sign in sign up
<<
Home , Acidithiobacillus caldus, Acidophile, Sulfur metabolism

Original Research Article published: 10 February 2011 doi: 10.3389/fmicb.2011.00017 in the extreme caldus

Stefanie Mangold1*, Jorge Valdés 2,3†, David S. Holmes 2,3 and Mark Dopson1†

1 Department of Molecular Biology, Umeå University, Umeå, Sweden 2 Center for Bioinformatics and Genome Biology, Fundación Ciencia para Vida, Santiago, Chile 3 Departamento de Ciencias Biologicas, Andrés Bello University, Santiago, Chile

Edited by: Given the challenges to life at low pH, an analysis of inorganic sulfur compound (ISC) oxidation Thomas E. Hanson, University of was initiated in the chemolithoautotrophic . A. caldus is Delaware, USA able to metabolize elemental sulfur and a broad range of ISCs. It has been implicated in the Reviewed by: Kathleen Scott, University of South production of environmentally damaging acidic solutions as well as participating in industrial Florida, USA operations where it forms part of microbial consortia used for the recovery of Dimitry Y. Sorokin, Delft University of metal ions. Based upon the recently published A. caldus type strain genome sequence, a Technology, Netherlands bioinformatic reconstruction of elemental sulfur and ISC metabolism predicted genes included: *Correspondence: –quinone reductase (sqr), tetrathionate hydrolase (tth), two sox gene clusters potentially Stefanie Mangold, Department of Molecular Biology, Umeå University, involved in oxidation (soxABXYZ ), sulfur oxygenase reductase (sor), and various SE-901 87 Umeå, Sweden. electron transport components. RNA transcript profiles by semi quantitative reverse transcription e-mail: stefanie.mangold@miolbiol. PCR suggested up-regulation of sox genes in the presence of tetrathionate. Extensive gel umu.se based proteomic comparisons of total soluble and membrane enriched fractions during † Current address: growth on elemental sulfur and tetrathionate identified differential protein levels from the two Jorge Valdés, Bio-Computing Laboratory, Fraunhofer-Chile Research Sox clusters as well as several chaperone and stress up-regulated in the presence Foundation, Santiago, Chile; of elemental sulfur. Proteomics results also suggested the involvement of heterodisulfide Mark Dopson, Institution for Natural reductase (HdrABC) in A. caldus ISC metabolism. A putative new function of Hdr in Sciences, Linnaeus University, 391 82 is discussed. Additional proteomic analysis evaluated protein expression differences between Kalmar, Sweden. cells grown attached to solid, elemental sulfur versus planktonic cells. This study has provided insights into sulfur metabolism of this acidophilic chemolithotroph and gene expression during attachment to solid elemental sulfur.

Keywords: Acidithiobacillus caldus, elemental sulfur, inorganic sulfur compounds, metabolism, attachment, proteomics

Introduction ferent oxidation states by the contained in the V-K-V-T-I-G- Inorganic sulfur compounds (ISCs) in acidic, envi- G-C-G-G conserved motif on the carboxy terminus of the protein. ronments are produced as a result of abiotic Fe(III) oxidation of The SoxB subunit is predicted to have two manganese ions in the sulfide minerals such as (FeS2; initial ISC product is thiosul- active site and works as a thiohydrolase interacting with SoxYZ fate) or chalcopyrite (CuFeS2; initial product is polysulfide sulfur). (Friedrich et al., 2005). Several sulfur oxidizing (e.g., green Their subsequent biooxidation produces sulfuric acid as the final and purple sulfur bacteria) only contain the core thiosulfate oxidiz- product (Schippers and Sand, 1999; Johnson and Hallberg, 2009). ing multi-enzyme system (TOMES). The TOMES lacks the sulfur 0 As a result of sulfuric acid production, sulfide mineral environ- dehydrogenase Sox(CD)2 and oxidizes thiosulfate to sulfate and S ments are typically inhabited by acidophilic . These (reviewed in Friedrich et al., 2001; Ghosh and Dam, 2009, and Sakurai 0 microorganisms are exploited in the biotechnological process of et al., 2010). Due to the lack of Sox(CD)2, S is polymerized to form “” whereby dissolution of sulfide minerals is catalyzed globules which can be further oxidized by proteins encoded in the dis- by the action of ISC oxidizing microorganisms as well as Fe(II) similatory (dsr) gene cluster (Hensen et al., 2006). oxidizers that regenerate the Fe(III) required for the abiotic attack In contrast to the well studied Sox enzyme complex, the ISC oxi- of sulfide minerals (Rawlings and Johnson, 2007). dations pathways in acidophiles are not very well understood. As A diverse range of acidophilic or neutrophilic photo- and chemo- described in recent reviews (Rohwerder and Sand, 2007; Johnson can oxidize ISCs from sulfide (oxidation state of −2) to and Hallberg, 2009), S0 is thought to be oxidized by acidophilic sulfate (+6; reviewed in Ghosh and Dam, 2009). Microorganisms bacteria via sulfur dioxygenase (SDO) and by via sul- utilize several systems for ISC oxidation including the Paracoccus pan- fur oxygenase reductase (Sor). The SDO has not been character- totrophus 15 gene sulfur oxidizing (sox) cluster. This cluster encodes ized although its enzyme activity has been shown (Suzuki, 1999; the multiple substrate Sox system that catalyzes oxidation of thio- Rohwerder and Sand, 2003). However, the archaeal Sor has been sulfate, elemental sulfur (S0), sulfide, and sulfite to sulfate. SoxAX is well studied and the corresponding gene has been identified in composed of the dihemic and monohemic cytochromes SoxA and Acidianus tengchongensis, aeolicus, Picrophilus torridus, SoxX, respectively. SoxYZ is predicted to be able to bind ISCs in dif- “ acidarmanus,” and tokodaii (Urich et al.,

www.frontiersin.org February 2011 | Volume 2 | Article 17 | 1 Mangold et al. Sulfur metabolism in Acidithiobacillus caldus

2006). In the presence of oxygen, Sor simultaneously catalyzes plasmic homo-dimer with an optimum pH of 3 (Bugaytsova and oxidation and reduction of S0 generating sulfite, thiosulfate, and Lindström, 2004). Previously Tth was also studied in A. ­ferrooxidans sulfide (Urich et al., 2006). The enzyme does not require cofactors (de Jong et al., 1997). or external electron donors for S0 reduction. Due to its cytoplasmic Owing to the fact that A. caldus is ubiquitous in both natural location it is believed that it does not play a role in formation of and anthropogenic sulfide mineral environments, its importance the transmembrane electron gradient but rather provide substrates in generating sulfuric acid, and in mitigating mineral passivation for other membrane bound enzymes. Another enzyme which has we have investigated its ISC metabolism. An in depth bioinformatic recently been suggested to be involved in Acidithiobacillus ferrooxi- analysis revealed the putative genes responsible for sulfuric acid dans S0 metabolism is heterodisulfide reductase (Hdr; Quatrini generation, that have then been verified by proteomic comparison et al., 2009). So far no biochemical evidence for A. ferrooxidans between growth with tetrathionate and S0 and via transcript profil- S0 oxidation by Hdr has been reported, however, transcriptom- ing. This has generated insights into the ISC metabolism of this ics (Quatrini et al., 2009) and proteomics data (unpublished . Such knowledge might help to better understand data) strongly suggests its involvement. Hdr of methanogenic the industrial processes. archaea has been studied (Hedderich et al., 2005) and it catalyzes the reversible reduction of the disulfide bond in heterodisulfide Materials and Methods accompanied by the extrusion of electrons and the formation of a Bioinformatic reconstruction of A. caldus ISC metabolism transmembrane electron gradient. Quatrini et al. (2009) hypoth- Genes and metabolic pathways involved in ISC and S0 oxida- esize that Hdr works in reverse in acidophiles by utilizing the tion/reduction were obtained from Metacyc1 and Kegg2. Amino naturally existing proton gradient to oxidize disulfide intermedi- acid sequences derived from selected genes previously identi- ates originating from S0 and donating electrons to the quinone fied to be involved in ISC metabolism were used as a query to pool. Other enzymes involved in acidophilic ISC oxidation path- conduct BlastP and tBlastN (Altschul et al., 1997) searches to ways are thiosulfate:quinone oxidoreductase (Tqr) which oxidizes interrogate the A. caldusT (ATCC51756) draft genome sequence thiosulfate to tetrathionate, tetrathionate hydrolase (Tth), and (NZ_ACVD00000000.1). Potential gene candidates were fur- sulfide oxidoreductase (Rohwerder and Sand, 2007; Johnson and ther characterized employing the following bioinformatic tools: Hallberg, 2009). Recently, the analysis of gene context has high- ClustalW (Larkin et al., 2007) for primary structure similarity lighted differences in ISC oxidation strategies in A. ferrooxidans, relations, PSI-PRED (Bryson et al., 2005) for secondary structure Acidithiobacillus thiooxidans, and Acidithiobacillus caldus (Cardenas predictions, Prosite (Hulo et al., 2006) for motif predictions, and et al., 2010). Microarray analysis suggests the petII (prosthetic ProDom (Bru et al., 2005) and Pfam (Finn et al., 2008) for group-containing subunits of the cytochrome bc1 complex), cyo predictions. Selected gene candidates were assigned to putative (cytochrome o ubiquinol oxidase), cyd (cytochrome bd ubiquinol orthologous groups in order to determine potential evolution- oxidase), and doxII (encoding thiosulfate quinol reductase) gene ary associations3 (Tatusov et al., 2003). Information regarding the clusters are up-regulated during growth on S0 compared to Fe(II) organization of genes in other S0 metabolizing microorganisms grown cells (Quatrini et al., 2006). From these data, a model for was obtained from NCBI4 and IMG–JGI5. A. ferrooxidans ISC metabolism has been created (Quatrini et al., 2009). A. ferrooxidans proteins with increased expression during Media and culture conditions growth on S0 include an outer membrane protein (Omp40) and a A. caldusT was cultured in mineral salts medium (MSM) with trace thiosulfate sulfur transferase protein (Ramirez et al., 2004). Also, elements (Dopson and Lindström, 1999) at 45°C and pH 2.5 whilst a high throughput study of periplasmic proteins identified 41 and sparging with 2% (vol/vol) CO2 enriched air. Tetrathionate (5 mM; 14 proteins uniquely expressed in S0 and thiosulfate grown cells, Sigma) and 5 g/L hydrophilic, biologically produced S0 (provided respectively (Valenzuela et al., 2008). The genome context of these by PAQUES B.V., the Netherlands) were used as substrate. Stock proteins suggests they are involved in ISC metabolism and pos- solutions of tetrathionate were sterile filtered and added to the sibly S0 oxidation and Fe–S cluster construction. Secreted proteins autoclaved (121°C for 15 min) MSM, whereas the finely ground from a pure culture of A. thiooxidans and from co-culture with S0 was added to MSM prior to autoclaving at 105°C for 30 min. A. ferrooxidans were studied by proteomics (Bodadilla Fazzini and The medium containing solid S0 was stirred for 24 h to ensure fine Parada, 2009). An Omp40 like protein was identified which is sug- dispersion of the S0 particles. Biomass for the transcript profiling gested to be involved in attachment. Finally, S0 induced genes in and proteomic comparison of growth on tetrathionate versus S0 the acidophilic archaeon Sulfolobus metallicus include Sor (Bathe was produced in continuous culture with a dilution rate of 0.06 h−1. and Norris, 2007). The homogeneous delivery of solid substrate was ensured by con- A. caldus is an ISC oxidizing acidophile (Hallberg et al., 1996b) tinuous stirring of the feed vessel and an appropriate flow rate often identified in biomining environments (Okibe et al., 2003; which did not allow S0 to settle in the tubing. In contrast, cell mass Dopson and Lindström, 2004). A. caldus aids in metal dissolution for proteomic comparison of A. caldus sessile versus planktonic by removal of solid S0 that may form a passivating layer on the mineral surface (Dopson and Lindström, 1999). The A. caldus draft 1http://metacyc.org/ genome contains genes for ISC oxidation (Valdes et al., 2009). The 2http://www.genome.ad.jp/kegg/ gene cluster containing the A. caldus tetrathionate hydrolase (tth) 3http://www.ncbi.nlm.nih.gov/COG/ and the doxD component (thiosulfate:quinol oxidoreductase) has 4http://www.ncbi.nlm.nih.gov/genome/ been characterized (Rzhepishevska et al., 2007). The Tth is a peri- 5http://genome.jgi-psf.org/programs/bacteria-archaea/index.jsf

Frontiers in Microbiology | Microbial and Metabolism February 2011 | Volume 2 | Article 17 | 2 Mangold et al. Sulfur metabolism in Acidithiobacillus caldus

growth was grown in 1 L batch cultures with initial pH 2.5. Sessile with a NanoDrop 2000 spectrophotometer (ThermoScientific). and planktonic bacteria from batch cultures were harvested in mid In order to rule out DNA contamination, the RNA samples were exponential growth phase according to planktonic cell counts (pH subjected to PCR using illustra PuRE Taq Ready-To-Go PCR Beads at collection was 1.3–1.4). Planktonic cells from batch or continu- (GE Healthcare). RT-PCR was performed in a two step reaction ous culture were harvested at 4750 g for 10 min followed by a using RevertAid First Strand cDNA Synthesis Kit (Fermentas) for washing step in MSM pH 2.5. For the continuous culture grown RT and AccessQuick Master Mix (Promega) for PCR. The RT reac- on S0, the remaining S0 particles were separated from planktonic tion primed with random hexamers was performed with 1 μg total cells by pelleting at 450 g for 30 s which only removed the S0 but left RNA for 1 h at 45°C using two independent biological samples for planktonic cells in the supernatant (the solid S0 and any attached each condition. PCR primed with specific primers (Table 1) was cells were discarded). Solid S0 with sessile bacteria attached was carried out with 1 μL of RT reaction as template in 25 μL reac- collected from batch cultures and washed four times with MSM pH tion volume in PTC-100 Programmable Thermal Controller (MJ 2.5 until no planktonic bacteria were detected in the supernatant Research Inc.). PCR cycling was started with initial denaturation by microscopic investigation before pelleting at 450 g for 30 s. All at 95°C for 5 min, followed by 30 amplification cycles consisting cell and S0 pellets were stored at −80°C. of denaturation at 95°C for 30 s, annealing at primer specific tem- peratures (Table 1) for 30 s, and elongation at 72°C for 2 min 30 s Semi quantitative RNA transcript profiles and concluded with 5 min elongation at 72°C (no further increase Primers targeting selected genes putatively involved in ISC metab- of PCR product was observed after 31 cycles). A transcription con- olism were designed for semi quantitative reverse transcription trol gene, DNA gyrase (gyrA), was used (Takle et al., 2007). PCR (RT-) PCR amplification (product sizes 98–530 bp; Table 1). RNA products were separated by agarose electrophoresis and quantified was extracted from 100 to 200 mL medium from the continuous with QuantityOne (BioRad). For final analysis, the 2 independent cultures with TRI reagent (Ambion) according to the manufac- RNA samples (biological replicates) were used as templates for turer’s recommendations. Contaminating DNA was digested with duplicate RT-PCR reactions (technical replicates) which yielded RNase-free DNase I (Fermentas) followed by a second extraction a total of four replications. In a few cases one replicate was not with TRI reagent. RNA concentration and purity was measured considered for analysis.

