Microbially Induced Calcite Precipitation Using Bacillus Velezensis with Guar Gum

bioRxiv preprint doi: https://doi.org/10.1101/634212; this version posted May 10, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

Microbially induced calcite precipitation using Bacillus velezensis with guar gum

Rashmi Dikshit1, Animesh Jain1, Arjun Dey2, Sujit Kamilya3, Abhishake Mondal3, Aloke Kumar1*

1Dept. of Mechanical Engineering, Indian Institute of Science, Bangalore-560012, India

2Thermal Systems Group, U. R. Rao Satellite Centre (Formerly known ISRO Satellite Centre), Indian Space Research Organisation, Bangalore-560017, India.

3Solid State and Structural Chemistry Unit, Indian Institute of ScienceBangalore-560012, India

* Corresponding author email: [email protected]

Abstract

The present study was performed to explore the efficiency of microbially induced calcite

precipitation (MICP) via locally isolated bacterial strains. Strains were isolated from soil and were

screened for urease activity as well as microbial precipitation. Among all screened isolates, a

carbonate precipitating soil bacterium was subjected for 16S rRNA gene sequencing. This strain

was identified as Bacillus velezensis. The MICP characteristics of this strain were explored under

three different media compositions and significant amount of precipitation in all cases was

observed. Highest amount of precipitation was seen with guar as a biopolymer additive medium

under experimented conditions. Activity of isolated strain with reference to pH profile, and

ammonia concentration and total reducing sugar was further explored under media supplemented

with four concentrations of guar (0.25%, 0.5%, 0.75% and 1% w/v). Microstructural analysis of

microbial precipitation was performed with the help of scanning electron microscopy (SEM) and

X-ray powder diffraction (XRD) analysis, which confirmed the presence of calcium carbonate in

different phases. The strain was subjected to bio-cementation and locally available sand was

successfully consolidated. XRD results confirmed the presence of calcium carbonate on

consolidated samples.

Keywords: microbially induced calcite precipitation, Bacillus velezensis, guar gum,

biocementation, ureolysis

1. Introduction

Mineral precipitation mediated via microbial metabolic activity known as bio-mineralization is a

pervasive phenomenon on our planet. Reactions such as sulfate reduction [1], methane oxidation

[2], photosynthesis [3], and urea hydrolysis [4] help in either increasing the environmental pH or

metabolization of dissolved inorganic carbon [5]. Microbial induced calcium carbonate

precipitation (MICP), one of the mechanisms of bio-mineralization, is a process which creates a

favourable microenvironment for calcium carbonate precipitation by microbes [6] MICP has

potential applications in numerous domains such as prevention of soil erosion [7, 8], enhancing

the durability of concrete [9], restorations of cultural and historical assets [10-12] and production

of bio-cement [13, 14].

Urea hydrolysis is an important pathway for MICP due to its exclusively controlled mechanism to

get higher concentration of precipitated carbonates [15]. Diverse bacterial strains such as

Sporosarcina pasteurii (formerly Bacillus pasteurii)[16, 17], Bacillus megaterium [14],

Helicobacter pylori [16], Pseudomonas aeruginosa [16], etc are known to hydrolyse urea by

producing the urease enzyme (urea amidohydrolase; EC 3.5.1.5). Sporosarcina pasteurii, an

alkaliphilic, non-pathogenic and endospore producing bacteria has been extensively explored for

MICP [18-21]. Achal et al. [19] developed a mutant strain of S. pasteurii to enhance urease activity

which has shown significantly more urease activity and CaCO3 precipitation compared to the wild

strain of Sporosarcina pasteurii MTCC 1761. Dhami et al. [22] reported improved concrete

strength and durability of construction material when incubated with Bacillus megaterium. Strains

belonging to Bacillus genus are suitable for MICP applications as they can tolerate adverse

environmental stresses such as alkaline pH, higher mechanical forces and dehydrating conditions

by forming endospores [5, 23]. Given the relevance of MICP to various applications, discovery of

new naturally occuring MICP-capable strains is likely to be beneficial. In this study, an unexplored

soil isolated Bacillus strain namely Bacillus velezenesis was explored for MICP.

