DOCSLIB.ORG

Identification and Characterization of Tyrosine Kinase Nonreceptor 2 Mutations in Leukemia Through Integration of Kinase Inhibitor Screening and Genomic Analysis

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Identification and Characterization of Tyrosine Kinase Nonreceptor 2 Mutations in Leukemia Through Integration of Kinase Inhibitor Screening and Genomic Analysis Published OnlineFirst December 17, 2015; DOI: 10.1158/0008-5472.CAN-15-0817 Cancer Therapeutics, Targets, and Chemical Biology Research Identification and Characterization of Tyrosine Kinase Nonreceptor 2 Mutations in Leukemia through Integration of Kinase Inhibitor Screening and Genomic Analysis Julia E. Maxson1,2,3, Melissa L. Abel1,2, Jinhua Wang4, Xianming Deng4, Sina Reckel5, Samuel B. Luty1,2, Huahang Sun6, Julie Gorenstein6, Seamus B. Hughes3, Daniel Bottomly1,7, Beth Wilmot1,7,8, Shannon K. McWeeney1,7,8, Jerald Radich3, Oliver Hantschel5, Richard E. Middleton6, Nathanael S. Gray4, Brian J. Druker1,2,9, and Jeffrey W. Tyner2,10 Abstract The amount of genomic information about leukemia cells exhibited oncogenic capacity. Importantly, the integration of currently far exceeds our overall understanding of the precise functional and genomic data using HitWalker allowed for genetic events that ultimately drive disease development and prioritization of rare oncogenic mutations that may have been progression. Effective implementation of personalized medi- missed through genomic analysis alone. These mutations were cine will require tools to distinguish actionable genetic altera- sensitive to the multikinase inhibitor dasatinib, which antag- tions within the complex genetic landscape of leukemia. In this onizes TNK2 kinase activity, as well as novel TNK2 inhibitors, study, we performed kinase inhibitor screens to predict func- XMD8-87 and XMD16-5, with greater target specificity. We also tional gene targets in primary specimens from patients with identified activating truncation mutations in other tumor types acute myeloid leukemia and chronic myelomonocytic leuke- that were sensitive to XMD8-87 and XMD16-5, exemplifying mia. Deep sequencing of the same patient specimens identified the potential utility of these compounds across tumor types genetic alterations that were then integrated with the function- dependent on TNK2. Collectively, our findings highlight a ally important targets using the HitWalker algorithm to prior- more sensitive approach for identifying actionable genomic itize the mutant genes that most likely explain the observed lesions that may be infrequently mutated or overlooked and drug sensitivity patterns. Through this process, we identified provide a new method for the prioritization of candidate tyrosine kinase nonreceptor 2 (TNK2) point mutations that genetic mutations. Cancer Res; 76(1); 1–12. Ó2015 AACR. Introduction genomic data, our understanding of the functional signifi- cance of these genetic events lags far behind. One major A tremendous amount of information now exists detailing challenge is how to sort through all of the known mutations the genetic alterations in leukemia cells. Despite this wealth of to find novel therapeutic targets. To this end, we have devel- oped an algorithm called HitWalker (1), which can prioritize gene mutations based on functional data, detailing the under- 1Knight Cancer Institute, Oregon Health and Science University, Port- lying vulnerabilities of the leukemia cells. These functional land, Oregon. 2Division of Hematology and Medical Oncology, Oregon Health and Science University, Portland, Oregon. 