Isolation and Characterization of an Agarase-Producing Bacterial Strain, Alteromonas Sp

J. Microbiol. Biotechnol. (2012), 22(12), 1621–1628 http://dx.doi.org/10.4014/jmb.1209.08087 First published online September 21, 2012 pISSN 1017-7825 eISSN 1738-8872

Isolation and Characterization of an Agarase-Producing Bacterial Strain, Alteromonas sp. GNUM-1, from the West Sea, Korea

Kim, Jonghee1 and Soon-Kwang Hong2*

1Department of Food and Nutrition, Seoil University, Seoul 131-702, Korea 2Division of Bioscience and Bioinformatics, Myongji University, Yongin 449-728, Korea Received: September 3, 2012 / Revised: September 7, 2012 / Accepted: September 8, 2012

The agar-degrading bacterium GNUM-1 was isolated Keywords: Agarase, Alteromonas, agar degradation, Sargassum from the brown algal species Sargassum serratifolium, serratifolium which was obtained from the West Sea of Korea, by using the selective artificial seawater agar plate. The cells were Gram-negative, 0.5-0.6 µm wide and 2.0-2.5 µm long Agar, which is extracted mainly from marine red algae curved rods with a single polar flagellum, forming non- (including Gelidium and Gracilaria spp.), is a mixture of pigmented, circular, smooth colonies. Cells grew at 20oC- o heterogeneous galactans composed mainly of 3,6-anhydro- 37 C, between pH 5.0 and 9.0, and at 1-10% (w/v) NaCl. L-galactose and D-galactose units alternately linked by α- The DNA G+C content of the GNUM-1 strain was 45.5 (1,3) and β-(1,4) linkages [2, 8]. It is a major cell-wall mol%. The 16S rRNA sequence of the GNUM-1 was very component in red algae and has been used in various similar to those of Alteromonas stellipolaris LMG 21861 laboratory and industrial applications, owing to its gelation (99.86% sequence homology) and Alteromonas addita T properties. Therefore, efficient degradation of polysaccharides R10SW13 (99.64% sequence homology), which led us to in the cell wall of seaweeds is a prerequisite for marine assign it to the genus Alteromonas. It showed positive biomass utilization [20]. Many microorganisms that can activities for agarase, amylase, gelatinase, alkaline phosphatase, hydrolyze and metabolize agar as a carbon and energy esterase (C8), lipase (C14), leucine arylamidase, valine source have been identified in seawater, marine sediments, arylamidase, α-chymotrypsin, acid phosphatase, naphthol- and soil. Agarolytic microorganisms commonly produce AS-BI-phosphohydrolase, α-galactosidase, β-galactosidase, agarases, which catalyze the hydrolysis of agar. β-glucosidase, catalase, and urease. It can utilize citrate, Agarases that hydrolyze the glycosidic bonds of agarose malic acid, and trisodium citrate. The major fatty acids are generally grouped into 2 types on the basis of their ω were summed feature 3 (21.5%, comprising C16:1 7c/iso- mode of action on agarose; α-agarases cleave the α-1,3 C15:0 2-OH) and C16:0 (15.04%). On the basis of the linkage, whereas β-agarases cleave the β-1,4 linkage of variations in many biochemical characteristics, GNUM-1 agarose [5]. A number of agar-hydrolyzing bacteria have was considered as unique and thus was named Alteromonas been isolated from marine and other environments, and sp. GNUM-1. It produced the highest agarase activity in several agarases have been purified and characterized in modified ASW medium containing 0.4% sucrose, but the past decade from these isolates, including those belonging lower activity in rich media despite superior growth, to the genera Alteromonas [18, 25, 37], Cytophaga [33], implying that agarase production is tightly regulated and Microscilla [40], Pseudoalteromonas [36], Pseudomonas repressed in a rich nutrient condition. The 30 kDa protein [24], and Streptomyces [30, 31]. with agarase activity was identified by zymography, and During screening of agar-hydrolyzing bacteria, the this report serves as the very first account of such a GNUM-1 strain was isolated, using an artificial seawater protein in the genus Alteromonas. (ASW) agar medium, from the marine algae Sargassum serratifolium, obtained from the West Sea of Korea. This *Corresponding author Phone: +82-31-330-6198; Fax: +82-31-335-8249; report describes the characteristics of the GNUM-1 strain E-mail: [email protected] as