DOCSLIB.ORG

Biomolecules in Disease and Disease Treatment

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Biomolecules in Disease and Disease Treatment University of South Florida Scholar Commons Graduate Theses and Dissertations Graduate School 11-15-2019 The Activity and Structure of Cu2+-Biomolecules in Disease and Disease Treatment Darrell Cole Cerrato University of South Florida Follow this and additional works at: https://scholarcommons.usf.edu/etd Part of the Chemistry Commons Scholar Commons Citation Cerrato, Darrell Cole, "The Activity and Structure of Cu2+-Biomolecules in Disease and Disease Treatment" (2019). Graduate Theses and Dissertations. https://scholarcommons.usf.edu/etd/8628 This Dissertation is brought to you for free and open access by the Graduate School at Scholar Commons. It has been accepted for inclusion in Graduate Theses and Dissertations by an authorized administrator of Scholar Commons. For more information, please contact [email protected]. The Activity and Structure of Cu2+-Biomolecules in Disease and Disease Treatment by Darrell Cole Cerrato A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Department of Chemistry College of Arts and Sciences University of South Florida Major Professor: Li-June Ming, Ph.D. Randy Larsen, Ph.D. Jianfeng Cai, Ph.D. Yu Chen, Ph.D. Date of Approval: November 4th, 2019 Keywords: Alzheimer’s, beets, bacitracin, oxidative stress, thiabendzole, betanin, phytochemicals, salicylic acid, amyloid Copyright © 2019, Darrell Cole Cerrato DEDICATION I dedicate this to you, Reader. If you are reading this, it is likely that you are family, friends, colleagues, researchers, or someone who is curious about the world we live in. The foundation of studying science is that we rely on each other. We use peer review; we train those that don’t have experience; we advance science based on what was discovered before us. For those of you reading this that are not chemists or professional scientists, this is for you as well. Science is not for a certain sect of society. It is for everyone, and we all benefit from the curiosity of others. Your enthusiasm for learning more about the world around you is the same reason I remained motivated to complete this degree. If you have need of the information within this dissertation, I hope it helps you. We live in a world we must share, and I would like to share this contribution with you. ACKNOWLEDGEMENTS If I have seen further it is by standing on the shoulders of Giants. - Isaac Newton, 1675 First and foremost, I must acknowledge my best friend Erin Cerrato. Your dedication and belief in me carried me more than I ever knew and will probably ever completely comprehend. Without you I do not think I would have ever applied to the University of South Florida, much less have ever worked for a Ph.D. in chemistry. You worked just as hard for this as I did, seeing more in me than I often saw in myself. I would also like to acknowledge Max, Andi, and Alex. I realize you cannot read, because, you know, you’re a couple of dogs and a cat, but you guys, ironically, maintained my humanity and compassion throughout some of the toughest times. I don’t deserve any of you, and love you all so much more for it. I must also acknowledge my academic family and friends, Shahed, Christie, Yassin, Anne-Claire, Briana, Brian, Andrew, Anne-Marie, and Arthur, and so many more. You were all there for me both academically, emotionally, spiritually, scientifically, grammatically, etc. The mid-afternoon coffees, post-lab drinks, and dragging me from my apartment after marathon writing sessions maintained my motivation and sanity. I would also like to recognize my mentors. Dr. Randy Larsen, you taught me that chemistry is more than facts, but it’s a lens through which we view and explore nature. You have taught me how to communicate science and inspired me to keep looking at the big picture. Finally, I must acknowledge my major professor and advisor Dr. Li- June Ming. In the moment I might have lamented how you would not give answers but made us figure it out instead. I cannot thank you enough for that now. I learned that a portion of earning this degree isn’t only learning the material and doing the research, but also learning how to think. Regardless of what life throws my way, I think I can handle it with the tools you have let me learn to use. I am a better person for knowing all of you. TABLE OF CONTENTS List of Tables ................................................................................................................................ iii List of Figures .............................................................................................................................. iv List of Abbreviations and Units .............................................................................................. xiii Abstract........................................................................................................................................ xv Chapter One: Life is So Metal: A Survey of Copper in Life, Disease, and Disease Treatment from Humans to Agriculture ...................................................................................1 A Very Brief Historic Overview of Metals in Biology .................................................1 Copper in Biology ..........................................................................................................7 Role of Copper in Neurodegenerative Disease ..........................................................22 Metallo-Antibiotics ........................................................................................................28 Copper and Secondary Metabolite Interactions .........................................................32 Conclusion .......................................................................................................................35 References ........................................................................................................................36 Chapter Two: “Beeting” Alzheimer’s Disease: The Structure-Activity Role of Betanin Towards the Redox Active CuAβ Implicated in Alzheimer’s Disease ...........55 Background ......................................................................................................................55 Results and Discussion Antioxidation of CuAβ by Bn ................................................................................... 