Table 1 | Primers used for RNA transcript profiles.

Primer name Primer sequence Targeted gene Product size [bp] Melting temp. [°C]

ACA0302For TTCGAGCAACTCCTGCAGACG sor 271 55.5 ACA0302Rev CGTCCGTCATACCCATGATCC ACA_0302 ACA1632For GATCCAGGCGATTCATATACGG doxD 337 55.5 ACA1632Rev TGATCCCCATAGCGAAATTAGAG ACA_1632 ACA1633For TTTTGCGCGTTTGTACCTACCC tth 223 55.5 ACA1633Rev AACGCCGTCTACTTGAGCTCC ACA_1633 ACA2312For TGGCGATCTTACCTTGAGCGAGG soxA-I 436 55.5 ACA2312Rev TGCGCTCTGCCCCAAAAGTGG ACA_2312 ACA2392For ATCTACCCTTCGACAAGTATGC soxA-II 527 55.5 ACA2392Rev TGTGCCGTCTCGCCTTGCAAG ACA_2392 ACA2317For GAAGCCGGTACTGATCAACAAG soxB-I 437 55.5 ACA2317Rev CGTGTACTCCGTAACCGTAACC ACA_2317 ACA2394For TCCGTCCTCAACCAGACGCCC soxB-II 467 55.5 ACA2394Rev ACAGCGATTTTGCGACCGCTG ACA_2394 ACA2319For CTCGCGCCGCAAATGTTCCCG soxY-I 180 55.5 ACA2319Rev TGATCGACATCCACGGTAACCG ACA_2319 ACA2390For ATCGGCACAAGCCTCGTTGCG soxY-II 340 55.5 ACA2390Re2 CTGGGGTGAGATCGAACTGGC ACA_2390 ACA2313For GTGCAGTTTATTTACGACCCGG soxX-I 98 58 ACA2313Rev ACCAAGCCAATCTGGTGATCCG ACA_2313 ACA2389For ACTCGATACCATCGTTCGTGC soxX-II 256 58 ACA2389Rev TCTGGAACATCTGCTGGAAGG ACA_2389 ACA2318For AGAGGTCCGTTCGTTGATCATG soxZ-I 269 58 ACA2318Rev TCAGGCGACGGTGATCTTTGCC ACA_2318 ACA2391For ATGGCAGACAATATTGGTAACCC soxZ-II 197 58 ACA2391Rev TCGATGTCCAGCAGCTTTGCAC ACA_2391 ACAgyrA-F4 CAGCCTCGAAAAAGAAATGC gyrA 431 55.5 ACAgyrA-R4 CCACCTCCTTCTCGTCGTAG ACA_1592

www.frontiersin.org February 2011 | Volume 2 | Article 17 | 3 Mangold et al. Sulfur metabolism in Acidithiobacillus caldus

A. caldus proteomics analysis the gel, destained, and digested with sequencing grade modified For the preparation of the total soluble proteome, cell pellets from trypsin (Promega) according to standard procedures for matrix- 200 mL culture were re-suspended in lysis buffer (7 M urea, 2 M assisted laser desorption/ionization time-of-flight (MALDI-ToF) thiourea, 30 mM Tris, 1 mM EDTA, 1.5% Triton X-100, pH 8.5), mass spectrometry (Shevchenko et al., 1996; Pandey et al., 2000). broken by sonication (2 min, 5 s pulse, 5 s break, 30% amplitude), Subsequently, tryptic digests were spotted on a MALDI target plate cell debris removed by centrifugation (10 min, 10 000 rpm, 4°C), and co-crystallized with α-cyana-4-hydroxy-cinnamic acid solu- and the lysate stored at −80°C. Isoelectric focusing (IEF) was per- tion (Agilent Technologies). Mass spectra were acquired with a formed using pre-cast, 18 cm, Immobiline DryStrip IPG gels (GE Voyager DE-STR mass spectrometer (Applied Biosystems) and Healthcare) with a non-linear pH gradient from 3 to 10 in an Ettan analyzed using DataExplorer (Applied Biosystems). External cali- IPGphor IEF unit (GE Healthcare). Protein samples (200 μg) were bration with premixed standard (Sequenzyme applied to the IPG strip in rehydration buffer (7 M urea, 2 M thiou- Mass Standard Kit, Applied Biosystems) was performed. Peptide rea, and 1.5% Triton X-100) with 1.45% dithiothreitol (DTT) and mass fingerprints (PMFs) of mass spectra were searched against 0.5% IPG buffer (GE Healthcare). After passive rehydration for 16 h a local database containing the A. caldusT draft genome sequence at 25°C, IEF was run for a total of 42 kVh with stepwise increas- (NZ_ACVD00000000.1) using Mascot with the following search ing voltage according to supplier’s recommendation. Following parameters: (i) two missed cleavages; (ii) peptide mass tolerance IEF, the gel strips were equilibrated in two steps using equilibra- of 50 ppm; and (iii) variable modifications [carbamidomethyl (C), tion buffer (75 mM Tris, 6 M urea, 30% glycerol, 2% SDS) with oxidation (M), propionamide (C)]. Hits in the local database with additional 100 mM DTT in the first step and equilibration buffer a Mowse score > 47 were significant at a confidence level of 95%. with 2.5% iodoacetamide in the second step. The gel strips were Two samples were analyzed by Edman degradation performed at the then applied to 12% Duracryl (NextGene Genomic Solutions) Protein Analysis Center, Karolinska Institute, Stockholm, Sweden. SDS-polyacrylamide gels and sealed with 1.5% (wt/vol) agarose For more detailed functional information of identified proteins the solution containing bromophenol blue. Electrophoresis was run Biocyc database6 was queried and InterProScan signature recogni- in an Ettan DALTsix apparatus (GE Healthcare). The gels were tion search7 was performed. fixed and stained to saturation with colloidal Coomassie (Anderson, In order to rule out any contaminating proteins originating 1991). After staining was completed the gels were scanned using from the biological S0, 2D gels were run from samples prepared by Image Scanner (GE Healthcare) and analyzed using image analysis suspending the S0 in lysis buffer and sonicating. Control gels were software Melanie 7.03 (Genebio). The membrane enriched frac- stained with silver (Blum et al., 1987) and no protein spots were tions were prepared according to Molloy (2008). In brief, crude cell detected (data not shown). extracts were obtained by sonication in Tris buffer (50 mM Tris pH 8.0, 0.5 mM EDTA) and enriched for bacterial membranes by Results incubation at 4°C for 1 h in 100 mM Na2CO3 and subsequent ultra- Bioinformatic reconstruction of A. caldus ISC metabolism centrifugation at 170 000 g for 70 min. This carbonate extraction A detailed analysis of the genes present in the draft genome in combination with membrane solubilization and 2D gel electro- sequence of A. caldusT revealed genes for ISC oxidation that are phoresis has been used for the recovery of outer membrane proteins common to A. ferrooxidans [sulfide quinone reductase (sqr), doxD, of Gram-negative bacteria (Molloy et al., 2000, 2001; Phadke et and tth] (Valdes et al., 2008) and other microbial representatives al., 2001). The pellets were washed with 50 mM Tris buffer pH from extreme acidic environments. A. caldus also has gene can- 8.0 and re-suspended overnight at 4°C in rehydration buffer. The didates potentially encoding components of the Sox sulfur oxi- protocol for 2D gels was the same as above except that 24 cm IPG dizing system and Sor, which are not present in its close relative strips were used and IEF was run for a total of 59 kVh. For the A. ferrooxidans. The gene clusters are presented in Figure 1A while preparation of the soluble protein fraction from sessile bacteria the bioinformatic reconstruction of A. caldus ISC metabolism is it was necessary to detach the cells from the S0 prior to protein presented in Figure 1B. extraction and 2D gel electrophoresis (as above). The method for The first documented step in ISC oxidation is the transition cell detachment by Gehrke et al. (1998) was modified. In brief, the of sulfide to Sº. In Gram-negative bacteria, this reaction is car- S0 with sessile cells was incubated with a detergent solution pH 7.0 ried out by the usually membrane bound Sqr. This reaction can (0.01 mM 3-(Decyldimethylammonio)propanesulfonate inner salt also be catalyzed by membrane bound FCC sulfide dehydroge- (SB 3–10; Sigma), 10 mM Tris, 1 mM EDTA) for 5 min at room nase. The enzymatic activity of Sqr (EC 1.8.5.-) has been purified temperature with occasional vortexing before pelleting the S0 by from A. ferrooxidans membranes (Wakai et al., 2007). A sulfide centrifuging at 450 g for 30 s. The treatment was repeated four oxidizing activity has been identified in A. caldus but the enzyme times and supernatants containing the detached cells pooled and has not been identified (Hallberg et al., 1996b). Furthermore, one cells collected before proteomic analysis (as above). All gels of the of the three sqr copies present in the A. ferrooxidans genome is same condition were run in triplicate. reported to be involved in ISC metabolism (Quatrini et al., 2006, Protein spots were regarded as differentially expressed if they 2009). In A. caldus, an ortholog of the sqr (sqr-1) was identified showed the following characteristics: (i) reproducibility in all that was divergently oriented from a gene potentially encoding Sor, three gels of the same condition; (ii) the fold change between that participates in the utilization of S0 as energy source in several the two conditions was ≥2.0; and (iii) the fold change between conditions was significant with a probability of 95% according 6http://biocyc.org/ to one-way ANOVA testing. Spots of interest were excised from 7http://www.ebi.ac.uk/Tools/InterProScan/

Frontiers in Microbiology | Microbial Physiology and Metabolism February 2011 | Volume 2 | Article 17 | 4 Mangold et al. Sulfur metabolism in Acidithiobacillus caldus

A Inorganic sulfur compound enzymes

sox cluster I doxD and tth hdr resC-1 soxA-1 soxX resB-1 hyp soxB-1 soxZ-1 soxY-1 doxD tth tchq rtc tpase-1 hdrA hyp hdrC hdrB

sox cluster II sqr and sor soxX-2 soxY-2 soxZ-2 soxA-2 hyp soxB-2 hyp sor sqr-1 hyp hyp sqr-2

Terminal oxidases

bo3 type bd type cyoB cyoA cyoC cyoD caf ftr mfs hyp cydB -1 cydA-1 hyp g6pi tpase cydA-4 cydB-4 hyp

cyoB cyoA cyoC cyoD caf ftr mfs tpase hyp cydB-2 cydA-2 hyp atrp hyp cydB-5 cydA-5

matr cydB-3 cydA-3 hyp blac cydA-6 cydB-6 hyp aa3type qoxB qoxA qoxC qoxD

NADH quinone oxidoreductase nuoA nuoB nuoC nuoD nuoE nuoF nuoG nuoH nuoI nuoJ nuoK nuoL nuoM nuoN

nuoA nuoB nuoCD nuoE nuoF nuoG nuoH nuoI nuoJ nuoK nuoL nuoM nuoN

B ISCs

Outer membrane Omp40 2H+ Tth

H S S0 S O -2 -2 aa3 2 4 6 S2O3 -2 0 Cyt Ox SO + S + 4 4H Sqr Sox CytC 4H+ + Complex 2H2H + 1/2O1/2O2 H2O bo3 ubi-ox

4H+ 2H+ 4H+ QH2 2H++ 1/2O1/2O H O Cytoplasmic bd ubi-ox 2 2 membrane NADH 2H2H+ 6H+ Sor 2H++ 1/2O H O Hdr 2 2 + 2NAD 2NADH 0 2- 2- 2- 5S SO3 + S2O3 + S 2- GSSH GSH + SO3

Sox complex Transposases Bd terminal oxidases Bo3 terminal oxidases Maturation proteins Nuo complex Hypothetical proteins Other

Figure 1 | Gene clusters of enzymes potentially involved in inorganic reductase; sor, sulfur oxygenase reductase; hyp, hypothetical protein; caf, sulfur compound (ISC) metabolism as well as gene clusters of terminal cytochrome oxidase assembly factor; ftr, heme O synthase, protoheme IX oxidases and the NADH quinone-oxidoreductase complex as predicted farnesyltranferase; g6pi, 6-p isomerase; mfs, major facilitator by bioinformatic analysis of the A. caldus genome sequence (A). superfamily protein; atrp, putative transporter; matr, putative malic Suggested model for ISC metabolism in A. caldus (B). Abbreviations: sox, acid transporter; blac, beta lactamase; tpase, transposase; tchq, two sulfur oxidation system; doxD, thiosulfate:quinol oxidoreductase; tth, component system – histidine quinase; rtc, two component system – tetrathionate hydrolase; hdr, heterodisulfide reductase;sqr , sulfide quinone response regulator.