a species of the genus Alteromonas, and yield improvement 1622 Kim and Hong of agarase production through the optimization of the Tool (BLAST) program [1] and registered as JN578476. The 16S composition of its culture medium. rRNA gene sequences of the related type strains were obtained from the EzTaxon server (http://www.eztaxon.org [7]). Multiple sequence alignment of the most closely related Alteromonas species was carried out using ClustalW [32] and 5'- and 3'-gaps were edited using MATERIALS AND METHODS the BioEdit program [11]. Neighbor-joining (NJ) [27] and maximum Chemicals parsimony methods [15] from the PHYLIP suit program [9] were used to construct phylogenetic trees. Bootstrap analysis was used to Agar and agarose were purchased from Amresco Inc., USA and evaluate the tree topology of the NJ data, performing 1,000 replicates Takara Shuzo Inc., Japan, respectively. All other chemicals were and marked into branching points. The evolutionary distance matrix purchased from Sigma Chemical Co., USA. was estimated using the Kimura’s 2-parameter model [13]. Isolation of Agarase-Producing Microorganisms Phenotypic and Biochemical Characteristics The agarase-producing strain was isolated from S. serratifolium collected in Asan Bay, which is located near the West Sea in Korea. Gram staining was performed using the standard reaction and was S. serratifolium was dissected into 5 mm sections and placed in confirmed by using the KOH test [19]. Colony morphology was observed on ASW-YP after incubation at 28oC for 3 days. Growth bottles containing 250 ml of sterile seawater. The solution was then o o vortexed thoroughly and the supernatant was spread on an artificial at different temperatures (between 4 C and 40 C), pH range (between - seawater (ASW) agar plate [4] containing 6.1 g Tris base (pH 7.2), pH 4 and 10 at intervals of 1 pH unit), and NaCl concentrations [0 15% (w/v)] were determined after 3 days of incubation at 28oC. To 12.3 g MgSO4, 0.74 g KCl, 0.13 g (NH4)2HPO4, 17.5 g NaCl, 0.14 g o test for antibacterial activity, Escherichia coli and Bacillus subtilis CaCl2, and 15 g agar per liter. After incubation at 28 C for 2 weeks, Lugol’s iodine solution (25 g of iodine and 50 g of potassium iodine were used as the reference strains for Gram-negative and Gram- in 1,000 ml of distilled water) was poured onto the plate to detect positive bacteria, respectively. After culturing for 3 days, each indicator strain was overlaid on the surface of the colony. Protein agarase activity. Each colony selected as the candidate for agarase o producer was streaked on a modified ASW (ASW-YP) plate hydrolysis was determined after 3 days of incubation at 28 C on supplemented with 0.3% of bacto-peptone and 0.02% of yeast ASW-YP plate supplemented with 1% gelatin as a substrate. extract, and the plate was incubated at 28oC for several days. A Productions of cellulase, xylanase, and amylase were tested by single colony was then picked and transferred again onto a new adding 0.3% cellulose azure, 0.3% xylan azure, and 0.3% starch ASW-YP plate. The same procedure was repeated for colony isolation azure by using the same method as that used for the analysis of several times until a pure culture was obtained. gelatin hydrolysis. Biochemical characteristics were observed using the API 20NE and API ZYM kits (bioMérieux, France) according Determination of Agarase Activity to the manufacturer’s instructions. Antibiotics susceptibility was All experiments after sampling were performed at 4oC unless otherwise determined by the paper disk-diffusion method, in which a paper µ mentioned. Agarase activity was indirectly measured by the release disk was immersed in 30 l of each stock solution. of the reducing sugar equivalent using the dinitrosalicylic acid µ Chemotaxonomic Characteristics (DNS) method [22]. A 100- l volume of the sample was mixed o with 3.9 ml of reaction buffer (20 mM Tris-Cl, pH 8.0) containing The isolate was cultured on ASW-YP agar at 28 C for 48 h. Major 0.2% of agarose and incubated at 40oC. After incubation for 30 min, respiratory quinone was analyzed by reverse-phase HPLC as DNS was added to the reaction solution. The reaction samples were described elsewhere [16]. Cellular