Posted on Authorea 9 Oct 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.160225751.15887529/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. nlss(TUTR n eHbis n iciiatAayi fPicplCmoet DP) u td uprsthe supports study Bayesian in our the (DAPC), on Components Based Principal Argentina. of of Formosa, Analysis recognition to Discriminant Brazil and Gerais, NewHybrids) Minas and between from (STRUCTURE identify hybrids species, analysis to of interspecific and diversity distribution of wide boundaries, occurrence genetic a morphological representing the the assessing populations to about to approach due doubt A population challenging is genetic of a hybrids there particularly applied interspecific addition, we is study, In this distinctiveness In traits. their species. the and both of America. taxons plasticity in large different distribution with as wide similarities classification a their with in species consensus eight attributed is (Arecaceae) and Acrocomia genus Neotropical the To Abstract 2020 9, October 2 1 Sanit´aMariana D´ıazBrenda of aculeata identification hybrid and delimitation Species alsA oob -alcro.oob@pgvb RI:0000-0003-3269-6068 ORCID: [email protected] e-mail Colombo A. Carlos 0000-0003-2937-966X ORCID: [email protected], e-mail: Sanita Mariana [email protected] e-mail: Azevedo-Filho A. 0000-0002-4863-1843 Joaquim ORCID: [email protected] e-mail: Zucchi I Maira Brazil. Campinas-SP, 0000-0002-3012-6355 2 ORCID: [email protected], e-mail: Alves-Pereira 0000-0001-7787-852 Alessandro ORCID: [email protected] e-mail: Diaz G Brenda 1 Sanita D´ıaz G. Brenda of identification approach hybrid for population strategies and establish delimitation to essentials Species are results species. The both species. of to and domestication markers populations and microsatellite of conservation, of management, level usefulness adequate the the the at showed diversity study genetic this about conclusion, knowledge of In boundaries hybrids. genetic F2 the elucidate as assigned were individuals admixed nttt Agronomico Instituto Campinas of University State tt nvriyo apnsUIAP nttt fBooy apnsS,Brazil. Campinas-SP, Biology, of Institute UNICAMP, Campinas of University State nttt gooiod saod a al-A,Cnr ePsus eRcro eeio Vegetais, Geneticos Recursos de Pesquisa de Centro Paulo-IAC, Sao de estado do Agronomico Instituto .totai A. .totai A. 2 alsA Colombo A. Carlos (H r h otipratseisbcueo hi iheooi oeta o i rdcin oee,teei no is there However, production. oil for potential economic high their of because species important most the are E .aculeata A. 051 hnin than =0.551) 1 and ai Zucchi Maria , 1 ai .Zucchi I. Maria , 2 n alsColombo Carlos and , aculeata . .totai A. and 2* .totai A. .aculeata A. and .aculeata A. 2 .totai A. lsadoAlves-Pereira Alessandro , stoseisadteetmtso eei aaeesrvae oegntcdiversity genetic more revealed parameters genetic of estimates the and species two as 1,2 ygntcpplto approach population genetic by (H lsadoAlves-Pereira Alessandro , hrenlc fsml eunerpa SR eeepoe oaayetwelve analyze to employed were (SSR) repeat sequence simple of loci Thirteen . E and 046.W bandeiec fhbiiainbtenteseisadthat and species the between hybridization of evidence obtained We =0.466). .totai A. 2 uprigtercasfiaina ieetseisadices our increase and species different as classification their supporting , 1 cooi aculeata Acrocomia 1 1 oqi Azevedo-Filho Joaquim , oqi .Azevedo-Filho A. Joaquim , Acrocomia and .totai A. 2 ygenetic by 2 , Mariana , .aculeata A. Posted on Authorea 9 Oct 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.160225751.15887529/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. pce r eena ihasnl yidia tmadcnrah1 o1 eesi egt(oez 2006; (Lorenzi height Both in meters 15 2017a). to al., 10 reach et can Vianna and 1996; stem cylindrical Melo, single and a the (Crocomo with or differentiation perennial patterns their are plasticity for morphological great species have adopted intraspecific both characteristics because of of and variation similarity broad absence vegetative 2010; great exhibit the al., attributes, to et morphological due of Lorenzi, be may 1956; discrepancy (Markley, This Sul species. do Grosso Mato al., of Although et state (Scariot the 2005). regions to Aschero, Cerrado restricted and in is Santa Rodriguez observed species Parana, being this Paulo, occurrence Brazil, Sao higher Sul, In with do Grosso Sul, 1995). Mato do 1991; Grosso, Grande Mato et Rio (Henderson Goias, and Ecuador Gerais, Catarina and Minas 1995). Peru Ceara, for al. Maranhao, except Para, et Argentina, to Scariot Antilles 1995; the al. and Mexico from 2006). America al., subtropical et (Lorenzi feed and (2020). List Plant aculeata The A. site by recognized also is (2010), Islands, Lorenzi is the today of emensis classification A. areas accepted genus: to most the restricted the for and However, totai species small, Paraguay. seven herbaceous, of genus. recognizes is part the who second and genus, within the Brazil the authors and of to several America, Cerrado South by species and two recognized Central only systematics are Henderson throughout synonyms to attribute its According and/or (1995) studied, and species number. widely Mart. al. 35 species is et its than it Henderson of more although However, undefinition (1995), and the family, for al. Arecaceae implications et have the and to controversial belongs are Acrocomia genus The The Introduction species. 1. and domestication populations and of conservation, level management, Keywords: adequate the the at for diversity species. strategies markers both genetic establish microsatellite of to of about essentials usefulness knowledge are the our showed results increase study of this and boundaries conclusion, species genetic In the hybrids. elucidate F2 to in as diversity assigned genetic were more uals revealed parameters of Formosa, genetic Analysis to aculeata of Discriminant Brazil of estimates and recognition Gerais, the NewHybrids) the Minas supports and and study interspecific from (STRUCTURE our identify analysis species, (DAPC), Bayesian Components of to Principal the distribution and on applied wide diversity Based we a study, Argentina. boundaries, representing this genetic populations In addition, twelve the In species. lyze assessing both traits. between to the hybrids of approach of interspecific hybrids plasticity population of large occurrence genetic distinctiveness the with their a about and similarities taxons doubt morphological different is to as there classification due their challenging in particularly consensus Amer- no is in is distribution there wide However, a with production. species eight attributed is ica. (Arecaceae) Acrocomia genus Neotropical the To Abstract (CAC) [email protected] E-mail: * orsodn author: Corresponding .aculeata A. Mart., (H .aculeata A. .aculeata A. E .hassleri A. fsalsz.I diin h resz species size tree the addition, In size. small of , and 046.W bandeiec fhbiiainbtenteseisadta die individ- admixed that and species the between hybridization of evidence obtained We =0.466). .crispa A. .totai A. aab am irstlie akr,Dmsiain osrain eei Resources Genetic Conservation, Domestication, markers, Microsatellites palm, Macauba .totai A. and .totai A. cusol nSuhAeia otesenAgnia atr oii,adParaguay. and Bolivia, eastern Argentina, northeastern America, South in only occurs Knh ..Bkre ec,o resz,and size, tree of Becc., ex Baker C.F. (Kunth) and Br.Rd. ..Hh.Tefis pce slre roel n ieydistributed widely and arboreal, large, is species first The Hahn. W.J. Rodr.) (Barb. and r h pce fgets cnmcitrs,piaiyt rdc eeal i,food oil, vegetable produce to primarily interest, economic greatest of species the are .totai A. .totai A. r h otipratseisbcueo hi iheooi oeta o oil for potential economic high their of because species important most the are .aculeata A. .aculeata A. r lsie ndffrn aa nmn eot,te r rae sasingle a as treated are they reports, many in taxa, different in classified are hrenlc fsml eunerpa SR eeepoe oana- to employed were (SSR) repeat sequence simple of loci Thirteen . .aculeata A. stems omnpl nBai,bigfudi h ttsof states the in found being Brazil, in palm common most the is .aculeata A. a iegorpia itiuin curn ntoia and tropical in occurring distribution, geographical wide a has and 2 .totai A. Jc. od xMart., ex Lodd. (Jacq.) .media A. uprigtercasfiaina different as classification their supporting , .hslr,A glaucescens A. hassleri, A. nei rmPet ioadVirgin and Rico Puerto from endemic , .aculeata A. .totai A. .aculeata A. .intumescens A. and (H .totai A. E 051 hnin than =0.551) Jc. od ex Lodd. (Jacq.) stospecies two as oez and Lorenzi Drude, A. A. Posted on Authorea 9 Oct 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.160225751.15887529/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. pce rpris hti,peoi itnto,rpoutv slto,mnpii n iegneecological contingent identifies divergence acquire and which necessarily monophilia adopted, not isolation, was reproductive did lineage distinction, that 2007). metapopulation phenolic but (Queiroz, is, separately, species that evolved of properties, that concept species lineages the metapopulation study, as the species of purpose (SSR) the Repeats Sequence For SSR. Simple genomic (EST) diversity Tags using genetic species Sequence between the and Expressed addressing populations boundaries and between study the and one within elucidate variation only for genetic date, pop- approach To natural genetic 2012). of population structure on al. genetic out et and Oliveira carried of diversity 2017; been Silva, the have 2015; assess studies Mengistu to most used and been have ulations microsatellites al., species: Acrocomia, et palm In Vieira different delimit 2015; codominant, in to al., 2006), being used used et al., (Dobrovolskayaa, widely successfully multiallelism, et identification also been hybrid are or have markers and and polymorphism These studies 2016) phylogeny high 2015). studies taxa (Mason, as genetics related species plant such related closely in between used (Lewontin, qualities, transferable widely environments and important are reproducible new have (SSRs) repeats to they sequence adaptation single because for or markers variation molecular of Microsatellite source interest, important