Moreover, in nature, biominerals are mainly embedded in organic matrices, made up of

macromolecules. These macromolecules can be proteins or polysaccharides, known to act as

templates for growth and precipitation of bio-minerals[24, 25]. Organic macromolecules along

with inorganic minerals have proven to be nucleating sites for mineral precipitation[26-28]. Also,

catanionic polypeptides influence CaCO3 precipitation as it contains negatively charged carboxylic

2+ 2− group, which shows strong affinity towards Ca in the presence of CO3 to promote CaCO3

nucleus formation[28]. Here we explored the role of two biopolymers on the MICP process: a) the

guar and b) L-phenylalanine, which is a cationic polypeptide. Guar (Cyamopsistetragonolobus,

family Leguminosae) is a green, non-toxic, easily available, cost-effective and easily

biodegradable polysaccharide-based natural polymer[29]

The aim of present study was to isolate and characterize indigenous strains for calcium carbonate

precipitation under three different media compositions and its application to soil consolidation.

This was accomplished by (i) screening of soil isolated bacterial strains for urease activity and

precipitation of CaCO3 via ureolytic pathway, (ii) exploration of precipitation under various

nutritional conditions, (iii) investigation of growth kinetics of urease positive strain with different

concentration of guar gum supplementations and (iv) consolidation of locally available sand in

order to check bio-consolidation efficacy of indigenous isolated strain(s).

2. Materials and Methods

2.1 Bacterial strains and its characterization

Soil isolated bacterial strains used for the present study were gratefully obtained from Dr. Swetha

S. and maintained on glycerol stock at -80ºC. Strains were sub cultured on nutrient agar media at

30ºC for 24 hours. Seed culture was prepared by inoculating one bacterial colony with 50 ml

nutrient broth media in shaking incubator (BioBee, India) at 120 rpm and 30ºC to get optical

density of 0.5 at 600 nm. The strains were named as SI1 (Soil isolate 1), SI2 (Soil isolate 2), SI3

(Soil isolate 3) and SI4 (Soil isolate 4). Biochemical characterization of isolated strains was done

by performing biochemical assay such as oxidation-fermentation test, catalase test, Voges-

Proskauer test, sugar fermentation, etc with the help of Bacillus identification kit (Hi-media, India).

2.2 Screening for Urea hydrolysis

Isolated strains were screened for urea hydrolysis by streaking a single bacterial colony on urea-

agar plate and kept at 30ºC for 24 hours. To observe change in medium pH, phenol red was added

as an indicator along with media. Urea-agar plate was prepared by adding 0.1 g glucose, 0.1 g

peptone, 0.5 g NaCl, 0.2 g mono-potassium phosphate, 2 g urea, 0.0012 g phenol red dye and 2 g

agar to 100 ml distilled water. All chemicals were procured from Hi-Media, India.

2.3 Molecular identification of isolate

Molecular identification of urease positive strain was done by 16S rRNA gene sequencing.

Colonies from single streak on the agar plate were scraped and suspended in PBS buffer and

centrifuged. The pellet obtained was dispersed in 600 µl of cell lysis buffer (Guanidium

isothiocyanate, SDS, Tris-EDTA) and mixed by inverting the vial for 5 minutes and incubated for

10 minutes with gentle mixing till the suspension looked almost transparent. The solution was

layered on top with 600 µl of isopropanol. The two layers were mixed gently till white strands of

DNA were seen and the solution became homogenous. The spooled DNA was spun to precipitate

DNA at 10,000 rpm for 10 minutes. The air-dried pellet was suspended into 50 µl of 1X Tris-

EDTA buffer and incubated for 5 min at 55–60ºC to increase the solubility of genomic DNA. 5 µl

of freshly extracted DNA along with 3µl of gel loading dye was loaded onto 1% agarose gel and

subjected to electrophoresis. Amplification of 16s rRNA gene was performed using the following

primers.

Forward primer: 5’- AGAGTTTGATCCTGGCTCAG - 3’

Reverse primer: 5’- ACGGCTACCTTGTTACGACTT - 3’

2.4 In vitro CaCO3 Precipitation

Urease positive strain was evaluated for microbial induced precipitation under flask conditions in

the following media compositions:

1) Synthetic media-urea-calcium chloride (hereafter, SMUC): Prepared by adding 0.1 g glucose, 0.1 g peptone, 0.5 g NaCl, 0.2 g mono-potassium phosphate and 2 g urea in 100

ml of distilled water with 25 mM CaCl2. 2) Synthetic media-urea-calcium chloride-guar gum (hereafter, SMUCG): Prepared by

replacing glucose in SMUC medium with 1% (w/v) guar gum (Urban Platter, India).

3) Synthetic media-urea-calcium chloride- L-phenylalanine (hereafter, SMUCP): Prepared by

adding 50 mg/l L-phenylalanine (Hi-Media, India) in SMUC medium.