65 Betanin-Copper Binding ............................................................................................... 86 Beet Extract Redox Inhibition and Metal Binding ..................................................... 99 Concluding Remarks . .............................................................................................................. 103 Materials and Methods............................................................................................................. 106 References ................... .............................................................................................................. 108 Chapter Three: Inhibition of Copper(II)-Bacitracin Mediated Oxidation By Salicylic Acid and Thiabendazole .....................................................................................120 Background ....................................................................................................................120 Results and Discussion Salicylic acid as an inhibitor against Cu-bactracin .......................................134 i Thiabendazole as an inhibitor against Cu-bacitracin ..................................159 Concluding Remarks ....................................................................................................173 Materials and Methods ................................................................................................175 References ......................................................................................................................176 Chapter Four: Three-Dimensional Structure Elucidation of a Novel Peptide “Foldamer” and NMR Evaluation of a Metallo-Peptoid ..............................................187 Background ....................................................................................................................187 Results and Discussion D-sulfono-γ-AApeptide/L-amino acid structure and conformation elucidation ....................................................................................................192 Ac-FHFH, γ-Peptoid, and Peptide metal binding ........................................203 Concluding Remarks ....................................................................................................211 Materials and Methods ................................................................................................212 References ......................................................................................................................214 Appendix A ................................................................................................................................221 Permissions ....................................................................................................................221 ii LIST OF TABLES Table 2.1 – Michaelis-Menten parameters of betanin inhibition of aerobic oxidation determined by fitting each line in Figure 2.6 to the Michaelis- Menten hyperbolic equation. (a) based on dimeric CuAβ concentration of 2.5 μM ...........................................................................................................................................72 Table 2.2 - MM parameters
Load more

Recommended publications
  • Targeted Genes and Methodology Details for Neuromuscular Genetic Panels
    Targeted Genes and Methodology Details for Neuromuscular Genetic Panels Reference transcripts based on build GRCh37 (hg19) interrogated by Neuromuscular Genetic Panels Next-generation sequencing (NGS) and/or Sanger sequencing is performed Motor Neuron Disease Panel to test for the presence of a mutation in these genes. Gene GenBank Accession Number Regions of homology, high GC-rich content, and repetitive sequences may ALS2 NM_020919 not provide accurate sequence. Therefore, all reported alterations detected ANG NM_001145 by NGS are confirmed by an independent reference method based on laboratory developed criteria. However, this does not rule out the possibility CHMP2B NM_014043 of a false-negative result in these regions. ERBB4 NM_005235 Sanger sequencing is used to confirm alterations detected by NGS when FIG4 NM_014845 appropriate.(Unpublished Mayo method) FUS NM_004960 HNRNPA1 NM_031157 OPTN NM_021980 PFN1 NM_005022 SETX NM_015046 SIGMAR1 NM_005866 SOD1 NM_000454 SQSTM1 NM_003900 TARDBP NM_007375 UBQLN2 NM_013444 VAPB NM_004738 VCP NM_007126 ©2018 Mayo Foundation for Medical Education and Research Page 1 of 14 MC4091-83rev1018 Muscular Dystrophy Panel Muscular Dystrophy Panel Gene GenBank Accession Number Gene GenBank Accession Number ACTA1 NM_001100 LMNA NM_170707 ANO5 NM_213599 LPIN1 NM_145693 B3GALNT2 NM_152490 MATR3 NM_199189 B4GAT1 NM_006876 MYH2 NM_017534 BAG3 NM_004281 MYH7 NM_000257 BIN1 NM_139343 MYOT NM_006790 BVES NM_007073 NEB NM_004543 CAPN3 NM_000070 PLEC NM_000445 CAV3 NM_033337 POMGNT1 NM_017739 CAVIN1 NM_012232 POMGNT2