3Clinical Research data are derived from a kinase inhibitor screening platform Division, Fred Hutchinson Cancer Research Center, Seattle, Washing- (2). These kinase inhibitor screens are run on primary patient ton. 4Department of Cancer Biology, Dana Farber Cancer Institute, samples, and then the kinase targets of the effective drugs are Department of Biological Chemistry and Molecular Pharmacology, fi 5 calculated based on the known ef cacy of the drugs against Harvard Medical School, Boston, Massachusetts. Swiss Institute for fi Experimental Cancer Research (ISREC), School of Life Sciences, Ecole various targets (1). This study is the rst example of the polytechnique fed erale de Lausanne (EPFL), Lausanne, Switzerland. HitWalker algorithm being used to identify a novel therapeu- 6Belfer Institute for Applied Cancer Science, Dana Farber Cancer tic target, TNK2. 7 Institute, Boston, Massachusetts. Oregon Clinical and Translational Tyrosine Kinase Nonreceptor 2 (TNK2) is a cytoplasmic Research Institute, Oregon Health and Science University, Portland, Oregon. 8Division of Bioinformatics and Computational Biology, Ore- kinase also known as ACK1 (activated CDC42-associated gon Health and Science University, Portland,Oregon. 9Howard Hughes kinase;ref.3).TNK2ispartofafamilyofcytoplasmictyrosine 10 Medical Institute, Portland, Oregon. Cell, Developmental & Cancer kinases that also includes TNK1 (3). TNK2 was originally Biology, Oregon Health and Science University, Portland, Oregon. identified based on its binding to the cell-cycle regulator, Note: Supplementary data for this article are available at Cancer Research CDC42 (4). Together, TNK2 and CDC42 regulate cellular Online (http://cancerres.aacrjournals.org/). attachment and migration (5). Corresponding Author: Jeffrey W. Tyner, Oregon Health and Science University, TNK2 is composed of several functional domains, including 3181 SW Sam Jackson Park Road, Portland OR, 97239. Phone: 503-346-0603; a sterile alpha motif (SAM) domain, a tyrosine kinase domain, Fax: 503-494-3688; E-mail: [email protected] aSH3protein–protein interaction domain, a CDC42/RAC- doi: 10.1158/0008-5472.CAN-15-0817 interactive (CRIB) domain, and a region that is homologous Ó2015 American Association for Cancer Research. to the EGFR-binding domain (EBD) of Mig6 and a ubiquitin www.aacrjournals.org OF1 Downloaded from cancerres.aacrjournals.org on September 25, 2021. © 2015 American Association for Cancer Research. Published OnlineFirst December 17, 2015; DOI: 10.1158/0008-5472.CAN-15-0817 Maxson et al. association domain. In addition to phosphorylation in QuikChange II XL site-directed mutagenesis Kit (Agilent Technol- response to EGFR signaling, TNK2 can also be activated by ogies) and the following primers: TNK2-D163E-F gcctgaagccc- other receptor tyrosine kinases (6), and phosphorylation of gaggtcctgagccagc, TNK2-D163E-R gctggctcaggacctcgggcttcaggc, the TNK2 activation loop by SRC is required for its kinase TNK2-R806Q-F cgctgccaccccagctctcaagctc, TNK2-R806Q-R gagctt- activity (7). gagagctggggtggcagcg, TNK2-P494fs-F gctcaggaggtcggggggtccatg, Multiple mechanisms by which TNK2 contributes to solid TNK2-P494fs-R catggaccccccgacctcctgagc, TNK2-P632fs-F ctgcccc- tumors have been documented. TNK2 mutations have been cccccgcccgcctatg, TNK2-P632fs-R cataggcgggcgggggggggcag, found in renal cancer cells and also in lung, ovarian, and gastric TNK2-S808Ã-F cccaggtgagctttagagccggggtgg, TNK2-S808Ã-R cca- cancers (8, 9). TNK2 genomic amplification has been associated ccccggctctaaagctcacctggg, TNK2-Q831fs-F gcctggatcacctgggggtggc- with late-stage or metastatic lung and prostate cancers (10). gtac, and TNK2-Q831fs-R gtacgccacccccaggtgatccaggc. Wild-type Overexpression of TNK2 promoted metastasis in a mouse model and mutated TNK2 were transferred into a Gateway-converted of breast cancer (10). Finally, TNK2 signaling is disrupted in version of pMXs-IRES-Puro (Cell Biolabs, Inc.) or MSCV-IRES- prostate (11), breast (12), and gastrointestinal (13) tumors. GFP using a Gateway LR Clonase kit (Invitrogen). Plasmid TNK2 can activate several protumorigenic signaling path- sequences were confirmed via Sanger sequencing (Eurofins). ways, including modulation of the prosurvival AKT signaling pathway (14), phosphorylation of androgen receptor leading to Cell culture and transfection