­organisms (Urich et al., 2004). The product of the A. caldus sqr-1 Another enzyme reported to be involved in ISC ­metabolism is Tth. shares 40% similarity with another putative sqr ortholog (sqr-2) The activity of this enzyme has been detected in several acidithio- identified in the draft genome sequence. This latter copy has a bacilli (Hallberg et al., 1996b; Brasseur et al., 2004). An inspection similar gene context to sqr-3 from A. ferrooxidans and shares a of the draft genome of A. caldus reveals the presence of a candidate 62% similarity to this protein. Although Sqr representatives belong tth upstream of doxD (Figure 1A). The putative Tth of A. caldus to a large and considerably variable gene family of the pyridine shares 71% similarity with the Tth of A. ferrooxidans, indicating nucleotide-disulfide oxido-reductases (Pfam: PF07992), the high their high similarity orthologous relationship. The Tth of both similarity plus the conservation of gene context observed with sequenced acidithiobacilli have a conserved pyrrolo-quinoline A. ferrooxidans strongly suggests similar functional properties. quinone (PQQ) domain (Pfam: PF01011). Although Tth’s are

www.frontiersin.org February 2011 | Volume 2 | Article 17 | 5 Mangold et al. Sulfur metabolism in Acidithiobacillus caldus

predicted to be external ­membrane proteins, experimental evi- ­binding of a Fe–S cluster. The putative HdrB, ACA_2421, contains dence showed that the A. caldus Tth is a soluble periplasmic pro- two typical cysteine rich regions whereas the second putative HdrB tein with maximum activity at pH 3 (Bugaytsova and Lindström, subunit, ACA_2417, contains only one such region. The remain- 2004). Furthermore, the tth gene cluster has been recently studied ing subunit, HdrC, is represented by ACA_2376 and ACA_2420 (Rzhepishevska et al., 2007). both containing the 4F–4S ferredoxin iron–sulfur binding domain. In contrast to the enzymes described above, the Sox sulfur oxi- ACA_2418, ACA_2421, and ACA_2420 are embedded in the gene dizing system has not been found in any microorganisms from cluster hdrA hyp hdrC hdrB (Figure 1A). All putative A. caldus the Acidithiobacillus genus. However, the bioinformatics analyses Hdr subunits showed >90% similarity to the respective A. fer- identified the presence of two gene clusters potentially encod- rooxidans Hdr subunits. As previously shown for A. ferrooxidans ing components of the Sox system. The A. caldus Sox complex is (Quatrini et al., 2009), the similarity to Hdr of other acidophilic ­predicted to be formed by three periplasmic components (referred sulfur ­oxidizers is significant whereas the similarity of theA. caldus to as core TOMES): SoxAX, SoxYZ, and SoxB (Figure 1A). Our putative HdrABC to their respective subunits of the methanogenic bioinformatics inspection did not identify soxCD orthologs in the archaea Methanothermobacter marburgensis is only around 30%. draft genome sequence of A. caldus; however we cannot disregard It has been shown that sulfur oxidizing bacteria which lack the presence of these genes until the A. caldus genome sequence Sox(CD)2 utilize the reverse dissimilatory sulfite reductase (DsrAB) is finished. Nevertheless, based on the model for ISC metabolism for the oxidation of S0 to sulfite (reviewed inFriedrich et al., 2001; in the green sulfur bacterium Chlorobaculum tepidum proposed Ghosh and Dam, 2009, and Sakurai et al., 2010). In Allochromatium by Sakurai et al. (2010) it can be predicted that the A. caldus core vinsum, DsrAB is encoded with 13 other Dsr proteins in a cluster TOMES is able to oxidize thiosulfate with the possible accumula- (Dahl et al., 2005) also containing DsrEFH and DsrC. The latter tion of S0 globules in the periplasm and it may be able to oxidize are proposed to be involved in S0 substrate binding and transport sulfite (Friedrich et al., 2001). No candidates for the enzymes adeny- of S0 from the periplasmic S0 globules to the cytoplasm (Cort et lylphosphosulfate (APS) reductase or sulfate adenylyltransferases, al., 2008). Escherichia coli DsrEFH and DsrC homologs (TusBCD which consecutively oxidize sulfite via an indirect pathway, have and TusE) interact in a S0 relay system during 2-thiouridine bio- been found in the genome of A. caldus. However, an oxidoreductase synthesis (Ikeuchi et al., 2006). Although no homologs of dsr were molybdopterin-binding protein (ACA_1585) was identified as a found in the A. caldus draft genome sequence, several potential possible sulfite oxidizing enzyme catalyzing the direct oxidation of DsrE-like proteins containing the characteristic DsrE/DsrF-like sulfite to sulfate. ACA_1585 has a molybdopterin-binding domain family features (Pfam 02635) were detected. All of those were anno- (PF00174) and a twin-arginine translocation pathway signal tated as hypothetical proteins (ACA_0867, ACA_0091, ACA_2522, sequence. It lacks a dimerization domain and an N-terminal heme ACA_0556, ACA_1583, ACA_1441, and ACA_2423) and putatively domain. Furthermore, no additional putative subunits containing play a role in S0 binding and transport. Additionally, several candi- heme domains have been detected. ACA_1585 has 26% similarity dates for the transport of extracellular S0 to the cytoplasm have been with the sulfite oxidizing enzyme DraSO fromDeinococcus radio- proposed for green sulfur bacteria (Frigaard and Bryant, 2008a,b; durans which was proposed to be a novel sulfite oxidizing enzyme Sakurai et al., 2010). One possibility is that the thioredoxin SoxW without a heme domain (D’Errico et al., 2006). acts together with thiol:disulfide interchange protein DsbD within Another enzyme involved in A. caldus ISC metabolism not the periplasm in transferring S0 across the inner membrane (Sakurai found in A. ferrooxidans is Sor (one copy of sor was identified). et al., 2010). One candidate gene was predicted that potentially The predicted protein shows a characteristic domain of the Sor encodes a DsbC ortholog (ACA_2033) with similar functions as family (Pfam: PF07682) and all activity-critical residues based on DsbD. DsbC thiol:disulfide interchange protein ACA_2033 exhibits structural and experimental data (Urich et al., 2006). Furthermore, a conserved N-terminal domain of the disulfide bond isomerase the predicted cytoplasmic location of the A. caldus Sor enzyme DsbC family (Pfam10411). It has been reported that members of agrees with experimental data obtained from A. tengchongensis this protein family are responsible for the formation of disulfide and Escherichia coli transformants (Chen et al., 2005). The sor was bonds and function as a disulfide bond isomerase during oxidative found adjacent and divergently arranged from sqr-1 (Figure 1A). protein-folding in the bacterial periplasm (Hiniker et al., 2005). This suggests the presence of potentially shared regulatory regions No homolog of SoxW has been found in A. caldus; however, other that could be co-regulating both enzymes, catalyzing successive thioredoxins might fulfill the same function. reactions, and thus providing an adaptive strategy. Recently, the A. caldus is also predicted to contain two gene clusters poten- enzyme activity of Sor has been reported to be present in A. caldus- tially encoding components of the NADH quinone-oxidoreductase like strains (Janosch et al., 2009). However, it is still unknown how complex (EC 1.6.5.3) as has been observed in Azotobacter vinelan- its substrate (S8) is incorporated in to the cell or how the result- dii (Bertsova et al., 2001). In addition, six cydAB copies possibly 0 −2 ing products (S , H2S, and S2O3 ) are excreted. Furthermore, het- encoding subunits of Qox-bd (EC 1.10.3.-) terminal oxidase and erodisulfide reductase (Hdr) has been postulated to be involved one gene cluster that might code for a putative aa3-type terminal in A. ­ferrooxidans S0 oxidation (Quatrini et al., 2009) and is up- oxidase were detected. The analysis also revealed the presence of regulated during aerobic growth on solid S0 (unpublished data). two copies of the cytochrome o (cyoBACD-caf-ftr-mfs) gene cluster In A. caldus two orthologs of each HdrABC subunit have been (Cyo-1 and Cyo-2), sharing 89 and 75% similarity with orthologs found. Both putative HdrA subunits (ACA_1473, ACA_2418) in A. ferrooxidans. This gene redundancy could have several expla- are flavoproteins with a FAD binding site and they also contain nations including: (i) to provide regulatory and pathway flexibility the conserved four cysteine residues (CXGXRDX6–8CSX2CC) for to confront environmental changes such as oxygen availability

Frontiers in Microbiology | Microbial Physiology and Metabolism February 2011 | Volume 2 | Article 17 | 6 Mangold et al. Sulfur metabolism in Acidithiobacillus caldus

No putative proteins belonging to NADH quinine-oxidoreduct- ase or terminal oxidases were found differentially expressed in the various conditions tested. However, based on the bioinformatic reconstruction the involvement of NADH quinone-oxidoreductase complex and terminal oxidases in the A. caldus ISC metabolism was suggested. Therefore, these complexes were represented in the proposed model (Figure 1B).

Proteins involved in ISC metabolism Proteins encoded within the two Sox clusters were up-regulated in gels from tetrathionate grown bacteria including SoxB-I (M793) and hypothetical protein ACA_2320 (S524) encoded in sox cluster I; as well as SoxA-II (S356, S538, S539), SoxZ-II (S10), and hypothetical protein ACA_2393 (S34) from sox cluster II. These findings clearly suggest an involvement of proteins encoded by both Sox clusters in ISC metabolism during growth on tetrathionate. Furthermore, both Sqr-1 (S260) and Sqr-2 (M300) were identified as up-regulated on tetrathionate. A DsrE/F-like hypothetical protein ACA_0867 (S17, Figure 2 | RNA transcript profiles of selected genes predicted to be 0 involved in A. caldus inorganic sulfur compound metabolism. Shown are S518, M13), potentially involved in S binding and transport, was the means of relative band intensities from semi quantitative RT-PCR products up-regulated on tetrathionate and subunit C of CoB–CoM heterodi- of three to four replicates with standard deviations. RNA was extracted from sulfide reductase (S543, S544; ACA_2420) was a unique protein spot cells grown on tetrathionate (gray columns) or S0 (white columns). on tetrathionate gels. In contrast, HdrA (S462; ACA_2418) was found as a unique protein spot in S0 gels while the DsrE/F-like hypothetical

(bo and bd complexes have different O2 affinities); or (ii) to man- protein ACA_1583 (S9) and DsbC thiol:disulfide interchange protein age ISC oxidizing complexes that introduce electrons at variable ACA_2033 (S358) were up-regulated on S0. places in the electron transport chain (e.g., quinol-level for SQR and cytochrome c-level for Sox). General trends in the proteome of tetrathionate grown A. caldus Several proteins relevant in signal transduction were up-regulated RNA transcript profiles of selected ISC genes in tetrathionate grown cells, i.e., chemotaxis protein CheV (S151, Reverse transcription-PCR showed that all assayed genes were tran- M735), putative sensory histidine kinase YfhA (S577), nitrogen reg- scribed during growth on tetrathionate and S0 (Figure 2). No sig- ulation protein NRI (M 776), and hypothetical protein ACA_1270 nificant changes in transcript levels were detected for sor, doxD, tth, (M277) containing a PAS domain fold involved in signaling pro- soxZ-I, and soxZ-II. The remaining sox cluster genes were significantly teins. However, the signature feature of the tetrathionate grown up-regulated during growth on tetrathionate. The similar RNA levels proteome was up-regulation of proteins involved in central car- for soxZ-I and soxZ-II during growth on tetrathionate and S0 was unex- bon metabolism, cell division, amino acid biosynthesis, fatty acid pected as both genes would be expected to be co-transcribed with their biosynthesis, translation, and DNA repair. The up-regulated cen- respective gene clusters. With the exception of the soxA transcript, the tral carbon metabolism proteins included aspartate aminotrans- transcript levels of both sox clusters followed the same trends indicating ferase (S571), dihydrolipoamide dehydrogenase (S594), fructose that both were involved in ISC metabolism. The control gene, gyrA, bisphosphate aldolase (M248), and phophoglucomutase (M368). displayed similar transcription levels under both conditions. A few proteins of central carbon metabolism were up-regulated in S0 grown cells those including 6-phosphogluconate dehydro- Protein expression during growth on S0 versus genase (S154) and HAD-superfamily hydrolase (M71). Proteins tetrathionate involved in cell division were solely found up-regulated on gels of Proteomic analysis yielded 115 identifications of differentially tetrathionate grown cells such as FtsA (M262), FtsZ (M227), and expressed protein spots (Figures 3 and 4; Table A1 in Appendix). FtsH (M386, M388, M513). Four proteins involved in amino acid Forty-three proteins were up-regulated on tetrathionate (12 in biosynthesis and degradation (S549, S694, M353, M755) and three soluble and 31 in membrane fraction) and 30 uniquely found on involved in fatty acid biosynthesis (M179, M309, M726) were up- tetrathionate gels (21 in soluble and 9 in membrane fraction). regulated in tetrathionate grown cells. No proteins of this group During growth on S0, 23 protein spots were up-regulated (15 in were up-regulated in S0 grown cells. Another characteristic group soluble and 8 in membrane fraction) and 19 were unique (11 in consisted of translation related proteins which included two differ- soluble and 8 in membrane fraction). Several protein spots yielded ent translation elongation factors (S217, S388, M254, M521), four the same identification which indicated protein fragmentation, post different tRNA synthetases (S572, S625, M431, M508), and one translational modification, or the protein was up-regulated in both amidotransferase (S702) up-regulated on tetrathionate; whereas the soluble and membrane enriched fractions. Protein designa- only one ribosomal protein (S338) was detected up-regulated in tions are given in parenthesis with their match ID as designated by S0 grown cells. Proteins involved in DNA repair included a MutS2 Melanie including a capital letter S specifying soluble fraction and family protein identified in two protein spots (M344, M781) and M for membrane enriched fractions. DNA repair protein RecN (M362).

www.frontiersin.org February 2011 | Volume 2 | Article 17 | 7 Mangold et al. Sulfur metabolism in Acidithiobacillus caldus

Figure 3 | Two dimension gel of the A. caldus soluble proteome from cells unique in tetrathionate grown cells (I); heat shock protein GroEL (S429 and grown on tetrathionate (A; identified spots are marked with circles and the S428) unique in S0 grown cells (II); twin-arginine translocation protein TatA (S37) numbers indicate match IDs given without S in the figure). Inset frames show which was 3.8-fold up-regulated in tetrathionate (III); and heat shock protein tetrathionate (B) and S0 (C) conditions: Radical SAM domain protein (spot S563) Hsp20 (S26) that was 8.6-fold up-regulated in S0 grown cells (IV).