agronomic of an characteristics representing 1966). complementary to as with opportunity genotypes well important an identify as represent and can diversity hybridization genetic interspecific of increase between proof relationships Moreover, is genetic strategies. it breeding the studies, of future of delimitation and elucidation taxonomic actual in correct the have a may establish recognition to species incorrect necessary in that mainly after-effects studies significant species, the this given of industries advantages the 2015). energy to al., and Due et cosmetic Cesar from food, generated 2011; products Jorge, the by and from the (Coimbra demand In and great fruits its of 2018). in liters.ha being present al., and acid et value lauric and (Colombo added acid with oleic extraction of in rich oil occurrence oil the of amount suggesting large Sul, do aculeata between Grosso A. distinction Mato the and blurring Paulo further Sao consequently, totai of and, states hybridization Brazilian interspecific the phe- between intermediate species. communication), between border personal relationship Institute, this taxonomic Agronomic between In dubious (Campinas notypes a 2008). Colombo elucidate Widmer, Carlos to and to alternatives (Minder According use them to differentiate continuous necessary to the is is adopted there support it morphology when 2015) case, the especially species, in al., of overlap separation et al., and unambiguous (Machado variation et for capacity fruit (Vianna low reveal the anatomy may characters of leaf characteristics 20017), physicochemical Silva, that and hypothesis 2010, biometric (Lorenzi, in and characteristics cm 2017b) morphological 5.0 and on 3.5 based from Studies ranging in diameters cm leaf with 3.5 are species, to species between 2.5 size from these in differentiate varying to type, drupe used characteristics morphological spines, the spines, Among and remnants 1991). sheath al., et Scariot .aculeata A. . .aculeata A. -1 qaigta fpl i n oal upsigsyen,wihpoueol 0 liters.ha 500 only produce which soybeans, surpassing notably and oil palm of that equaling , and hei atlantic Phoenix and .aculeata A. .totai A. .aculeata A. .totai A. a ihrdniyadlne pnsthan spines longer and density higher has .totai A. a enietfida nipratsuc o eeal i rdcindet the to due production oil vegetable for source important an as identified been has and a enrpre Lm ta. 00.Tu,i h rsn td eue a used we study present the in Thus, 2020). al., et (Lima reported been has .aculeata A. .aculeata A. Hnesne l,20) and 2006), al., et (Henderson and Lrni 00 ina ta. 07,Sla 2017). Silva, 2017a, al., et Vianna, 2010; (Lorenzi, . .totai A. .totai A. a efset enns whereas remnants, sheath leaf has r rmdffrn aooi rus oee,sm morphological some However, groups. taxonomic different from are h siae il fpl-eie i sapoiaey5,000 approximately is oil pulp-derived of yield estimated the , aebe bevdi ra fsmar fteeseiso the on species these of sympatry of areas in observed been have .aculeata A. 3 .aculeata A. .aculeata A. .aculeata A. uep edulis Euterpe .totai A. and Arue l,21;Lns ta. 2015; al., et Lanes, 2012; al., et (Abreu aeitnie nrcn er.However, years. recent in intensified have .aculeata A. .totai A. and h ri nbt pce sglobose, is species both in fruit The . ati gasipaes Bactris .totai A. at Gitoe l,2003). al., et (Gaiotto Mart. .totai A. scuilfrdfiigspecific defining for crucial is and o reigpurposes, breeding For . osnt nrlto to relation In not. does .totai A. .aculeata A. ut (Couvreur Kunth .aculeata A. n compare and and and A. -1 Posted on Authorea 9 Oct 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.160225751.15887529/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. eso . eawsue Adro n hmsn 02.Tecluaino h rbblt feach of runs probability MCMC the independent 10 iterations. of with 100,000 calculation performed of Results The was period 3. species burn-in parental a 2002). a and program Thompson, or steps NewHybrids backcross and 500,000 the F2, hybrids, with method (Anderson F1, interspecific Evanno’s a used putative uses being and was which individual species 2012), beta pure Holdt, independent identify 1.1 Von 10 To interpreted version and considered, were 2005). Markov (Earl data clusters al., the HARVESTER the K of clusters, et STRUCTURE of K replicates (Evanno tool of 250,000 number number by online each probable followed For the most iterations the by allele 100,000 15. determine To of to correlated (MCMC). period chain 1 with burn-in Carlo from Monte a model set with admixture performed was were clusters 2000) an runs K al., were of et genetic parameters number (Pritchard distinct The assumed information. Program a The species 2.3.4 considered prior STRUCTURE was without in structure. sampled and method genetic frequencies population Bayesian the each platform the R to DAPC, infer used from we the according to 2011) addition, Ahmed, perform (DAPC) & In To Components (Jombart package group. Principal 2018). statistical Adegenet Team, of the Core using Analysis and (R Discriminant (2010) by al. package et inferred PopGenKit Jombart the was with 2018) structure Team, Genetic Core (R (Ne), platform and alleles R 2006). heterozygosity, the of Smouse, (He) on 2012). and number estimated expected (Peakall (Paquette, was software effective and (Ar) 6.2 the (Ho) richness GenAlEx allelic observed using (Na), The estimated alleles, alleles were private 1922) of of (Wright, F-statistics number number Wright’s (I), as index parameters diversity diversity Shanon genetic of Estimates analysis the USA). using Data IA, USA) Ames, 2.3 Technologies, IA, Analytical Ames, Technologies, (Advanced following Analytical Kit the (Advanced Reagent system DNF-905 under CE T100) Analyzer Fragment (model 96-Capillary thermocycler Bio-Rad 72 at a in 55-58 conducted 94 at at was denaturation reaction initial PCR conditions: Polymerase 5 The 2). at (Table gSSR reverse 2018) and water. or (Bazzo, forward regions EST-SSRs the primer 15 genomic tags and each in sequence from of performed (GE (1990), expressed were five spectrophotometer Doyle amplifications from markers, Plus (PCR) eight & microsatellite NanoVue reaction and chain Doyle a 13 2008) and of using al., gel performed protocol et agarose was (Nucci the 1% study a using The on material evaluated Healthcare). were leaf quantity from and quality isolated DNA was DNA genomic genotyping Total microsatellite and extraction DNA 2.2 1. Figure (2017). Silva be parameters. by to reported as 1. considered 1), were Table between (Figure Paulo hybrids characteristics morphological Sao interspecific their and possible to Gerais considered due and Minas occurrence) of (simultaneous states the Lorenzi of from as classification populations taxonomic gradient the geographical six on a Based (2010), aculeata in 1). analyzed (Table were al. Brazil populations Gerais, et natural Minas 12 to Argentina from Formosa, individuals from 175 study, present the For sampling population and Species 2.1 methods and Materials 2. .totai. A. ° o 0mn mlfiainpout eesprtdb ailr lcrpoei na automated an on electrophoresis capillary by separated were products Amplification min. 10 for C n he ouain rmMt rsod u n n rmAgniawr osdrdt be to considered were Argentina from one and Sul do Grosso Mato from populations three and , ° dpnigo rmr al )fr1mn lnaina 72 at elongation min, 1 for 2) Table primer, on (depending C a fgorpi itiuinof distribution geographic of Map ecito of Description nadto,w nlddtoppltoslctdi h ra hr ohseisconverge species both where areas the in located populations two included we addition, In cooi sp. Acrocomia ° o iue olwdb 0cce t94 at cycles 30 by followed minutes 2 for C μ ,3 M, ouain ape o eei nlssadtergeographic their and analyses genetic for sampled populations cooi spp. Acrocomia μ fHtSatPRMse i 2)ad9 and (2X) Mix Master PCR Start Hot of L 4 μ fttlvlm otiig2 go N,2.0 DNA, of ng 20 containing volume total of L ape populations. sampled ° o i n nlextension final and min 1 for C ° o iue annealing minute, 1 for C .aculeata A. μ fultrapure of L and .totai A. μ A. L Posted on Authorea 9 Oct 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.160225751.15887529/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. ewe h ouainwt yrdpat n ohseis rsnigvle fF of values presenting species, both and plants hybrid F x with the population to the between according moderate F considered (total between was comparisons pair-wise taxa the study for among differentiation Genetic indicating 4). high, (Table and heterozygosity relatively of 4. positive deficiency were Table and populations all equilibrium for Hardy–Weinberg found of (f) deviation index significant fixation of H values by average The evidenced as diversity, genetic genetic alleles The of effective values respectively. and lowest (H (11), 5.0, heterozygosity Corumba observed to and and 2.15 (6) expected of Itapira from populations of of ranged all population population (Na) in the the locus higher in was per 2.92 evaluated alleles to diversity of 1.97 number from ranged the (Ne) level, population the At 3. Table locus. each at diversity index. fixation for 2. the found Table for those values than positive higher and were which homozygotes respectively, of excess an indicating totai plants, hybrid (H with heterozygosity tions expected in of found mean was The alleles private of number 3). higher (Table A detected were locus. for in per obtained than (Ne) those alleles) alleles than (16 effective values 2.32 diversity and markers allelic (Na) microsatellite alleles higher 13 of locus, total species per a The with (Ne) EST-SSR). conducted 8 was and analysis gSSR diversity (5 genetic intraspecific alleles, diversity and private inter- genetic The 1.63 intraspecific versus and (H Inter 2.60 of higher 2 mean with mean was The a EST-SSR, 3. gSSR (H with 0.421. with the EST-SSR of 861 by from detected mean 278) 0. derived revealed a than (EST-SSR to variation microsatellites with two gSSR 0.567 with 0.792 genetic from from to in mean variation ranged 0.105 The higher allelic from gSSR was varying respectively. an of EST-SSR values alleles and the PIC private locus with EST-SSR The values per of alleles. PIC 64). alleles (Aacu26) the (EST-SSR 14 6 gSSR while to locus of five 0.752, 