fatty acids were extracted heated at 100oC for 5 min and then cooled to room temperature, according to the standard protocol of the Microbial Identification measuring the amount of reducing sugar released by agarase using a System (MIDI) and identified by gas chromatography using the spectrophotometer (Genesys 8; Spectronic Unicam Inc., France) at a Microbial Identification software package [28]. DNA G+C content wavelength of 540 nm. Because the culture broth has its own was determined by reverse-phase HPLC as described elsewhere [21]. characteristic color and absorbance at 540 nm, the OD540 (optical density at 600 nm) of the reaction solution before incubation was subtracted from that after incubation. Specific agarase activity was Medium Optimization for Agarase Production calculated as the observed agarase activity per unit cell density To establish the optimal culture media that supports the highest (OD540/OD600) using the described culture conditions. agarase production and cell growth of microbial strains, the ASW- YP medium was modified, especially in carbon source. Five kinds 16S rRNA Sequencing and Construction of Phylogenetic Tree of carbon source (agar, starch, sucrose, glucose, and maltose) were To identify the phylogenetic position of the agarase-producing added to the original ASW-YP medium at various final concentrations strain, 16S rRNA sequencing was performed at Genotech Inc. ranging from 0.1% to 0.4%, respectively. Finally, various types of (Daejeon, Korea) with the Applied Biosystems 3730xl DNA Analyzer. media including the modified ASW-YP were tested for the The primers used for 16S rRNA sequencing were as follows: 5'- cultivation of the isolate. TCCTGGCTCAGAACGCTGGCGGCTGCTTAACACATGCAAG TCAGAACGATGAAGCC-3' (forward) and 5'-CCTGGCTCAGAT Zymogram of Agarase Activity TGAACGCTGGCGGCAGGCCTAACACATTCAAGTCGAATCG For zymography, the native protein sample was subjected to 0.1% GAAACATG-3' (reverse). The resulting 16S rRNA gene sequence sodium dodecyl sulfate–10% polyacrylamide gel electrophoresis was submitted to GenBank using the Basic Local Alignment Search (SDS-PAGE) [17] precasted with 0.5% (w/v) agarose. After AN AGARASE-PRODUCING BACTERIAL STRAIN, ALTEROMONAS SP. GNUM-1 1623

Fig. 1. Agarolytic activity of the GNUM-1 strain isolated from a marine algae, Sargassum serratifolium. (A) Detection of agarolytic activity depending on the cultivation time on the agar plate. The strain was cultured on ASW-YP agar plate, and Lugol’s iodine solution was overlaid to detect reducing sugars, which the degraded product formed by the action of agarase on agar. (B) A colony of the GNUM-1 strain. (C) Transmission electron microscopy (TEM) of GNUM-1. The bacterial colonies were picked after 2 days of culture on the agar plate and then examined by TEM after negative staining with 1% phosphotungstic acid. The polar flagellum is indicated by the arrow. Bar, 0.5 µm. electrophoresis, the gel was soaked in 2.5% (w/v) Triton X-100 for Phylogenetic Analysis of the GNUM-1 Strain 30 min, washed in buffer B (20 mM Tris-Cl, pH 8.0) for 30 min, The almost-complete 16S rRNA gene sequence (1,434 bp) and then further incubated at 40oC for 3 h in the same buffer. The of strain GNUM-1 was determined (GenBank Accession gel was stained with Lugol’s iodine solution and submerged in 0.5% No. JN578476). Phylogenetic analysis revealed that the (w/v) acetic acid. closest relatives of this isolate were A. stellipolaris LMG 21861T [34], A. addita R10SW13T [12], Alteromonas macleodii DSM6062T [26], Alteromonas marina SW-47T RESULTS AND DISCUSSION [38], Alteromonas litorea TF-22T [39], and Alteromonas hispanica F-32T [19], with 16S rRNA gene sequence Isolation of the Agar-Hydrolyzing Strain, GNUM-1 similarities of 99.86%, 99.64%, 98.09%, 98.00%, 97.58%, After incubation of the solution extracted from S. and 97.51%, respectively (Table 1). Reconstruction of the serratifolium on ASW agar plates containing agar as the phylogenetic tree also showed that the GNUM-1 strain o sole carbon source for 2 weeks at 28 C, several microbial clustered with the Alteromonas species and that this cluster colonies were obtained. The strains were transferred onto a was strongly supported by a bootstrap value of 99% (Fig. 2). o