Figure 4 | Two dimension gel of the A. caldus membrane enriched identified as hypothetical protein ACA_1144 that were unique (M738) and proteome on tetrathionate (A; identified proteins indicated with circles and 10.7-fold up-regulated (M482) in gels from tetrathionate grown cells (II); type 1 match IDs given without M in the figure). Inset frames are presented for secretion outer membrane protein (M493) that was 2.4-fold up-regulated in S0 tetrathionate (B) and for S0 (C) conditions: Carboxysome shell protein CsoS1 grown cells (III); and a putative lipoprotein (M49) which was 10.3-fold (spot M263) that was 6.1-fold up-regulated in S0 grown cells (I); two spots up-regulated on tetrathionate (IV).

Frontiers in Microbiology | Microbial Physiology and Metabolism February 2011 | Volume 2 | Article 17 | 8 Mangold et al. Sulfur metabolism in Acidithiobacillus caldus

Increased expression of proteins with central functions is com- Protein expression during planktonic versus sessile monly attributed to an increased growth rate. However, the samples growth on S0 originated from continuous cultures grown at identical dilution In 2D gels of planktonic A. caldus, three up-regulated and three rates, meaning that bacteria were theoretically maintained at the unique protein spots were identified. Based on characteristic peaks same growth rate. Therefore, it was more likely that the observed in mass spectra an additional six protein spots up-regulated in trends signified down-regulation of central functions in the0 S planktonic cells were revealed to be the same protein. The identifica- grown cells due to a stress response. Nevertheless, the observed tion of this protein could neither be determined by MALDI-ToF nor results motivated the proteomic investigation of sessile and plank- by Edman degradation. From gels of sessile cells, 22 up-regulated tonic A. caldus grown in S0 batch cultures as only the planktonic protein spots were identified (Figure 5; Table A2 in Appendix). sub-population was investigated for the comparison of growth on Several of the proteins identified from planktonic cells were also tetrathionate and S0. found up-regulated in tetrathionate grown cells, i.e., TatA (64), Sqr-1 (492), and hypothetical protein ACA_0867 (826 and 827). General trends in the proteome of S0 grown A. caldus In addition, SoxY-I (841) and hypothetical protein ACA_2219 The most striking characteristic of the proteome of S0 grown cells (118) were identified. Proteins up-regulated in gels of sessile cells was the high number of up-regulated chaperones and proteases: comprised characteristic proteins from tetrathionate grown and S0 GroEL (S114, S146, S409, S413, S416, S425, S428, S429, S435, grown proteomes as well as proteins not identified from other gels. S436), heat shock protein Hsp20 (S26, S46), DnaK (M397), ClpB S0 characteristic proteins included the chaperones GroEL and DnaK (M441), and protease Do (M605). In contrast, the only chaperone (329, 541, 543, and 556), HdrA (382; ACA_2418), and proteins up-regulated during growth on tetrathionate was HscA (S624). involved in CO2 fixation such as ribulose bisphosphate carboxy- This indicated a stress response during growth on S0. It should lase large chain (258) and rubisco activation protein CbbQ (280). be noted that GroEL has been detected in many protein spots Tetrathionate associated proteins consisted of peptidyl-prolyl cis- most of them with low molecular weight in 2D gels (Figure 3, trans isomerase ppiD (213), CoB–CoM HdrC (238; ACA_2420), Table A1 in Appendix) indicating fragmentation of the protein. proteins involved in amino acid biosynthesis (442, 447, 455, 515), The cause of this fragmentation remains unknown. A second dis- two central carbon metabolism proteins (364, 408), and a single- tinguishing feature of the S0 grown proteome was up-regulation of stranded DNA-binding protein involved in DNA replication (70). proteins involved in CO2 fixation, namely ribulose bisphosphate The up-regulation of proteins involved in amino acid biosynthesis carboxylase large chain (M503) and carboxysome shell protein and central carbon metabolism suggests that sessile cells are less CsoS1 (M263, M530). However, the reasons for up-regulation starved than planktonic cells. CoB–CoM HdrB (395; ACA_2421) of proteins related to CO2 fixation remain unclear. Additionally, was not previously detected but was found up-regulated in gels stringent starvation protein A (S102) and flagella basal-body rod of sessile bacteria. Additionally, twitching motility protein (325) protein FlgC (S205) were up-regulated on S0. Stringent starvation and 40-residue YVTN family β-propeller repeat protein (404) protein A is believed to be important for stress response during were up-regulated in gels of sessile cells. Twitching motility pro- stationary phase and nutrient limitation in E. coli (Williams et tein is required for twitching motility and social gliding which al., 1994). The up-regulation of FlgC which is part of the basal allows Gram-negative bacteria to move along surfaces (Merz et al., body in flagella points at an increase of flagella and the impor- 2000). The YVTN domain is present in surface layer proteins of tance of cell motility in S0 grown cells to be able to attach to the archaea (Jing et al., 2002) which protect cells from the environment solid substrate. and have been shown to be involved in cell to cell association in Methanosarcina mazei (Mayerhofer et al., 1998). Proteins up-regulated under both conditions In one case, a two component protein was identified in both con- Discussion ditions whereas in other cases proteins sharing a similar func- ISC Metabolism in A. caldus tion could not be clearly attributed to either condition. Those A model has been constructed for ISC oxidation and electron trans- included proteins involved in protein transport such as an efflux port based upon gene predictions and proteomics data (Figure 1B). transporter (M180, M740) and Twin-arginine translocation pro- Tetrathionate is hydrolyzed by a periplasmic Tth with a DoxD com- tein TatA (S37, M32) which were up-regulated in tetrathionate ponent (Hallberg et al., 1996b; Bugaytsova and Lindström, 2004; grown cells. While in S0 grown cells protein export chaperone Rzhepishevska et al., 2007). Previously, the genes encoding Tth and (S25) and Type I secretion outer membrane protein, TolC pre- DoxD were shown to be up-regulated during growth on tetrathion- cursor (M497) were up-regulated. A two component protein was ate as compared to growth on S0. However, this study showed the found up-regulated on tetrathionate (M291) and as a unique same expression levels of tth and doxD in the semi quantitative spot in S0 gels (M607). The two spots were in close proximity on RT-PCR. Additionally, neither protein was detected in the proteom- the gels; however the unique spot traveled with slightly larger ics investigation suggesting that protein levels were also similar. A molecular weight and more basic isoelectric point suggesting post possible explanation for the discrepancy between this and the previ- translational modification. This protein is encoded together with ous report (Rzhepishevska et al., 2007) is that gene transcription of the signal transduction histidine kinase up-stream of sox cluster tth and doxD might be different in the sub-populations of S0 grown II indicating that this two component system might be involved sessile and planktonic cells (potentially explaining the previously in its regulation. reported large standard deviations Rzhepishevska et al., 2007). The

www.frontiersin.org February 2011 | Volume 2 | Article 17 | 9 Mangold et al. Sulfur metabolism in Acidithiobacillus caldus

Figure 5 | Two dimension gel of the A. caldus soluble proteome of sessile (I); single-stranded DNA-binding protein (70) 3.1-fold up-regulated in sessile cells cells grown on S0 (A; identified proteins marked with circles and match IDs). and sulfur oxidation protein SoxY (841) unique in gels from planktonic cells (II); Inset frames show sessile (B) and planktonic (C) conditions: twin-arginine translocation protein TatA (64) was up-regulated 7.9-fold in S-adenosylmethionine synthetase (spot 420) and YVTN family beta-propeller planktonic cells (III); and hypothetical protein ACA_0867 (spots 827 and 826) repeat protein (404) that were 2.4 and spot 7.7-fold up-regulated in sessile cells uniquely found in planktonic cells (IV). role of the DoxD component is unknown as it lacks the DoxA of et al., 2009). The substrate for Sor is believed to be sulfur in a the thiosulfate quinine-oxidoreductase and Tth is thought to be a linear form, probably as a polysulfide. Furthermore, two hypo- hydrolase (Bugaytsova and Lindström, 2004; Rzhepishevska et al., thetical DsrE/F-like proteins were detected in the proteomics, one 2007). Therefore, the main product of Tth in the proposed model, up-regulated on tetrathionate and the other on S0 which might thiosulfate, was suggested to be oxidized by the A. caldus SoxABXYZ be involved in the transfer of sulfane sulfur in the course of S0 system. The experimental data supports this view with up-regulated oxidation (Dahl et al., 2005). One candidate for S0 oxidation is transcripts of both sox clusters as well as up-regulation of several Sor that catalyzes the disproportionation of S0 to sulfite, thio- gene products during growth on tetrathionate. As homologs of nei- sulfate, and sulfide (potentially explaining the up-regulation of ther Sox(CD)2 nor DsrAB were detected in the genome sequence of Sqr in cells grown on less reduced forms of sulfur). In this study, A. caldus to date it is proposed that the products of its core TOMES RT-PCR data demonstrated similar levels of sor transcripts for are sulfate and S0. This aspect is further strengthened by the obser- growth on tetrathionate and S0 suggesting it may be involved in vation that thiosulfate oxidation has a S0 intermediate (Hallberg ISC oxidation. A second candidate for S0 oxidation is the trimeric et al., 1996b) and that S0 globules have been detected in A. caldus complex HdrABC suggested to be involved in A. ferrooxidans S0 when under sub-optimal conditions (Hallberg et al., 1996a). Also, metabolism by utilizing the proton gradient to oxidize disulfide sulfur globules are an obligate intermediate in A. vinosum thiosul- intermediates originating from S0 oxidation to sulfite (Quatrini fate oxidation (Pott and Dahl, 1998; Dahl et al., 2005). et al., 2009). To date, this reverse reaction of HdrABC is purely The metabolism of S0 is complicated by its hydrophobic nature speculative and awaits biochemical evidence. Yet, the similarities which makes an activation of S0 prior to its oxidation necessary. of HdrABC within acidophilic sulfur oxidizers are striking and Potentially the DsbC (up-regulated in S0 grown cells) was involved might point to this new function of the enzyme. Additionally, in transferring the S0 equivalent from the membrane to the S0 A. ferrooxidans Hdr has been shown to be up-regulated during oxidizing enzyme as suggested for green sulfur bacteria (Sakurai growth on S0 (Quatrini et al., 2009 and unpublished data). In et al., 2010). Additionally, it has also been suggested that sulfane this study HdrA was up-regulated in S0 grown A. caldus, whereas sulfur is the actual substrate of the sulfur oxidizing enzyme (SDO HdrC was up-regulated in tetrathionate grown cells. However, or Hdr) in A. ferrooxidans (Rohwerder and Sand, 2003; Quatrini all subunits HdrABC were up-regulated in sessile compared to

Frontiers in Microbiology | Microbial Physiology and Metabolism February 2011 | Volume 2 | Article 17 | 10 Mangold et al. Sulfur metabolism in Acidithiobacillus caldus