The strain was inoculated in all mentioned media and incubated at 30ºC for 7 days under static

condition. After the incubation period, samples were centrifuged (SorvallTM LegendTM X1

Centrifuge, Thermo Fisher Scientific, Germany) at 4ºC and 5000 rpm for 10 minutes. The

supernatant was discarded and precipitates were dried at 37ºC for 12 hours in hot air oven (BioBee,

India). Precipitates were weighed using analytical weighing balance (ATX224 Unibloc®,

Shimadzu, Japan). These precipitates were further observed using scanning electron microscope

imaging and X-ray diffraction analysis.

2.5 Bacterial activity with guar gum

Bacterial activity of isolated urease positive strain was investigated in SMUCG medium

supplemented with varying concentration of guar gum (0.25%, 0.50%, 0.75% and 1% w/v) and

was compared with SMUC medium. The strain was inoculated and incubated at 30ºC, pH

(CyberScan pH meter, Eutech Instruments), ammonium concentration and amount of reducing

sugar were measured at different time intervals. Nessler’s reagent assay was used to quantify

ammonium concentration, by adding 100 µl of Nessler’s reagent (Hi-Media, India) in 2 ml of

bacterial sample. Absorbance was measured at 425 nm (using UV/Vis spectrophotometer,

Shimadzu, Japan) after 10 minutes of incubation [30]. Total reducing sugar was estimated using

DNS protocol [31] by measuring optical density at 540 nm.

2.6 Preparation of sample for bio-consolidation

A 50 ml Disposable polypropylene syringes (DispoVanTM) with an internal diameter of 30 mm

were used as a bioreactor for consolidation of loose mass (Fig 1). The outlet of syringe was sealed

using parafilm and inner surface was layered with OHP transparency film to ensure easy removal

of sample. The column was fitted with scouring pad at bottom and packed with locally available

manufactured sand (M-sand) (particle size characteristics: d10 (10% of sand particles have this

diameter or lower) = 125 µm; d50 = 212 µm; d90 = 250 µm) and covered again with a layer of

scouring pad. To avoid influence of any external contamination, sand was autoclaved at 121ºC and

15 psi for 30 minutes. The top portion of bioreactor was kept empty for aeration and was covered

with cotton plug to avoid contamination.

Inoculum was prepared by culturing Bacillus velezensis in SMUC media at 30ºC and 130 rpm for

24 hours to obtain an optical density of 2 at 600 nm (OD600). A volume of 5 ml inoculum was

added to sand column along with 5 ml of SMUC media and column was maintained at 30ºC. After

72 hours, extra culture at top of column was pipetted out and 5 ml SMUC media along with 5 ml

of bacterial culture was injected from bottom of the syringe to ensure flow in every portion of

column. This process was repeated after 144 hours. Sample was removed after 240 hours and kept

for drying at 45ºC for 24 hours. The experiments were performed in triplicates. The result was

compared with two control samples: (a) sand with tap water and (b) sand with SMUC media

(without bacteria) under same treatment.

2.7 Scanning electron microscopy (SEM)

Bacterial precipitates in different media compositions (SMUC, SMUCG and SMUCP) and bio-

consolidated samples were observed using Scanning Electron Microscopy (Carl Zeiss AG -

ULTRA 55, Germany). The dried precipitates were fixed with 2.5% glutaraldehyde in PBS buffer

(pH 7.4) for 30 minutes, followed by centrifugation at 5ºC and 5000 rpm for 5 minutes. The

supernatant was removed and sample was washed with PBS buffer to remove fixative. The treated

samples were dehydrated with serial dilution using 10, 30, 50, 70, 90 and 100% v/v ethanol. The

samples were mounted on carbon tape fixed on aluminium stub and kept in desiccator for 24 hours.

Before SEM imaging, the dried samples were coated with gold for 120sec to avoid charging.

2.8 X-ray diffraction (XRD) analysis:

The precipitated samples and bio-consolidated sand were collected, air dried and grinded to fine

powder. The fine powder was analysed using a commercial X-ray diffractometer (powder XRD,

Rigaku SmartLab®, Rigaku Corporation) and thoroughly indexed as per Inorganic Crystal

Structure Database (ICSD) library using PANalytical X'PertHighScore Plus pattern analysis

software.