androgen-independent prostate cancer growth (11, 15), and The human embryonic kidney, 293T17 cell line (ATCC), was negatively regulate the tumor suppressor Wwox (16). In mye- growninDMEM(Invitrogen)mediumwith10%FBS(Atlanta loid malignancies, specifically chronic neutrophilic leukemia Biologicals), L-glutamine, penicillin/streptomycin (Invitrogen), and atypical chronic myeloid leukemia, nonmutated TNK2 and amphotericin B (HyClone). Murine retrovirus was created has been shown to be a functional target in patients with by cotransfecting TNK2 plasmids and the EcoPac plasmid CSF3R mutations (17). TNK2 levels increase in BaF3 cells (provided by Dr. Rick Van Etten, Tufts University, Medford, harboring oncogenic CSF3R mutations, which have upregu- MA) into 293T17 using FuGENE 6 (ProMega). Supernatants lated JAK kinase and SRC signaling promoting IL3-independent were harvested 72 hours later. Ba/F3 cells were maintained in growth (17). RPMI 1640 medium with 10% FBS, 15% conditioned medium In this report, we find a novel link between TNK2 mutations fromtheWEHIcellline(asourceofIL3),L-glutamine, peni- and leukemia using a combination of drug screening and cillin/streptomycin, and amphotericin B. deep sequencing of primary patient samples to identify novel mutations of TNK2 that are therapeutically targetable in leuke- mia. These mutations are oncogenic and sensitive to previously Ba/F3 cytokine-independent growth assays Ba/F3 cells were infected with murine retrovirus obtained from developed TNK2 inhibitors. In addition, we developed novel, potent TNK2 inhibitors that exhibit greater specificity for TNK2. 293T17 cells via addition of polybrene and spinoculation at 30 C for 90 minutes at 2,500 rpm. Infected cells were placed under Materials and Methods puromycin selection for 72 hours. Cells were expanded after being washed three times and finally plated at 5 Â 105 cells/mL in RPMI Sequencing of patient samples 1640 medium with 10% FBS, penicillin/streptomycin, L-gluta- 6 Genomic DNA was extracted from pellets of 5 Â 10 purified
Load more

Recommended publications
  • Mutation-Specific and Common Phosphotyrosine Signatures of KRAS G12D and G13D Alleles Anticipated Graduation August 1St, 2018
    MUTATION-SPECIFIC AND COMMON PHOSPHOTYROSINE SIGNATURES OF KRAS G12D AND G13D ALLELES by Raiha Tahir A dissertation submitted to The Johns Hopkins University in conformity with the requirement of the degree of Doctor of Philosophy Baltimore, MD August 2018 © 2018 Raiha Tahir All Rights Reserved ABSTRACT KRAS is one of the most frequently mutated genes across all cancer subtypes. Two of the most frequent oncogenic KRAS mutations observed in patients result in glycine to aspartic acid substitution at either codon 12 (G12D) or 13 (G13D). Although the biochemical differences between these two predominant mutations are not fully understood, distinct clinical features of the resulting tumors suggest involvement of disparate signaling mechanisms. When we compared the global phosphotyrosine proteomic profiles of isogenic colorectal cancer cell lines bearing either G12D or G13D KRAS mutations, we observed both shared as well as unique signaling events induced by the two KRAS mutations. Remarkably, while the G12D mutation led to an increase in membrane proximal and adherens junction signaling, the G13D mutation led to activation of signaling molecules such as non-receptor tyrosine kinases, MAPK kinases and regulators of metabolic processes. The importance of one of the cell surface molecules, MPZL1, which found to be hyperphosphorylated in G12D cells, was confirmed by cellular assays as its knockdown led to a decrease in proliferation of G12D but not G13D expressing cells. Overall, our study reveals important signaling differences across two common KRAS mutations and highlights the utility of our approach to systematically dissect the subtle differences between related oncogenic mutants and potentially lead to individualized treatments.