45) The per mean (Aacu heterozygosity. alleles a six and 11 from with locus ranging to alleles 10.6, per molecular 48 of alleles EST- mean detected than (EST-SSR) of a variable number loci region with more loci, alleles are expressed polymorphic 53 gSSRs of detected and that number markers shows (gSSR) of markers terms microsatellite both in from genomic SSRs obtained variability used genetic we The study, markers. loci present microsatellite the EST-SSR and In gSSR in variability Genetic 3.1 tpr ouain o08 ewe u n retn Tbe6). (Table Argentina 5 and Table Luz between 0.80 F to (total high populations was Itapira level intrapopulation the at . eiiaino species of Delimitation 3.3 6. Table loci. microsatellites 13 on .aculeata A. n ouain ihhbi lnsehbtdsmlrvle fgntcdvriy(H diversity genetic of values similar exhibited plants hybrid with populations and .aculeata A. arxo arieF pairwise of Matrix . hrceitc ftefiegS n ih S-S rmr n umr ttsiso h genetic the of statistics summary and primers EST-SSR eight and gSSR five the of Characteristics eei iest siae ttepplto ee sn 3mcoaelt loci. microsatellite 13 using level population the at estimates diversity Genetic loci. microsatellite 13 using taxa Acrocomia for estimates diversity Genetic arxo arieF pairwise of Matrix n F and .aculeata A. .aculeata A. and ST .5 o yrd x hybrids for 0.059 = .totai A. hnetmtdb h ubro lee N n e,Sao ne I and (I) index Shanon Ne), and (Na alleles of number the by estimated when ST .aculeata A. 9alls,wiei ouain ihhbi lns nytopiaealleles private two only plants, hybrid with populations in while alleles), (9 ST (F aus(eo ignl mn ouain ae n1 microsatellites. 13 on based populations among diagonal) (below values ST aus(eo ignl among diagonal) (below values .9.Lwrgntcdffrnito a bevdfrtecomparison the for observed was differentiation genetic Lower 0.09). = ST .totai A. E E .0,P 0.105, = a ihrta htosre (H observed that than higher was ) n H and ST and E .totai A. rsne eno .9alls(a n .8eetv alleles effective 3.28 and (Na) alleles 6.69 of mean a presented 045 Tbe2). (Table =0.455) .6 P 0.267 = O .Ban n u ouain rsne h ihs and highest the presented populations Luz and Brauna ). .totai. A. O .totai A. < .aculeata A. 5 037ad018 epciey(al 4). (Table respectively 0.158, and =0.347 .0) h ihs eei ieetainwsfound was differentiation genetic highest The 0.001). Tbe5.Teetmto fgntcdifferentiation genetic of estimation The 5). (Table < n nppltoswt yrdpat hnin than plants hybrid with populations in and .0) agn rm00 ewe ian and Rifaina between 0.05 from ranging 0.001), (H A O . claaA totai A. aculeata .0)(al 3). (Table 0.208) = .aculeata A. O E nbt pce n popula- and species both in ) 077 hnta obtained that than =0.777) iha vrg f5.38 of average an with , ST O .7 o hybrids for 0.079 = n Hybrids and ,027ad0.331, and 0.287 ), ST au obtained value .totai A. , based A. Posted on Authorea 9 Oct 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.160225751.15887529/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. hs akr cesdffrn ein ftegnm,tegntcifraingnrtdb ohmarkers both by generated Because information Acrocomia. genetic in the markers (2020). gSSR genome, al. and the et EST-SSR Lima of and both regions (2018) using different al., study et access first Coelho markers (2017), the these al. Ara´ujo represents et (2016), work al. this et Thus, Neiva most (2016), at al. with et conducted for were Mengistu developed markers microsatellite loci with gSSR performed 8 studies economically genetic and most several (EST-SSR) the Acrocomia, between regions genus al. relationship expressed ( et taxonomic of Henderson species the palm markers 2006; elucidate Acrocomia microsatellite to al., important In informative, study, adopted et present were highly 2015). (Couvreur the (gSSR) species In regions are (Mason, related genomic 2010). closely they species al., delimit et because to related Pintaud used genotyping 2006; between been have plant transferable markers for these and trees, used reproducible, widely multiallelic, been codominant, have EST-SSRs markers and gSSRs Microsatellite genomic in variability Genetic groups 4.1 main two the between Discussion individuals these 4. of position intermediate the 3). by (Figure shown as analysis, DAPC by fte1 lnsaaye 1.% eeietfida 2gnrto yrd sn au fq05(Figure also q=0.5 NewHybrids of the value by a hybrids Bra´una, using as in (IQ hybrids classified and generation admixture individuals (30.0%) five F2 of analyzed the as plants signs STRUCTURE, identified 10 showed the were the in of (15.3%) of analyses existence analyzed 3 Through the plants Grande, 2). 13 confirmed Campo software the of interspe- of NewHybrids population of the 2 identification using In the analyses genotype. for Bayesian hybrid DAPC) The and a congruent. STRUCTURE were (NewHybrids, hybrids analyses three cific the of results The hybridization Interspecific 3.4 presented. are eigenvalues totai A. probability 3. posterior Figure the represents group. color each the to where bars assignment vertical of by represented are Individuals NewHybrids. 2. Figure Bra´una and of (2010). populations classification Lorenzi the to 3), according and two considered 2 currently of of Figures are group occurrence DAPC, populations the and the to (Bayesians signed of were performed wherein hypothesis Fusquinha analyses program, The population- three NewHybrids observe the axis. For genetic the to second total by the possible the confirmed for of not also 44.3% 9.5% was was explained totai and it components species axis STRUCTURE, major distinct first two in genetically the first for analyses The 34.8% Bayesian species. variation, the each within in structuring as level and However, STRUCTURE of the results by 3). of Bayesian conformed population the groups define with by well agreement two and in of was formation DAPC the the identified also in individuals found of was substructure clustering genetic The the no however, of performed; was individuals shown). revealed Most not groups genetic (data most main two 2). grouped the for (Figure red analysis Cluster 2) = assignments. as uncertain (K ascribed as without ascribed groups homogeneity populations distinct from high individuals presented genetically groups two genetic of two formation ( the groups indicated of number likely most The eeceryrcgie saprna pce Fgr 2.) (Figure species parental a as recognized clearly were ae ntemcoaelt aast nytetofis xssoigtetohge discriminant higher two the showing axes two-first the Only set. data microsatellite the on based iciiataayi fpicplcmoet DP)aogppltosof populations among (DAPC) components principal of analysis Discriminant eut fBysa lseigasgmn ihtesfwr’ )SRCUE(=)adb) and (K=2) STRUCTURE a) software’s the with assignment clustering Bayesian of Results .totai A. codn otecasfiainb oez ta.(00.Sbeunl,anwBayesian new a Subsequently, (2010). al. et Lorenzi by classification the to according .totai A. .aculeata A. .aculeata A. Cutrgen,crooaigtecersprto ewe pce (Figure species between separation clear the corroborating green), (Cluster < 5 between 75) ΔΚ .aculeata A. .totai A. eeldb h aeinaayi sn h TUTR software STRUCTURE the using analysis Bayesian the by revealed ) yNcie l 20) si ae ta.(05,Lnse l (2016), al. et Lanes (2015), al. et Lanes in as (2008), al. et Nucci by .aculeata, A. and Cutrred) (Cluster .totai A. .aculeata A. ae nislcto nSoPuosaeadtemorphology the and state Paulo Sao in location its on based n lse re rue niiul rmpopulations from individuals grouped green cluster and 6 n oietf osbeitrpcfi yrd.I the In hybrids. interspecific possible identify to and ) . and hsotoewsuepce,gvnta these that given unexpected, was outcome This .totai A. .aculeata A. Fgr )adwr lodetected also were and 2) (Figure Cutrrd populations red) (Cluster .aculeata A. .aculeata A. and and A. Posted on Authorea 9 Oct 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.160225751.15887529/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. h antd n tutr ftegntcdvriyo h pce.Ms tde ngntcdvriyin diversity genetic on studies Most species. the of understand to diversity desirable genetic is with the it conducted conservation, of been have or structure Acrocomia exploration and through magnitude resources genetic the of management the valuable diversity For a genetic amount represents intraspecific high markers and microsatellite a Inter have of in 4.2 types still used. studies markers evolutionary both they the and of gSSR, of genetic use to nature using for the compared and studies tool that number polymorphism in the demonstrating of (2017) as polymorphism, levels al. well of lower as et have analyzed, Araujo material EST-SSRs and botanical Although (2015) the al. to et due Lanes be by may reported cited those for developed than gSSR lower only and (2016) al et ) h oe ausi h eei iest aaeesadtehg xto ae on o ohspecies both for found rates fixation high the and parameters diversity the genetic in the deficiency heterozygote in indicating of values values (f), lower f index The the fixation with 4). the species, for both values of high populations reveal also to data of index obtained source belonging diversity The important Shannon S˜ao (11), Paulo. an and of Corumb´a, heterozygosity represent MS state the therefore and the by may of estimated (3) and diversity region genetic MG central and S˜ao higher Paulo the Ibituruna, of presented in respectively, states of located the population of populations the border The in the than in when Sul located Sul species do populations the do Grosso in Grosso to Grosso Mato observed Mato authors Mato heterozygosity from of the from populations values number by populations that greater higher attributed considering in a were Gerais, locus, polymorphism Minas per Sul of alleles and S˜aodo of percentage Paulo from number higher populations higher in a to a diversity compared reported and genetic (2016) of alleles al. levels et specific higher Mengsitu of identified and also (2015) which al. (2020), et Lanes al et Lima by in conducted found Ho- than also heterozygosities species. were in diversity two values tic higher the in and between richness evidenced similar allelic was locus, were diversity data of genetic microsatellite samples greater from wever, including obtained species, estimates both