3. Results

3.1 Screening and identification of strains

Morphological and biochemical characterisation of all soil isolated strains was performed with the

help of Bacillus kit. All strains were found to be gram-positive, aerobic, spore-forming and

catalase-positive (Table S1). Further, qualitative analysis based on pH indicator (phenol red) for

urea degradation of all strains was performed on SMU agar plate (Fig 2). Colour change was

observed only in case of SI1 (Fig 2a) due to enhancement in medium pH while no change was

observed in SI2 (Fig 2b), SI3 (Fig 2c) and SI4 (Fig 2d) as compared to control (without organism)

(Fig 2e). SI1 was subjected to 16S rRNA gene sequencing (Fig 3) and based on DNA−DNA

relatedness values has shown approximately 99% similarity with Bacillus amyloliquefaciens and

was identified as Bacillus velezensis (Table S2).

3.2 Precipitation under flask condition and its microstructural analysis

Bacillus velezensis induced precipitates were obtained with three different media supplementations

SMUC, SMUCP and SMUCG after 7 days of incubation under flask conditions. Amount of

precipitation (g/l) was plotted for different media supplementations (Fig 4a). It was observed that

an increase of 101% in SMUCG and 58% in SMUCP media took place as compared to SMUC

medium. This indicates the two additives support bacterial activity resulting in enhanced amount

of precipitation.

SEM images of these precipitates with different media supplementations show distinctly different

crystal morphologies (Fig 4b,4c,4d). In SMUC medium, sparingly populated mixture of spherical

and rectangular shaped crystals embedded in bacterial bioproduct can be observed in Fig 4b. Multi-

shaped densely populated sharp pointed flaked precipitates dominated by rectangular flakes (with

traces of organic matrix in between) can be observed in Fig 4c in case of SMUCG supplemented

media. Whereas, in case of SMUCP medium, the precipitate can be seen to be concentrated in

multi-layered stepped plateau like structure with bacteria and its secreted matrix sandwiched in

between the layers (Fig 4d).

XRD analysis of dried and crushed precipitated crystals (Fig 5) clearly suggests that different

amount of calcite, vaterite and aragonite are co-existing in the samples. The hexagonal vaterite

(ICSD File no. 98-011-5332) and orthorhombic vaterite (ICSD File no. 98-010-9797) were found

in all three media. SMUC has not shown any calcite content. The identified hexagonal shaped

calcite (ICSD File no. 98-002-1912) peaks in SMUCG correspond to 2θ values of 29.15°, 31.44°,

40.72°, 46.57°, 49.52° correlated with lattice indices (hkl) of (1 0 4), (0 0 6), (1 1 3), (0 1 8) and

(1 1 6) respectively. While in case of SMUCP, hexagonal shaped calcite (ICSD File no. 98-003-

4957) correspond to 2θ values of 23.07°, 29.42°, 31.52°, 36.02°, 39.47°, 43.20°, 47.52°, 48.53°,

57.47° correlated with lattice indices (h k l) of (0 1 2), (1 0 4), (0 0 6), (1 1 0), (1 1 3), (2 0 2), (0

1 8), (1 1 6) and (1 2 2) respectively.

XRD and SEM analysis clearly reveal that different phases of calcium carbonate are precipitated

as a result of difference in bacterial activity in all three media. As significant improvement in

precipitation was observed in guar gum as a bio-polymer additive medium (SMUCG), its effect

was further explored at different guar concentrations.

3.4 Influence of polymer on microbial activity and precipitation

Bacillus velezensis activity was studied with different concentrations of guar gum (0%, 0.25%,

0.50%, 0.75% and 1% w/v) in SMUCG media. Fig 6a shows the plot of ammonium concentration

with time. An increase in ammonium concentration was observed until 96 hours in all cases.

Further, it decreased until 144 hours and remained approximately constant thereafter. Maximum

ammonium concentration was observed with 1% guar gum additive (17.5 µg/ml) followed by 14.9

µg/ml, 13.5 µg/ml, 11.6 µg/ml, 10.3 µg/ml for 0.75%, 0.50%, 0.25% and 0% guar gum additive

respectively. It suggests that an increase in guar gum concentration enhances the rate of urea

hydrolysis. This is confirmed by the plot of change in pH of growth medium with time shown in

Fig 6a (inset). The experiment was initiated at an acidic pH of 5.5 due to the fact that the media

was based on urea and CaCl2 composition and any adjustment in pH towards alkalinity may result

in quick abiotic precipitation which is undesirable [6]. An increase in pH is observed until 48 hours

in all cases while with higher guar gum concentrations, pH further increased until 96 hours. In the

case of 0% and 0.25% guar gum supplemented media, pH reaches to maximum value of 8,

whereas, a maximum value of 9 was observed in media supplemented with 0.50%, 0.75% and 1%

guar gum.