new ASW agar plate and grown at 28 C for several days, The results of the comparative 16S rRNA gene sequence after which the plate was stained using a Lugol’s solution analysis clearly demonstrated that the GNUM-1 strain is a overlay to check the agar-hydrolyzing ability (Fig. 1A). member of the genus Alteromonas. Among the colonies showing agar hydrolysis, one colony that formed a circular soft pit without color on the agar Phenotypic and Biochemical Analyses of Strain GNUM-1 plate surface was selected and considered to be the Cells were found to be Gram-negative, 0.5-0.6 µm wide GNUM-1 strain (Fig. 1B). and 2.0-2.5 µm long curved rods. A single polar flagellum

Table 1. 16S rRNA gene nucleotide sequence similarity between strain GNUM-1 (1,434 bases) and its homologs. Bacterial species (Accesion No. in GenBank) Similarity (%) Gene size (bases) References T Alteromonas stellipolaris LMG21861 (AJ295715) 99.857 1,482 [34] Alteromonas addita R10SW13T (AY682202) 99.642 1,466 [12] T Alteromonas macleodii DSM6062 (Y18228) 98.089 1,492 [26] T Alteromonas marina SW-47 (AF529060) 98.003 1,489 [38] Alteromonas litorea TF-22T (AY428573) 97.584 1,456 [39] T Alteromonas hispanica F-32 (AY926460) 97.512 1,479 [19] T Alteromonas tagae BCRC17571 (DQ836765) 97.157 1,479 [6] Alteromonas genovensis LMG24078T (AM885866) 97.002 1,501 [35] T Alteromonas simiduii BCRC17572 (DQ836766) 96.043 1,391 [6] T Alteromonas halophita JSM073008 (EU583725) 95.389 1,445 [3] Aestuariibacter aggregatus WH169T (FJ847832) 94.963 1,232 [37] 1624 Kim and Hong

Fig. 2. Neighbor-joining phylogenetic dendrogram based on 16S rRNA sequences showing the relationships between the GNUM-1 strain and related taxa. Alteromonas stellipolaris LMG 21861T was used as an out-group. Numbers at nodes are bootstrap percentages (based on 1,000 replicates). Only bootstrap values greater than 50% are shown at branch points. Bar, 0.005 substitutions per nucleotide position. was observed by transmission electron microscopy analysis On the basis of the results of the phenotypic and after negative staining (Fig. 1C). Circular, smooth, non- phylogenetic studies, it is clear that the GNUM-1 strain pigmented colonies measuring 2 mm in diameter were belongs to the genus Alteromonas. However, it could be formed after growth on ASW-YP agar plates at 28oC for clearly distinguished from the recognized Alteromonas 3 days. Cells showed growth at 20oC-37oC (optimum range: species on the basis of biochemical traits: the ability to 25oC-35oC) but not at 4oC or 40oC. Growth occurred at hydrolyze agar and produce acid from various carbon between pH 5.0 and 9.0 (optimum range: 6.0-8.0), but not resources. Thus, on the basis of the phenotypic and at pH 4.0 and pH 10.0. NaCl was required for their growth. genotypic characteristics, the GNUM-1 strain is considered Growth occurred at 1-10% (w/v) NaCl (optimum range: a variant strain of the genus Alteromonas. 2-4%), but not at 0% and 15% (Table 2). Cells showed moderate susceptibility to chloramphenicol Improvement of Agarase Production by Optimizing but resistance to ampicillin, apramycin, and neomycin. Medium Composition Positive activities were detected for the assays for agarase, Although ASW-YP liquid medium was used for the amylase, gelatinase, alkaline phosphatase, esterase (C8), production of agarase from the GNUM-1 strain in the lipase (C14), leucine arylamidase, valine arylamidase, α- preliminary experiment, we used a modified medium, chymotrypsin, acid phosphatase, naphthol-AS-BI- specifically modifying the carbon sources for better phosphohydrolase, α-galactosidase, β-galactosidase, β- agarase production. Among the tested carbon sources (i.e., glucosidase, catalase, and urease. Negative activities were agar, starch, sucrose, maltose, and glucose) at various detected for the assays for cellulase, esterase (C4), cystine concentrations, the addition of 0.4% (final concentration) arylamidase, trypsin, beta-glucuronidase, α-glucosidase, of sucrose gave the best result in agarase production and N-acetyl-beta-glucosaminidase, α-mannosidase, and α- cell growth (data not shown). Thus, the final modified fucosidase. Furthermore, positive responses were observed ASW-YPS containing 0.4% sucrose was used for