    [Show full text]
  • Role of Oxidative Stress in the Pathogenesis of Amyotrophic Lateral Sclerosis: Antioxidant Metalloenzymes and Therapeutic Strategies
    biomolecules Review Role of Oxidative Stress in the Pathogenesis of Amyotrophic Lateral Sclerosis: Antioxidant Metalloenzymes and Therapeutic Strategies Pavlína Hemerková * and Martin Vališ Department of Neurology, Charles University, Faculty of Medicine and University Hospital Hradec Kralove, 500 05 Hradec Kralove, Czech Republic; [email protected] * Correspondence: [email protected]; Tel.: +420-731-304-371 Abstract: Amyotrophic lateral sclerosis (ALS) affects motor neurons in the cerebral cortex, brainstem and spinal cord and leads to death due to respiratory failure within three to five years. Although the clinical symptoms of this disease were first described in 1869 and it is the most common motor neuron disease and the most common neurodegenerative disease in middle-aged individuals, the exact etiopathogenesis of ALS remains unclear and it remains incurable. However, free oxygen radicals (i.e., molecules containing one or more free electrons) are known to contribute to the pathogenesis of this disease as they very readily bind intracellular structures, leading to functional impairment. Antioxidant enzymes, which are often metalloenzymes, inactivate free oxygen radicals by converting them into a less harmful substance. One of the most important antioxidant enzymes is Cu2+Zn2+ superoxide dismutase (SOD1), which is mutated in 20% of cases of the familial form of ALS (fALS) and up to 7% of sporadic ALS (sALS) cases. In addition, the proper functioning of catalase and glutathione peroxidase (GPx) is essential for antioxidant protection. In this review article, we focus on the mechanisms through which these enzymes are involved in the antioxidant response to oxidative Citation: Hemerková, P.; Vališ, M. Role of Oxidative Stress in the stress and thus the pathogenesis of ALS and their potential as therapeutic targets.
    [Show full text]
  • 192ICM ICBIC Abstracts
    Workshop Lecture Journal of Inorganic Biochemistry 96 (2003) 3 Structural Genomics Antonio Rosato, Magnetic Resonance Center, University of Florence, Italy To realize the true value of the wealth of data provided by genome sequencing data, it is necessary to relate them to the functional properties of the proteins they encode. Since the biological function of a protein is determined by its 3D structure, the systematic determination of proteins’ structures on a genome-wide scale is a crucial step in any (post-)genomic effort, which may (or may not) provide initial hints on the function. This is what is commonly referred to as ‘Structural Genomics’ (or Structural Proteomics). Because of the huge number of systems into question, all the complex steps necessary for structure determination must be optimized, streamlined and, possibly, robotized in order to shrink the time needed to solve each protein structure. This approach is dubbed ‘high-throughput’ (HTP) and is an intrinsic feature of Structural Genomics. What can be the relationship between Biological Inorganic Chemistry and Structural Genomics? A major challenge is that to reconcile the concept of HTP with the care that metalloproteins most often require because of their metal cofactors. The identifi cation of metalloproteins is even not explicitly taken into account in purely Structural Genomics projects, nor is any methodology particularly developed for them. To create true correlations between Biological Inorganic Chemistry and Structural Genomics it is necessary to develop new computational tools (e.g. to identify metalloproteins in databanks, or to correctly model their structures), as well as new methodological approaches to HTP metalloprotein expression/purifi cation and structural characterization.
    [Show full text]
  • Targeting SOD1 Reduces Experimental Non–Small-Cell Lung Cancer
    Targeting SOD1 reduces experimental non–small-cell lung cancer Andrea Glasauer, … , Andrew P. Mazar, Navdeep S. Chandel J Clin Invest. 2014;124(1):117-128. https://doi.org/10.1172/JCI71714. Research Article Oncology Approximately 85% of lung cancers are non–small-cell lung cancers (NSCLCs), which are often diagnosed at an advanced stage and associated with poor prognosis. Currently, there are very few therapies available for NSCLCs due to the recalcitrant nature of this cancer. Mutations that activate the small GTPase KRAS are found in 20% to 30% of NSCLCs. Here, we report that inhibition of superoxide dismutase 1 (SOD1) by the small molecule ATN-224 induced cell death in various NSCLC cells, including those harboring KRAS mutations. ATN-224–dependent SOD1 inhibition increased superoxide, which diminished enzyme activity of the antioxidant glutathione peroxidase, leading to an increase in intracellular hydrogen peroxide (H2O2) levels. We found that ATN-224–induced cell death was mediated through H2O2- dependent activation of P38 MAPK and that P38 activation led to a decrease in the antiapoptotic factor MCL1, which is often upregulated in NSCLC. Treatment with both ATN-224 and ABT-263, an inhibitor of the apoptosis regulators BCL2/BCLXL, augmented cell death. Furthermore, we demonstrate that ATN-224 reduced tumor burden in a mouse model of NSCLC. Our results indicate that antioxidant inhibition by ATN-224 has potential clinical applications as a single agent, or in combination with other drugs, for the treatment of patients with various forms of NSCLC, including KRAS- driven cancers. Find the latest version: https://jci.me/71714/pdf Research article Targeting SOD1 reduces experimental non–small-cell lung cancer Andrea Glasauer,1 Laura A.