    [Show full text]
  • Src-Family Kinases Impact Prognosis and Targeted Therapy in Flt3-ITD+ Acute Myeloid Leukemia
    Src-Family Kinases Impact Prognosis and Targeted Therapy in Flt3-ITD+ Acute Myeloid Leukemia Title Page by Ravi K. Patel Bachelor of Science, University of Minnesota, 2013 Submitted to the Graduate Faculty of School of Medicine in partial fulfillment of the requirements for the degree of Doctor of Philosophy University of Pittsburgh 2019 Commi ttee Membership Pa UNIVERSITY OF PITTSBURGH SCHOOL OF MEDICINE Commi ttee Membership Page This dissertation was presented by Ravi K. Patel It was defended on May 31, 2019 and approved by Qiming (Jane) Wang, Associate Professor Pharmacology and Chemical Biology Vaughn S. Cooper, Professor of Microbiology and Molecular Genetics Adrian Lee, Professor of Pharmacology and Chemical Biology Laura Stabile, Research Associate Professor of Pharmacology and Chemical Biology Thomas E. Smithgall, Dissertation Director, Professor and Chair of Microbiology and Molecular Genetics ii Copyright © by Ravi K. Patel 2019 iii Abstract Src-Family Kinases Play an Important Role in Flt3-ITD Acute Myeloid Leukemia Prognosis and Drug Efficacy Ravi K. Patel, PhD University of Pittsburgh, 2019 Abstract Acute myelogenous leukemia (AML) is a disease characterized by undifferentiated bone-marrow progenitor cells dominating the bone marrow. Currently the five-year survival rate for AML patients is 27.4 percent. Meanwhile the standard of care for most AML patients has not changed for nearly 50 years. We now know that AML is a genetically heterogeneous disease and therefore it is unlikely that all AML patients will respond to therapy the same way. Upregulation of protein-tyrosine kinase signaling pathways is one common feature of some AML tumors, offering opportunities for targeted therapy.
    [Show full text]
  • Supplementary Table 1. in Vitro Side Effect Profiling Study for LDN/OSU-0212320. Neurotransmitter Related Steroids
    Supplementary Table 1. In vitro side effect profiling study for LDN/OSU-0212320. Percent Inhibition Receptor 10 µM Neurotransmitter Related Adenosine, Non-selective 7.29% Adrenergic, Alpha 1, Non-selective 24.98% Adrenergic, Alpha 2, Non-selective 27.18% Adrenergic, Beta, Non-selective -20.94% Dopamine Transporter 8.69% Dopamine, D1 (h) 8.48% Dopamine, D2s (h) 4.06% GABA A, Agonist Site -16.15% GABA A, BDZ, alpha 1 site 12.73% GABA-B 13.60% Glutamate, AMPA Site (Ionotropic) 12.06% Glutamate, Kainate Site (Ionotropic) -1.03% Glutamate, NMDA Agonist Site (Ionotropic) 0.12% Glutamate, NMDA, Glycine (Stry-insens Site) 9.84% (Ionotropic) Glycine, Strychnine-sensitive 0.99% Histamine, H1 -5.54% Histamine, H2 16.54% Histamine, H3 4.80% Melatonin, Non-selective -5.54% Muscarinic, M1 (hr) -1.88% Muscarinic, M2 (h) 0.82% Muscarinic, Non-selective, Central 29.04% Muscarinic, Non-selective, Peripheral 0.29% Nicotinic, Neuronal (-BnTx insensitive) 7.85% Norepinephrine Transporter 2.87% Opioid, Non-selective -0.09% Opioid, Orphanin, ORL1 (h) 11.55% Serotonin Transporter -3.02% Serotonin, Non-selective 26.33% Sigma, Non-Selective 10.19% Steroids Estrogen 11.16% 1 Percent Inhibition Receptor 10 µM Testosterone (cytosolic) (h) 12.50% Ion Channels Calcium Channel, Type L (Dihydropyridine Site) 43.18% Calcium Channel, Type N 4.15% Potassium Channel, ATP-Sensitive -4.05% Potassium Channel, Ca2+ Act., VI 17.80% Potassium Channel, I(Kr) (hERG) (h) -6.44% Sodium, Site 2 -0.39% Second Messengers Nitric Oxide, NOS (Neuronal-Binding) -17.09% Prostaglandins Leukotriene,
    [Show full text]
  • TRK Inhibitors: Tissue-Agnostic Anti-Cancer Drugs
    pharmaceuticals Review TRK Inhibitors: Tissue-Agnostic Anti-Cancer Drugs Sun-Young Han Research Institute of Pharmaceutical Sciences and College of Pharmacy, Gyeongsang National University, Jinju-si 52828, Korea; [email protected] Abstract: Recently, two tropomycin receptor kinase (Trk) inhibitors, larotrectinib and entrectinib, have been approved for Trk fusion-positive cancer patients. Clinical trials for larotrectinib and entrectinib were performed with patients selected based on the presence of Trk fusion, regardless of cancer type. This unique approach, called tissue-agnostic development, expedited the process of Trk inhibitor development. In the present review, the development processes of larotrectinib and entrectinib have been described, along with discussion on other Trk inhibitors currently in clinical trials. The on-target effects of Trk inhibitors in Trk signaling exhibit adverse effects on the central nervous system, such as withdrawal pain, weight gain, and dizziness. A next generation sequencing-based method has been approved for companion diagnostics of larotrectinib, which can detect various types of Trk fusions in tumor samples. With the adoption of the tissue-agnostic approach, the development of Trk inhibitors has been accelerated. Keywords: Trk; NTRK; tissue-agnostic; larotrectinib; entrectinib; Trk fusion 1. Introduction Citation: Han, S.-Y. TRK Inhibitors: Tropomyosin receptor kinases (Trk) are tyrosine kinases encoded by neurotrophic Tissue-Agnostic Anti-Cancer Drugs. tyrosine/tropomyosin receptor kinase (NTRK) genes [1]. Chromosomal rearrangement of Pharmaceuticals 2021, 14, 632. https:// NTRK genes is found in cancer tissues [2]. The resulting fusion proteins containing part of doi.org/10.3390/ph14070632 the Trk protein have a constitutively active form of kinase that transduces deregulating signals.