The effect of guar gum degradation by Bacillus velezensis was studied using DNS protocol. In Fig

6b, total reducing sugar is plotted as a function of time. Total reducing sugar content in SMUC

media increases till 24 hours followed by its decrease. Interestingly, trends for SMUCG media

differed from the control sample (SMUC media). For SMUCG media, amount of total reducing

sugar in media increases till 48 hours in 0.25% guar gum while it increases till 72 hours in all other

guar gum concentrations and decreases thereafter.

3.6 Bio-consolidation of sand

Potential of Bacillus velezensis for MICP mediated consolidation was checked in M-sand

incubated in SMUC medium. Fig 7a shows consolidated sample of M-sand after 10 days of

incubation in bioreactor inoculated with bacterial strain. Control sample with SMUC media

(without bacteria) showed no sign of particle aggregation (Fig 7b). Consolidation via bacterial

activity was confirmed with SEM imaging and XRD analysis. A bacterial induced matrix bridging

sand particles can be observed in SEM image of consolidated sample (Fig 7c) as compared to

control sample (Fig 7d). Different sized precipitates can be seen embedded in the matrix of bio-

consolidated sample. XRD analysis of bio-consolidated sample when compared to control (Fig 8)

revealed presence of orthorhombic vaterite (ICSD File no. 98-011-5332) with peaks identified at

2θ values of 31.80°, 32.77° correlated with lattice indices (h k l) of (0 2 4) and (1 1 6) respectively.

4. Discussion The present study explored the novel urease producer soil bacterium for MICP application, which

was identified as Bacillus velezensis through 16S rRNA gene sequencing. The important factor for

MICP via ureolytic pathway is the selection of strain and its specificity based on the rate of urea

hydrolysis. B. velezensis has shown potential for urea hydrolysis and degradation of urea was

observed after 10 hrs of inoculation on urea agar plate which indicates its suitability for MICP

mediated applications. Historically, Bacillus velezensis was isolated from the river of Velez in

Ma ́laga (Southern Spain) and explored by Ruiz-Garcia et al.[32]. This novel isolated strain was

characterized as a gram-positive bacterium that can tolerate a varied range of pH 5.0-10 and

temperature 15 to 45°C.

Further, the ureolytic activity of isolated strain was explored for calcium carbonate precipitation

under flask conditions with biopolymer (guar gum), cationic polypeptide (L-phenylalanine)

additives and compared with media composition with no additives (SMUC). These naturally

occurring polymer additives accelerated calcium carbonate precipitation, and a significant

enhancement in the amount of precipitation was also observed. Different phases of calcium

carbonate precipitation induced by bacterial activity have been reported in numerous studies [6,

16, 33-35]. Major forms of calcium carbonate precipitate are calcite, aragonite, and vaterite of

which vaterite and calcite are the most commonly reported polymorphs of bacterial calcium

carbonate precipitates [36]. Precipitation found in this study with newly isolated bacterium

incubated medium was dominated by vaterite, which is a metastable form of calcium carbonate.

SEM images also depicted significantly different precipitate morphology under different media

supplementation. The role of these polymers as a media additive for MICP mediated consolidation

of loose mass should be further investigated.

Guar gum gave promising results in terms of the amount of precipitation and calcite content which

is known to be the stable most form of calcium carbonate [37]. The effect of guar gum additive on

bacterial activity was extensively studied with four different concentrations by measuring change

in the pH, ammonium concentration and total reducing sugar every 24 hours for 7 days. It was

found that isolated strain was able to survive with different concentrations of guar gum, a complex

biopolymer.

This biopolymer supplemented media has shown positive influence on calcite precipitation by

enhancing the pH of the medium due to urea hydrolysis and release of ammonia. The experiment

was initiated at an acidic pH of 5.5 because any adjustment in pH towards alkalinity would result

in quick abiotic precipitation which is undesirable. Tanushree et al. [6] had also concluded that

initial media pH played an important role in microbial induced calcite precipitation as when media

pH was kept at 9, quick abiotic precipitation was observed. Microbial precipitation is influenced

by pH of the medium because urease enzyme hydrolyses urea into ammonium ions, increases the

pH and thus provides suitable micro-environment to proceed the reactions [6, 38, 39]. In the

present study, maximum urea hydrolysis by bacterial activity was observed with higher

concentrations of guar gum as evident from enhancement in medium pH and ammonium ion

concentration.

