefer not to answer Raccoons Foxes Skunks Bats Mice Coyotes Voles Rats Other 8. Does your dog(s) come into contact with the stool (feces) of other dogs or wildlife? (SC) a. Yes [ ] b. No [ ] c. Unsure [ ] d. I prefer not to answer [ ]

9. For each of the diseases listed, please choose which of the following you believe is a disease of dogs that can cause disease in humans.

293

Where there are common names for these diseases, they are given in brackets () Can this disease in dogs cause disease in humans? Disease I prefer not Yes No Unsure to answer

Adrenal Insufficiency (Addison’s Disease) Hyperadrenocorticism (Cushing’s Disease) Canine Distemper (Hard Pad Disease) Echinococcus Multilocularis (Alveolar Hydatid Disease) Giardiasis (Beaver Fever) Heartworm (Dirofilariasis) Canine Infectious Tracheobronchitis (Kennel cough) Leishmaniasis (Dumdum fever) Lyme disease (Lyme Arthritis) Rabies (Hydrophobia) Salmonellosis Toxoplasmosis

10. Have any of the dogs in your household been diagnosed with a disease that humans can also get? a. Yes [ ] b. No [ ] (Please go to question 12) c. Unsure [ ] (Please go to question 12) d. I prefer not to answer [ ] (Please go to question 12)

11. If yes, a. Please list the diseases that your dog has been diagnosed with that humans can get

b. Unsure [ ] c. I prefer not to answer [ ]

12. In your opinion, what are some of the ways you can control or prevent diseases that humans can get from dogs a. Wash my hands thoroughly (with soap and water) after contact with dogs [ ] b. De-worm dog(s) [ ] c. Bathe dog(s) on a regular basis [ ] d. Remove dog stool (feces) from the yard and any areas where dog(s) go to the bathroom in the environment [ ] e. Use flea preventives [ ]

294

f. Use tick preventives [ ] g. Routine veterinary care including vaccination [ ] h. All of the above [ ] i. Other (specify)

j. Unsure [ ] k. I prefer not to answer [ ]

295

Appendix 7. 1 Questionnaire for sources of dogs as pets in southern Ontario, Canada

1. Did you get any dogs from WITHIN Canada in the last 7 years? a. Yes [ ] b. No [ ] (Please go to question 10) c. Unsure [ ] (Please go to question 10) d. I prefer not to answer [ ] (Please go to question 10)

2. Please provide the name(s) of your dog(s) in the space below. If you do not feel comfortable providing their names, you may list each dog with a number (e.g., dog 1, dog 2 etc.).

The names of your dog(s) will not be provided in the data, it is asked here for ease of completing the survey.

a. The name(s) of my dog(s) that I got from WITHIN Canada in the last 7 years are/were:

b. I prefer not to answer [ ] (Please go to question 33)

3. For each dog that you got WITHIN Canada in the last 7 years, please fill out the following table.

*Two examples have been placed in the table for your information

Was the dog What was What is the vaccinated the age of Province/T What year How did for rabies the dog Gender of erritory Dog did you get you find when you when you dog where you your dog? your dog? got it? got got your (Y/N/Unsur him/her? dog from? e)

Adoption Yes 0.6 Female 2007 Ontario Rover agency No 3 years Male 2011 Yukon Breeder Muttie

296

4. Since you got your dog(s), has any of them developed any diseases in the last 7 years that either you or a veterinarian felt the dog(s) got from its Province/Territory of origin? a. Yes [ ] b. No [ ] (Please go to question 6) c. Unsure [ ] (Please go to question 6) d. I prefer not to answer [ ] (Please go to question 6)

5. For each dog that you got WITHIN Canada, please list the disease(s) the dog got in the last 7 years. *Two examples have been placed in the table for your information

Province/Territ Disease Dog ory of Origin Leptospirosis Ontario Rover Heartworm Yukon Muttie

6. Were any of the dogs that you got WITHIN Canada screened for any diseases before you got the dog? a. Yes [ ] b. No [ ] (Please go to question 8) c. Unsure [ ] (Please go to question 8) d. I prefer not to answer [ ] (Please go to question 8)

7. For each dog that you got WITHIN Canada, please list disease(s) the dog was screened for, how it was screened, why it was screened and who did the screening. *Two examples have been placed in the table for your information

What Who did the Province/Terr disease(s) was How was the Why was the Dog screening? itory of origin the dog dog screened? dog screened? screened for? Came from an area where Veterinarian Ontario Lyme disease Blood test Rover Lyme disease was common Veterinary Dog had Yukon Heartworm Blood test technician Muttie heartworm

8. Did you get any documentation (e.g., Rabies Vaccination Certificates, Veterinary Certificate of Health etc.) for any of the dogs that you got WITHIN Canada?