    [Show full text]
  • HSP90 Is Necessary for the ACK1-Dependent Phosphorylation of STAT1 and MARK STAT3
    Cellular Signalling 39 (2017) 9–17 Contents lists available at ScienceDirect Cellular Signalling journal homepage: www.elsevier.com/locate/cellsig HSP90 is necessary for the ACK1-dependent phosphorylation of STAT1 and MARK STAT3 Nisintha Mahendrarajaha, Marina E. Borisovab, Sigrid Reichardtc, Maren Godmannc, Andreas Sellmerd, Siavosh Mahboobid, Andrea Haitele, Katharina Schmidf, Lukas Kennere,g,h, ⁎ Thorsten Heinzelc, Petra Belib, Oliver H. Krämera, a Department of Toxicology, University Medical Center, Obere Zahlbacher Str. 67, 55131 Mainz, Germany b Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz, Germany c Center for Molecular Biomedicine (CMB), Institute for Biochemistry, Friedrich-Schiller University Jena, Hans-Knöll Str. 2, 07745 Jena, Germany d Institute of Pharmacy, Faculty of Chemistry and Pharmacy, University of Regensburg, 93040 Regensburg, Germany e Department of Pathology, Medical University of Vienna, Waehringer Guertel 18-20, 1090 Vienna, Austria f Institute of Anatomy and Experimental Morphology, University of Hamburg-Eppendorf, Martinistraße 52, 20251 Hamburg, Germany g Department of Laboratory Animal Pathology, University of Veterinary Medicine, Veterinaerplatz 1, 1210 Vienna, Austria h Ludwig Boltzmann Institute for Cancer Research, Waehringerstrasse 13A, 1090 Vienna, Austria ARTICLE INFO ABSTRACT Keywords: Signal transducers and activators of transcription (STATs) are latent, cytoplasmic transcription factors. Janus ACK1 kinases (JAKs) and activated CDC42-associated kinase-1 (ACK1/TNK2) catalyse the phosphorylation of STAT1 HSP90 and the expression of its target genes. Here we demonstrate that catalytically active ACK1 promotes the phos- Lung cancer phorylation and nuclear accumulation of STAT1 in transformed kidney cells. These processes are associated with SIAH2 STAT1-dependent gene expression and an interaction between endogenous STAT1 and ACK1.