Bio-degradation of complex polymer (i.e., guar gum) into small moiety was observed by Bacillus

velezensis activity. In case of media without guar gum, as glucose is a monosaccharide which can

metabolize easily, degrades till 24 hours and followed by its utilization by bacteria thereafter as is

evident from total sugar content characteristics with time. With guar gum additive, net degradation

by bacterial activity lasted up to 48 hours (in 0.25% guar gum) and 72 hours in rest of the cases

followed by its utilization by bacterial strain. Polymer degradation releases free sugar which could

be readily available in the growth medium for bacterial growth and resultant enhancement in the

activity. It is reported that the organic matrix covering calcium carbonate precipitation is made up

of either proteins or polysaccharides and these macromolecules play an important role in the

synthesis of biominerals either by providing a structural framework, or regulating its entire

dynamic process such as the nucleation site, growth of crystal and direction of orientation etc.[27,

40].

Bio consolidation mediated by B. velezensis exhibited the presence of vaterite. SEM images

revealed sand particles and precipitates aggregated by covering of bacterial-induced matrix.

Similar result was reported by Fadwa et al. [41] with MICP mediated consolidated gypsum plaster,

which was covered with organics matrix along with meso-crystals of vaterite. Such organics matrix

embedded with vaterite meso-crystals might be the reason behind the aggregation of the loose

mass of the soil particles. Further experiments shall be performed to investigate the co-relation

between organic matrix along with vaterite mediated consolidation.

5. Conclusion

In the present work, an efficient carbonate-precipitating soil bacterium was discovered and

identified as Bacillus velezensis. The MICP characteristics of this strain were evaluated under three

different media compositions. The isolated strain has given significant amount of calcite

precipitation in all cases, with highest amount in case of guar gum additive as it was able to degrade

guar as a biopolymer supplemented in the medium. It was further subjected to four different

conditions of guar and maximum activity was observed in case of 1% guar. The strain was

subjected to bio-cementation and has successfully consolidated locally available sand. This

unexplored strain had shown potential towards MICP and bio-consolidation of loose mass. To the

best of the authors’ knowledge, this is the first ever report on bio-consolidation mediated by

Bacillus velezensis depicting positive influence of biopolymer on calcite precipitation. The

encouraging results of this study indicate that, this locally available strain could be a model

solution for the construction industry (e.g., bio-bricks by a green route) and other related MICP

based applications.

Acknowledgments

Authors would like to acknowledge Dr. Swetha Seshagiri, Associate Professor

Center for Incubation Innovation Research and Consultancy, Jyothy Institute of Technology

Bangalore - 560082, Karnataka, India for kind gift of soil isolates. Authors also would like to

acknowledge Ms. Harshita Patangia for her help in performing lab experiments. The authors

acknowledge funding from Indian Space Research Organization (ISRO) and also funding from

Indian Institute of Science.

