DOCSLIB.ORG

Phylogenetic Status of the Turkish Red Fox (Vulpes Vulpes), Based on Partial Sequences of the Mitochondrial Cytochrome B Gene

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Phylogenetic Status of the Turkish Red Fox (Vulpes Vulpes), Based on Partial Sequences of the Mitochondrial Cytochrome B Gene 64 (2): 273 – 284 © Senckenberg Gesellschaft für Naturforschung, 2014. 25.7.2014 Phylogenetic Status of the Turkish Red Fox (Vulpes vulpes), based on Partial Sequences of the Mitochondrial Cytochrome b Gene Osman İbiş 1, Coşkun Tez 2, * & Servet Özcan 2, 3 1 Graduate School of Natural and Applied Sciences, Erciyes University, Kayseri 38039, Turkey — 2 Department of Biology, Faculty of Sciences, Erciyes University, Kayseri 38039, Turkey — 3 Genome and Stem Cell Center, GENKÖK, Erciyes University, Kayseri 38039, Turkey — * Corresponding author: tezc(at)erciyes.edu.tr Accepted 25.v.2014. Published online at www.senckenberg.de/vertebrate-zoology on 15.vii.2014. Abstract Genetic diversity and multiple mitochondrial phylogroups of the red fox have been revealed from scattered locations in previous studies. There is a still lack of information about the genetic diversity and phylogeographic structure of the red fox in Asia Minor. We investigated the genetic diversity in the Turkish red fox using a part of the cytochrome b mitochondrial gene (375 bp), and attempted to evaluate the phylogeographic structure in various geographic ranges of the species with the use of sequences available from the GenBank from various geographic origins and our data. Bayesian and Network analyses of the cytochrome b sequences from Turkey and GenBank suggested that the red fox is divided into four main phylogroups. They are grouped accordingly: Group 1 (SW Anatolia, Turkey and Hokkaido, Japan), Group 2 (Eurasia and North America), Group 3 (only North America), and Group 4 (Vietnam). The majority of Turkish haplotypes grouped with those of Eurasia. Despite the great distance between the localities, two haplotypes from SW Anatolia, Turkey grouped with previously reported haplotypes from Hokkaido, Japan. The present study shows that the Turkish red fox is nested within two main phylogroups and exhibits a high genetic diversity. Key words Vulpes vulpes, Mitochondrial DNA, Cytochrome b, Turkey. Introduction The red fox Vulpes vulpes is one of the most widely dis- FERNANDES et al. 2008, AUBRY et al. 2009, SACKS et al. tributed canid species throughout Northern Hemisphere 2010, 2011, STATHAM et al. 2011, 2012, TEACHER et al. (also introduced to Australia in the 1800’s – WILSON & 2011, EDWARDS et al. 2012, YU et al. 2012a), control re- REEDER 2005, MACDONALD & REYNOLDS 2008). During gion (INOUE et al. 2007, KIRSCHNING et al. 2007, AUBRY the past two decades, V. vulpes has been one of the most et al. 2009, SACKS et al. 2010, 2011, STATHAM et al. investigated mammals from various regions. There are 2011, 2012, TEACHER et al. 2011, EDWARDS et al. 2012, comprehensive studies dealing with the phylogeograph- KUTSCHERA et al. 2013, GALOV et al. 2014), tRNA-threo- ic structure and pattern of genetic diversity in the red nine and tRNA-proline (INOUE et al. 2007), microsatellite fox populations, using allozyme or isozyme (FRATI et data (LADE et al. 1996, WANDELER et al. 2003, KUKEKOVA al. 1998, SIMONSEN et al. 2003), RAPD (GACHOT-NEVEU et al. 2004, WANDELER & FUNK 2006; SACKS et al. 2010, et al. 2009), mitochondrial DNA cytochrome (Cyt) b 2011, OISHI et al. 2011) and single nucleotide polymor- (FRATI et al. 1998, INOUE et al. 2007, PERRINE et al. 2007, phism (SACKS et al. 2011). ISSN 1864-5755 273 O. İbiş et al.: Phylogenetic status of Turkish red fox Fig. 1. Collection localities and distribution of red foxes (Vulpes vulpes) in Turkey. Map numbers are locality codes (see Table 1). Multiple studies based on mitochondrial DNA of red genetic diversity of Turkish red fox have not been previ- fox emphasize that there has been a considerable impor- ously investigated. Therefore, there is a