fermentation for the utilization of citrate, malic acid, and trisodium of GNUM-1, and agarase production was compared with citrate, but negative for the utilization of D-glucose, those cultured in various media [i.e., ASW-YP, tryptic soya maltose, L-arabinose, D-mannose, D-mannitol, acetic acid, broth (TSB), Luria-Bertani (LB) broth, and nutrient broth potassium gluconate, capric acid, and phenylacetic acid (NB)]. (Table 2). The DNA G+C content of the GNUM-1 strain Use of the modified media demonstrated a considerable was 45.5 mol%. The major fatty acids (constituting 5% of advantage for microbial cultivation. In particular, remarkably the total cellular fatty acid composition) are summed higher agarolytic activities were observed in GNUM-1 feature 3 (21.5%, comprising C16:1ω7c/iso-C15:0 2-OH), grown in ASW-YPS than in other competitive media (Fig. 3). C16:0 (15.04%), C16:0 N alcohol (9.79%), C16:1ω7c This fact implies that the optimization of medium alcohol (6.91), C18:1ω7c (9.32), and 10-methyl C17:0 components resulted in the improvement in agarase (7.33) (Table 3). production of the GNUM-1 strain. Although cell growth in AN AGARASE-PRODUCING BACTERIAL STRAIN, ALTEROMONAS SP. GNUM-1 1625

Table 2. Phenotypic and biochemical characteristics of strain Table 2. Continued. GNUM-1 and its closely related type strains of genus Alteromonas. a a a Characteristic 1 2 3 Characteristic 1a 2a 3a Antibiotic susceptibility Pigments --- Kanamycin (50 ug) v ND ND Polar flagella + + + Neomycin (90 ug) - ND ND G+C content (mol%) 45.5 43.3 43 Ampicillin (100 ug) - ND ND Enzyme activity (with API 20NE kit, API ZYM kit, and assay) Apramycin (100 ug) - ND ND Agarase + + + Chloramphenicol (25 ug) + ND ND Amylase + + + Antibacterial activity against Cellulase - ND ND E. coli (Gram-negative) - ND ND Gelatinase + + + B. subtilis (Gram-positive) - ND ND Alkaline phosphatase + + ND a T Strains: 1, Alteromonas sp. GNUM-1; 2, A. stellipolaris LMG21861 [34]; Esterase (C4) - w ND 3, A. addita R10SW13T [12]. Esterase (C8) + w ND Symbols: +, positive; -, negative; ND, not detected/not mentioned; v, very Lipase (C14) + - ND weak positive; w, weak positive. Leucine arylamidase + + ND Valine arylamidase + w ND Cystine arylamidase - - ND Table 3. Cellular fatty acid compositions of strain GNUM-1 and Trypsin - w ND its closely related strains. Alpha-chymotrypsin + - ND Fatty acid 1a 2a 3a Acid phosphatase + + ND Straight-chain fatty acid: Naphthol-AS-BI-phosphohydrolase + + ND C12:0 2.87 - 1.0 Alpha-glucosidase - + ND C14:0 1.87 - 2.9 N-Acetyl-β-glucosaminidase - - + C15:0 1.96 - - Alpha-galactosidase + w ND C16:0 15.04 12.6 15.2 Beta-galactosidase + + ND C16:0 N alcohol 9.79 tr - Beta-glucosidae + - ND C17:0 2.09 - 2.0 Catalase + + + Hydroxy fatty acid: Oxidase - + + C10:0 3-OH 1.65 - 3.3 Urease + - ND C12:1 3-OH 1.17 - - Utilization of (20NE): C12:0 3-OH 1.48 - 1.9 Citrate + - ND Branched fatty acid: D-Glucose - + - Anteiso-C15:1 A1.60NDND Maltose - + + Unsaturated fatty acid: D-Mannitol - + - C15:1ω8c 1.76 - 2.7 Acetic acid - + + C16:1ω7c alcohol 6.91 tr 30.1 Malic acid + ND ND C17:1ω8c 3.62 9.4 4.1 Trisodium citrate + ND ND C18:1ω7c 9.32 18.0 11.7 Arabinose - - + Methyl fatty acid: Mannose - + + 10-Methyl C17:0 7.43 - - Growth at Summed features: 4oC--+ Sum 2* (C14:0 3-OH/iso-C16:1 I) 3.77 - - 37oC+++ Sum 3* (C16:1ω7c/iso-C15:0 2-OH) 21.5 27.3 - 40oC --- aStrains: 1, Alteromonas sp. GNUM-1; 2, A. stellipolaris LMG21861T [34]; pH 4 --- T 3, A. addita R10SW13 [12]. pH 5 + - - Symbols: -, not detected; tr, trace amount. pH 6 + + + pH 7 + + +

pH 8 + + + LB (OD600 = 0.27) was slightly higher than that in ASW- pH 9 w + + YPS (OD600 = 0.23, Fig. 3A), the specific agarase activity Growth in NaCl at (OD540/OD600) of GNUM-1 in ASW-YPS was 50-fold 0% --- higher than that in LB (Fig. 3B). 3% + + + When the extracellular protein prepared from the 10% + + + GNUM-1 culture broth was analyzed by SDS-PAGE and 15% - - - subsequent zymography, the protein with agarase activity 1626 Kim and Hong