297

a. Yes [ ] b. No [ ] (Please go to question 10) c. Unsure [ ] (Please go to question 10) d. I prefer not to answer [ ] (Please go to question 10)

9. For each dog that you got WITHIN Canada, please choose the type(s) of documentation that you got with the dog.

Lifetim Provinc Rabies Veterin Microc Certific e e/Territ Vaccina ary hip or ate of I prefer Dog Import Registra ory of tion Certific Tattoo Pure Unsure not to Permit tion Origin Certific ate of docume Breedin answer docume ate Health nt g nt

10. In your opinion, are there any potential health risks to humans associated with getting a dog(s) from WITHIN Canada? a. Yes, there are some [ ] b. Yes, there are many [ ] c. No, there are no health risks to humans associated with getting a dog(s) WITHIN Canada [ ] d. Unsure [ ] e. I prefer not to answer [ ]

11. Did you get a dog(s) from OUTSIDE of Canada within the last 7 years? a. Yes [ ] b. No [ ] (Please go to question 21) c. Unsure [ ] (Please go to question 21) d. I prefer not to answer [ ] (Please go to question 21)

12. Please provide the name(s) of your dog(s) in the space below. If you do not feel comfortable providing their names, you may list each dog with a number (e.g., dog 1, dog 2 etc.).

The names of your dog(s) will not be provided in the data, it is asked here for ease of completing the survey.

a. The name(s) of my dog(s) that I got from OUTSIDE of Canada in the last 7 years are/were:

b. I prefer not to answer [ ] (Please go to question 21)

298

13. For each dog that you got OUTSIDE of Canada in the last 7 years, please fill out the following table. *Two examples have been placed in the table for your information

Was the dog What is the vaccinated What was State, (if for rabies the age of What year USA) or How did Gender of when you the dog did you get country you find Dog dog got it? when you your dog? where you your dog? (Y/N/Unsure got him/her? got your dog ) from?

Adoption Yes 0.6 Female 2007 Ohio, USA Fluffy agency Website No 3 years Male 2011 Italy advertiseme E.T. nt

14. Since you got your dog(s), has any of them developed any diseases in the last 7 years that either you or a veterinarian felt the dog(s) got from its country of origin OUTSIDE of Canada? a. Yes [ ] b. No [ ] (Please go to question 16) c. Unsure [ ] (Please go to question 16) d. I prefer not to answer [ ] (Please go to question 16)

15. For each dog that you got OUTSIDE of Canada, please list the disease(s) the dog got in the last 7 years. *Two examples have been placed in the table for your information

Country of Origin Disease (State, (if USA) or Dog country) Leishmaniasis Ohio, USA Fluffy Heartworm Italy E.T.

16. Were any of the dogs that you got OUTSIDE of Canada screened for any diseases before you got the dog? a. Yes [ ] b. No [ ] (Please go to question 18) c. Unsure [ ] (Please go to question 18) 299

d. I prefer not to answer [ ] (Please go to question 18)

17. For each dog that you got OUTSIDE of Canada, please list disease(s) the dog was screened for, how it was screened, why it was screened and who did the screening. *Two examples have been placed in the table for your information

Country of What disease(s) Who did the Origin (State, How was the Why was the Dog was the dog screening? (if USA) or dog screened? dog screened? screened for? country) Came from an area where Veterinarian Ohio, USA Leishmaniasis Blood test Fluffy Leishmaniasis was common Veterinary Dog had Italy Heartworm Blood test technician E.T. heartworm

18. Did you get any documentation (e.g., Rabies Vaccination Certificates, Veterinary Certificate of Health etc.) for any of the dogs that you got OUTSIDE of Canada? a. Yes [ ] b. No [ ] (Please go to question 20) c. Unsure [ ] (Please go to question 20) d. I prefer not to answer [ ] (Please go to question 20)

19. For each dog that you got OUTSIDE Canada, please choose the type(s) of documentation that you got with the dog.

Province Rabies Veterina Lifetime Microch Certifica /Territor Vaccinat ry Registrat ip or te of I prefer Dog Import y of ion Certifica ion Tattoo Pure not to Permit Unsure Origin Certifica te of docume docume Breedin answer te Health nt nt g

20. What is or are the reason(s) for you getting a dog(s) from OUTSIDE of Canada? a. I feel better by helping a dog(s) from another state/country [ ] b. My friends/family have done so and I heard about it through them [ ] c. I travelled abroad and wanted to rescue a dog(s) in the state/country I was in [ ] d. There are no available dogs of this kind in Ontario [ ] e. I wanted to help save the lives of dogs [ ] f. Other (specify)

300

g. Unsure [ ] h. I prefer not to answer [ ]