­planktonic cells. In our model both Sor and Hdr can oxidize S0 and metabolism) but generally more stressed than planktonic cells are hypothesized to comprise multiple pathways. The potential use (up-regulation of chaperones). All three Hdr subunits were up- of Hdr and/or Sor in A. caldus S0 oxidation remains to be resolved. regulated in the sessile cells suggesting they oxidize S0. In contrast, Sor or Hdr might be employed in variable growth conditions or the planktonic sub-population may oxidize soluble ISCs (e.g., for different (internal or external) sources of S0. For instance, the tetrathionate) potentially released from sessile cells. The growth Sor enzyme identified in A. caldus-like strains has an increased medium of A. caldus grown on S0 was tested for tetrathionate and activity at 65°C (Janosch et al., 2009) suggesting it may be used thiosulfate. Neither compound could be detected during growth at higher growth temperatures. The observation that DsbE-like for 10 days (data not shown) potentially because the soluble ISCs proteins and different subunits of Hdr were up-­regulated in both were oxidized by planktonic cells before they accumulated to a conditions might point to the fact that tetrathionate oxidation detectable concentration. In addition, proteins were detected, has a S0 intermediate (Hallberg et al., 1996b). Following the such as a twitching motility protein involved in sessile cell motil- reaction of either Sor or Hdr, the produced sulfite is oxidized ity (Merz et al., 2000) and a YVTN family beta-propeller repeat to sulfate. Although no candidate for a sulfite oxidizing enzyme protein possibly involved in cell-to-cell interactions (Mayerhofer was detected in the proteomics a activity has been et al., 1998) that might also be involved in attachment to the solid reported for A. caldus (Hallberg et al., 1996b) and a candidate for substrate. Although no flagellar proteins were found up-regulated a sulfite oxidizing enzyme without heme domain was detected in in the proteomic comparison of sessile versus planktonic cells the genome sequence. No biochemical evidence (Dopson et al., the up-regulation of flagellar basal-body rod protein FlgC in the 2002) or putative gene candidates were found for involvement of comparison between tetrathionate and S0 grown cells indicated the adenosine monophosphate system. the importance of cell motility to be able to attach to the solid Clear trends in the protein expression of cells grown on substrate. tetrathionate versus S0 were observed. In S0 grown cells this included Typically, planktonic and sessile sub-populations are stable up-regulation of chaperones and a protease and down-regulation (Vilain et al., 2004b) and their proteomes include many differ- of proteins involved in central carbon metabolism, amino acid entially expressed proteins (Vilain et al., 2004a). The proteomes biosynthesis, fatty acid biosynthesis, cell division proteins, and DNA and transcriptomes of biofilms have been widely studied in several repair. The latter changes can be attributed to the cell’s effort to neutrophilic organisms (Sauer and Camper, 2001; Oosthuizen et conserve energy which is a feature of the general stress response. al., 2002; Sauer et al., 2002; Planchon et al., 2009). A transcriptomic study of biofilm and planktonic Leptospirillum spp. suggests aci- Sessile versus planktonic A. caldus dophile biofilms are, similarly to neutrophilic biofilms, dynamic It is believed that the stress response observed in S0 grown sessile structures with distinct metabolic differences between planktonic cells (compared to planktonic) was due to a biological phenomenon and biofilm cells (Moreno-Paz et al., 2010). The reported differ- and not due to sample treatment. Several points argue in favor of ences in the proteomes between sessile and planktonic A. caldus this view: (i) the stress response was also apparent in S0 grown cells sub-populations comprised a comparatively small number of dif- when compared to tetrathionate grown cells although the treatment ferentially expressed proteins. In this case study, it may be possible for both conditions was identical; and (ii) sessile cells were frozen that planktonic and sessile sub-populations interchanged (possibly prior to detachment which probably killed most cells conserving due to vigorous stirring and shear forces exerted by the solid S0 their proteome and making changes in the proteome of sessile cells particles) that resulted in relatively similar proteomes. during detachment treatment unlikely. The A. caldus planktonic proteome contained up-regulated Acknowledgments proteins similar to the expression pattern of tetrathionate grown Mark Dopson wishes to thank the Swedish Research Council cells; whereas, the sessile proteome contained up-regulated pro- for financial support (Vetenskapsrådet contract number 621- teins that were described to be signature proteins of tetrathionate 2007-3537). David S. Holmes acknowledges Fondecyt 1050063, and S0 grown cells. Possibly cells attached to S0 are less starved than DI-UNAB 34-06, DI-UNAB 15-06/I, and a Microsoft Sponsored planktonic cells (up-regulation of proteins from central carbon Research Award.

References Bertsova, Y. V., Bogachev, A. V., and Acidithiobacillus thiooxidans and families: more emphasis on 3D. Nucleic Altschul, S. F., Madden, T. L., Schaffer, A. Skulachev, V. P. (2001). Noncoupled Acidithiobacillus ferrooxidans. Adv. Acids Res. 33, D212–D215. A., Zhang, J., Zhang, Z., Miller, W., and NADH:ubiquinone oxidoreductase of Mat. Res. 71–73, 151–154. Bryson, K., McGuffin, L. J., Marsden, Lipman, D. J. (1997). Gapped BLAST Azotobacter vinelandii is required for Brasseur, G., Levican, G., Bonnefoy, V., R. L., Ward, J. J., Sodhi, J. S., and and PSI-BLAST: a new generation of diazotrophic growth at high ­oxygen Holmes, D., Jedlicki, E., and Lemesle- Jones, D. T. (2005). Protein struc- protein database search programs. concentrations. J. Bacteriol. 183, Meunier, D. (2004). Apparent redun- ture prediction servers at University Nucleic Acids Res. 25, 3389–3402. 6869–6874. dancy of electron transfer pathways via College London. Nucleic Acids Res.

Anderson, N. L. (1991). Two Dimensional Blum, H., Beier, H., and Gross, H. J. bc1 complexes and terminal oxidases 33, W36–W38. Gel Electrophoresis: Operation of the (1987). Improved silver staining of in the extremophilic chemolithoau- Bugaytsova, Z., and Lindström, E. B. ISO-DALT System. Rockville, MD: -proteins, RNA and DNA in totrophic Acidithiobacillus ferrooxi- (2004). Localization, purification and Large Scale Biology Press. polyacrylamide gels. Electrophoresis dans. Biochim. Biophys. Acta 1656, properties of a tetrathionate hydrolase Bathe, S., and Norris, P. R. (2007). Ferrous 8, 93–99. 114–126. from Acidithiobacillus caldus. Eur. J. iron- and sulfur-induced genes in Bodadilla Fazzini, R. A., and Parada, P. Bru, C., Courcelle, E., Carrère, S., Beausse, Biochem. 271, 272–280. Sulfolobus metallicus. Appl. Environ. (2009). Analysis of sulfur metase- Y., Dalmar, S., and Kahn, D. (2005). The Cardenas, J. P., Valdes, J., Quatrini, Microbiol. 73, 2491–2497. cretome in mixed cultures of ProDom database of protein domain R., Duarte, F., and Holmes, D. S.

www.frontiersin.org February 2011 | Volume 2 | Article 17 | 11 Mangold et al. Sulfur metabolism in Acidithiobacillus caldus

(2010). Lessons from the genomes Friedrich, C. G., Rother, D., Bardischewsky, ­thiouridine biosynthesis at tRNA wob- ­operation. Appl. Environ. Microbiol. of extremely acidophilic bacteria and F., Quentmeier, A., and Fischer, J. ble positions. Mol. Cell 21, 97–108. 69, 1936–1943. archaea with special emphasis on (2001). Oxidation of reduced inor- Janosch, C., Thyssen, C., Vera, M., Oosthuizen, M. C., Steyn, B., Theron, J., bioleaching microorganisms. Appl. ganic sulfur compounds by bacteria: Bonnefoy, V., Rohwerder, T., and Sand, Cosette, P., Lindsay, D., von Holy, A., Microbiol. Biotechnol. 88, 605–620. emergence of a common mecha- W. (2009). Sulfur oxygenase reductase and Brozel, V. S. (2002). Proteomic Chen, Z. W., Jiang, C. Y., She, Q., Liu, nism? Appl. Environ. Microbiol. 67, in different Acidithiobacillus caldus- analysis reveals differential protein S. J., and Zhou, P. J. (2005). Key role 2873–2882. like strains. Adv. Mat. Res. 71–73, expression by cereus during of cysteine residues in catalysis and Frigaard, N. U., and Bryant, D. A. (2008a). 239–242. biofilm formation. Appl. Environ. subcellular localization of sulfur oxy- “Genomic and evolutionary perspec- Jing, H., Takagi, J., Liu, J. H., Lindgren, S., Microbiol. 68, 2770–2780. genase-reductase of Acidianus teng- tives on sulfur metabolism in green Zhang, R. G., Joachimiak, A., Wang, Pandey, A., Andersen, J. S., and Mann, M. chongensis. Appl. Environ. Microbiol. sulfur bacteria,” in Microbial Sulfur J. H., and Springer, T. A. (2002). (2000). Use of mass spectrometry to 71, 621–628. Metabolism, eds C. Dahl and C. G. Archaeal surface layer proteins contain study signaling pathways. Sci. STKE Cort, J. R., Selan, U., Schulte, A., Grimm, Friedrich (Berlin: Springer), 60–76. beta propeller, PKD, and beta helix 37, pl1. F., Kennedy, M. A., and Dahl, C. Frigaard, N. U., and Bryant, D. A. (2008b). domains and are related to metazoan Phadke, N. D., Molloy, M. P., Steinhoff, (2008). Allochromatium vinosum “Genomic insights into the sulfur cell surface proteins. Structure 10, S. A., Ulintz, P. J., Andrews, P. C., DsrC: solution-state NMR structure, metabolism of phototrophic green 1453–1464. and Maddock, J. R. (2001). Analysis properties, and interaction with sulfur bacteria,” in Sulfur Metabolism Johnson, D. B., and Hallberg, K. B. (2009). of the outer membrane proteome DsrEFH, a protein essential for pur- in Phototrophic Organisms, eds R. Hell, Carbon, iron and sulfur metabolism of Caulobacter crescentus by two- ple sulfur bacterial sulfur oxidation. C. Dahl, D. B. Knaff, and T. Leustek in acidophilic micro-organisms. Adv. dimensional electrophoresis and J. Mol. Biol. 382, 692–707. (Berlin: Springer), 337–355. Microb. Physiol. 54, 201–255. mass spectrometry. Proteomics 1, D’Errico, G., Di Salle, A., La Cara, F., Gehrke, T., Telegdi, J., Thierry, D., and Larkin, M. A., Blackshields, G., Brown, 705–720. Rossi, M., and Cannio, R. (2006). Sand, W. (1998). Importance of N. P., Chenna, R., McGettigan, P. A., Planchon, S., Desvaux, M., Chafsey, I., Identification and characterization extracellular polymeric substances McWilliam, H., Valentin, F., Wallace, Chambon, C., Leroy, S., Hebraud, M., of a novel bacterial sulfite oxidase from ferrooxidans for I. M., Wilm, A., Lopez, R., Thompson, and Talon, R. (2009). Comparative sub- with no heme binding domain from bioleaching. Appl. Environ. Microbiol. J. D., Gibson, T. J., and Higgins, D. G. proteome analysis of planktonic and radiodurans. J. Bacteriol. 64, 2743–2747. (2007). Clustal W and Clustal X version sessile Staphylococcus xylosus C2a: new 188, 694–701. Ghosh, W., and Dam, B. (2009). 2.0. Bioinformatics 23, 2947–2948. insight in cell physiology of a coagula- Dahl, C., Engels, S., Pott-Sperling, A. Biochemistry and molecular biology Mayerhofer, L. E., Conway de Macario, se-negative Staphylococcus in biofilm. S., Schulte, A., Sander, J., Lubbe, Y., of lithotrophic sulfur oxidation by E., Yao, R., and Macario, A. J. (1998). J. Proteome Res. 8, 1797–1809. Deuster, O., and Brune, D. C. (2005). taxonomically and ecologically diverse Structure, organization, and expres- Pott, A. S., and Dahl, C. (1998). Sirohaem Novel genes of the Dsr gene cluster bacteria and archaea. FEMS Microbiol. sion of genes coding for enve- sulfite reductase and other proteins and evidence for close interaction of Ecol. 33, 999–1043. lope components in the archaeon encoded by genes at the Dsr locus of Dsr proteins during sulfur oxidation Hallberg, K. B., Dopson, M., and Methanosarcina mazei S-6. Arch. Chromatium vinosum are involved in in the phototrophic sulfur bacterium Lindstrom, E. B. (1996a). Arsenic tox- Microbiol. 169, 339–345. the oxidation of intracellular sulfur. Allochromatium vinosum. J. Bacteriol. icity is not due to a direct effect on the Merz, A. J., So, M., and Sheetz, M. P. Microbiology 144, 1881–1894. 187, 1392–1404. oxidation of reduced inorganic sulfur (2000). Pilus retraction powers bac- Quatrini, R., Appia-Ayme, C., Denis, Y., de Jong, G. A. H., Hazeu, W., Bos, P., and compounds by Thiobacillus caldus. terial twitching motility. Nature 407, Jedlicki, E., Holmes, D., and Bonnefoy, Kuenen, J. G. (1997). Polythionate deg- FEMS Microbiol. Lett. 145, 409–414. 98–102. V. (2009). Extending the models for radation by tetrathionate hydrolase of Hallberg, K. B., Dopson, M., and Molloy, M. D. (2008). Isolation of bacterial iron and sulfur oxidation in the Thiobacillus ferrooxidans. Microbiology Lindstrom, E. B. (1996b). Reduced cell membrane proteins using carbon- extreme acidophile Acidithiobacillus 143, 499–504. sulfur compound oxidation by ate extraction. Methods Mol. Biol. 424, ferrooxidans. BMC Genomics 10, 394. Dopson, M., and Lindström, E. B. (1999). Thiobacillus caldus. J. Bacteriol. 178, 397–401. doi: 10.1186/1471-2164-10-394 Potential role of Thiobacillus caldus 6–11. Molloy, M. P., Herbert, B. R., Slade, M. Quatrini, R., Appia-Ayme, C., Denis, Y., in arsenopyrite bioleaching. Appl. Hedderich, R., Hamann, N., and Bennati, B., Rabilloud, T., Nouwens, A. S., Ratouchniak, J., Veloso, F., Valdes, Environ. Microbiol. 65, 36–40. M. (2005). Heterodisulfide reductase Williams, K. L., and Gooley, A. A. J., Lefimil, C., Silver, S., Roberto, F., Dopson, M., and Lindström, E. B. (2004). from methanogenic archaea: a new (2000). Proteomic analysis of the Orellana, O., Denizot, F., Jedlicki, E., Analysis of community composition catalytic role for an iron sulfur cluster. Escherichia coli outer membrane. Eur. Holmes, D., and Bonnefoy, V. (2006). during moderately thermophilic Biol. Chem. 386, 961–970. J. Biochem. 267, 2871–2881. Insights into the iron and sulfur ener- bioleaching of pyrite, arsenical pyrite Hensen, D., Sperling, D., Truper, H. G., Molloy, M. P., Phadke, N. D., Maddock, getic metabolism of Acidithiobacillus and chalcopyrite. Microb. Ecol. 48, Brune, D. C., and Dahl, C. (2006). J. R., and Andrews, P. C. (2001). ferrooxidans by microarray transcrip- 19–28. Thiosulphate oxidation in the Two-dimensional electrophoresis tome profiling. Hydrometallurgy 83, Dopson, M., Lindstrom, E. B., and phototrophic sulphur bacterium and peptide mass fingerprinting of 263–272. Hallberg, K. B. (2002). ATP generation Allochromatium vinosum. Mol. bacterial outer membrane proteins. Ramirez, P., Guiliani, N., Valenzuela, during reduced inorganic sulfur com- Microbiol. 62, 794–810. Electrophoresis 22, 1686–1696. L., Beard, S., and Jerez, C. A. (2004). pound oxidation by Acidithiobacillus Hiniker, A., Collet, J. F., and Bardwell, J. Moreno-Paz, M., Gomez, M. J., Arcas, A., Differential protein expression dur- caldus is exclusively due to elec- C. (2005). Copper stress causes an and Parro, V. (2010). Environmental ing growth of Acidithiobacillus fer- tron transport phosphorylation. in vivo requirement for the Escherichia transcriptome analysis reveals physi- rooxidans on ferrous iron, sulfur 6, 123–129. coli disulfide isomerase DsbC. J. Biol. ological differences between biofilm compounds, or metal . Appl. Finn, R. D., Tate, J., Mistry, J., Coggill, P. C., Chem. 280, 33785–33791. and planktonic modes of life of the Environ. Microbiol. 70, 4491–4498. Sammut, S. J., Hotz, H.-R., Ceric, G., Hulo, N., Bairoch, A., Bulliard, V., iron oxidizing bacteria Leptospirillum Rawlings, D. E., and Johnson, D. B. (2007). Forslund, K., Eddy, S. R., Sonnhammer, Cerutti, L., De Castro, E., Langendijk- spp. in their natural microbial com- The Microbiology of biomining: E. L. L., and Bateman, A. (2008). The Genevaux, P. S., Pagni, M., and Sigrist, munity. BMC Genomics 11, 404. doi: development and optimization of Pfam protein families database. Nucleic C. J. (2006). The PROSITE database. 10.1186/1471-2164-11-404 mineral-oxidizing microbial consor- Acids Res. 36, D281–D288. Nucleic Acids Res. 34, D227–D230. Okibe, N., Gericke, M., Hallberg, K. B., and tia. Microbiology 153, 315–324. Friedrich, C. G., Bardischewsky, F., Rother, Ikeuchi, Y., Shigi, N., Kato, J., Nishimura, Johnson, D. B. (2003). Enumeration Rohwerder, T., and Sand, W. (2003). The D., Quentmeier, A., and Fischer, J. A., and Suzuki, T. (2006). Mechanistic and characterization of acidophilic sulfane sulfur of persulfides is the (2005). Prokaryotic sulfur oxidation. insights into sulfur relay by mul- microorganisms isolated from a actual substrate of the sulfur-oxidizing Curr. Opin. Microbiol. 8, 253–259. tiple sulfur mediators involved in pilot plant stirred-tank bioleaching enzymes from Acidithiobacillus and