was detected in the ASW-YPS culture broth but not in the LB broth, despite the observed similar growth patterns (Fig. C). The molecular mass of agarase was estimated to be 30 kDa, and its production was significantly influenced by the medium components. This study showed that the GNUM-1 strain isolated from the West Sea of Korea grows well in seawater-based medium (ASW) or that supplemented with yeast extract and peptone (ASW-YP). Because agar was the sole carbon source in the ASW medium, degradation of agar into an available carbon source such as monomeric or oligomeric sugars will be indispensable in its survival. Our data clearly showed that the GNUM-1 strain could degrade agar and grow well on solid or in liquid media by producing agarase. The phylogenetic tree based on 16s rRNA sequence analysis showed that strain GNUM-1 clustered with Alteromonas species, especially A. stellipolaris LMG 21861T [34] and A. addita R10SW13T [12], with a bootstrap value of 99%. However, studies on its biochemical phenotypes clearly revealed that it had different biochemical characteristics from those of A. stellipolaris LMG 21861T and A. addita R10SW13T, suggesting the GNUM-1 strain is a novel microorganism belonging to genus Alteromonas. Alteromonas is a genus of Proteobacteria found in seawater, either in the open ocean or in the coastal areas, which coincides with the GNUM-1 strain that was isolated from highly saline ocean waters. To date, a few agarases isolated from the genus Alteromonas have been identified. A β-agarase with a MW of 52 kDa, hydrolyzing agar into neoagarotetraose [O-3,6-anhydro-α-L-galactopyranosyl(1 → 3)-D-galactose]2 as the main product, was purified from Alteromonas sp. strain C-1 [18]. A novel β-agarase with MW of 82 kDa was purified from another agar-degrading alkalophilic bacterium, Alteromonas sp. E-1, isolated from soil [14]. This β-agarase hydrolyzed agarose into neoagarobiose [O-3,6-anhydro-α-L-galactopyranosyl(1→3)-D-galactose]. A β-agarase, with MW of 39.5 kDa, was also identified from marine Alteromonas sp. SY37-12 [37]. Interestingly, it hydrolyzed agar, yielding neoagarotetraose and neoagarohexaose [O-3,6-anhydro-α-L-galactopyranosyl(1→3)-D-galactose]3 as the main products. A rare α-agarase, with a MW of Fig. 3. Comparison of cell growth (A), agarase production (B), 180 kDa, was reported from Alteromonas agaralyticus and detection of agarase activity (C) in Alteromonas sp. GNUM- (Cataldi) comb. nov., strain GJ1B. This enzyme hydrolyzed 1 in various liquid media. agar into agarotetraose [O-D-galactopyranosyl-β(1→4)- (A) Comparison of cell growth in various media. Cell growth was α L measured spectrophotometrically at 600 nm. ○-○, NB; ●-●, LB; ■-■, 3,6-anhydro- - -galactose]2 and its gene was also cloned TSB; ▲-▲, modified ASW-YP; and ◆-◆, ASW-YP. (B) Comparison of [10, 25]. The agarase we detected from Alteromonas sp. agarase activity in various media. The agarolytic activity was expressed in GNUM-1 has a MW of ~30 kDa, suggesting that it is a specific activity (OD540/OD600). Black, white, dashed, and dotted bars novel agarase. indicate the cultivation time (1, 2, 3, and 4 days, respectively). ASW-YP containing 0.1% agar as the sole carbon source was used as the control. All We found that sucrose supported better growth of data are the average of 3 parallel replicates. (C) Detection of agarase by GNUM-1 and improved agarase production by 1.8-fold zymography. M, protein standard marker; lane 1, total extracellular protein when added to ASW-YP at a concentration of 0.4%. prepared from 4-day culture using the modified ASW-YP (ASW-YPS), Among the tested media, the LB complex media resulted lane 2, total extracellular protein prepared from 4-day culture using NB. The arrow indicates the protein with agarase activity. in the best growth of GNUM-1; however, ASW-YPS AN AGARASE-PRODUCING BACTERIAL STRAIN, ALTEROMONAS SP. GNUM-1 1627 produced specific agarase activity at least 50-fold higher identification of prokaryotes based on 16S ribosomal RNA gene than that of LB complex media. This observation implies sequences. Int. J. Syst. Evol. Microbiol. 57: 2259-2261. that agarase production in GNUM-1 is critically dependent 8. Duckworth, M. and W. Yaphe. 1971. Structure of agar. I. on the presence of agar and other carbon sources in the Fractionation of a complex mixture of polysaccharides. Carbohydr. 16: - medium, and thus, expression of its encoding gene(s) may Res. 189 197. 