lack of informa- tance to have a comprehensive picture of genetic varia- tion in this respect. In reference to the red fox dentition tion in the entire range of the species, when new insights study, SZUMA (2008) suggested that the modern red fox are added into phylogeographic and colonization patterns evolved either in Asia Minor (Anatolia) or North Africa of red fox with a wider biogeographic context (FRATI during the early Pleistocene. Consequently, to confirm et al. 1998, INOUE et al. 2007, PERRINE et al. 2007, AUBRY this, the phylogenetic status of Tur kish red fox should be et al. 2009, TEACHER et al. 2011, EDWARDS et al. 2012, YU revealed using different markers. et al. 2012a, KUTSCHERA et al. 2013). Some of the studies In this study, our primary purpose was to determine resulted in the formation of mitochondrial phylogroups, the magnitude of genetic diversity within the Turkish red which were classified as Holoarctic and/or Eurasian, fox by sequencing part of the Cyt b gene. With emphasis Nearctic, and Hokkaido (INOUE et al. 2007, AUBRY et al. on this information we provide new insights into phylo- 2009, YU et al. 2012a, KUTSCHERA et al. 2013). Although geographic processes which may be essential for a better there is a substantial inventory of mitochondrial data understanding of evolution. from Eurasia and North America (FRATI et al. 1998, INOUE et al. 2007, PERRINE et al. 2007, AUBRY et al. 2009, TEACHER et al. 2011, EDWARDS et al. 2012, YU et al. 2012, KUTSCHERA et al. 2013), there is a still lack of information Material and Methods about the genetic diversity and phylogeographic structure of the red fox from Turkey and the Middle East, except Israel. In this sense, more genetic and phylogeographic Localization, tissue sampling and DNA studies are needed to place these new mitochondrial data extraction in a wider context and to elucidate the current pattern of phylogeographic structure throughout the red fox’ range. Various tissues (ear, tail, skin and skeletal muscle) of 51 Therefore, it would not only be beneficial to determine the red foxes, which were road kills, were collected from genetic structure of different red fox populations but also 51 different localities in Turkey (Table 1, Fig. 1) during to focus on regional details, especially those in previously 2002-2010. Tissue samples had been stored in the cor- unsampled areas. Turkey is one of such areas. Because of responding author’s private collection at the Department its continental position, Turkey constitutes a mysterious of Biology, Faculty of Sciences, Erciyes University in and interesting area for mammalian biogeography due Kayseri, Turkey. to its climate, vegetation, heterogeneous topography and Total genomic DNA was extracted by using the geological history; together these unique factors produce DNeasy Blood and Tissue Kit (QIAGEN), following a biodiversity hotspot (MÉDAIL & QUÉZEL 1999, BILGIN the manufacturer’s instructions. A segment of the mito - 2011). Currently, there are at least 150 or more mamma- chondrial cytochrome (Cyt) b (375 base pairs) from each lian species from Turkey (KRYšTUFEK & VOHRALIK 2001, Turkish sample was amplified by polymerase chain reac- 2009, WILSON & REEDER 2005). Although there are a few tion (PCR) using the primer pair studies based on its morphology and distribution (ÖZKURT L14724 (5’ GATATGAAAAACCATCGTTG 3’) and et al. 1998, TEMIZER 2001), the phylogenetic status and H15149 (5’ CAGAATGATATTTGTCCTCA 3’) 274 VERTEBRATE ZOOLOGY — 64 (2) 2014 Table 1. List of Turkish samples and sequences/haplotypes used in the present study (* Map numbers are locality codes in Figure 1). Map Cyt b Tissue Locality Coordinate/Altitude number* haplotype 1 TR1 Tail Özlüce/Boğazlıyan/Yozgat N 39º 29.185’ E 35º 04.298’ H – 1099m 2 TR1 Muscle Boğazkale/Çorum N 39º 56.087’ E 34º 42.963’ H – 1215m 3 TR1 Tail Kemerhisar/Bor/Niğde N 37º 45.509’ E 34º 34.032’ H – 1128m 4 TR1 Tail Karabük N 41º 09.810’ E 32º 38.428’ H – 304m 5 TR1 Tail Bozca/Avanos/Nevşehir N 38º 44.331’ E 