21. In your opinion, are there any potential health risks to humans associated with getting a dog(s) from OUTSIDE of Canada? a. Yes, there are some [ ] b. Yes, there are many [ ] c. No, there are no health risks to humans associated with getting a dog(s) from OUTSIDE of Canada [ ] d. Unsure [ ] e. I prefer not to answer [ ]

22. If there were health risks to humans, would you avoid getting a dog(s) OUTSIDE of Canada in the future? a. Yes [ ] b. No [ ] (Please go to question 23) c. Unsure [ ] (Please go to Section 23) d. I prefer not to answer [ ] (Please go to Section 23)

23. If no, a. Please write why, in the future, you would still choose to get a dog from OUTSIDE of Canada?

b. I prefer not to answer [ ]

Additional Information: Respondent Demographic Information 1. What is your gender? a. Male [ ] b. Female [ ] c. I prefer not to answer [ ]

2. Including yourself, how many individuals live in your household? a. 1 [ ] b. 2 [ ] c. 3 [ ] d. 4 [ ] e. 5 [ ] f. More than 5 [ ] g. I prefer not to answer [ ]

301

3. In what age range are you? a. 18 - 24 [ ] b. 25 - 34 [ ] c. 35 - 44 [ ] d. 45 - 54 [ ] e. 55 - 64 [ ] f. 65 and Older [ ] g. I prefer not to answer [ ]

4. Are there any dependents living in your household who are minors (That is, persons less than 18 years of age)? a. Yes [ ] b. No [ ] (Please go to question 6) c. I prefer not to answer [ ] (Please go to question 6)

5. If yes, how many dependents living in your household are minors (That is, persons less than 18 years of age)? a. 1 [ ] b. 2 [ ] c. 3 [ ] d. 4 [ ] e. 5 [ ] f. More than 5 [ ] g. I prefer not to answer [ ]

6. Before taxes and deductions, in what range is the total annual (per year) household income in Canadian dollars? a. Less than $20,000 [ ] b. Between $20,000 and $39,999 [ ] c. Between $40,000 and $79,999 [ ] d. Between $80,000 and $120,000 [ ] e. Greater than $120,000 [ ] f. Unsure [ ] g. I prefer not to answer [ ]

7. What is your highest level of education? a. Elementary school [ ] b. High school diploma, certificate or equivalent [ ] c. College, trade or other non-university certificate or diploma [ ] 302

d. University degree, certificate or diploma [ ] e. Unsure [ ] f. I prefer not to answer [ ]

8. Please choose which one of the following best describes you. a. Aboriginal (First Nations, Inuit, Métis) [ ] b. Arab [ ] c. Black (African American) [ ] d. Chinese [ ] e. Filipino [ ] f. Japanese [ ] g. Korean [ ] h. Latin American [ ] i. South Asian (e.g., East Indian, Pakistani, Sri Lankan) [ ] j. Southeast Asian (e.g., Vietnamese, Cambodian, Malaysian, Laotian) [ ] k. West Asian (e.g., Iranian, Afghan) [ ] l. White (Caucasian) [ ] m. Other (specify)

n. Unsure [ ] o. I prefer not to answer [ ]

Please note for the purposes of this survey, an “active farm” means a farm, ranch or other agricultural operation that produces at least one of the following products intended for sale: Livestock, poultry, animal products. 9. Do you live or have you lived on an active farm within the last 12 months? a. Yes [ ] b. No [ ] (Please go to question 16) c. Unsure [ ] d. I prefer not to answer [ ]

10. Do you or your household members own cattle where you live? a. Yes [ ] b. No [ ] c. Unsure [ ] d. I prefer not to answer [ ]

11. Do you or your household members own small ruminants (That is, sheep or goats) where you live? a. Yes [ ] 303

b. No [ ] c. Unsure [ ] d. I prefer not to answer [ ]

12. Do you or your household members own poultry where you live? a. Yes [ ] b. No [ ] c. Unsure [ ] d. I prefer not to answer [ ]

13. Do you or your household members own pigs where you live? a. Yes [ ] b. No [ ] c. Unsure [ ] d. I prefer not to answer [ ]

14. Do you or your household members own horses where you live? a. Yes [ ] b. No [ ] c. Unsure [ ] d. I prefer not to answer [ ]

15. Do you or your household members own any pets, other than dog(s), where you live? a. Yes [ ] (Please write what kinds of pets in the text box below e.g., cat, hamster, goldfish etc.)

b. No [ ] c. Unsure [ ] d. I prefer not to answer [ ]

16. If you wanted to learn more about diseases that humans can get from dogs, which of the following resources would you use? a. Veterinarian [ ] b. Family physician [ ] c. School or work [ ] d. Colleagues/ friends [ ] e. Public health personnel [ ] 304

f. Internet [ ] g. All of the above [ ] h. Other (specify)

i. Unsure [ ] j. I prefer not to answer [ ]

305