    [Show full text]
  • NRF2 and the Ambiguous Consequences of Its Activation During Initiation and the Subsequent Stages of Tumourigenesis
    cancers Review NRF2 and the Ambiguous Consequences of Its Activation during Initiation and the Subsequent Stages of Tumourigenesis Holly Robertson 1,2, Albena T. Dinkova-Kostova 1 and John D. Hayes 1,* 1 Jacqui Wood Cancer Centre, Division of Cellular Medicine, Ninewells Hospital and Medical School, University of Dundee, Dundee DD1 9SY, Scotland, UK; [email protected] (H.R.); [email protected] (A.T.D.-K.) 2 Wellcome Trust Sanger Institute, Wellcome Genome Campus, Cambridge CB10 1SA, UK * Correspondence: [email protected]; Tel.: +44-(0)-1382-383182 Received: 30 October 2020; Accepted: 27 November 2020; Published: 2 December 2020 Simple Summary: Transcription factor NRF2 controls expression of antioxidant and detoxification genes. Normally, the activity of NRF2 is tightly controlled in the cell, and is continuously adjusted to ensure that cells are protected against endogenous chemicals and environmental agents that perturb the intracellular antioxidant/pro-oxidant balance (i.e., redox) that must be maintained for them to grow and survive in an appropriate manner. This tight control of NRF2 is achieved by a repressor protein called KEAP1 that perpetually targets NRF2 protein for degradation under normal conditions, but is unable to do so when challenged with oxidants or thiol-reactive chemicals. In the context of cancer, it is well known that drugs that stimulate short-term and reversible activation of NRF2 can provide protection for a limited period against exposure to chemicals that cause cancer. However, it is also becoming widely recognised that permanent hyper-activation of NRF2 resulting from somatic mutations in the gene that encodes NRF2, or in genes associated with its degradation, is frequently observed in certain cancers and associated with poor outcome.
    [Show full text]
  • Single-Cell RNA-Seq Analysis of the Brainstem of Mutant SOD1 Mice Reveals Perturbed Cell Types and Pathways of Amyotrophic Lateral Sclerosis
    HHS Public Access Author manuscript Author ManuscriptAuthor Manuscript Author Neurobiol Manuscript Author Dis. Author manuscript; Manuscript Author available in PMC 2020 September 26. Published in final edited form as: Neurobiol Dis. 2020 July ; 141: 104877. doi:10.1016/j.nbd.2020.104877. Single-cell RNA-seq analysis of the brainstem of mutant SOD1 mice reveals perturbed cell types and pathways of amyotrophic lateral sclerosis Wenting Liua, Sharmila Venugopala, Sana Majida, In Sook Ahna, Graciel Diamantea, Jason Honga, Xia Yanga,b,c,*, Scott H. Chandlera,b,* aDepartment of Integrative Biology & Physiology, University of California, 2024 Terasaki Bld, 610 Charles E. Young Dr. East, Los Angeles, USA bBrain Research Institute, University of California, Los Angeles, USA cInstitute for Quantitative and Computational Biosciences, University of California, Los Angeles, USA Abstract Amyotrophic lateral sclerosis (ALS) is a neurodegenerative disease in which motor neurons throughout the brain and spinal cord progressively degenerate resulting in muscle atrophy, paralysis and death. Recent studies using animal models of ALS implicate multiple cell-types (e.g., astrocytes and microglia) in ALS pathogenesis in the spinal motor systems. To ascertain cellular vulnerability and cell-type specific mechanisms of ALS in the brainstem that orchestrates oral-motor functions, we conducted parallel single cell RNA sequencing (scRNA-seq) analysis using the high-throughput Drop-seq method. We isolated 1894 and 3199 cells from the brainstem of wildtype and mutant SOD1 symptomatic mice respectively, at postnatal day 100. We recovered major known cell types and neuronal subpopulations, such as interneurons and motor neurons, and trigeminal ganglion (TG) peripheral sensory neurons, as well as, previously uncharacterized interneuron subtypes.