35º 02.312’ H – 1048m 6 TR1 Tail Avanos/Nevşehir N 38º 41.409’ E 34º 48.850’ H – 1012m 7 TR1 Tail Konya N 38º 01.340’ E 32º 51.829’ H – 1001m 8 TR1 Tail Konya N 37º 53.613’ E 32º 09.022’ H – 1565m 9 TR1 Tail Yozgat N 39º 48.504’ E 34º 46.330’ H – 1204m 10 TR1 Tail Tokat N 40º 03.833’ E 36º 29.187’ H – 1143m 11 TR1 Ear Çamlıbel/Tokat N 40º 04.261’ E 36º 29.011’ H – 1132m 12 TR1 Tongue Amasya N 40º 41.779’ E 35º 48.765’ H – 408m 13 TR1 Ear Bekdiğin/Havza /Samsun N 40º 59.861’ E 35º 46.125’ H – 725m 14 TR1 Muscle Eğirdir/Isparta N 37º 52.000’ E 30º 15.000’ 15 TR1 Tubercle Acıgöl/Nevşehir N 38º 32.691’ E 34º 29.174’ H – 1264m 16 TR1 Ear Aksaray N 38º 30.969’ E 34º 21.098’ H – 1227m 17 TR1 Ear Kayaönü Mah./Karaman N 37º 14.318’ E 33º 21.128’ H – 1039m 18 TR1 Ear Kirşehir N 39º 05.094’ E 34º 16.287’ H – 1200m 19 TR1 Ear Elmadağ/Ankara N 39º 55.348’ E 33º 15.923’ H – 1072m 20 TR1 Ear Eskişehir N 39º 30.058’ E 31º 13.424’ H – 1028m 21 TR1 Muscle Ilgın/Konya N 38º 18.062’ E 31º 39.356’ H – 1080m 22 TR1 Ear Eşmekaya/Aksaray N 38º 15.152’ E 33º 28.976’ H – 971m 23 TR1 Ear Çalış/Nevşehir N 38º 58.846’ E 34º 54.890’ H – 1316m 24 TR1 Ear Pınarbaşı/Kayseri N 38º 43.000’ E 36º 23.000’ 25 TR2 Tail Kızılırmak/Çankiri N 40º 21.169’ E 33º 58.767’ H – 555m 26 TR2 Tail Yeniyapan/Keskin/Kirikkale N 39º 35.319’ E 33º 42.013’ H – 922m 27 TR3 Tail Kandıra/Kocaeli N 41º 04.907’ E 30º 10.238’ H – 41m 28 TR4 Tail Isparta N 39º 03.203’ E 31º 25.615’ H – 1200m 29 TR4 Tail Dikici Köyü/Dinar/Afyon N 38º 00.140’ E 30º 11.522’ H – 940m 30 TR4 Ear Beyşehir/Konya N 37º 54.691’ E 31º 56.955’ H – 1270m 31 TR5 Tail Bahadin/Sarıkaya/Yozgat N 39º 36.066’ E 35º 15.707’ H – 1123m 32 TR5 Tail Isparta N 37º 52.539’ E 30º 30.730’ H – 935m 33 TR5 Tail Eğirdir/Isparta N 37º 50.753’ E 30º 51.579’ H – 922m 34 TR5 Muscle Arguvan/Malatya N 38º 46.000’ E 38º 16.000’ 35 TR5 Tail Taşköprü/Babaeski/Kirklareli
Load more

Recommended publications
  • Cranial Morphological Distinctiveness Between Ursus Arctos and U
    East Tennessee State University Digital Commons @ East Tennessee State University Electronic Theses and Dissertations Student Works 5-2017 Cranial Morphological Distinctiveness Between Ursus arctos and U. americanus Benjamin James Hillesheim East Tennessee State University Follow this and additional works at: https://dc.etsu.edu/etd Part of the Biodiversity Commons, Evolution Commons, and the Paleontology Commons Recommended Citation Hillesheim, Benjamin James, "Cranial Morphological Distinctiveness Between Ursus arctos and U. americanus" (2017). Electronic Theses and Dissertations. Paper 3261. https://dc.etsu.edu/etd/3261 This Thesis - Open Access is brought to you for free and open access by the Student Works at Digital Commons @ East Tennessee State University. It has been accepted for inclusion in Electronic Theses and Dissertations by an authorized administrator of Digital Commons @ East Tennessee State University. For more information, please contact [email protected]. Cranial Morphological Distinctiveness Between Ursus arctos and U. americanus ____________________________________ A thesis presented to the Department of Geosciences East Tennessee State University In partial fulfillment of the requirements for the degree Master of Science in Geosciences ____________________________________ by Benjamin Hillesheim May 2017 ____________________________________ Dr. Blaine W. Schubert, Chair Dr. Steven C. Wallace Dr. Josh X. Samuels Keywords: Ursidae, Geometric morphometrics, Ursus americanus, Ursus arctos, Last Glacial Maximum ABSTRACT Cranial Morphological Distinctiveness Between Ursus arctos and U. americanus by Benjamin J. Hillesheim Despite being separated by millions of years of evolution, black bears (Ursus americanus) and brown bears (Ursus arctos) can be difficult to distinguish based on skeletal and dental material alone. Complicating matters, some Late Pleistocene U. americanus are significantly larger in size than their modern relatives, obscuring the identification of the two bears.