Genetic-population of distribution geographical occurrence. of of of diversity 2015; country gradient genetic al. another wide the at a on (Lanes from et results (Abreu data Sul presents Sul study do do our Grosso Grosso Mato Thus, Mato and S˜ao considered of Paulo of in 2018) diversity states al., populations genetic the et between of Coelho region 2012; accessions border al., the of in diversity and 2016) genetic Mengsitu the 2017). on al., Studies et Araujo 2013; Silva 2016; Mengistu and index gSSR polymorphism Considering the 2005). study, al. this genome 2012; et in the Varshney al., detected of 2007; et alleles regions Burke Song of transcribed and number 2011; in (H (Ellis average EST-SSRs estimates al., diversity variation of the et to location together, (Hu the EST-SSR subject species to of and less plant attributed number be 2). other be (Table average therefore can in loci higher and and reported EST-SSR 2017) a eight those al., presented the with et than loci Meyer congruent index gSSR are polymorphism five results and the alleles, These private markers, trans- of of their number types confirming locus, thereby two per levels, the alleles species Comparing and gSRR. population for the for both developed to at primers ferability polymorphisms EST-SSR high and distribution and gSSR the profiles both study, on 2002). present (Kalinowski information the parameters accurate In genetic more population provides and combination diversity their genetic and of complementary, be to tends .totai A. .totai A. speiul etoe yBzoe l 21) o S-S n iae l (2020), al. et Lima and EST-SSR for (2018), al. et Bazzo by mentioned previously as , E n H and .aculeata A. hog oeua akr ihsmlsol rmBai Lm ta. 2020). al., et (Lima Brazil from only samples with markers molecular through O Tbe2 eehge hntoefudb ae ta.(06 n Mengistu and (2016) al. et Lanes by found those than higher were 2) (Table ) .totai A. h ieecsi h siae bandi oprsnwt h works the with comparison in obtained estimates the in differences The . .aculeata A. ttepplto ee.Orrslsaei iewt rvosstudies previous with line in are results Our level. population the at .aculeata A. .aculeata A. .aculeata A. Arue l,21;Oier ta.21;Lns ta. 2015; al., et Lanes, 2012; al. et Oliveira 2012; al., et (Abreu .totai A. nsitu in 7 ssuymtra.Asnl td a eotdo the on reported was study single A material. study as .aculeata A. n eae species. related and hc rsne ihrnme fallsper alleles of number higher a presented which , eei iest fteespecies. these of diversity genetic en ihrta hs of those than higher being .aculeata A. .aculeata A. iial,Ceh ta.(08 obtained (2018) al. et Coelho Similarly, . .aculeata A. and Tbe ) ihrvle fgene- of values Higher 2). (Tables .totai A. .aculeata A. hwdgo amplification good showed .totai A. ae npopulation on based .totai A. and .totai A. Tbe and 3 (Tables Likewise, . .totai A. from , Posted on Authorea 9 Oct 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.160225751.15887529/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. 21b ae nla ntm aaadLm ta 22)bsdo oeua aagnrtdfo SSR from generated data molecular on based al. (2020) et al Vianna et characters, Lima morphological and on based data (2017a) anatomy existence al. leaf marker. the et on indicated Vianna of based also and classification (2017b) (2010) program the Lorenzi NewHybrids supporting 2), with the (Figure consistent in 3. species performed and ”pure” analysis two 2 of the Figures (STRUCTURE) result, in Bayesian shown this both as by Corroborating defined (DAPC), well analysis were discriminant that component clusters two expressive principal of and and formation loci analysis of the differentiation microsatellite by statistical the different of supported highlight the number strongly adopting to elucidate large and possible was a distribution to it of geographical Thus, markers approaches. wide analysis molecular a the of representing on sampling means based population were by results approach Our genetic them. population between Paranava´ı, a Paran´a in between use collected boundaries we individuals species work named present who (state the (2013), Dourados In al. from et collections from Santos with collections (2014) Dos with al. or (2013) et Sul), Traesel al. with and do et Sul) Grosso Ciconini do Mato and Grosso (2015) of Mato typically al. of occurrence (state et of Grande Lescano Paraguay, areas Campo from of and material material with classification the botanical working taxonomic of with their studies case hindered many the why has of In is which morphology. which characters, and controversial, phenotypic generated distribution many geographical for their polymorphism interest, high on economic based hybridi- greater mainly as of between events is differentiation species such genetic species to and of due morphological sification task of difficult levels (Queiroz, a (Sch low discipline be and species biological can divergence, any information recent for introgression, this zation, obtaining information However, strategic 2006). represent Hey, delimitation 2007; and recognition Species species of in hybridization, Delimitation studies interspecific 4.3 to of result according a and 2014), as 2008) diversity al., al., genetic et (L´opez-Caamal increased diversity reported as have such genetic that of Bra´una genera of plant levels several municipality increased hybrids the interspecific for putative from considered coming responsible were individuals population their the analysis, Bayesian for with the between on obtained individuals based were the that, diversity and of (SP) variability genetic of of loss values which with High variation, characteristic large this a the content. for presents oil in 2017), selection pulp al., variation positive lower et a little hand, Reis caused other with dos have the 2015; characteristics (Concei¸c˜aowould On al., authors both several et 2015). Concei¸c˜ao seed, to al., 2013; according the et al from et extracted Ciconini, in oil 2011; al., the (Sanjinez-Argando˜na et and species production flour in for words, other In between index reproductive processes. fixation a domestication has and different species index this with diversity than that suggest genetic rate the we of allogamy work, self- about values present higher knowledge which of the a 2013), in no rate (Brito, obtained with is high apomixis results system even there the a and Currently, on 2012) with based heterozygotes. al., but but of et system, Abreu allogamy reduction 2008; for the al., A favor et preference In Nucci may a 1991; species. al. with these et systems, (Scariot of fertilization reproduction system mixed reproductive of the predominance to due be may .totai A. .aculeata, A. .aculeata A. Ulmus .aculeata A. aecniee h td pce oinclude to species study the considered have nwte ta.20;Lg ta.21;So´ke l 02.I h eu cooi,teclas- the Acrocomia, genus the In 2012). al. Slov´ak et 2012; al. et Lega 2009; al. et ¨ onswetter Phoenix p.(aaae l,2009), al., et (Zalapa spp. h oetcto ooe lnswt ihrolcneti h up hrceitcthat, characteristic a pulp, the in content oil higher with plants honored domestication the subsp. .totai, A. and p.(Gonz´alez-P´erez2004). spp. al., et totai .totai A. .aculeata A. h anpout fatrpcitrs r h elws eho h fruit the of flesh yellowish the are interest anthropic of products main the . .aculeata A. ti ieykonta neseichbiiaini lnsmybe may plants in hybridization interspecific that known widely is It . .aculeata A. and .aculeata A. Quercus .totai A. and and .totai A. p.(ozae-orıuze l,20;Tovar-S´anchez et 2005; (Gonz´alez-Rodr´ıguez al., spp. et 8 .totai A. n oietf h curneo neseichybrids interspecific of occurrence the identify to and nte yohsssget htdffrne nthe in differences that suggests hypothesis Another . .aculeata A. .aculeata A. aculeata . ohhv ra opooia iiaiyand similarity morphological great have both .aculeata A. .aculeata A. si h ok fGuoe l (2011), al. et Gauto of works the in as , eea tde aerpre the reported have studies several , and and and .totai A. .totai A. .totai A. pce r associated are species .totai A. sdsic species, distinct as pce,wihwas which species, reproductive Posted on Authorea 9 Oct 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.160225751.15887529/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. neet h ipra fhmngop oad h etr ieo ot mrc,priual nthe in particularly America, South of anthropic side local western of the patterns towards distinct to groups exposed human species subsequently of the was of dispersal and domestication of The America beginning interest. South the that northern assumed in be can occurred it data, these finding on the Based by supported the be of also origin is 1995). of hypothesis This center Brazil. the of emensis of exception that region the suggest northern with 2001) process the that the Bernal, be favored (Morcote-R´ıos may and of that origin years Acrocomia environments records rainforest of genus 11,200 open fossil tropical center from more humid oldest possible and dating the The a drier Brazil, of Acrocomia. in as shrinkage resulted of suggest progressive Eocene diversification (2008) the the of al. that during given et America America, Pintaud South South unknown. in of is region Acrocomia northern genus Piquerobi the the of of locality other origin from the The samples from the samples from work, of distanced representative genetically this were were time. In they study) Gerais. because our possibly Minas of of diversity locations, collections and genetic Fusquinha S˜ao obtained Paulo of the those of structuring to near the identical states (region are on results the study between These a of 3). grouped in and were origins 2 (2012) S˜ao Paulo, (Figures al. of Sul et do state Abreu Grosso the by Mato of. in state location the and considered geographical Argentina previously their Fusquinha, Bra´una to and of geographical due populations the the , is that species reveal Acrocomia whereas results of our species, classification However, case the the the define of to In adopted distribution 1956). parameters (Markley, the zones of temperate one Currently, in addition in occur wetland 2010), to Lorenzi, flooded Acrocomia arrangements. 