    [Show full text]
  • The Non-Receptor Tyrosine Kinase TNK2/ACK1 Is a Novel Therapeutic Target in Triple Negative Breast Cancer
    www.impactjournals.com/oncotarget/ Oncotarget, 2017, Vol. 8, (No. 2), pp: 2971-2983 Research Paper The non-receptor tyrosine kinase TNK2/ACK1 is a novel therapeutic target in triple negative breast cancer Xinyan Wu1,2,*, Muhammad Saddiq Zahari1,2,*, Santosh Renuse1,2,5, Dhanashree S. Kelkar1,2, Mustafa A. Barbhuiya2, Pamela L. Rojas1,2, Vered Stearns3, Edward Gabrielson3,4, Pavani Malla6, Saraswati Sukumar3, Nupam P. Mahajan6,7, Akhilesh Pandey1,2,3,4 1Department of Biological Chemistry, Johns Hopkins University School of Medicine Baltimore, MD 21205, U.S.A 2McKusick-Nathans Institute of Genetic Medicine, Johns Hopkins University School of Medicine Baltimore, MD 21205, U.S.A 3Department of Oncology, Johns Hopkins University School of Medicine Baltimore, MD 21205, U.S.A 4Department of Pathology, Johns Hopkins University School of Medicine Baltimore, MD 21205, U.S.A 5Institute of Bioinformatics, International Technology Park, Bangalore, 560066, India 6Department of Drug Discovery, Moffitt Cancer Center, Tampa, FL 33612, U.S.A 7Department of Oncologic Sciences, University of South Florida, Tampa, FL 33612, U.S.A *These authors have contributed equally to this work Correspondence to: Xinyan Wu, email: [email protected] Nupam P. Mahajan, email: [email protected] Akhilesh Pandey, email: [email protected] Keywords: TNK2, triple negative breast cancer, tyrosine kinase, phosphorylation Received: March 11, 2016 Accepted: October 10, 2016 Published: November 25, 2016 ABSTRACT Breast cancer is the most prevalent cancer in women worldwide. About 15-20% of all breast cancers do not express estrogen receptor, progesterone receptor or HER2 receptor and hence are collectively classified as triple negative breast cancer (TNBC).
    [Show full text]
  • Abl P210 and P190 Kinases in Leukemia Cells Defined By
    OPEN Leukemia (2017) 31, 1502–1512 www.nature.com/leu ORIGINAL ARTICLE Differential signaling networks of Bcr–Abl p210 and p190 kinases in leukemia cells defined by functional proteomics S Reckel1, R Hamelin2, S Georgeon1, F Armand2, Q Jolliet2, D Chiappe2, M Moniatte2 and O Hantschel1 The two major isoforms of the oncogenic Bcr–Abl tyrosine kinase, p210 and p190, are expressed upon the Philadelphia chromosome translocation. p210 is the hallmark of chronic myelogenous leukemia, whereas p190 occurs in the majority of B-cell acute lymphoblastic leukemia. Differences in protein interactions and activated signaling pathways that may be associated with the different diseases driven by p210 and p190 are unknown. We have performed a quantitative comparative proteomics study of p210 and p190. Strong differences in the interactome and tyrosine phosphoproteome were found and validated. Whereas the AP2 adaptor complex that regulates clathrin-mediated endocytosis interacts preferentially with p190, the phosphatase Sts1 is enriched with p210. Stronger activation of the Stat5 transcription factor and the Erk1/2 kinases is observed with p210, whereas Lyn kinase is activated by p190. Our findings provide a more coherent understanding of Bcr–Abl signaling, mechanisms of leukemic transformation, resulting disease pathobiology and responses to kinase inhibitors. Leukemia (2017) 31, 1502–1512; doi:10.1038/leu.2017.36 INTRODUCTION experimental conditions, the expression of p190 lead to a disease The Bcr–Abl kinase and its inhibitors (imatinib and successors) are with a shorter latency and more B-ALL, whereas p210 mice 9,11–13 a paradigm for targeted cancer therapy.1 Bcr–Abl is a constitu- developed CML-like leukemias.
    [Show full text]
  • Amplification of the Human Epidermal Growth Factor Receptor 2 (HER2) Gene Is Associated with a Microsatellite Stable Status in Chinese Gastric Cancer Patients
    387 Original Article Amplification of the human epidermal growth factor receptor 2 (HER2) gene is associated with a microsatellite stable status in Chinese gastric cancer patients He Huang1#, Zhengkun Wang2#, Yi Li2, Qun Zhao3, Zhaojian Niu2 1Department of Gastrointestinal Surgery, The First Hospital of Shanxi Medical University, Shanxi, China; 2Department of Gastrointestinal Surgery, The Affiliated Hospital of Qingdao University, Qingdao, China; 3Department of Gastrosurgery, The Fourth Hospital of Hebei Medical University, Shijiazhuang, China Contributions: I) Conception and design: Z Niu, Q Zhao, H Huang; (II) Administrative support: Z Niu, H Huang, Z Wang; (III) Provision of study materials or patients: All authors; (IV) Collection and assembly of data: Z Wang, Q Zhao; (V) Data analysis and interpretation: Z Niu, H Huang; (VI) Manuscript writing: All authors; (VII) Final approval of manuscript: All authors. #These authors contributed equally to this work. Correspondence to: Zhaojian Niu. Department of Gastrointestinal Surgery, The Affiliated Hospital of Qingdao University, No. 16, Jiangsu Road, Shinan District, Qingdao 260003, China. Email: [email protected]; Qun Zhao. Department of Gastrosurgery, The Fourth Hospital of Hebei Medical University, No. 12 Jiankang Road, Shijiazhuang 050011, China. Email: [email protected]. Background: Gastric cancer (GC) is one of the most common cancers worldwide. However, little is known about the combination of HER2 amplification and microsatellite instability (MSI) status in GC. This study aimed to analyze the correlation of HER2 amplification with microsatellite instability (MSI) status, clinical characteristics, and the tumor mutational burden (TMB) of patients. Methods: A total of 192 gastric cancer (GC) patients were enrolled in this cohort. To analyze genomic alterations (GAs), deep sequencing was performed on 450 target cancer genes.