    [Show full text]
  • Coyote Canis Latrans in 2007 IUCN Red List (Canis Latrans)
    MAMMALS OF MISSISSIPPI 10:1–9 Coyote (Canis latrans) CHRISTOPHER L. MAGEE Department of Wildlife and Fisheries, Mississippi State University, Mississippi State, Mississippi, 39762, USA Abstract—Canis latrans (Say 1823) is a canid commonly called the coyote. It is dog-like in appearance with varied colorations throughout its range. Originally restricted to the western portion of North America, coyotes have expanded across the majority of the continent. Coyotes are omnivorous and extremely adaptable, often populating urban and suburban environments. Preferred habitats include a mixture of forested, open, and brushy areas. Currently, there exist no threats or conservation concerns for the coyote in any part of its range. This species is currently experiencing an increasing population trend. Published 5 December 2008 by the Department of Wildlife and Fisheries, Mississippi State University Coyote location (Jackson 1951; Young 1951; Berg and Canis latrans (Say, 1823) Chesness 1978; Way 2007). The species is sexually dimorphic, with adult females distinctly CONTEXT AND CONTENT. lighter and smaller than adult males (Kennedy Order Carnivora, suborder Caniformia, et al. 2003; Way 2007). Average head and infraorder Cynoidea, family Canidae, subfamily body lengths are about 1.0–1.5 m with a tail Caninae, tribe Canini. Genus Canis consists length of about Young 1951). The skull of the of six species: C. aureus, C. latrans, C. lupus, coyote (Fig. 2) progresses through 6 distinct C. mesomelas, C. simensis, and C. adustus. developmental stages allowing delineation Canis latrans has 19 recognized subspecies between the age classes of juvenile, immature, (Wilson and Reeder 2005). young, young adult, adult, and old adult (Jackson 1951).
    [Show full text]
  • Periodic Status Review for the Steller Sea Lion
    STATE OF WASHINGTON January 2015 Periodic Status Review for the Steller Sea Lion Gary J. Wiles The Washington Department of Fish and Wildlife maintains a list of endangered, threatened, and sensitive species (Washington Administrative Codes 232-12-014 and 232-12-011, Appendix E). In 1990, the Washington Wildlife Commission adopted listing procedures developed by a group of citizens, interest groups, and state and federal agencies (Washington Administrative Code 232-12-297, Appendix A). The procedures include how species listings will be initiated, criteria for listing and delisting, a requirement for public review, the development of recovery or management plans, and the periodic review of listed species. The Washington Department of Fish and Wildlife is directed to conduct reviews of each endangered, threatened, or sensitive wildlife species at least every five years after the date of its listing. The reviews are designed to include an update of the species status report to determine whether the status of the species warrants its current listing status or deserves reclassification. The agency notifies the general public and specific parties who have expressed their interest to the Department of the periodic status review at least one year prior to the five-year period so that they may submit new scientific data to be included in the review. The agency notifies the public of its recommendation at least 30 days prior to presenting the findings to the Fish and Wildlife Commission. In addition, if the agency determines that new information suggests that the classification of a species should be changed from its present state, the agency prepares documents to determine the environmental consequences of adopting the recommendations pursuant to requirements of the State Environmental Policy Act.