2000; genus temporarily population al., the from et of (Herrera-MacBryde occurs species areas species of mechanisms only dry the in the adaptation in as which being own well alleles in to their as private habitats floodplains, of of of seasonal emergence number diversification and higher the the A by and in environments. explained species alleles respective private both their of of to 2015). (Concei¸c˜ao number evolution al., 76% high of independent et to fruits a 30 probable ranging while from of pulp 2005), ranging the detection al. content, in et content The oil oil of Hiane higher showed Fruits 2015, presented Sul fruits. al. Gerais do the et Minas Grosso of Mato (Vianna and S˜ao content of Paulo 33% state oil to fruit the Paran´a); the 26 the of of in from region compared (state variation Pantanal (2015) Umuarama the also of al. and is populations et Gerais) there Machato Minas differences, 2017). of morphological Silva (state the and Contagem 2017a of municipalities al., therefore, Brazilian et the Vianna of 2010, (Lorenzi size (Lorenzi Acrocomia cM genus 3.5 the and from species distinguish suggesting of with to case also a the used border, and In Paraguay been 2010). Gerais, the have Minas characteristics near and phenotypic Sul Acrocomia. S˜ao Paulo Some do of of Grosso species genotypes Mato different by of of in shared occurrence collected region them the genotypes Pantanal of of two the haplotype haplotypes, 67 from unique F four individuals of the of by region to formation formed according ITS the differentiation one the genetic groups, by high with main generated Sul two markers do microsatellite of Grosso with formation localities Mato Brazilian the different identified from provided have Acrocomia and studies from other individuals location, of geographic diversity their genetic of on based differentiation but of species, evidence different as treated not Although .aculeata A. .aculeata A. , .aculeata A. .glaucescens A. hsseisocr rfrnilyi erd ra Lrni 00 nlreadcontinuous and large in 2010) (Lorenzi, areas cerrado in preferentially occurs species this , rsnigfut ewe . n . M while cM, 5.0 and 3.5 between fruits presenting .aculeata A. and and .crispa A. .totai A. .aculeata A. .intumescens A. and .aculeata A. and a endaeeso .3ad34 M epciey nadto to addition In respectively. cM, 3.42 and 5.03 of diameters mean had .totai A. .totai A. and .media A. .totai A. a o bevdi h tt fSa al Lrni 2010). (Lorenzi, S˜ao Paulo of state the in observed not was en nei rmBai Lrnie l(00 Henderson, (2010; al et (Lorenzi Brazil from endemic being ri hrceitc r ihyifraiefrti purpose, this for informative highly are characteristics fruit , eoye rmtesuyb iv ta.(07 identified (2017) al. et Silva by study the from genotypes h te pce ftegnsocri rzl with Brazil, in occur genus the of species other the , 9 rmmlclrdt.Lnse l 21)aaye the analyzed (2015) al. et Lanes data. molecular from .aculeata A. .totai A. .aculeata A. n o of not and and .totai A. .aculeata A. .totai A. ST on nSantar´em, Par´a, northern in found .totai A. .aculeata A. .aculeata A. ne.Smlry h information the Similarly, index. a mle risbten2.5 between fruits smaller has pce Tbe2 indicates 2) (Table species than olce ntesae of states the in collected .totai A. ape rmdifferent from samples ssgetda that at suggested as , .aculeata A. cooi aculeata Acrocomia .totai A. ape from samples .aculeata A. a be can from A. Posted on Authorea 9 Oct 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.160225751.15887529/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. neseichbiiaini oefeun ncoeyrltdseiso hs htaentsffiinl di- sufficiently not are that those or species cm related 3.4 closely and in diameter frequent vertical more for is cm fruits hybridization 3.6 in respectively. Interspecific and diameter, (2011) cm horizontal Machado for 3.3 Sanjinez-Aragando˜na and cm of between and 3.1 averages hybridization (MS) and Epit´acio, reported Grande interspecific Presidente Campo in possible in collected a collected suggest fruits also studying studies previous aculeata from data Morphological marker, SSR the on based of al., study, population et previous hybrids a of A natural Scariot in data. of admixture 2009; molecular occurrence and through (Salis the connectivity Acrocomia hybridization verified of genus evidence natural the unprecedented of of reporting species occurrence are between we possible Therefore, the 2006). Lorenzi favoring in 1995; analyses species, Bayesian of these the period of by results flowering region the supported our that also add program, is we 3). result Furthermore, NewHybrids and have This which 2 the 2). Grande, (Figures (Figure in Campo DAPC Bra´una F2 and hybridization of and performed class STRUCTURE populations natural generation analysis the on to in Bayesian attributed hybrids studies interspecific and been of of data occurrence reports the genetic no suggest on are based there Thus, Acrocomia, date. genus to the species in its However, among 2011). 2010), al., al., et et Pintaud 2004; al. et (Gonzalez-Perez 1995), al. et genera: several in reported been Calyptrogyne has species hybridization these interspecific between Arecaceae, between hybridization In natural morphology possible intermediate describing with 2012). reports al., individuals previous et of from observations (Abreu as between well field hybrids as visual of species, from occurrence both arose the investigate hypothesis to This was . study the of objective species. Another the of dispersal hybridization wide of Interspecific and case rapid 4.4 specific of the events In favored 2011). have al., may et pasture Donatti 1998, (Scariot, dispersers aculeata Specifically, contemporary considered 2001). are of which Bernal tribes. dispersal indigenous and the of recently, Morcote-Rios interests More the 1998; with Pearsall associated always ( and was Bocayauba that Piperno and reported 1995; both (1891) America, Rodrigues Moussa South Barbosa In and authors. several Kahn by ethnographic reports 1983; on and based is aculeata historical spp Acrocomia A. on of dispersion based of hypothesis are and The 1984) groups of al., indigenous et uses various Hill popular Bal´ee, 2013; selective of 2010; different different documented preferences and which processes the between accounts. domestication to different differentiation by due genetic consequently, them. and, possible pressures between use a flow anthropic through for gene with gone the have and associated argue would by contact to species limiting represented argument these isolation, group case, Another geographical this botanical speciation, In allopatric new bordering 2010). of al., Brazil a process et of of a (Lorenzi Paran´a region state emergence of western north and the the Par´a diffusion of to the part and explain species Argentina could northern countries, and these Paraguay Bolivia, of countries .aculeata A. .totai A. h xaso ftearclua rniri h rzla erd nsac fnwaesfrcattle for areas new of search in Cerrado Brazilian the in frontier agricultural the of expansion the , and and .ed.(edro 2005), (Henderson H.Wendl. Desmoncus .totai A. Lm ta. 2020). al., et (Lima Thus, . .totai A. yrvaigitreit ausfrfutcaatrsis ioin ta.(2013), al. et Ciconinni characteristics. fruit for values intermediate revealing by .aculeata A. aebe togyascae ihhmndsesos(emn,15;Janzen, 1856; (Seemann, dispersions human with associated strongly been have at Hnesne l 1995), al. et (Henderson Mart. .aculeata A. ol aetknohrpts pedn hog eta rzlfrom Brazil central through spreading paths, other taken have would .totai A. Caryota and .totai A. Sead 96 Pati˜no 2002). 1946; (Steward, .aculeata A. Syagrus .(anadStm,1999), Sytsma, and (Hahn L. 10 .totai A. .totai A. ed a bevdt epromdb ateherds, cattle by performed be to observed was seeds .aculeata A. at Hnesne l 95 Ram´ırez-Rodr´ıguez 1995; al. et (Henderson Mart. Hyospathe and copne ot-ot ninmigrations Indian North-South accompanied ) oae egahclycoet h population the to close geographically located .totai A. Wlhe l,21,Nsiet tal., et Nascimento 2013, al., et (Welch at Hnesn2004), (Henderson Mart. pce vra ntesympathetic the in overlap species .aculeata A. Attalea Copernicia .aculeata A. Hnesne l 1995), al. et (Henderson and at (Henderson Mart. .totai A. and Phoenix .totai A. species A. A. L. Posted on Authorea 9 Oct 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.160225751.15887529/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. nesnE,Topo A(02 oe-ae ehdfrietfigseishbisuigmultilocus using hybrids (2012) species identifying CA for 160:1217–1229. method Colombo Genetics model-based RM, A data. (2002) genetic Coelho EA Thompson MI., EC, Zucchi Anderson of system SM, mating Nucci and JA, https://doi.org/10.1590/S1415-47572012005000002 structure Azevedo-Filho genetic RHG, The Priolli AG, Abreu at available Framework Science Open References the at data genotyping microsatellite the https://doi.org/10.17605/OSF.IO/C4YE2 deposited have authors The accessibility Data providing kindly for genetic Wassner Diego of to purposes grateful are the We for criteria selection guide to Acknowledgements as species. well genetic both as the of germplasm, domestication assess of or to management conservation environments, first situ in ex new the found and to is that situ adaptation study to for this agronomic superior Additionally, variation of is changes. of characteristics climate source complementary current increase of important of with diversity an to function genotypes representing opportunity in for of an especially as appearance represents well the hybrids as for interest, interspecific both The of diversity Acrocomia. occurrence genus genetic the The of hybridization. systematics the interspecific understanding that towards show step significant results a represents study analyzed Our plants to needed of studies are number additional approach Conclusions multidisciplinary that reduced 5. a suggesting the using populations, and to plants) populations results. due by our (10 plants corroborate be Grande and may Campo populations more and detected sampling plants) hybrids Bra´una (13 between of the identified number in hybrids low interspecific This the species. between frequency. that both hybrids emphasize of natural border we coexistence of Finally, the sympatric emergence species reaching the the the enabling state, that where