Frontiers in Microbiology | Microbial Physiology and Metabolism February 2011 | Volume 2 | Article 17 | 12 Mangold et al. Sulfur metabolism in Acidithiobacillus caldus

Acidiphilium spp. Microbiology 149, polyacrylamide gels. Anal. Chem. 68, T., and Kamimura, K. (2007). Vilain, S., Cosette, P., Zimmerlin, I., 1699–1709. 850–858. Purification and characterization Dupont, J. P., Junter, G. A., and Rohwerder, T., and Sand, W. (2007). Suzuki, I. (1999). Oxidation of inorganic of sulfide:quinone oxidoreductase Jouenne, T. (2004b). Biofilm­proteome: Oxidation of inorganic sulfur com- sulfur compounds: chemical and from an acidophilic iron-oxidizing ­homogeneity or versatility? J. Proteome pounds in acidophilic . enzymatic reactions. Can. J. Microbiol. bacterium, Acidithiobacillus ferrooxi- Res. 3, 132–136. Engineering in Life Sciences 7, 301- 45, 97–105. dans. Biosci. Biotechnol. Biochem. 71, Williams, M. D., Ouyang, T. X., and Flickinger, 309. Takle, G. W., Toth, I. K., and Brurberg, M. 2735–2742. M. C. (1994). Starvation-induced expres- Rzhepishevska, O. I., Valdés, J., B. (2007). Evaluation of reference genes Valdes, J., Pedroso, I., Quatrini, R., sion of SspA and SspB: the effects of a Marcinkeviciene, L., Algora Gallardo, for real-time RT-PCR expression stud- Dodson, R. J., Tettelin, H., Blake, R., null mutation in sspA on Escherichia C., Meskys, R., Bonnefoy, V., Holmes, D. ies in the plant pathogen Pectobacterium Eisen, J. A., and Holmes, D. S. (2008). coli protein synthesis and survival dur- S., and Dopson, M. (2007). Regulation atrosepticum. BMC Plant Biol. 7, 50. doi: Acidithiobacillus ferrooxidans metabo- ing growth and prolonged starvation. of a novel Acidithiobacillus caldus gene 10.1186/1471-2229-7-50 lism: from genome sequence to indus- Mol. Microbiol. 11, 1029–1043. cluster involved in reduced inorganic Tatusov, R. L., Fedorova, N. D., Jackson, J. trial applications. BMC Genomics 9, sulfur compound metabolism. Appl. D., Jacobs, A. R., Kiryutin, B., Koonin, 597. doi: 10.1186/1471-2164-9-597 Conflict of Interest Statement: The Environ. Microbiol. 73, 7367–7372. E. V., Krylov, D. M., Mazumder, R., Valdes, J., Quatrini, R., Hallberg, K., authors declare that the research was con- Sakurai, H., Ogawa, T., Shiga, M., and Mekhedov, S. L., Nikolskaya, A. N., Dopson, M., Valenzuela, P. D., and ducted in the absence of any commercial or Inoue, K. (2010). Inorganic sulfur oxi- Rao, B. S., Smirnov, S., Sverdlov, A. Holmes, D. S. (2009). Draft genome financial relationships that could be con- dizing system in green sulfur bacteria. V., Vasudevan, S., Wolf, Y. I., Yin, J. J., sequence of the extremely acidophilic strued as a potential conflict of interest. Photosyn. Res. 104, 163–176. and Natale, D. A. (2003). The COG bacterium Acidithiobacillus caldus Sauer, K., and Camper, A. K. (2001). database: an updated version includes ATCC 51756 reveals metabolic versa- Received: 02 November 2010; accepted: Characterization of phenotypic . BMC Bioinformatics 4, 41. tility in the genus Acidithiobacillus. J. 25 January 2011; published online: 10 changes in Pseudomonas putida in doi: 10.1186/1471-2105-4-41 Bacteriol. 191, 5877–5878. February 2011. response to surface-associated growth. Urich, T., Bandeiras, T. M., Leal, S. S., Valenzuela, L., Chi, A., Beard, S., Citation: Mangold S, Valdés J, Holmes DS J. Bacteriol. 183, 6579–6589. Rachel, R., Albrecht, T., Zimmermann, Shabanowitz, J., Hunt, D. F., and Jerez, and Dopson M (2011) Sulfur metabolism Sauer, K., Camper, A. K., Ehrlich, G. P., Scholz, C., Teixeira, M., Gomes, C. A. (2008). “Differential-expression in the extreme acidophile Acidithiobacillus D., Costerton, J. W., and Davies, D. C. M., and Kletzin, A. (2004). The proteomics for the study of sulfur caldus. Front. Microbio. 2:17. doi: 10.3389/ G. (2002). Pseudomonas aeruginosa sulphur oxygenase reductase from metabolism in the chemolithoau- fmicb.2011.00017 displays multiple phenotypes during Acidianus ambivalens is a multimeric totrophic Acidithiobacillus ferrooxi- This article was submitted to Frontiers in development as a biofilm.J. Bacteriol. protein containing a low-potential dans,” in Microbial Sulfur Metabolism , Microbial Physiology and Metabolism, a 184, 1140–1154. mononuclear non-haem iron centre. eds C. Dahl and C. G. Friedrich (Berlin: specialty of Frontiers in Microbiology. Schippers, A., and Sand, W. (1999). Bacterial Biochem. J. 381, 137–146. Springer), 77–86. Copyright © 2011 Mangold, Valdés, Holmes leaching of metal sulfides proceeds by Urich, T., Gomes, C. M., Kletzin, A., and Vilain, S., Cosette, P., Hubert, M., Lange, and Dopson. This is an open-access article two indirect mechanisms via thiosul- Frazao, C. (2006). X-ray Structure C., Junter, G. A., and Jouenne, T. subject to an exclusive license agreement fate or via polysulfides and sulfur.Appl. of a self-compartmentalizing sulfur (2004a). Comparative proteomic between the authors and Frontiers Media Environ. Microbiol. 65, 319–321. cycle metalloenzyme. Science 311, analysis of planktonic and immobi- SA, which permits unrestricted use, distri- Shevchenko, A., Wilm, M., Vorm, O., and 996–1000. lized Pseudomonas aeruginosa cells: a bution, and reproduction in any medium, Mann, M. (1996). Mass spectrometric Wakai, S., Tsujita, M., Kikumoto, multivariate statistical approach. Anal. provided the original authors and source sequencing of proteins silver-stained M., Manchur, M. A., Kanao, Biochem. 329, 120–130. are credited.

www.frontiersin.org February 2011 | Volume 2 | Article 17 | 13 Mangold et al. Sulfur metabolism in Acidithiobacillus caldus

k 5 02 4 7 7 4 4

5 02 4 03 4 03 03 02 03 02 02 02 03 03 03 03 03 02 02 02 03 02 03 02 − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − −

3.4e 4.2e 2.0e 2.1e 1.3e 4.5e 2.4e 2.6e 5.0e 3.9e 1.3e 2.3e 1.6e 3.2e 1.8e 2.7e 2.4e 1.8e 9.4e 2.4e 4.7e 2.9e 1.1e 2.9e 1.2e 1.2e 2.1e 1.6e 8.3e 3.5e 1.5e ANOVA

j Fold unique unique unique unique unique unique unique unique unique unique unique unique unique unique unique unique unique unique unique 4.9 6.9 6.1 3.5 2.8 2.2 2.3 2.1 10.5 3.8 4.2 4.0 difference

i 14 08 05 07 06 08 09 05 03 07 03 04 04 04 03 03 05 06 05 12 02 10 05 04 04 02 04 08 03 03 04 03