    [Show full text]
  • Springer Handbook of Enzymes
    Dietmar Schomburg and Ida Schomburg (Eds.) Springer Handbook of Enzymes Volume 25 Class 1 • Oxidoreductases X EC 1.9-1.13 co edited by Antje Chang Second Edition 4y Springer Index of Recommended Enzyme Names EC-No. Recommended Name Page 1.13.11.50 acetylacetone-cleaving enzyme 673 1.10.3.4 o-aminophenol oxidase 149 1.13.12.12 apo-/?-carotenoid-14',13'-dioxygenase 732 1.13.11.34 arachidonate 5-lipoxygenase 591 1.13.11.40 arachidonate 8-lipoxygenase 627 1.13.11.31 arachidonate 12-lipoxygenase 568 1.13.11.33 arachidonate 15-lipoxygenase 585 1.13.12.1 arginine 2-monooxygenase 675 1.13.11.13 ascorbate 2,3-dioxygenase 491 1.10.2.1 L-ascorbate-cytochrome-b5 reductase 79 1.10.3.3 L-ascorbate oxidase 134 1.11.1.11 L-ascorbate peroxidase 257 1.13.99.2 benzoate 1,2-dioxygenase (transferred to EC 1.14.12.10) 740 1.13.11.39 biphenyl-2,3-diol 1,2-dioxygenase 618 1.13.11.22 caffeate 3,4-dioxygenase 531 1.13.11.16 3-carboxyethylcatechol 2,3-dioxygenase 505 1.13.11.21 p-carotene 15,15'-dioxygenase (transferred to EC 1.14.99.36) 530 1.11.1.6 catalase 194 1.13.11.1 catechol 1,2-dioxygenase 382 1.13.11.2 catechol 2,3-dioxygenase 395 1.10.3.1 catechol oxidase 105 1.13.11.36 chloridazon-catechol dioxygenase 607 1.11.1.10 chloride peroxidase 245 1.13.11.49 chlorite O2-lyase 670 1.13.99.4 4-chlorophenylacetate 3,4-dioxygenase (transferred to EC 1.14.12.9) .
    [Show full text]
  • Polyphenol Oxidases in Crops: Biochemical, Physiological and Genetic Aspects
    International Journal of Molecular Sciences Review Polyphenol Oxidases in Crops: Biochemical, Physiological and Genetic Aspects Francesca Taranto 1,*, Antonella Pasqualone 2, Giacomo Mangini 2, Pasquale Tripodi 3, Monica Marilena Miazzi 2, Stefano Pavan 2 and Cinzia Montemurro 1,2 1 SINAGRI S.r.l.-Spin off dell’Università degli Studi di Bari “Aldo Moro”, 70126 Bari, Italy; [email protected] 2 Dipartimento di Scienze del Suolo, della Pianta e degli Alimenti, Università degli Studi di Bari “Aldo Moro”, 70126 Bari, Italy; [email protected] (A.P.); [email protected] (G.M.); [email protected] (M.M.M.); [email protected] (S.P.) 3 Consiglio per la ricerca in agricoltura e l’analisi dell’economia agraria, Centro di ricerca per l’orticoltura, 84098 Pontecagnano Faiano, Italy; [email protected] * Correspondence: [email protected]; Tel.: +39-80-5443003 Academic Editor: Gopinadhan Paliyath Received: 15 November 2016; Accepted: 4 February 2017; Published: 10 February 2017 Abstract: Enzymatic browning is a colour reaction occurring in plants, including cereals, fruit and horticultural crops, due to oxidation during postharvest processing and storage. This has a negative impact on the colour, flavour, nutritional properties and shelf life of food products. Browning is usually caused by polyphenol oxidases (PPOs), following cell damage caused by senescence, wounding and the attack of pests and pathogens. Several studies indicated that PPOs play a role in plant immunity, and emerging evidence suggested that PPOs might also be involved in other physiological processes. Genomic investigations ultimately led to the isolation of PPO homologs in several crops, which will be possibly characterized at the functional level in the near future.