process, the assumed 2002), colonization of state Marquis, be southwest and can and (Oliveira it west Sul and Therefore, north, do centuries, massifs. the twentieth Grosso large to early Mato and in routes of nineteenth rail state late several the the from of with primarily opening territory, cite the its not of with do occupation Saint-Hilaire by of century process nineteenth rapid the species in the conducted of surveys presence floristic the the (1944), Hoehen of report suggest mutations low accumulate 3) the to (Table Currently, and or hybrids backcrossing hybrids interspecific for represent F2 time generations. sufficient to only many without chosen over of recent populations is presence hybridization in close The cross-species present the that hybrids. alleles by viable private corroborated of of as F number formation America, low and South as compatibility across (Petitet reproductive species, expansion studies between several species between relationship in recent genetic Hybridization reported more be 2010). been after may has contact al. Hybridization as secondary et 2015). divergence, Fussi al. allopatric 2002; et after (Taylor al. contact mechanisms secondary isolation by reproductive promoted complete develop to vergent .totai A. .aculeata A. .totai A. a aebe aiiae ytedseslof dispersal the by facilitated been have may .aculeata A. rmaohrcutybsdsBai n oso httegntcdvriyin diversity genetic the that show to and Brazil besides country another from a ewdl on hogottesaeo a al.Hwvr codn othe to according However, Paulo. Sao of state the throughout found widely be can .aculeata A. .aculeata A. and .totai A. ntesaeo a al.Hwvr h tt fSa al rsne a presented S˜ao Paulo of state the However, Paulo. Sao of state the in u eut otiuet h hieo etrsrtge o in for strategies better of choice the to contribute results Our . r eeial itntseiswt togeiec fpossible of evidence strong with species distinct genetically are cooi aculeata Acrocomia ST aus(.9 Tbe5,admitnneo interspecific of maintenance and 5), (Table (0.09) values .aculeata A. 11 .totai A. .aculeata A. ape rmdffrn ouaino Argentina. of population different from samples and Aeca)GntMlBo 35:119-121. Biol Mol Genet (Areaceae) .totai A. ntesaeo ˜oPuodrn this during S˜ao Paulo of state the in .aculeata A. a aebe h eutof result the been have may and .totai A. totai A .aculeata A. sobserved is r tlow at are .totai A. Posted on Authorea 9 Oct 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.160225751.15887529/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. ihRgoso hoooe A,2S n D nBedWet usJGnt plRs6:330-337. Res Gene Appl in Genet: Microsatellites J of Russ Location Wheat. and Bread Structure in the 2DS Homoeo- of and for Study 2BS, Markers 2AS, SSR the New Chromosomes on https://doi.org/10.1134/S2079059716030023 of of Based Development Regions (2016) Loci Rich J Gene Salsec WFZP YL, Orlova logous C, Pontc OB, Dobrovolskayaa Caracteriza¸c˜ao Campinas (2017) de Agronˆomico de Instituto da agromorfol´ogicos. Dissertation, PH https://doi.org/10.1007/s10722-005-5033-z Silva 53:361-1373. Evol Da Crop Resour Clo- Genet (2006) Ecuador. wild JC Western Pintaud and JL, in cultivated Lude˜na Pham between Y, B, proximity Vigouroux Biotech- C, genetic IV. Lara se Trees AM, Risterucci (eds) N, Y.P.S. Billotte Heidelberg. TLP, Bajaj Berlin, Couvreur In: 8:1-9. Springer, Palm). Forestry, Notes (Macauba and Res Species Agriculture BMC Acrocomia in (1996) Brazil. nology M of Melo populations OJ, natural Crocomo from macauba of pro- ID, diversity the Duarte Rog´eriohttps://doi.org/10.1186/s13104-015-1335-1 Genetic JB, for AF, (2015) palm Faria-Machado HR MF, tropical Bizzo Braga promising NTV, a Junqueira Macauba: https://doi.org/10.1051/ocl/2017038 R, Concei¸c˜ao (2018) 25:1-9. Antoniassi RA OCL LDHCS, Ferrari oil. BG, vegetable of Diaz duction LHC, Berton CA, Colombo of use sustainable struc- and Ferraz genetic conservation RAR, the spatial Silva diversity, for markers Da genetic aculeata microsatellite Understanding Sanson through RC, (2018) system FB Braga mating and Gandara RM, ture, PY, Portela Kageyama RH, MA, Roque Moreno BI, htt- EM, Aguiar 208–214. EV, Tambarussi NHP, 45: palm Coelho https://doi.org/10.1002/jsfa.4630 Brazilian Prod of 92:679–684. kernels Crops Agric and Food pulps Ind Sci the of J Brazil. compounds bioactive ( Sul, and guariroba acids Fatty of do species, (2012) contents N Grosso Jorge Bor- oil MC, Mato Coimbra F, and Galvani in L, Biometry biomes Bearari (2013) Pantanal MAM, MH, ps://doi.org/10.1016/j.indcrop.2012.12.008 Miyahira and CF, Naka Cerrados Tapeti LA, CHB, the Colnago Miranda AV, R, Roscoe sato SP, using Favaro of G, prospects Ciconini The (2015) AE Atabani ps://doi.org/10.1016/j.rser.2015.04.125 GC, Silva RP, leata Souza FA, Almeida C´esar AS, Vi¸cosa Maca´uba: Flora¸c˜ao, 2-10 de Frutifica¸c˜ao de Federal Conserva¸c˜ao 18: Polinizadores, reprodutiva Universidade e P´olen. Biol Biologia Thesis, de Plant (2013) ( AC BMC maca´uba palm Brito species. the Arecaceae in in transferability markers cross-species https://doi.org/10.1186/s12870-018-1509-9 EST-SSR and novel sequencing Colombo Guimar˜aes of Landscape. PGA, transcriptome MF, Development Carazzolle their de, (2018) and LM Carvalho CA People BR, Bazzo maca´uba ( of Campinas-UNICAMP. of palm of transcriptome Ecology comprehensive University a Historical Macaubest: (2018) A BR Bazzo Amazon: Press. Alabama the of of University Descriptas, AL: Forests Janeiro. Tuscaloosa, Cultural R´ıo de Botˆanico do (2013) Jardim Brazil. Bal´ee W Janeiro, no de cultivadas Rio novas desenhadas. Plantas e (1891) classificadas J Rodrigues FA https://doi.org/10.1016/j.bse.2017.02.005 Barbosa Vieira 71:47-154. in VA, Ecol flow Royo Syst gene DA, Biochem and Oliveira generation. structure LG, overlapping genetic Cota spatial Brand˜ao MM, Fine-scale EV, (2017) Menezes Afrˆanio F, J, Melo Ara´ujo MRG, mc´ b)anneil idee edtc nBai.RnwSsanEeg e 9 2320 htt- 1213-220. 49: Rev Energy Sustain Renew Brazil. in feedstock biodiesel non-edible (maca´uba) a Jc. od xMr.Cn ee 98981 https://doi.org/10.1007/s10592-018-1061-z 19:879-891. Genet Cons Mart. Ex Lodd. (Jacq.) ygu oleracea Syagrus ,jeriv´a ( ), cooi aculeata Acrocomia ygu romanzoffiana Syagrus ati gasipaes Bactris 12 cooi aculeata Acrocomia e cooi totai Acrocomia ut eeldb irstliemarkers microsatellite by revealed Kunth n maca´uba ( and ) cooi aculeata Acrocomia cooi aculeata Acrocomia cooi aculeata Acrocomia Aeaee:Aayi nan in Analysis (Arecaceae): o eod descritores de meio por cooi aculeata Acrocomia cooi acu- Acrocomia risfrom fruits Acrocomia .Thesis, ). using ) ). Posted on Authorea 9 Oct 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.160225751.15887529/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. edro J(05 utvraesuyo aytoye(ame.Ss o 06-3 htt- 30:60-83. Bot Syst (Palmae). htt- Calyptrogyne 965. of 91:953- study Bot multivariate J Am A (Palmae). (2005) Hyospathe ps://doi.org/10.1600/0363644053661913 AJ of analysis Henderson multivariate A (2004) ps://doi.org/10.3732/ajb.91.6.953 AJ Islands Verde Henderson Cape https://doi.org/10.1007/s10592-006- of 7:213-223. isolation Genet Genetic Cons markers. (2006) 9128-7 microsatellite JC by Pintaud Princepton revealed Jersey: N, (Arecaceae) New Billotte Americas the SA, of Palms Henderson the to Guide USA. Field Jersey, (1995) New R University, Bernal Caryota G, genus Galeano Asian A, Southeast Henderson the of biogeography 24:558-580. and Bot systematics Syst Molecular (Palmae). (1999) KJ Sytsma WJ, Hahn populations of https://doi.org/10.1139/b04-162 differentiation 83:155-162. and Bot variation Genetic the (2005) within K Oyama Gonz´alez-Rodr´ıguez Ar´ıas DM, A, Canarian the https://doi.org/10.1038/sj.hdy.6800507 tree of structure palm of and endemic variation assessment Allozyme status (2004) conservation PA Gonz´alez-Per´ez Sosa and Caujap´e-Castells J, distribution MA, https://doi.org/10.1007/s10531-011-0100- Diversity, 20:2705-2728. (2011) Conserv 6 FW Biodivers (Arecaceae). Stauffe palms RE, Paraguayan Spichiger gene long-distance I, and Gauto system, ( mating palm structure, of Genetic heart (2003) in R Genet flow Venkovsky Tree the D, refugia. Grattapaglia FA, using disconnected Gaiotto from individuals recolonisation of during https://doi.org/10.1007/s11295-009-0262-5 hybridization 6:439-450. clusters https://doi.org/10.1111/j.1365- and of Genomes Phylogeography contact of (2010) 14:2611–2620. secondary B number Europe: Heinze Ecol C, the Lexer Mol B, Detecting Fussi study. (2005) simulation J 99:125-132. a Goudet 294X.2005.02553.x Heredity analyses. STRUCTURE: S, 359–361. genetic software Regnaut population visuali- 4: for G, Resour for resource Evanno a Genet program as Cons EST-SSRs and (2007) method. website JM https://doi.org/10.1038/sj.hdy.6801001 Evanno Burke a JR, the Ellis HARVESTER: implementing STRUCTURE and (2012) output https://doi.org/10.1007/s12686-011-9548-7 BM STRUCTURE Caracteriza¸c˜ao VonHoldt 2:14-16. zing (2013) number DA, AC Especial Lea Earl Reports Guimar˜aes MF, Biotech LSS, Biochem Takahashi Maca´uba. BBR- FF, de http://dx.doi.org/10.5433/2316-5200.2013v2n3espp14 Lira Diferentes W, a Frutos Machado Biom´etrica de of JVF, from Santos Analysis maca´uba fruits Dos of https://doi.org/10.1590/s0100- (2011) 52:277-282. diversity Bras Genetic Agropec R 14:773-81. (2017) Pesq Goi´as, da Brazi. of Dirzo Letters 204x2017000400008 DFP state the Silva Ecol Assun¸c˜ao FMD, of da, municipalities JFN, HF mechanisms. 