References

[1] Braissant O, Decho AW, Dupraz C, Glunk C, Przekop KM, Visscher PT. Exopolymeric substances of sulfate‐reducing bacteria: interactions with calcium at alkaline pH and implication for formation of carbonate minerals. Geobiology 2007;5:401-11. [2] Reeburgh WS. Oceanic methane biogeochemistry. Chemical reviews 2007;107:486-513. [3] Dupraz C, Visscher PT, Baumgartner L, Reid R. Microbe–mineral interactions: early carbonate precipitation in a hypersaline lake (Eleuthera Island, Bahamas). Sedimentology 2004;51:745-65. [4] Fujita Y, Ferris FG, Lawson RD, Colwell FS, Smith RW. Subscribed content calcium carbonate precipitation by ureolytic subsurface bacteria. Geomicrobiology Journal 2000;17:305-18. [5] Zhu T, Dittrich M. Carbonate precipitation through microbial activities in natural environment, and their potential in biotechnology: a review. Frontiers in bioengineering and biotechnology 2016;4:4. [6] Ghosh T, Bhaduri S, Montemagno C, Kumar A. Sporosarcina pasteurii can form nanoscale calcium carbonate crystals on cell surface. PloS one 2019;14:e0210339. [7] Comoss EJ, Kelly DA, Leslie HZ. Innovative erosion control involving the beneficial use of dredge material, indigenous vegetation and landscaping along the Lake Erie shoreline. Ecological Engineering 2002;19:203-10. [8] DeJong JT, Mortensen BM, Martinez BC, Nelson DC. Bio-mediated soil improvement. Ecological Engineering 2010;36:197-210. [9] De Muynck W, De Belie N, Verstraete W. Microbial carbonate precipitation in construction materials: a review. Ecological Engineering 2010;36:118-36. [10] Tiano P, Biagiotti L, Mastromei G. Bacterial bio-mediated calcite precipitation for monumental stones conservation: methods of evaluation. Journal of microbiological methods 1999;36:139-45. [11] Castanier S, Le Métayer-Levrel G, Orial G, Loubière J-F, Perthuisot J-P. Bacterial carbonatogenesis and applications to preservation and restoration of historic property. Of microbes and art: Springer; 2000. p. 203-18. [12] De Belie N, De Muynck W. Crack repair in concrete using biodeposition. Proceedings of the International Conference on Concrete Repair, Rehabilitation and Retrofitting (ICCRRR), Cape Town, South Africa2008. p. 291-2. [13] Rodriguez-Navarro C, Rodriguez-Gallego M, Chekroun KB, Gonzalez-Munoz MT. Conservation of ornamental stone by Myxococcus xanthus-induced carbonate biomineralization. Appl Environ Microbiol 2003;69:2182-93. [14] Dhami NK, Reddy MS, Mukherjee A. Improvement in strength properties of ash bricks by bacterial calcite. Ecological Engineering 2012;39:31-5. [15] Jiang N-J, Yoshioka H, Yamamoto K, Soga K. Ureolytic activities of a urease-producing bacterium and purified urease enzyme in the anoxic condition: Implication for subseafloor sand production control by microbially induced carbonate precipitation (MICP). Ecological engineering 2016;90:96-104. [16] Anbu P, Kang C-H, Shin Y-J, So J-S. Formations of calcium carbonate minerals by bacteria and its multiple applications. Springerplus 2016;5:250. [17] Bhaduri S, Debnath N, Mitra S, Liu Y, Kumar A. Microbiologically Induced Calcite Precipitation Mediated by Sporosarcina pasteurii. Journal of visualized experiments : JoVE 2016. [18] Bang SS, Galinat JK, Ramakrishnan V. Calcite precipitation induced by polyurethane- immobilized Bacillus pasteurii. Enzyme and microbial technology 2001;28:404-9.

[19] Achal V, Mukherjee A, Basu P, Reddy MS. Strain improvement of Sporosarcina pasteurii for enhanced urease and calcite production. Journal of industrial microbiology & biotechnology 2009;36:981-8. [20] Okwadha GD, Li J. Optimum conditions for microbial carbonate precipitation. Chemosphere 2010;81:1143-8. [21] Al Qabany A, Soga K, Santamarina C. Factors affecting efficiency of microbially induced calcite precipitation. Journal of Geotechnical and Geoenvironmental Engineering 2011;138:992- 1001. [22] Dhami NK, Reddy MS, Mukherjee A. Application of calcifying bacteria for remediation of stones and cultural heritages. Frontiers in microbiology 2014;5:304. [23] Achal V, Mukherjee A, Reddy MS. Microbial concrete: way to enhance the durability of building structures. Journal of materials in civil engineering 2010;23:730-4. [24] Mann S. Biomineralization: principles and concepts in bioinorganic materials chemistry: Oxford University Press on Demand; 2001. [25] Polowczyk I, Bastrzyk A, Fiedot M. Protein-mediated precipitation of calcium carbonate. Materials 2016;9:944. [26] Sondi I, Matijević E. Homogeneous precipitation of calcium carbonates by enzyme catalyzed reaction. Journal of colloid and interface science 2001;238:208-14. [27] Yao Y, Dong W, Zhu S, Yu X, Yan D. Novel morphology of calcium carbonate controlled by poly (L-lysine). Langmuir 2009;25:13238-43. [28] Nawarathna TH, Nakashima K, Fujita M, Takatsu M, Kawasaki S. Effects of Cationic Polypeptide on CaCO3 Crystallization and Sand Solidification by Microbial-Induced Carbonate Precipitation. ACS Sustainable Chemistry & Engineering 2018;6:10315-22. [29] Goldstein AM. Guar gum. Industrial Gums; Polysaccharides and Their Derivatives 1973:303- 21. [30] Cuzman OA, Richter K, Wittig L, Tiano P. Alternative nutrient sources for biotechnological use of Sporosarcina pasteurii. World Journal of Microbiology and Biotechnology 2015;31:897- 906. [31] Ghose T. Measurement of cellulase activities. Pure and applied Chemistry 1987;59:257-68. [32] Ruiz-Garcia C, Bejar V, Martinez-Checa F, Llamas I, Quesada E. Bacillus velezensis sp. nov., a surfactant-producing bacterium isolated from the river Velez in Malaga, southern Spain. International Journal of Systematic and Evolutionary Microbiology 2005;55:191-5. [33] Dhami NK, Reddy MS, Mukherjee A. Biomineralization of calcium carbonate polymorphs by the bacterial strains isolated from calcareous sites. J Microbiol Biotechnol 2013;23:707-14. [34] Rodriguez-Navarro C, Jroundi F, Schiro M, Ruiz-Agudo E, Gonzalez-Munoz MT. Influence of substrate mineralogy on bacterial mineralization of calcium carbonate: implications for stone conservation. Applied and environmental microbiology 2012;78:4017-29. [35] Rusznyak A, Akob DM, Nietzsche S, Eusterhues K, Totsche KU, Neu TR, et al. Calcite biomineralization by bacterial isolates from the recently discovered pristine karstic herrenberg cave. Applied and environmental microbiology 2012;78:1157-67. [36] Navarro LR, Pekelharing-Berghuis M, de Waal WJ, Thijsen SF. Bacterial colonization patterns in neonates transferred from neonatal intensive care units. International journal of hygiene and environmental health 2011;214:167-71. [37] Ni M, Ratner BD. Differentiating calcium carbonate polymorphs by surface analysis techniques—an XPS and TOF‐SIMS study. Surface and Interface Analysis: An International