    [Show full text]
  • Downloads.Action)
    bioRxiv preprint doi: https://doi.org/10.1101/259192; this version posted February 2, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. INKA, an integrative data analysis pipeline for phosphoproteomic inference of active phosphokinases Thang V. Pham1,2, Robin Beekhof1,2, Carolien van Alphen1,2, Jaco C. Knol1, Alex A. Henneman1, Frank Rolfs1, Mariette Labots1, Evan Henneberry1, Tessa Y.S. Le Large1, Richard R. de Haas1, Sander R. Piersma1, Henk M.W. Verheul1, Connie R. Jimenez1 * 1 OncoProteomics Laboratory, Department of Medical Oncology, Cancer Center Amsterdam, VU University Medical Center, De Boelelaan 1117, 1081 HV Amsterdam, The Netherlands 2 These authors contributed equally to this work * Correspondence should be addressed to C.R.J. ([email protected]) Running Title: Integrative tool ranks active kinases Character Count: 50,356 1 bioRxiv preprint doi: https://doi.org/10.1101/259192; this version posted February 2, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Abstract 2 3 Identifying (hyper)active kinases in cancer patient tumors is crucial to enable individualized 4 treatment with specific inhibitors. Conceptually, kinase activity can be gleaned from global 5 protein phosphorylation profiles obtained with mass spectrometry-based phosphoproteomics. A 6 major challenge is to relate such profiles to specific kinases to identify (hyper)active kinases that 7 may fuel growth/progression of individual tumors. Approaches have hitherto focused on 8 phosphorylation of either kinases or their substrates.
    [Show full text]
  • Entry by Multiple Picornaviruses Is Dependent on a Pathway That Includes TNK2, WASL, and NCK1 Hongbing Jiang*, Christian Leung, Stephen Tahan, David Wang*
    RESEARCH ARTICLE Entry by multiple picornaviruses is dependent on a pathway that includes TNK2, WASL, and NCK1 Hongbing Jiang*, Christian Leung, Stephen Tahan, David Wang* Department of Molecular Microbiology, Pathology and Immunology, School of Medicine, Washington University, St. Louis, United States Abstract Comprehensive knowledge of the host factors required for picornavirus infection would facilitate antiviral development. Here we demonstrate roles for three human genes, TNK2, WASL, and NCK1, in infection by multiple picornaviruses. CRISPR deletion of TNK2, WASL, or NCK1 reduced encephalomyocarditis virus (EMCV), coxsackievirus B3 (CVB3), poliovirus and enterovirus D68 infection, and chemical inhibitors of TNK2 and WASL decreased EMCV infection. Reduced EMCV lethality was observed in mice lacking TNK2. TNK2, WASL, and NCK1 were important in early stages of the viral lifecycle, and genetic epistasis analysis demonstrated that the three genes function in a common pathway. Mechanistically, reduced internalization of EMCV was observed in TNK2 deficient cells demonstrating that TNK2 functions in EMCV entry. Domain analysis of WASL demonstrated that its actin nucleation activity was necessary to facilitate viral infection. Together, these data support a model wherein TNK2, WASL, and NCK1 comprise a pathway important for multiple picornaviruses. Introduction Picornaviruses cause a wide range of diseases including the common cold, hepatitis, myocarditis, *For correspondence: [email protected] (HJ); poliomyelitis, meningitis, and encephalitis (Melnick, 1983). Although vaccines exist for poliovirus [email protected] (DW) and hepatitis A virus, there are currently no FDA approved antivirals against picornaviruses in the United States. As obligate intracellular pathogens, viruses are dependent on the host cellular Competing interests: The machinery to complete their lifecycle.