9. Felsenstein, J. 1993. PHYLIP (phylogeny inference package), be tightly regulated depending on the need to degrade agar. version 3.5c. Distributed by the author. Department of Genome It was reported that glucose suppressed, but agar stimulated, Sciences, University of Washington, Seatle, USA. transcription of agarase-encoding genes in Streptomyces 10. Flament, D., T. Barbeyron, M. Jam, P. Potin, M. Czjzek, B. coelicolor [29], coinciding with our results. These Kloareg, and G. Michel. 2007. Alpha-agarases define a new observations together with our results imply that tight family of glycoside hydrolases, distinct from beta-agarase regulation of agarase production may be widely adopted families. Appl. Environ. Microbiol. 73: 4691-4694. by the the agarolytic bacteria that can use agar as a carbon 11. Hall, T. A. 1999. BioEdit: A user-friendly biological sequence resource for growth. alignment editor and analysis program for Windows 95/98/NT. Therefore, the characterization of agarases in Alteromonas Nucleic Acids Symp. Ser. 41: 95-98. sp. GNUM-1 and their encoding genes should be further 12. Ivanova, E. P., J. P. Bowman, A. M. Lysenko, N. V. Zhukova, investigated. N. M. Gorshkova, A. F. Sergeev, and V. V. Mikhailov. 2005. Alteromonas addita sp. nov. Int. J. Syst. Evol. Microbiol. 55: 1065-1068. GenBank Accession Number 13. Kimura, M. 1983. The Neutral Theory of Molecular Evolution. The 16S rRNA gene sequence (1,434 bp) of strain GNUM-1 Cambridge Univesity Press, UK. was registered in GenBank under the accession number 14. Kirimura, K., N. Masuda, Y. Iwasaki, H. Nakagawa, R. JN578476. Kobayashi, and S. Usai. 1999. Purification and characterization of a novel β-agarase from an alkalophilic bacterium, Altermonas sp. E-1. J. Biosci. Bioeng. 87: 436-441. Acknowledgment 15. Kluge, A. G and F. S. Farris. 1969. Quantitative phyletics and the evolution of anurans. Syst. Zool. 18: 1-32. This work was supported by the 2011 Research Fund from 16. Komagata, K. and K. Suzuki. 1987. Lipid and cell-wall analysis 19: - Seoul University, Korea. in bacterial systematics. Methods Microbiol. 161 207. 17. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: 680-685. 18. Leon, O., L. Quintana, G. Peruzzzo, and J. C. Slebe. 1992. REFERENCES Purification and properties of an extracellular agarase from Alteromonas sp. strain C-1. Appl. Environ. Microbiol. 58: 4060- 1. Altschul, S. F., T. L. Madden, A. A. Schaffer, J. Zhang, A. 4063. Zhang, W. Miller, and D. J. Lipman. 1997. Gapped BLAST and 19. Martinez-Checa, F., W. Bejar, I. Llamas, A. del Moral, and E. PSI-BLAST: A new generation of protein data base. Nucleic Quesda. 2005. Alteromonas hispanica sp. nov., a polyunsaturated- 25: - Acids Res. 3389 3402. fatty-acid-producing, halophilic bacterium isolated from Fuente 2. Araki, C. H. 1937. Acetylation of agar like substance of de Piedra, southern Spain. Int. J. Syst. Evol. Microbiol. 55: 58: - Gelidium amansii. J. Chem. Soc. 1338 1350. 2385-2390. 3. Chen, Y. G., H. D. Xiao, S. K. Tang, Y. Q. Zhang, E. 20. McCandless, E. 1981. Polysaccharides of the seaweeds, pp. Borrathybay, X. L. Cui, et al. 2009. Alteromonas halophila sp. 559-588. In C. Lobban and M. Wynne (eds.). The Biology of nov., a new moderately halophilic bacterium isolated from a sea Seaweeds. University of California Press, Berkeley, USA. 96: - anemone. Antonie Van Leeuwenhoek 259 366. 21. Mesbah, M., U. Premachandran, and W. B. Whitman. 1989. 4. Chi, W. J., D. Y. Park, S. C. Jeong, Y. K. Chang, and S. K. Precise measurement of the G+C content of deoxyribonucleic Hong. 2011. Isolation and characterization of starch-hydrolyzing acid by high-performance liquid chromatography. Int. J. Syst. Pseudoalteromonas sp. A-3 from the coastal sea water of Bacteriol. 39: 159-167. Daecheon, Republic of Korea. Kor. J. Microbiol. Biotechnol. 22. Miller, G. L. 1959. Use of dinitrosalicylic acid reagent for 39: - 317 323. determination of reducing sugar. Anal. Chem. 31: 426-428. 5. Chi, W. J., Y. K. Chang, and S. K. Hong. 2012. Agar 23. Moaledj, K. 1986. Comparison of Gram-staining and alternate degradation by microorganisms and agar-degrading enzymes. methods, KOH test and aminopeptidase activity in aquatic 94: - Appl. Microbiol. Biotechnol. 