00

− − − − − − − − − − − − − − − − − − − − − − − − + − − − − − − − − 8.9e 3.6e 2.5e 6.2e 1.2e 8.9e 2.2e 4.5e 3.8e 7.6e 4.2e 2.2e 4.0e 4.1e 3.8e 3.7e 1.2e 2.3e 1.6e 1.4e 3.6e 9.8e 3.7e 6.6e 2.8e 3.8e 7.6e 1.1e 1.7e 2.2e 4.0e 1.4e 2.6e

h e -value 34 34 20 30 18 15 28 15 20 25 20 21 29 31 24 34 27 16 34 34 27 55 58 25 26 17 38 32 54 51 34 60 Coverage (%)

g 165 102 81 111 97 34 85 118 79 66 58 101 58 68 69 69 74 61 52 73 59 70 89 76 150 49 56 114 62 131 78 63 70 score Mowse

f .23 5.70 4.83 6.14 6.43 6.43 6.43 6.02 6.34 7.13 5.08 5.77 6.76 6.57 6.18 6.44 7 8.06 7.42 5.85 9.1 7.15 5.17 8.63 8.57 5.15 8.44 5.44 5.22 5.95 6,05 6.12 7.76 9.32 p I

e 70 69 53 49 49 49 48 46 45 42 36 32 31 29 29 28 27 27 19 17 13 34 16 14 83 28 54 44 36 29 16 13 12 MW (kDa) MW

d 5.74 4.99 6.15 6.43 6.40 6.06 6.16 7.1 5.17 5.83 6.62 6.45 6.2 6.2 8.77 8.77 8.54 9.48 9.15 9.07 5.19 8.96 8.64 5.12 8.77 5.57 5.37 5.83 6.15 6.40 9.07 9.30 p I

c Theoretical e xperimental

64 66 49 48 45 50 46 44 43 31 32 30 27 27 32 32 28 40 17 18 30 19 12 64 32 47 43 31 26 8 18 12 MW (kDa) MW Acidithiobacillus caldus . Acidithiobacillus i on ) e ( so lu b le fract i onat t e trath -phosphate synthase -phosphate e d on - r egul at )/Methenyltetrahydrofolate cyclohydrolase )/Methenyltetrahydrofolate -succinyltransferase Prolyl-tRNA synthetase Prolyl-tRNA Chaperone protein HscA protein Chaperone dehydrogenase Dihydrolipoamide dehydrogenase lactate protein, Fe–S protein SO1521-like hydroxymethyltransferase Serine Putative sensory histidine kinase YfhA kinase sensoryhistidine Putative Tyrosyl-tRNA synthetase Tyrosyl-tRNA aminotransferase Aspartate Radical SAM domain protein domain SAM Radical (NADP + ACA_1144 protein Hypothetical N dehydrogenase Methylenetetrahydrofolate 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate CoB–CoM heterodisulfide reductase subunit C subunit reductase heterodisulfide CoB–CoM CoB–CoM heterodisulfide reductase subunit C subunit reductase heterodisulfide CoB–CoM SoxA protein oxidation Sulfur SoxA protein oxidation Sulfur Peptidyl-prolyl cis-trans isomerase ppiD isomerase cis-trans Peptidyl-prolyl Transposase, IS4 Transposase, ACA_2320 protein Hypothetical ACA_0867 protein Hypothetical Chemotaxis protein CheV protein Chemotaxis Protein of unknown function DUF302 function unknown of Protein ACA_1957 protein Hypothetical Translation elongation factor G factor elongation Translation SoxA protein oxidation Sulfur sqr-1 reductase, Sulfide-quinone Tu factor elongation Translation ACA_1144 protein Hypothetical Pyridoxine 5 ′ Pyridoxine TatA protein translocation Twin-arginine ACA_0867 protein Hypothetical SoxZ protein oxidation Sulfur Protein identification Protein

b CA_1144 ACA_1107 ACA_1178 ACA_2840 Mixture ACA_0441 ACA_0113 ACA_1668 ACA_1795 ACA_0032 ACA_2428 ACA_1144 ACA_2027 ACA_0761 ACA_2420 ACA_2420 ACA_2392 ACA_2392 ACA_1235 ACA_0688 ACA_2320 ACA_0867 ACA_0832 ACA_2393 ACA_1957 ACA_0248 ACA_2392 ACA_0303 ACA_0247 A ACA_2632 ACA_1726 ACA_0867 ACA_2391 Accession

a I D illu s ca l d u p c i d it h iob ac A S625 S624 S594 S579 S577 S572 S571 S563 S556 S551 S549 S544 S543 S539 S538 S537 S528 S524 S518 S151 S34 S22 S388 S356 S260 S217 S162 S127 S37 S17 S10 A ppend i x grown sulfur and tetrathionate of gels 2D from identified Proteins | A1 Table Match Match

Frontiers in Microbiology | Microbial Physiology and Metabolism February 2011 | Volume 2 | Article 17 | 14 Mangold et al. Sulfur metabolism in Acidithiobacillus caldus

4 4 03 03 03 03 03 03 03 03 5

03 02 02 02 02 02 02 4 02 02 02 4 03 02 4 02 02 03 02 02 4 − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − 1.1e 2.3e 1.2e 9.9e 1.9e 3.1e

2.7e 5.8e 3.2e 1.4e 3.0e 1.2e 5.5e 5.7e 8.1e 5.5e 1.5e 6.5e 4.1e 1.8e 5.4e 1.0e 5.0e 1.9e 4.1e 2.9e 3.4e 9.9e 2.4e 2.5e 1.5e 3.6e (Continued) 10.3 3.8 7.4 2.3 unique unique unique unique unique unique unique unique unique unique unique 2.0 2.0 3.1 2.5 2.3 4.5 2.3 3.4 2.3 3.6 2.9 3.5 8.6 3.2 2.3 unique unique

04 03 04 04 06 03 02 04 05 02 03 05 02 03 06 11 03 06 03 03 08 02 04 04 03 05 11 07 09 02 03 02 10 08

− − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − −

4.6e 1.0e 8.5e 3.6e 1.4e 4.6e 8.1e 6.5e 3.2e 4.2e 7.1e 9.3e 3.0e 1.5e 5.5e 8.5e 1.1e 1.4e 2.5e 4.3e 3.3e 7.1e 1.4e 2.2e 5.5e 1.0e 1.8e 2.2e 1.7e 3.0e 3.1e 2.8e 3.7e 5.9e 58 55 44 34 26 22 26 15 21 24 48 24 15 23 30 47 83 26 33 63 40 56 36 15 30 47 43 31 31 45 90 9 22 68 74 55 69 63 68 85 56 49 68 126 75 50 83 57 75 144 103 51 58 123 89 106 141 57 54 62 91 52 60 60 110 49 67 6.17 6.08 9.00 8.69 5.50 5.33 5.32 5.44 5.56 5.17 6.15 5.13 5.2 4.97 5.55 5.25 4.57 5.52 6.86 6.15 6.86 6.86 5.94 5.63 5.56 5.51 5.51 5.53 4.86 5.35 4.65 4.55 5.11 6.39 20 16 13 12 52 37 36 34 33 33 29 29 28 27 16 30 13 60 38 43 38 38 33 33 29 27 22 18 17 15 15 12 55 32 6.49 6.40 8.64 9.07 6.03 5.41 5.41 5.41 5.41 5.41 6.15 5.41 5.41 5.41 6.41 5.68 4.64 5.6 7.14 7.88

7.9 5.88 5.41 5.41 5.51 5.52 6.41 5.46 5.46 4.68 4.68 5.23 6.18 22 8 12 18 38 58 58 58 58 58 26 58 58 58 20 30 13 57 37 14

38 32 58 58 24 20 20 17 17 16 13 53 31

i on ) e ( m mbran nr i ch d fract i onat t e trath -phosphate synthase -phosphate e d on - r egul at i on ) e d on s ul f u r ( so lu b le fract - r egul at shock protein Hsp20 protein shock Putative lipoprotein Putative TatA protein translocation Twin-arginine ACA_1957 protein Hypothetical ACA_0867 protein Hypothetical Heterodisulfide reductase subunit A subunit reductase Heterodisulfide Heat shock protein 60 family chaperone GroEL chaperone family 60 protein shock Heat Heat shock protein 60 family chaperone GroEL chaperone family 60 protein shock Heat Heat shock protein 60 family chaperone GroEL chaperone family 60 protein shock Heat Heat shock protein 60 family chaperone GroEL chaperone family 60 protein shock Heat Heat shock protein 60 family chaperone GroEL chaperone family 60 protein shock Heat Pyridoxine 5 ′ Pyridoxine Heat shock protein 60 family chaperone GroEL chaperone family 60 protein shock Heat Heat shock protein 60 family chaperone GroEL chaperone family 60 protein shock Heat Heat shock protein 60 family chaperone GroEL chaperone family 60 protein shock Heat Peptidoglycan-associated outer membrane lipoprotein membrane outer Peptidoglycan-associated Thiol:disulfide interchange protein DsbG precursor DsbG protein interchange Thiol:disulfide formyltransferase (L23e) L7/L12 protein ribosomal LSU cyclohydrolase/Phosphoribosylaminoimidazolecarboxamide IMP Glyceraldehyde-3-phosphate dehydrogenase -4-phosphate dehydrogenase/erythrose FlgC protein rod basal-body Flagellar Membrane-fusion protein Membrane-fusion 6-phosphogluconate dehydrogenase, NAD-binding dehydrogenase, 6-phosphogluconate Heat shock protein 60 family chaperone GroEL chaperone family 60 protein shock Heat Heat shock protein 60 family chaperone GroEL chaperone family 60 protein shock Heat Stringent starvation protein A starvationprotein Stringent membrane lipoprotein membrane ACA_1478 protein Hypothetical Peptidoglycan-associated outer Peptidoglycan-associated Heat (SecB, maintains protein to be exported in unfolded state) unfolded in exported be to protein maintains (SecB, Hsp20 protein shock Heat Protein export cytoplasm chaperone protein chaperone cytoplasm export Protein amidotransferase subunit B subunit amidotransferase ACA_1583 protein Hypothetical 8-phosphate synthase 8-phosphate Aspartyl-tRNA(Asn)/Glutamyl-tRNA(Gln) 2-Keto-3-deoxy-d-manno-octulosonate- ACA_1466 ACA_1726 ACA_1957 ACA_0867 ACA_2418 ACA_2307 ACA_2307 ACA_2307 ACA_2307 ACA_2307 ACA_2632 ACA_2307 ACA_2307 ACA_2307 ACA_1343 ACA_2033 ACA_0241 ACA_1087 ACA_2096 ACA_0861 Mixture ACA_2530 ACA_0563 ACA_2307 ACA_2307 ACA_1210 ACA_1478 ACA_1343 ACA_0889 ACA_0889 ACA_1132 ACA_1583 ACA_0705 ACA_0585 illu s ca l d u p c i d it h iob ac illu s ca l d u p c i d it h iob ac A A M49 M32 M19 M13 S462 S436 S435 S429 S428 S425 S418 S416 S413 S409 S398 S358 S338 S285 S205 S175

S154 S146 S114 S102 S64 S53 S46 S26 S25 S9 S702 S694

www.frontiersin.org February 2011 | Volume 2 | Article 17 | 15 Mangold et al. Sulfur metabolism in Acidithiobacillus caldus

k

4 4 6 02 03 4 4 5 03 02 03 02 4 4 4 4 6 03 03 02 02 03 4 03 03 02 02 02 02 02 5 4 − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − 8.8e 2.1e 3.3e 1.5e 1.4e 1.4e 1.2e 4.7e 2.5e 7.9e 1.1e 4.8e 9.7e 6.4e 6.1e 3.2e 9.2e 1.9e 1.5e 1.0e 1.5e 2.7e 3.0e 1.5e 3.1e 3.9e 2.6e 7.7e 6.2e 2.3e 1.8e 3.0e ANOVA

j

Fold unique unique unique unique unique 2.1 3.5 2.4 2.7 10.7 2.5 2.1 9.1 4.1 2.8 3.1 2.5 3.0 2.7 2.3 2.1 2.5 3.0 2.3 4.5 4.1 2.1 2.2 2.9 15.0 2.1 5.9 difference

i 06 03 05 04 04 10 03 04 05 05 12 05 02 03 08 11 14 07 12 07 05 02 09 03 6 08 04 02 13 04 08 02 11 03 04

− − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − 4.7e 9.8e 4.7e 1.8e 2.0e 1.8e 2.9e 4.5e 3.8e 8.3e 2.9e 5.1e 1.5e 2.2e 2.8e 1.1e 1.2e 7.1e 7.4e 7.8e 1.7e 4.2e 6.6e 4.5e 1.8e 2.8e 8.9e 1.8e 2.2e 5.6e 1.8e 3.4e 4.5e 1.1e 3.9e

h e -value 23 34 24 40 58 40 22 27 14 36 25 32 50 19 17 18 18 33 17 21 8 16 20 25 33 36 40 39 30 35 28 48 28 21 18 (%) Coverage

g

88 55 78 122 71 62 70 128 59 65 80 77 93 151 80 114 74 136 56 66 52 48 56 108 162 140 165 72 101 147 112 99 78 54 49 score Mowse

f 8.90 5.72 5.27 5.69 9.39 5.27 5.27 5.74 5.96 5.96 5.79 5.91 7.81 5.81 5.78 5.85 5.37 5.27 5.79 5.76 5.60 6.52 6.22 7.42 5.43 6.08 5.41 5.31 5.31 5.74 4.98 8.17 9.36 5.43 6.10 p I

e 36 36 34 28 13 46 46 76 80 80 57 35 38 92 76 75 74 66 69 64 63 59 53 52 51 50 46 44 44 43 41 37 36 36 33 MW (kDa) MW

d 9.39 5.83 5.19 5.70 8.64 6.21 5.37 5.98 6.02 6.60 5.83 5.83 7.14 5.89 5.98 5.98 5.38 5.26 5.88 6.11 5.69 6.24 6.18 6.53 5.47 6.00 5.41 6.21 5.37 5.69 4.95 7.14 9.39 5.43 8.71 p I

c Theoretical xperimental e 39 31 30 27 12 21 43 69 73 16 53 31 37 88 69 69 73 62 59 50 63 55 49 48 50 44 45 21 43 38 40 37 39 34 39 MW (kDa) MW

division protein FtsH protein division Efflux transporter, RND family, MFP subunit MFP family, RND transporter, Efflux ACA_1144 protein Hypothetical Chemotaxis protein CheV protein Chemotaxis Enoyl-[acyl-carrier-protein] reductase [NADH] reductase Enoyl-[acyl-carrier-protein] ACA_1957 protein Hypothetical Tu factor elongation Translation Tu factor elongation Translation Cell division protein FtsH protein division Cell flagelllar motor components CheY components motor flagelllar ACA_0548 protein Hypothetical Chemotaxis regulator - transmits chemoreceptor signals to signals chemoreceptor transmits - regulator Chemotaxis Cysteinyl-tRNA synthetase Cysteinyl-tRNA ACA_1144 protein Hypothetical dehydrogenase glyceraldehyde-3-phosphate NAD-dependent chain betasynthetase Phenylalanyl-tRNA Cell Cell division protein FtsH protein division Cell GTPase subunit of restriction endonuclease-like protein endonuclease-like restriction of subunit GTPase RecN protein repair DNA Phosphoglucomutase Uptake hydrogenase large subunit large hydrogenase Uptake Acetolactate synthase large subunit large synthase Acetolactate MutS2 family protein family MutS2 carboxylase acetyl-CoA of carboxylase Biotin transcriptional regulator, Fis family Fis regulator, transcriptional sqr-2 reductase, Sulfide–quinone Two component, sigma54 specific, sigma54 component, Two ACA_1270 protein Hypothetical Cell division protein FtsA protein division Cell Tu factor elongation Translation Tu factor elongation Translation Fructose-bisphosphate aldolase class II class aldolase Fructose-bisphosphate Cell division protein FtsZ protein division Cell dehydrogenase glyceraldehyde-3-phosphate NAD-dependent Efflux transporter, RND family, MFP subunit MFP family, RND transporter, Efflux 4-hydroxy-3-methylbut-2-enyl diphosphate reductase diphosphate 4-hydroxy-3-methylbut-2-enyl ACA_2593 protein Hypothetical Protein identification Protein

b ACA_1142 ACA_1144 ACA_0832 ACA_0186 ACA_1957 ACA_1874 ACA_0247 ACA_1482 ACA_0548 ACA_0317 ACA_0293 ACA_1144 ACA_2096 ACA_2689 ACA_1482 ACA_1482 ACA_2179 ACA_1776 ACA_0098 ACA_2234 ACA_2547 ACA_2548 ACA_0933 ACA_2485 ACA_2388 ACA_1270 ACA_1228 ACA_1874 ACA_0247 ACA_2100 ACA_1229 ACA_2096 ACA_1142 ACA_2091 Accession ACA_2593

a I D M740 M738 M735 M726 M706

M521 M513

M512 M508 M482 M476 M431 M388 M386 M383 M362 M368 M357 M353 M344 M309 M300 M291 M277 M262

M254 M248 M227 M193 M180 M179 Match Match Table A1 | Continued | A1 Table M163

Frontiers in Microbiology | Microbial Physiology and Metabolism February 2011 | Volume 2 | Article 17 | 16 Mangold et al. Sulfur metabolism in Acidithiobacillus caldus