35 Marquitti Pinto EF, underlying MA, Reis and Dos Pizo modularity M, network: Galetti dispersal https://doi.org/10.1111/j.1461-0248.2011.01639.x PR, seed Guimaraes hyperdiverse CI, Donatti uru affinis Quercus hei canariensis Phoenix uep edulis Euterpe – uru laurina Quercus at) ee 43946 https://doi.org/10.1093/jhered/esg087 94:399-406. Hered J Mart.). Aeaee:ipiain o osrain eeiy93:307-315. Heredity conservation. for implications (Arecaceae): ( Fagaceae 13 ouu alba Populus ope nlzdwt ADmres a J Can markers. RAPD with analyzed complex ) L)and (L.) ouu tremula Populus hei atlantic Phoenix L)i Central in (L.) a Posted on Authorea 9 Oct 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.160225751.15887529/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. iaN e erwA,MnrnM 22)Gntcsrcueo w cooi ecoty- Acrocomia two Genomes16:56. of Genet structure Tree hybridi- https://doi.org/10.1186/s40693-014-0016-0 forests. Genetic plant 87:16. Nat of dry Hist patterns (2020) Chil chemical Rev seasonally and zation. MH morphological, and Genetic, (2014) Tovar-S´anchez Manfrin savannas L´opez-Caamal E A, AW, Brazilian across Meerow https://doi.org/10.1007/s11295-020-01446-y (Arecaceae) environments. de, new to pes NE adaptation for variation Lima of source a as Hybridization 315-336. (1966). Evolution, LC Birch RC, Lewontin https://doi.org/10.5897/AJFS2014.1212 FF 9:113-119. Lima from Sci ICF, extraction Food Moraes concept oil J EJ, and species Afr Arruda Sanjinez-Argando˜na characterization unified EJ, DS, content, the Baldivia Nutrients LR, of (2015) Silva IP, Application Oliveira (2012) CH, C Lescano system Varotto Mating the M, 2016. of Li https://doi.org/10.1111/j.1095-8312.2012.01887.x endemics T., 106:482-497. A, disjunct Soc E. Bertolli for F, Caixeta, lineages Prosser distinct V., reveals S, D. Foir M. M, Resende, https://doi.org/10.1093/jhered/esw038 Lega ( 527-536. N., 107, palm K. Hered macaw Kuki, J the programs. Y., of conservation S. composition Motoike, Popula- genetic M., and and C. Characterization E. Molecular Lanes, (2015) https://doi.org/10.1093/jhered/esu073 DR 106:102-112. Freitas Hered Palm, J Heredity C, Macaw Markers. distances? Nick the Microsatellites genetic NK, of estimate Kuki Structure to YS, tion used Motoike be ECM, should Lanes locus per alleles https://doi.org/10.1038/sj.hdy.6800009 many 88:62-65. How (2002) ST `aKalinowski p´eriph´erie- et sa Amazonie 71:161-177. en Biogeographica provoqu´ees l’homme palmiers constat. par de premier migrations Un Les (1995) F Moussa for F, method Kahn https://doi.org/10.1186/1471-2156- new 11:94. A Genetics components: BMC principal populations. of structured 11-94 analysis Bioinfor- genetically Discriminant data. of (2010) SNP analysis F genome-wide the Balloux of S, analysis Devillard the T, Jombart for tools new 1.3-1: https://doi.org/10.1093/bioinformatics/btr521 Adegenet 27:3070-3071. (2011) matics I Ahmed T, Jombart 184-185. pp Chicago, Press, Chicago diversity (1983) genetic estimating D for markers Janzen EST-SSR and 55:577-580. SSR Plantarum genomic do Biol. of Comparison Agricultura cucumber. (2011) in de J Li Secretaria L, Wang Botˆanica. J, S˜ao Paulo, Hu htt- de in Ach´e Instituto hunter-gatherers 21:447-450. of do diet Brazil S˜ao Relat´orio Annual Paulo, the Evol Estado. in (1944) variance FC Ecol Seasonal Hoehne (1984) https://doi.org/10.1007/BF01531269 Trends H 12:101-135. 8:256-259. Kaplan Technol Ecol Food M, concepts. Hum Paraguay. J Hurtado eastern Braz K, species composition. Hawkes acid K, fatty modern Hill and Bocai´uva, characterization (2005) oils: MLR of Macedo kernel MIL, and Ramos failure pulp MM, Filho Ramos the PA, Hiane On (2006) no. ps://doi.org/10.1016/j.tree.2006.05.011 SI/MAB J Bolivia. Beni, Estaci´on Biol´ogicaHey del Biosfera la D.C. Conserva- Washington, de Biodiversidad, Reserva Institution, (2000) Smithsonian C la Regi´on Miranda 4, de la JA, Comiskey en B, Manejo MacBryde ci´on y F, Dallmeier O, Herrera-MacBryde cooi vinifera Acrocomia cooi aculeata Acrocomia Cyl.i .H azn(d) ot ia aua itr.Ui.of Univ. history. natural Rican Costa (ed.), Janzen H. D. in (Coyol). cooi aculeata Acrocomia 14 rsiarepanda Brassica Aeaee,E iuGrpamCleto Using Collection Germplasm Situ Ex (Arecaceae), cooi aculeata Acrocomia :ipiain o reigadgenetic and breeding for implications ): Bascca)cmlx il Linn J Biol. complex. (Brassicaceae) cooi aculeata Acrocomia Jc. od Fruits. Lodd. (Jacq.) Jc. Lodd., (Jacq.) Posted on Authorea 9 Oct 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.160225751.15887529/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. aysG ur C lleM eog H oec ,SaeD abnrH arhn ,d Vries de SF, D, Madsen Taurchini AJ, Dumolin-Lapegue H, Lowe JD, Tabbener A, D, Deans Konig Slade B, JS, F, Dam Jensen Popescu van PG, MH, J, Goicoechea Pemonge Cottrell I, M, E, Gla Olalde for Coart A, RC, software Gillies Munro K, genetic R, G, Burg Population Matyas Finkelday S, S, Bordacs Excel. Cali, Fineschi M, in S, 326. Csaikl analysis RJ, genetic 6:288-295. No. Petit Notes CIAT 6: Ecol Mol GENALEX Neotropico. research. (2006) and del PE teaching nativos Smouse frutales R, los Peakall mi- de in dispersion resampling y data Historia Colombia and Neotropical conversion (2002) a RVM file of Patino (batch) 1.0. History for version package Natural Functions R and Useful datasets. Ecology PopGenKit: crosatellite (2012) Brazil: SR of Paquette York Cerrados New The Press, University (2002) Columbia RJ diversitySavanna. Marquis Genetic (2012) PS, PR Oliveira Ferreira EV, http://dx.doi.org/10.4238/2012.March.8.1 Menezes LA, 11:531-538. Res Rodrigues MM, of https://doi.org/10.1111/j.1471- Brandao populations in JAF, 8:224–226. Melo Resour DA, Ecol Oliveira Mol characterization macaw. and Development the (2008) MI from 8286.2007.01932.x Zucchi markers RH, Priolli microsatellites CA, of Colombo (2016) JA, EV Azevedo-Filho SM, Menezes Nucci MM, Brandao VA, Royo DA, http://dx.doi.org/10.4238/gmr.15017785 Oliveira AF, Junior sis Melo DS, Brasil. Tocantins. Neiva Kraho. Indigena A Territorio http://dx.doi.org/10.5380/rf.v40i1.17112 no World: palmeiras 40:209-220. New de etnobotanica Floresta the e in Riqueza Sites (2010) 17:1552-1563. Archaeological AR Nascimento at Ecol 67:309-350. (Palmae) Rev Palms Mol processes, Bot of Remains The neutral (2001) Review. species. R boundaries: Bernal plant G, species hybridizing Morcote-Rios of two analysis between genomic introgression population https://doi.org/10.1111/j.1365-294X.2008.03709.x and A EST-SSR divergence A(2008) and htt-adaptive gSSR Widmer https://doi.org/10.1371/journal.pone.0176197 New e0176197. 8:20. AM, (2017) 12, V Minder ONE Diversity Corre PLoS Le the plant species. B, markers. invasive Ambrosia Chauvel invasive the of G, other in microsatellite Bailly to diversity diversity R, genetic by Scalone genetic high F, reveal revealed Pernin markers and R, Causse characterization collection L, Meyer Molecular germplasm (2016) situ CD 10:3-32, ex ps://doi.org/10.3390/d8040020 Cruz Bot Econ palm SY, oil. of macaw Motoike source important FG, an palm: Mengistu coco Paraguay ( Mobocay´a or Biology (1956) Molecular KS in Markley Methods Genotyping. Plant J. Batley Protocols In: and Genotyping. SSR (2015) AS Mason Evaluation (2015) GTCP https://doi.org/10.1016/j.indcrop.2014.11.002 Coelho ( A, ecotypes Leal fruit LSA, two Takahashi JVF, of Odessa: Santos Nova FF, ed. Lira Guimar˜aes 1st MF, W, Palmeiras. Machado Arecaceae: Brasileira: Flora (2010) E Ferreira F, Plantarum. Kahn L, Noblick H, Lorenzi Paran´a do Federal Universidade sustent´avel. Thesis, (2006) GMAC Lorenzi Aeaee eei tutr n iest sn S oeua akr.GntMlRs15:1-11. Res Mol Genet markers. molecular SSR using diversity and structure genetic (Arecaceae) .Hmn rs,NwYr,N,p 78.https://doi.org/10.1007/978-1-4939-1966-6 77-89. pp NY, York, New Press, Humana ). cooi aculeata Acrocomia totai cooi aculeata Acrocomia and sclerocarpa Aeaee ntenrhr eino ia eas rzl ee Mol Genet Brazil. Gerais, Minas of region northern the in (Arecaceae) fmaca´uba ( of ) Jc. od xMr.-Aeaee ae aaoextrativismo o para bases Arecaceae: - Mart. ex Lodd. (Jacq.) 15 cooi aculeata Acrocomia mrsaartemisiifolia Ambrosia .IdCosPo 63:287–293. Prod Crops Ind ). .adcnb transferred be can and L. cooi emen- Acrocomia Methods 6 Posted on Authorea 9 Oct 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.160225751.15887529/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. A(07 eei iest n tutr fmcwpl:Ipiain o eei aiblt sampling. variability genetic for Moreira Implications ND, palm: Piovesan MDL, macaw Costa of http://dx.doi.org/10.1590/1806-90882017000500008 LO, structure 41:1-9. Oliveira Covent and Arvore De Street, diversity Rev PIV, Henrietta Genetic Good-god 5, (2017) CGI, Reeve, Carvalho MA Lovell RC, Lemos allies. LCC, their Silva and palms the of history Garden. Popular (1856) B Seemann https://doi.org/10.1002/tax.584020 to approach 58:1326-1343. morphological Taxon and molecular groups? plant combined mountain phylogeographical A European (2009) intricate R taxonomically Elven the PE, Garcia H, Solstad P, palm Schonswetter the of biology https://doi.org/10.2307/2388683 Reproductive (1991) palm 23:12-22. DJ the Biotropica Hay of E, Lleras phenologies AO, fruiting https://doi.org/10.2307/2388992 Scariot and 27:168-173. Flowering Biotropica (1995) consequences. fru- JD and Hay patterns palm de E, the Lleras of quimica AO, predation Scariot and e dispersal Seed fisica (1998) AO Scariot biometrica, bocaiuva Caracterizacao palmeira (2011) https://doi.org/10.1590/S0100-29452011000300040 da CCA Machado tos EJ, Sanjinez-Argandona ( Bocaiuva da Frutificacao e alba Floracao nicia (2009) PP Mattos 56:879-886. SM, Salis 32:1534-1542. Sci Archaeol Biol J (2005) Puna. CA Argentinean Syst Aschero MF, Rodriguez https://doi.org/10.1139/b11-043 89:545-557. hybridiza- Botany Introgressive (2011) patterns. delimitation. V PCR–RAPD Rodriguez FK, between Vega species RJ, Statistical. tion Jimenez for Foundation E, Tovar-Sanchez and R R, computing. Ramirez-Rodriguez statistical http://www.R-project.org/ for concepts URL environment and Austria. language Vienna, A Species Computing, R: (2018) Team Core (2007) R genotype de multilocus from https://doi.org/10.1080/10635150701701083 structure K population San of Queiroz Press, Inference Academic (2000) P 155:945–959. Neotropics. Genetics Donnelly lowland M, data. the Stephens in JK, agriculture Prichard of origins The B, (1998) Millan D Diego. distribucion K, diversidad, Pearsall Mejia Sur: D, JJ, del 15:7-29. Granville America Piperno Biol de E, Peru palmeras Ferreira Las Rev F, (2008) evolutiva. F Borchsenius historia Kahn R, FW, e Stauffer Bernal 267-286. L, N H, Noblick pp M, Balslev Billotte Denmark, on Moraes G, Press, J, Emphasis University Galeano Tregear with Aarhus JC, Markers, Pintaud F, Monocotyledons. SSR the Aberlenc-Bertossi ( in on Palm evolution S, Based 156:5-26. and Date (Arecaceae) Henderson phylogeny Manage the Diversity, Phoenix S, Ecol of Genus Barrow For Identity the T, the in Delimitation populations. Couvreur Species phylogeog- 2600 S, (2010) over Zehdi oaks: from white JC, data European Pintaud on in based variation diversity DNA of Chloroplast https://doi.org/10.1016/S0378-1127(01)00645-4 (2002) patterns A and Kremer raphy B, Ziegenhagen SMG, oPnaa.Crma mrp atnl ouiaoTcio78. Tecnico Comunicado Pantanal. Embrapa Corumba: Pantanal. no ) rhadulcis Brahea and cooi aculeata Acrocomia hei dactylifera Phoenix rhanitida Brahea cooi chunta Acrocomia Aeaee nMxc:eiec rmmrhlgcland morphological from evidence Mexico: in (Arecaceae) 16 .Sbr ,Ptre ,Bro ,DvsJ (Eds.): J. Davis A, Barfod G, Petersen O, Seberg ). aae alpinum Papaver Jc)Ld.RvBa rtc33:1023-1028. Frutic Bras Rev Lodd. (Jacq) Aeaee a aeilfrcr aigi the in making cord for material raw (Arecaceae) cooi aculeata Acrocomia cooi aculeata) Acrocomia cooi aculeata Acrocomia ..