917 930. bacteria: Their application to numerical taxonomy. J. Microbiol. 6. Chiu, H. H., W. Y. Shieh, S. Y. Lin, C. M. Tseng, P. W. Chiang, Methods 5: 303-310. and I. Wagner-Dobler. 2007. Alteromonas tagae sp. nov. and 24. Morrice, L. M., M. W. McLean, F. B. Williamson, and W. F. Alteromonas simiduii sp. nov., mercury-resistant bacteria Long. 1983. Beta-agarases I and II from Pseudomonas atlantica. isolated from a Taiwanese estuary. Int. J. Syst. Evol. Microbiol. Purifications and some properties. Eur. J. Biochem. 135: 553- 57: - 1209 1216. 558. 7. Chun, J. S., J. H. Lee, Y. Y. Jung, M. J. Kim, S. I. Kim, B. K. 25. Potin, P., C. Richard, C. Rochas, and B. Kloareg. 1993. Kim, and Y. W. Lim. 2007. Extaxon: A web-based tool for the Purification and characterization of the α-agarase from Alteromonas 1628 Kim and Hong

agaralyticus (Cataldi) comb. nov., strain GJ1B. Eur. J. Biochem. 34. Van Trappen, S., T. L. Tan, J. Yang, J. Mergaert, and J. Swings. 214: 599-607. 2004. Alteromonas stellipolaris sp. nov., a novel, budding, 26. Pukall, R., O. Paeuker, D. Buntefuss, G. Ulrichs, P. Lebaron, L. prosthecate bacterium from Antarctic seas, and emended Bernard, et al. 1999. High sequence diversity of Alteromonas description of the genus Alteromonas. Int. J. Syst. Evol. Microbiol. macleodii-related cloned and cellular 16s rDNAs from a 54: 1157-1163. Mediterranean seawater mesocosm experiment. FEMS Microbiol. 35. Vandecandelaere, I., O. Nercessian, E. Segaert, W. Achouak, A. Ecol. 28: 335-344. Mollica, M. Faimali, et al. 2008. Alteromonas genovensis sp. 27. Saitou, N. and M. Nei. 1987. The neighbor-joining method: A nov., isolated from a marine electroactive biofilm and emended new method for reconstructing phylogenetic trees. Mol. Biol. description of Alteromonas macleodii Baumann et al. 1972 Evol. 4: 406-425. (approved lists 1980). Int. J. Syst. Evol. Microbiol. 58: 2589- 28. Sasser, M. 1990. Identification of bacteria by gas chromatography 2596. of cellular fatty acids. MIDI Technical Note 101. MIDI Inc., 36. Vera, J., R. Alvarez, E. Murano, J. C. Slebe, and O. Leo. 1998. Newark, DE. Identification of a marine agarolytic Pseudoalteromonas isolate 29. Servin-Gonzalez, L., M. R. Jensen, J. White, and M. Bibb. 1994. and characterization of its extracellular agarase. Appl. Environ. Transcriptional regulation of the four promoters of the agarase Microbiol. 64: 4378-4383. gene (dagA) of Streptomyces coelicolor A3(2). Microbiology 37. Wang, J., H. Mou, X. Jiang, and H. Guan. 2006. Characterization 140: 2555-2565. of a novel beta-agarase from marine Altermonas sp. SY37-12 30. Temuuji, U., W. J. Chi, S. Y. Lee, Y. K. Chang, and S. K. and its degrading products. Appl. Microbiol. Biotechnol. 71: Hong. 2011. Overexpression and biochemical characterization 833-839. of DagA from Streptomyces coelicolor A3(2): An endo-type β- 38. Yoon, J. H., I. G. Kim, K. H. Kang, T. K. Oh, and Y. H. Park. agarase producing neoagarotetraose and neoagarohexaose. Appl. 2003. Alteromonas marina sp. nov., isolated from sea water of Microbiol. Biotechnol. 92: 749-759. the East Sea in Korea. Int. J. Syst. Evol. Microbiol. 53: 1625- 31. Temuujin, U., W. J. Chi, Y. K. Chang, and S. K. Hong. 2011. 1630. Identification and biochemical characterization of Sco3487 from 39. Yoon, J. H., S. H. Yeo, T. K. Oh, and Y. H. Park. 2004. Streptomyces coelicolor A3(2), an exo- and endo-type β- Alteromonas litorea sp. nov., a slightly halophilic bacterium agarase-producing neoagarobiose. J. Bacteriol. 194: 142-149. isolated from an intertidal sediment of the Yellow Sea in Korea. 32. Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. Int. J. Syst. Evol. Microbiol. 54: 1197-1201. CLUSTAL W: Improving the sensitivity of progressive multiple 40. Zhong, Z., A. Toukdarian, D. Helinski, V. Knauf, S. Sykes, J. E. sequence alignment through sequence weighting, position- Wilkinson, et al. 2001. Sequence analysis of a 101-kilobase specific gap penalties and weight matrix choice. Nucleic Acids plasmid required for agar degradation by a Microscilla isolate. Res. 22: 4673-4680. Appl. Environ. Microbiol. 67: 5771-5779. 33. Van der Meulen, H. J. and W. Harder. 1975. Production and characterization of the agarase of Cytophaga flevensis. Antonie Van Leeuwenhoek 41: 431-447.