    [Show full text]
  • Diallyl Disulfide Inhibits the Proliferation of HT-29 Human Colon Cancer Cells by Inducing Differentially Expressed Genes
    MOLECULAR MEDICINE REPORTS 4: 553-559, 2011 Diallyl disulfide inhibits the proliferation of HT-29 human colon cancer cells by inducing differentially expressed genes YOU-SHENG HUANG1,2, NA XIE1,2, QI SU1, JIAN SU1, CHEN HUANG1 and QIAN-JIN LIAO1 1Cancer Research Institute, University of South China, Hengyang, Hunan 421001; 2Department of Pathology, Hainan Medical University, Haikou, Hainan 571101, P.R. China Received November 22, 2010; Accepted February 28, 2011 DOI: 10.3892/mmr.2011.453 Abstract. Diallyl disulfide (DADS), a sulfur compound Introduction derived from garlic, has been shown to have protective effects against colon carcinogenesis in several studies performed in Colon cancer is one of the major causes of cancer death rodent models. However, its molecular mechanism of action worldwide (1). An understanding of the mechanisms involved remains unclear. This study was designed to confirm the anti- in the occurrence and development of colon cancer would aid proliferative activity of DADS and to screen for differentially in its therapy. Epidemiological investigations have provided expressed genes induced by DADS in human colon cancer cells compelling evidence that environmental factors are modifiers with the aim of exploring its possible anticancer mechanisms. in colon cancer (1-3); diet has also been shown to be an impor- The anti-proliferative capability of DADS in the HT-29 human tant determinant of cancer risk and tumor behavior (3-5). colon cancer cells was analyzed by MTT assays and flow Garlic consumption is very popular all over the world. cytometry. The differences in gene expression between DADS- Epidemiological studies have shown an inverse correlation treated (experimental group) and untreated (control group) between the consumption of garlic and colon cancer in certain HT-29 cells were identified using two-directional suppression areas (6).
    [Show full text]
  • Mitigation of ALS Pathology by Neuron-Specific Inhibition of Nuclear Factor Kappa B Signaling
    The Journal of Neuroscience, June 24, 2020 • 40(26):5137–5154 • 5137 Neurobiology of Disease Mitigation of ALS Pathology by Neuron-Specific Inhibition of Nuclear Factor Kappa B Signaling Kallol Dutta,1 Sai Sampath Thammisetty,1 Hejer Boutej,1 Christine Bareil,1 and Jean-Pierre Julien1,2 1CERVO Brain Research Centre, Québec City, Québec G1J 2G3, Canada, and 2Department of Psychiatry and Neuroscience, Université Laval, Québec City, Québec G1V 0A6, Canada To investigate the role of neuronal NF-jB activity in pathogenesis of amyotrophic lateral sclerosis (ALS), we generated trans- genic mice with neuron-specific expression of a super-repressor form of the NF-jB inhibitor (IjBa-SR), which were then crossed with mice of both sexes, expressing ALS-linked gene mutants for TAR DNA-binding protein (TDP-43) and superoxide dismutase 1 (SOD1). Remarkably, neuronal expression of IjBa-SR transgene in mice expressing TDP-43A315T or TDP-43G348C mice led to a decrease in cytoplasmic to nuclear ratio of human TDP-43. The mitigation of TDP-43 neuropathology by IjBa-SR, which is likely due to an induction of autophagy, was associated with amelioration of cognitive and motor deficits as well as reduc- tion of motor neuron loss and gliosis. Neuronal suppression of NF-jB activity in SOD1G93A mice also resulted in neuroprotection with reduction of misfolded SOD1 levels and significant extension of life span. The results suggest that neuronal NF-jB signaling constitutes a novel therapeutic target for ALS disease and related disorders with TDP-43 proteinopathy. Key words: amyotrophic lateral sclerosis; frontotemporal dementia; IjB suppressor; NF-jB; superoxide dismutase; TDP-43 Significance Statement This study reports that neuron-specific expression of IkB super-repressor mitigated behavioral and pathologic changes in transgenic mouse models of amyotrophic lateral sclerosis expressing mutant forms of either Tar DNA-binding protein 43 or superoxide dismutase.