Journal devoted to the development and application of techniques for the analysis of surfaces, interfaces and thin films 2008;40:1356-61. [38] Stocks-Fischer S, Galinat JK, Bang SS. Microbiological precipitation of CaCO3. Soil Biology and Biochemistry 1999;31:1563-71. [39] Gorospe CM, Han S-H, Kim S-G, Park J-Y, Kang C-H, Jeong J-H, et al. Effects of different calcium salts on calcium carbonate crystal formation by Sporosarcina pasteurii KCTC 3558. Biotechnology and bioprocess engineering 2013;18:903-8. [40] Tong H, Ma W, Wang L, Wan P, Hu J, Cao L. Control over the crystal phase, shape, size and aggregation of calcium carbonate via a L-aspartic acid inducing process. Biomaterials 2004;25:3923-9. [41] Jroundi F, Gonzalez-Muñoz MT, Garcia-Bueno A, Rodriguez-Navarro C. Consolidation of archaeological gypsum plaster by bacterial biomineralization of calcium carbonate. Acta biomaterialia 2014;10:3844-54.

Figures and Captions

Fig 1: Schematic of Experimental Setup

Fig 2: Plate showing urea hydrolysis after 24hrs of Soil Isolated strains (a) SI1, (b) SI2, (c) SI3, (d) SI4, (e) Control (without organism). SI1 shows color change due to increase in medium pH by bacterial activity

Fig 3: Phylogenetic tree of 16s rRNA gene sequencing for urease positive strain

Fig 4: (a) Quantification of microbial precipitation. SEM images of Bacillus velezensis mediated precipitated crystals with (b) SMUC medium, (c) SMUCG medium and (d) SMUCP medium. Incubation period was 7 days in all cases.

Fig 5: XRD pattern of Bacillus velezensis induced precipitates under different media compositions (a) SMUC (b) SMUCG (c) SMUCP. Incubation period was 7 days in all cases. Symbols represent: # (Vaterite ICPD no. 980115332), & (Vaterite ICPD no. 980109797), ++ (Vaterite ICPD no. 980012463), O (Aragonite ICPD no. 980114648), * (Calcite ICPD no. 980021912), ** (Calcite ICPD no. 980034957)

Fig 6: Exploration of microbial physiology under flask condition with guar gum additive. (a) temporal evolution of ammonium concentration in SMUCG media and temporal evolution of pH in SMUCG media (inset) (b) change in amount of total reducing sugar in SMUCG media with time compared with SMUC medium (0% curve). Legend shows guar gum percentage (w/v) in SMUCG media (Error bars represents the standard deviation of the data of three independent experiments).

Fig 7: Bio-consolidation of sand (a) Photograph of bio-consolidated sample (b) photograph of the control sample with SMUC media (without bacteria) (c) SEM image of bio-consolidated sample, (d) SEM image of control sample.

Fig 8: XRD pattern of bio-Consolidated sample, compared with sand control sample. # represents Vaterite – ICPD no. 98011532.