4 4 02 4 4 03 4 03 3 02 7 5 5 02 02 02 02 02 4 5 − − − − − − − − − − − − − − − − − − − −

4.7e 4.0e 2.1e 1.4e 1.8e 1.4e 2.8e 1.0e 8.5e 9.4e 1.6e 9.0e 8.4e 6.9e 4.1e 1.6e 8.7e 9.9e 1.8e 7.7e

47 are significant with significant are 47 > unique unique unique unique unique unique unique unique 2.6 2.4 3.3 2.7 3.6 6.1 2.6 2.1 unique unique unique unique 05 03 11 05 06 05 05 09 09 07 17 03 03 03 13 02 10 02 02 04 05 07

− − − − − − − − − − − − − − − − − − − − − − 9.3e 1.4e 1.2e 6.2e 2.2e 5.4e 2.0e 4.3e 4.3e 2.2e 2.2e 1.1e 6.9e 4.5e 3.9e 4.5e 2.8e 2.8e 1.3e 2.9e 1.1e 4.5e 16 16 15 26 42 36 59 46 46 62 27 23 29 25 18 41 23 64 11 13 25 49 75 53 54 57 141 77 91 78 78 121 121 74 96 198 59 58 60 160 83 50 104 128 5.52 5.33 6.9 4.66 8.89 5.05 8.39 5.39 5.39 5.39 5.78 6.02 6.70 5.49 5.01 5.00 5.55 5.97 7.41 6.23 5.74 7.45 53 52 51 28 25 22 16 10 10 10 53 50 39 100 79 47 26 24 66 60 58 45 6.14 5.47 6.98 4.74 8.98 5.10 6.52 5.58 5.58 5.52 5.96 6.34 5.87 5.52 5.06 5.52 5.67 6.08 6.66 6.24 5.84 6.73 51 50 53 32 25 21 12 10 10 10 53 50 42 97 68 10 24 24 64 55 54 42 i on ) e d on s ul f u r ( m mbran nr i ch fract - r egul at yl hydroperoxide reductase subunit C-like protein C-like subunit reductase hydroperoxide yl -Nucleotidase domain protein domain -Nucleotidase multidrug resistance system resistance multidrug regulator, Fis family Fis regulator, tripartite of component membrane Outer Two component, sigma54 specific, transcriptional specific, sigma54 component, Two Protease Do Protease ACA_1527 protein Hypothetical ACA_0993 protein Hypothetical dioxygenase 1,2-dihydroxy-3-keto-5-methylthiopentene ACA_1520 protein Hypothetical Carboxysome shell protein CsoS1 protein shell Carboxysome Carboxysome shell protein CsoS1 protein shell Carboxysome Carboxysome shell protein CsoS1 protein shell Carboxysome chain large carboxylase bisphosphate Ribulose Type I secretion outer membrane protein, TolC precursor TolC protein, membrane outer secretion I Type Phosphate-selective porin O and P and O porin Phosphate-selective ClpB protein ClpB Chaperone protein DnaK protein Chaperone Carboxysome shell protein CsoS1 protein shell Carboxysome Alk HAD-superfamily hydrolase, subfamily IA, variant 3 variant IA, subfamily hydrolase, HAD-superfamily 5 ′ MutS2 family protein family MutS2 Nitrogen regulation protein NR(I) protein regulation Nitrogen Aminomethyltransferase

ACA_2024 ACA_2388 ACA_0109 ACA_1527 ACA_0993 ACA_0172 ACA_1520 ACA_2772 ACA_2771 ACA_2773 ACA_2765 ACA_0129 ACA_2352 ACA_2034 ACA_1454 ACA_2773 ACA_0146 ACA_2067 ACA_2317 ACA_2548 ACA_1984 ACA_2748 illu s ca l d u p c i d it h iob ac Annotation number is that of Genebank genome annotation NZ_ACVD01000000.1. isoelectric point (pI) of database Predicted entry. 2D-PAGE. Experimental determined by molecular weight database the in (scores match random a not is probability hit the the giving that search (PMF) fingerprint mass peptide a of hit the describes and Mascot by generated was score Mowse peptide masses of the experimentally acquired PMF. the submitted by Mascot) presents the percentage (generated by of the databasecovered hit that was Sequence coverage (membrane fraction). Match ID in Figures is given without S or M in front of numbers. ID in Figures is given 4 (membrane fraction). Match 3 (soluble fraction) and Figure to protein spots in Figure Melanie and refers generated by ID was Match of database Molecular weight entry. Predicted considered to be significant. < 0.05 were condition and spots with p-values two or three replicates of each for performed test was Anova A Experimental 2D-PAGE. pI determined by Expect value (generated by Mascot) is the number of hits expected by change in a database of the same size. change by Mascot) is the number of hits expected (generated by Expect value expressed. regarded as differentially ≥ 2.0 were changes determined with Melanie. Fold was change Fold

M675 M607 M605 M565 M553 M550 M539

M530 M503 M497 M493 M441 M397 M263 M85 M71 M793 M781 M776 a significance threshold of 0.05). M755 a b c d e f g h i j k

www.frontiersin.org February 2011 | Volume 2 | Article 17 | 17 Mangold et al. Sulfur metabolism in Acidithiobacillus caldus k 5 03 -03 4 03 02 5 6 4 5 03 02 4 4

6 03 4 03 02 03 02 03 5 03 03 5 03 03 − − − − − − − − − − − − − − − − − − − − − − − − − − − − 3.3e 3.4e Anova 9.0e 3.1e 1.4e 1.1e 7.2e 7.9e 5.2e 2.9e 5.1e 5.3e 1.7e 9.5e 2.5e 3.6e 5.9e 4.4e 1.6e 9.0e 1.7e 8.5e 1.8e 1.7e 1.7e 7.0e 8.1e 5.2e

j 47 are significant with significant are 47 Fold > unique 2.6 difference 7.9 3.1 4.2 2.7 2.4 2.8 unique unique 2.2 2.4 2.0 2.2 3.0 2.4 2.1 7.7 2.3 2.4 2.5 5.2 2.5 2.5 2.3 3.8 2.4 3.0

i 13 04 04 05 03 06 04 07 04 05 04 04 02 05 08 04 08 04 05

08 05 07 03 06 06 05 06 07

− − − − − − − − − − − − − − − − − − − − − − − − − − − −

8.9e

2.1e 3.0e 8.9e 6.6e 6.5e 1.4e 3.2e 2.2e 4.7e 1.2e 1.8e 1.2e 5.5e 1.5e 4.3e 2.3e 3.4e 7.4e 3.3e 3.6e 2.0e 5.6e 7.3e 4.0e 7.8e 1.2e 5.8e

h e -value 36 51 66 31 20 35 50 61 15 53 35 33 18 20 34 28 56 7 33 21 25 22 33 29 18 34 28 18 (%) Coverage

g 76 71 70 75 56 86 68 69 84 64 77 93 68 71 49 79 71 86 68 96 94 77 113 101 102 109 107 155 Mowse score

f 5.65 5.02 5.59 6.33 p I 6.11 7.12 5.56 6.67 7.18 5.36 6.95 5.32 6.87 5.4 5.8 5.57 5.57 5.03 5.35 5.93 5.38 6.37 6.73 5.85 5.43 5.27 5.4 5.26 6.33

e E xperimental 16 82 MW (kDa) MW 16 16 20 27 52 28 14 30 14 32 36 37 39 40 40 41 43 43 45 48 49 49 56 57 63 67 79

d p I 5.06

5.49 6.40 6.15 8.54 5.57 6.20 9.07 5.96 9.07 5.32 6.50 5.14 5.69 6.03 5.86 5.01 5.98 5.69 5.37 5.87 6.4 5.69 5.94 5.32 5.14 5.14 5.95

c Theoretical 8 68 MW (kDa) MW

17 20 28 47 27 18 53 18 30 39 58 35 38 38 33 96 38 42 46 45 51 32 56 58 58 73 Acidithiobacillus caldus . Acidithiobacillus

-adenosylmethionine synthetase -adenosylmethionine SoxY protein oxidation Sulfur Chaperone protein DnaK protein Chaperone Protein identification Protein TatA protein translocation Twin-arginine protein DNA-binding Single-stranded ACA_2219 protein Hypothetical ppiD isomerase cis-trans Peptidyl-prolyl sqr-1 reductase, Sulfide–quinone C subunit reductase heterodisulfide CoB–CoM ACA_0867 protein Hypothetical chain large carboxylase bisphosphate Ribulose Hypothetical protein ACA_0867 ACA_0867 protein Hypothetical mod CbbQ protein activation Rubisco Twitching motility protein motility Twitching Heat shock protein 60 family chaperone GroEL chaperone family 60 protein shock Heat Pyruvate dehydrogenase E1 component beta subunit beta component E1 dehydrogenase Pyruvate Heterodisulfide reductase subunit A subunit reductase Heterodisulfide Heterodisulfide reductase subunit A subunit reductase Heterodisulfide B subunit reductase heterodisulfide CoB–CoM 40-residue YVTN family beta-propeller repeat protein repeat beta-propeller family YVTN 40-residue Fructose-bisphosphate aldolase class II class aldolase Fructose-bisphosphate S Gamma-glutamyl phosphate reductase phosphate Gamma-glutamyl hydroxymethyltransferase Serine 3-isopropylmalate dehydratase large subunit large dehydratase 3-isopropylmalate 2-isopropylmalate synthase 2-isopropylmalate chain alpha synthase ATP Heat shock protein 60 family chaperone GroEL chaperone family 60 protein shock Heat Heat shock protein 60 family chaperone GroEL chaperone family 60 protein shock Heat Transketolase

b CA_2737 ACA_2319 Accession ACA_1454 ACA_1726 ACA_1907 ACA_2219 ACA_1235 ACA_0303 ACA_2420 ACA_0867 ACA_2765 ACA_0867 ACA_2783 A ACA_2307 ACA_0002 ACA_2418 ACA_1473 ACA_2421 ACA_0152 ACA_2100 ACA_0056 ACA_0500 ACA_0113 ACA_1035 ACA_0148 ACA_0976 ACA_2307 ACA_2307 ACA_2095

a I D

l i c illu s ca l d u p ankton c i d it h iob ac illu s ca l d u e ss ile c i d it h iob ac Annotation number is that of Genebank genome annotation NZ_ACVD01000000.1. isoelectric point (pI) of database Predicted entry. 2D-PAGE. Experimental determined by molecular weight database the in (scores match random a not is probability hit the the giving that search (PMF) fingerprint mass peptide a of hit the describes and Mascot by generated was score Mowse peptide masses of the experimentally acquired PMF. the submitted by Mascot) presents the percentage (generated by of the databasecovered hit that was Sequence coverage Figure 5 . to protein spots in Figure Melanie and refers generated by ID was Match of database Molecular weight entry. Predicted considered to be significant. < 0.05 were condition and spots with p-values two or three replicates of each for performed test was Anova A A Experimental 2D-PAGE. pI determined by Expect value (generated by Mascot) is the number of hits expected by change in a database of the same size. change by Mascot) is the number of hits expected (generated by Expect value expressed. regarded as differentially ≥ 2.0 were changes determined with Melanie. Fold was change Fold Edman degradation. by analyzed Sample was Match Match a significance threshold of 0.05). 64 70 556 a b c d e f g h i j k l

Table A2 | Proteins identified in 2D gels from sessile and planktonic planktonic and sessile from gels 2D in identified Proteins | A2 Table 118 213 492 238 826 258 841 827 280 325 329 364 382 395 404 408 420 442 447 455 515 522 541 543 553

Frontiers in Microbiology | Microbial Physiology and Metabolism February 2011 | Volume 2 | Article 17 | 18