    [Show full text]
  • Human Breast Cancer Associated Fibroblasts Exhibit Subtype Specific
    Tchou et al. BMC Medical Genomics 2012, 5:39 http://www.biomedcentral.com/1755-8794/5/39 RESEARCH ARTICLE Open Access Human breast cancer associated fibroblasts exhibit subtype specific gene expression profiles Julia Tchou1*, Andrew V Kossenkov2, Lisa Chang2, Celine Satija1, Meenhard Herlyn2, Louise C Showe2† and Ellen Puré2† Abstract Background: Breast cancer is a heterogeneous disease for which prognosis and treatment strategies are largely governed by the receptor status (estrogen, progesterone and Her2) of the tumor cells. Gene expression profiling of whole breast tumors further stratifies breast cancer into several molecular subtypes which also co-segregate with the receptor status of the tumor cells. We postulated that cancer associated fibroblasts (CAFs) within the tumor stroma may exhibit subtype specific gene expression profiles and thus contribute to the biology of the disease in a subtype specific manner. Several studies have reported gene expression profile differences between CAFs and normal breast fibroblasts but in none of these studies were the results stratified based on tumor subtypes. Methods: To address whether gene expression in breast cancer associated fibroblasts varies between breast cancer subtypes, we compared the gene expression profiles of early passage primary CAFs isolated from twenty human breast cancer samples representing three main subtypes; seven ER+, seven triple negative (TNBC) and six Her2+. Results: We observed significant expression differences between CAFs derived from Her2+ breast cancer and CAFs from TNBC and ER + cancers, particularly in pathways associated with cytoskeleton and integrin signaling. In the case of Her2+ breast cancer, the signaling pathways found to be selectively up regulated in CAFs likely contribute to the enhanced migration of breast cancer cells in transwell assays and may contribute to the unfavorable prognosis of Her2+ breast cancer.
    [Show full text]
  • Potentiating Therapeutic Effects of Epidermal Growth Factor Receptor Inhibition in Triple-Negative Breast Cancer
    pharmaceuticals Review Potentiating Therapeutic Effects of Epidermal Growth Factor Receptor Inhibition in Triple-Negative Breast Cancer Kyu Sic You 1,2,† , Yong Weon Yi 3,† , Jeonghee Cho 3 , Jeong-Soo Park 1,* and Yeon-Sun Seong 1,2,3,* 1 Department of Biochemistry, College of Medicine, Dankook University, Cheonan 31116, Chungcheongnam-do, Korea; [email protected] 2 Graduate School of Convergence Medical Science, Dankook University, Cheonan 3116, Chungcheongnam-do, Korea 3 Department of Nanobiomedical Science, Dankook University, Cheonan 31116, Chungcheongnam-do, Korea; [email protected] (Y.W.Y.); [email protected] (J.C.) * Correspondence: [email protected] (J.-S.P.); [email protected] (Y.-S.S.); Tel.: +82-41-550-3876 (J.-S.P.); +82-41-550-3875 (Y.-S.S.) † These authors contributed equally to this work. Abstract: Triple-negative breast cancer (TNBC) is a subset of breast cancer with aggressive charac- teristics and few therapeutic options. The lack of an appropriate therapeutic target is a challenging issue in treating TNBC. Although a high level expression of epidermal growth factor receptor (EGFR) has been associated with a poor prognosis among patients with TNBC, targeted anti-EGFR therapies have demonstrated limited efficacy for TNBC treatment in both clinical and preclinical settings. However, with the advantage of a number of clinically approved EGFR inhibitors (EGFRis), combi- nation strategies have been explored as a promising approach to overcome the intrinsic resistance of TNBC to EGFRis. In this review, we analyzed the literature on the combination of EGFRis with Citation: You, K.S.; Yi, Y.W.; Cho, J.; other molecularly targeted therapeutics or conventional chemotherapeutics to understand the current Park, J.-S.; Seong, Y.-S.
    [Show full text]