(aaeaee-aao informal or (Papaveraceae)-taxa s.l. rnie 42:5-8. Principes . oCrna( Caranda do e cooi aculeata Acrocomia nCnrlBrazil. Central in Coper- : Posted on Authorea 9 Oct 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.160225751.15887529/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. 0Duao SBai 0-2226W-4878 S -54.837889 S -52.252472 S -50.212278 S S -46.821667 -54.777361 S -48.11850 S -47.508472 S S W -45.864639 -44.739736 -22.26276 W -22.11100 W -21.482306 W W S -22.433333 -20.469056 -46.455111 W -22.276083 W 20 -19.986278 W 18 W -19.773972 13 -21.343028 17 10 Brazil 10 Brazil W Brazil -18.591389 Brazil Brazil 12 MS Brazil 16 12 SP Brazil SP MS SP Dourados Grande SP Campo Brazil Brazil 15 10 Fusquinha MG 9 Bra´una 8 MG Brazil MG coordinates Itapira Geographical 7 Brotas coordinates Geographical 6 Rifaina MG Plants 5 No. Ibituruna Minas 4 de Patos Country 3 Luz Estate* 2 1 Population ID of parameters. Description geographic 1. Table the in introgression and (2008) K structure Oyama O, geographic Dorado reveals DM, x Arias polymorphism D, DNA Pinero and R, Chloroplast Acute Esteban-Jimenez (2014) P, AC Mussali-Galante Arena from E, Tovar-Sanchez RM, extracted Muzzi oil WO, USA. https://doi.org/10.1016/j.fct.2014.10.026 the Schmitz Washington, of 74:320–325. MA, assessment Toxic tribes. Souz toxicity Chem Differences marginal AL, oral The (2012) 14:1-7. Barros days) 1 De (28 China ZY Vol. JC, subacute Stud Souza Indians. Zhang For De American DQ, GK, South Traesel of Zhang poplar. Handbook XM, in (1946) An diversity H J genetic WH, Steward assessing Bo in ZL, markers Wang https://doi.org/10.1007/s11632-012-0106-5 genomic-SSR M, doi:10.1007/s11632-012-0106-5. and Zhang EST-SSR XB, of Jiang YP, https://doi.org/10.1600/036364412X616828 the in Song 37:258-278. variation Bot genetic Syst and concepts. morphological taxonomical The tional (2012) J Zozomova-Lihova species K, Marhold polymorphic J, Kucera M, Slovak aaaJ,Bue ,Gre P(09 atrso yrdzto n nrgeso ewe invasive between introgression and hybridization of Patterns (2009) RP 56:330-338. Guries e pumila Nat J, territorio Am Brunet relationship. rio: JE, Brazil. and do Zalapa Janeiro, inbreeding margem de of Rio primeira Coefficients Indio-FUNAI. Na (1922) do (2013) S Museu Wright CEA Wedeze. Jr de Coimbra Xavante NM, povo they Flowers do why R, ecologia and Santo mean 312-328. Ventura they 39: what J, Welch Biol markers: Mol Microsatellite of Genet (2016) assessment CF useful. Munhoz nutritional so AL, and are Diniz Physical L, Santini (2015) MLC, Vieira A Pott EC, Costa potential. Da 5:89-95. economic MN, great Jordao of with PA, fruits (Are- genus Hiane a Acrocomia SA, of of Vianna resolution anatomy https://doi.org/10.1007/s00606-016-1369-4 taxonomic Leaf 303:233–248. the (2017b) Evol of to CA Syst 9:78-92. Characterization contribution Plant Colombo Biol additional Biometric LR, J an Int Noblick (2017a). SM, caceae): (Arecaceae). CA Species Carmelo-Guerreiro Colombo Acrocomia SA, of SMC, Vianna Mesocarp Guerreiro the A, of Morphoanatomy Pott and LHC, Fruits Berton SA, applications. Vianna and features plants: https://doi.org/10.1016/j.tibtech.2004.11.005 in markers 23:48-55. microsatellite Genic Biotechnol (2005) Trends ME Sorrells A, Graner RK, Varshney uru crassifolia Quercus Umca)adnative and (Ulmaceae) cooi aculeata Acrocomia irshieracioides Picris yrdcmlxi eio oay8:2-3.https://doi.org/10.1139/B07-128 86:228-239. Botany Mexico. in complex hybrid Jc. ode at Aeaee ae npl oo.VrBoiesNeotrop Biodivers Ver color. pulp on based (Arecaceae) Mart. ex Lodd (Jacq.) cooi sp. Acrocomia .rubra U. mrJBt9:1612.https://doi.org/10.3732/ajb.0800334 96:1116-1128. Bot J Amer . Cmoia,Lcuee nErp togycnrsswt tradi- with contrasts strongly Europe in Lactuceae) (Compositae, ouain ape o eei nlssadtheir and analyses genetic for sampled populations 17 cooi aculeata Acrocomia upi as Food rats. in pulp uru crassipes Quercus Ulmus Posted on Authorea 9 Oct 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.160225751.15887529/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. co7 :GAATTCTTTCC(C) 531200150120 0.112 0 0.105 0.227 0 0.211 0 0.280 0.006 0.267 2 0.261 2 0.464 0.244 0.808 3 3 0.415 0.783 0 0.048 0.818 7 0.575 0.792 2 0.994 311 3 0.500 0.565 2 10 loci. 204 microsatellite 0.467 13 using 1 taxa 55 Acrocomia for 11 estimates 275 diversity 3 Genetic expected = 0.204 3. HE Table content; information 5 55 heterozygosity polymorphic = observed 268 PIC = 0.603 alleles; HO Private 0.212 Pa= heterozygosity; (CCG)6 locus; per 168 7 alleles of 0.567 Na=number 57 0.827 GAAGAGTTTTCCTCTCTGCTC F: (GAA)5 0.803 55 398 1 ATCTGAGACTGAAGCTGATGA F: mean 0.382 EST-SSR 55 294 (GGC)9 0.253 2 0.760 GAGAAGGTAAGGTAGACGAGG F: 0.877 6 0.361 Acro278 270 (CCA)5 55 0.734 11 0.861 0.821 (CTG)12 GGCTAAGATCATTAATGGGAC F: 55 Acro280 0.795 3 GTATGGATGTCGTCGTTGAT F: 4 55 260–284 (ATC)5 Acro246 3 CAGATTATAGCACAGCTGGAG 316–346 F: 12 (CCT)8 14 Acro102 CCACCCTTAAGTTCATCTTCT F: 10 (GCC)8 56 Acro64 56 GTCATATGGCTGGTGAGATT 190–202 F: 273–316 Acro46 (CGAC)5 168–186 CAGACTACCAGGCTTCCAGC Acro20 F: (TC)15 56 56 S TTCTCAGTTTCGTGCGTGAG -57.563611 Acro16 S (AC)13(AG)14 F: -58.256639 56 mean gSSR ACTTGCAGCCCCATATTCAG F: (TC)20 Aacu45 GAATGTGCGTGCTCAAAATG F: (AG)16 Aacu38 TGCCACATAGAGTGCTTGCT F: W -19.351261 W Aacu26 -25.232972 Aacu12 (5 sequence Primer Aacu10 statistics 22 summary 11 Name and Primer primers locus. EST-SSR Argentina each eight at and diversity gSSR Formosa genetic five Brazil FMS= the coordinates the Sul, of Geographical do of Grosso Characteristics Mato 2. FMS MS= Table S˜ao coordinates Paulo, SP= Geographical Gerais, Minas MG= Plants MS *States: No. Country Formosa Estate* Corumb´a 12 11 Population ID .tti6.7 .9 .8 .1 .7 .8 .5 .8 16 0.583 H 0.551 Ar 0.287 9 5.070 0.650 1.211 0.466 I 3.288 0.208 6.692 Ne 3.880 65.077 0.943 Na 2.329 Total 5.308 totai A. 74.385 N Hybrids aculeata A. Specie :AGATGCCCTATTGCTCAAG R: GATCTGCATACATCCATCTGTR: ATGGATCAAGAACCCGAC R: GGACCATACCAATTTCCTTAGR: GACTATGGTAATGGACCAACAR: AGTGACTTGAAGCTCATGTTG R: GACTGTTGGTGTTAAGGTTCA R: GTTCCTTCTCTTGGTGGAAT R: TCATCATCGCAGCTTGACTC R: GGGAGGCATGAGGAATACAAR: CAGGAACAGAGGCAAGTTC R: AATGCCAAGTGACCAAGTCC R: CTACCACATCCCCGTGAGTT R: 3185652761094430250580.558 2 0.518 0.420 0.275 0.538 4.413 0.331 1.079 4.290 2.776 1.083 5.615 2.711 53.128 4.846 19.923 ´ -3 ´ oi A( TA Motif ) 18 O H E PA f ° )Apio ieN aPCH PIC Pa Na size Amplicon C) . .30410460.241 0.456 0.421 1.63 6.0 0.282 0.778 0.752 2.60 10.60 E H O Posted on Authorea 9 Oct 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.160225751.15887529/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. Argentina Corumb´a Dourados Grande Campo Fusquinha Bra´una Itapira Brotas Rifaina Ibituruna Minas Patos Luz F pairwise of Matrix microsatellites. 6. Table F Ob- (I), pairwise Index of Shannon’s (Ar), Matrix Hybrids richness allelic 5. (Ne), Table allele effective of mean (H (Na), served alleles different of Mean loci. microsatellite 13 using level Ob- population (I), the Index at Shannon’s estimates (Ar), diversity richness Genetic allelic (Ne), 4. Table allele effective of mean (H (Na), served alleles different of Mean pce ouainNN eIA H Ar I totai A. Ne Bra´una Na Hybrids N Population aculeata A. Species , O O ae n1 irstlie loci. microsatellites 13 on based n xetd(H Expected and ) n xetd(H Expected and ) l populations All Argentina Corumb´a Dourados Fusquinha Grande Campo Itapira Brotas Rifaina Ibituruna Minas Patos Luz .8 .1 .1 .4 .3 .8 .3 .9 .1 .1 .3 0.000 0.136 0.000 0.113 0.056 0.000 0.212 0.123 0.126 0.000 0.093 0.064 0.056 0.134 0.164 0.109 0.000 0.283 0.090 0.175 0.154 0.235 0.175 0.081 0.148 0.235 0.000 0.132 0.240 0.203 0.183 0.131 0.162 0.161 0.140 0.000 0.125 0.203 0.213 0.077 0.141 0.119 0.000 0.128 0.127 0.056 0.165 0.067 0.146 0.210 0.000 0.119 0.176 0.287 0.111 0.180 0.172 Argentina 0.076 Corumb´a 0.220 0.187 0.088 Dourados 0.168 0.235 0.000 Grande 0.226 0.146 Campo 0.150 0.194 Fusquinha Bra´una 0.102 0.167 Itapira 0.120 0.117 Brotas 0.119 0.142 Rifaina 0.000 0.116 Ibituruna 0.148 Minas 0.000 Patos Luz E .tti0090090.000 0.059 0.099 totai A. 0.000 Hybrids aculeata A. E eeoyoiy iainidx()adttlnme fpiaealls(PA). alleles private of number total and (f) index Fixation Heterozygosity, ) eeoyoiyadFxto ne (f). index Fixation and Heterozygosity ) ST ST 3223382120742610200470.485 0.576 0.417 0.455 0.516 0.250 0.222 0.545 2.601 0.487 2.880 0.316 0.774 0.474 0.464 0.916 0.369 3.450 2.162 0.460 0.299 2.880 0.406 1.088 3.308 0.306 0.274 2.970 3.615 0.295 2.928 13.282 0.561 0.482 2.960 0.891 2.440 5.000 9.385 0.465 0.291 0.347 0.924 2.407 0.719 0.466 20.923 0.361 0.162 3.090 2.328 3.923 2.059 0.368 0.204 1.840 0.931 4.308 19.000 0.537 2.846 0.203 2.260 0.483 2.384 15.769 0.392 0.457 2.280 0.636 1.574 3.923 8.538 0.659 0.401 0.244 0.640 1.848 2.154 11.385 0.316 0.273 2.580 1.954 2.769 13.923 0.158 2.350 0.805 2.538 11.154 2.110 0.682 2.144 0.570 1.807 3.077 8.615 1.628 2.846 11.538 2.692 14.154 15.000 aus(eo ignl among diagonal) (below values aus(eo ignl mn ouain ae n13 on based populations among diagonal) (below values .7 0.000 0.079 .aculeata A. 19 Hybrids .totai A. A . claaA totai A. aculeata O H E f and Posted on Authorea 9 Oct 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.160225751.15887529/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. 20 Posted on Authorea 9 Oct 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.160225751.15887529/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. 21