    [Show full text]
  • Gene ID Log2 Ratio FDR Annotation
    Table S1. Primer sequences used for real-time quantitative PCR Gene ID Primer name Primer sequence (5’-3’) Experimental Use MD04G1003300 CHS-F CTAGTGACACCCACCTTGAYAG RT-PCR CHS-R AGAAGAGYGAGTTCCAGTCYGA MD01G1118100 CHI-F GGTCCGTTTGAGAAATTCATTC RT-PCR CHI-R KGTTTTCTATCACCRYGTTTGC MD15G1353800 F3H-F TCAACCAGTGGAAGGAGCTT RT-PCR F3H-R GTCCTGCAGTTGCTGTTCCT MD15G1024100 DFR-F AGTCCGAATCCGTTTGTGTC RT-PCR DFR-R TTGTGGGCTTGATCACTTCA MD03G1001100 ANS -F CACCTTCATCCTCCACAACAT RT-PCR ANS - R ATGTGCTCAGCAAAAGTTCGT MD15G1215500 MYB114-F GAAGACCTTGTTAGAAGACGACGATATA RT-PCR MYB114-R TATGATCTTGCCGACTGTTGCATAT MD03G1266300 bHLHA-like-F AACTAAGGGCCAAGGTGAAGG RT-PCR bHLHA-like-R CTGCTTATCCTAAATCGTCCTGC MD07G1137500 bHLH33-F ATGTTTTTGCGACGGAGAGAGCA RT-PCR bHLH33-R TAGGCGAGTGAACACCATACATTAAAGG MD09G1193500 MSI4-1F CCAGGCGTGATGTCTCCTTT RT-PCR MSI4-1R GCTGTCTTAGCGGACTGGTT JX162681 MYB10-F ACGCCACCACAAACGTCGTCG RT-PCR MYB10-R GGCGCATGATCTTGGCGACAGT DQ341382 18SR-F GAGCCTGAGAAACGGCTACC RT-PCR 18SR-R GTCACTACCTCCCCGTGTCA Table S2. Transcription factors identified among the differentially regulated genes log2 Ratio Gene ID FDR Annotation (RIT/UIT) MD00G1000500 2.12 0.032445 MYB family transcription factor PHL11 [Pyrus x bretschneideri] MD01G1054800 1.26 0.013987 MYB-related protein MYB4-like [Malus domestica] MD01G1084400 4.51 2.98E-06 MYB-related protein 308-like [Malus domestica] MD01G1144700 1.64 0.001018 transcription factor MYB86-like [Malus domestica] MD01G1155100 2.98 0.006279 transcriptional activator MYB-like [Malus domestica] MD02G1076300 -1.87 1.01E-05
    [Show full text]
  • The Metabolites NADP+ and NADPH Are the Targets of the Circadian Protein Nocturnin (Curled)
    ARTICLE https://doi.org/10.1038/s41467-019-10125-z OPEN The metabolites NADP+ and NADPH are the targets of the circadian protein Nocturnin (Curled) Michael A. Estrella 1,4, Jin Du 1,4, Li Chen2,3,4, Sneha Rath1, Eliza Prangley1, Alisha Chitrakar1, Tsutomu Aoki1, Paul Schedl1, Joshua Rabinowitz2,3 & Alexei Korennykh1 Nocturnin (NOCT) is a rhythmically expressed protein that regulates metabolism under the control of circadian clock. It has been proposed that NOCT deadenylates and regulates 1234567890():,; metabolic enzyme mRNAs. However, in contrast to other deadenylases, purified NOCT lacks the deadenylase activity. To identify the substrate of NOCT, we conducted a mass spec- trometry screen and report that NOCT specifically and directly converts the dinucleotide NADP+ into NAD+ and NADPH into NADH. Further, we demonstrate that the Drosophila NOCT ortholog, Curled, has the same enzymatic activity. We obtained the 2.7 Å crystal structure of the human NOCT•NADPH complex, which revealed that NOCT recognizes the chemically unique ribose-phosphate backbone of the metabolite, placing the 2′-terminal phosphate productively for removal. We provide evidence for NOCT targeting to mito- chondria and propose that NADP(H) regulation, which takes place at least in part in mito- chondria, establishes the molecular link between circadian clock and metabolism. 1 216 Schultz Laboratory, Department of Molecular Biology, Princeton, NJ 08544, USA. 2 285 Frick Laboratory, Department of Chemistry, Princeton, NJ 08544, USA. 3 Lewis-Sigler Institute for Integrative Genomics, Princeton, NJ 08544, USA. 4These authors contributed equally: Michael A. Estrella, Jin Du, Li Chen. Correspondence and requests for materials should be addressed to J.R.
    [Show full text]