    [Show full text]
  • Brain-Size Evolution and Sociality in Carnivora
    Brain-size evolution and sociality in Carnivora John A. Finarellia,b,1 and John J. Flynnc aDepartment of Geological Sciences, University of Michigan, 2534 C.C. Little Building, 1100 North University Avenue, Ann Arbor, MI 48109; bMuseum of Paleontology, University of Michigan, 1529 Ruthven Museum, 1109 Geddes Road, Ann Arbor, MI 48109; and cDivision of Paleontology and Richard Gilder Graduate School, American Museum of Natural History, Central Park West at 79th Street, New York, NY 10024 Edited by Alan Walker, Pennsylvania State University, University Park, PA, and approved April 22, 2009 (received for review February 16, 2009) Increased encephalization, or larger brain volume relative to body develop a comprehensive view of the evolutionary history of mass, is a repeated theme in vertebrate evolution. Here we present encephalization across 289 terrestrial species (including 125 an extensive sampling of relative brain sizes in fossil and extant extinct species) of Carnivora, providing an extensive sampling of taxa in the mammalian order Carnivora (cats, dogs, bears, weasels, fossil and living taxa for both major subclades: Caniformia and and their relatives). By using Akaike Information Criterion model Feliformia. selection and endocranial volume and body mass data for 289 species (including 125 fossil taxa), we document clade-specific Results evolutionary transformations in encephalization allometries. Akaike Information Criterion (AIC) model selection recovered These evolutionary transformations include multiple independent 4 optimal models (OM) within 2 log-likelihood units of the encephalization increases and decreases in addition to a remark- highest score (Table 1). There is broad agreement among the ably static basal Carnivora allometry that characterizes much of the OM with differences primarily in estimates of allometric slopes.
    [Show full text]
  • Evolutionary History of Carnivora (Mammalia, Laurasiatheria) Inferred
    bioRxiv preprint doi: https://doi.org/10.1101/2020.10.05.326090; this version posted October 5, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. This article is a US Government work. It is not subject to copyright under 17 USC 105 and is also made available for use under a CC0 license. 1 Manuscript for review in PLOS One 2 3 Evolutionary history of Carnivora (Mammalia, Laurasiatheria) inferred 4 from mitochondrial genomes 5 6 Alexandre Hassanin1*, Géraldine Véron1, Anne Ropiquet2, Bettine Jansen van Vuuren3, 7 Alexis Lécu4, Steven M. Goodman5, Jibran Haider1,6,7, Trung Thanh Nguyen1 8 9 1 Institut de Systématique, Évolution, Biodiversité (ISYEB), Sorbonne Université, 10 MNHN, CNRS, EPHE, UA, Paris. 11 12 2 Department of Natural Sciences, Faculty of Science and Technology, Middlesex University, 13 United Kingdom. 14 15 3 Centre for Ecological Genomics and Wildlife Conservation, Department of Zoology, 16 University of Johannesburg, South Africa. 17 18 4 Parc zoologique de Paris, Muséum national d’Histoire naturelle, Paris. 19 20 5 Field Museum of Natural History, Chicago, IL, USA. 21 22 6 Department of Wildlife Management, Pir Mehr Ali Shah, Arid Agriculture University 23 Rawalpindi, Pakistan. 24 25 7 Forest Parks & Wildlife Department Gilgit-Baltistan, Pakistan. 26 27 28 * Corresponding author. E-mail address: [email protected] bioRxiv preprint doi: https://doi.org/10.1101/2020.10.05.326090; this version posted October 5, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. This article is a US Government work.
    [Show full text]
  • Teacher Resource Guide
    7th Grade Teacher Resource Guide Sea Lions are part of a complex ecosystem that is impacted Theme: by human activities. Sustainable Seafood, Marine Debris, Plastic Pollution Critical Issue: Lesson 1: Family Matters . 3 Contents: Lesson 2: The Food Web Game . 7 Lesson 3: Sea Lion Inquiry . 20 Lesson 4: Ban the Bag . 30 Resources . 35 a division of Embarcadero at Beach St, San Francisco, CA 94133 | 415.623.5300 | aquariumofthebay.org 1 Aquarium of the Bay’s Education and Conservation mission statement: Department’s mission is to promote literacy in ocean and watershed health, climate change issues, and science career development through the lens of critical issues such as sustainable seafood, marine protected areas, marine debris and plastics, climate change and fresh water flows. Aquarium of the Bay thanks the S.D. Bechtel, Jr. Foundation acknowledgements: for their generous support for our K-12 programs and development of this Teacher Resource Guide. 2 Family Matters Enduring Understanding: Groups of animals, such as sea lions, can be classified into groups, such as lesson 1 pinnipeds, according to their various features. Materials Setup: • Poster paper 1. Prepare the art materials. • Pens, markers, pencils • 5 spoons of different types (i.e., wooden program outline: spoon, ladle, ice cream scoop) How do we classify things in the natural world? • With this activity, you will demonstrate the classification of animal families by using the classification of spoons as an analogy - Hold up a regular spoon and ask students to talk about its features as if they were describing it to someone who had never seen a spoon before.
    [Show full text]
  • Hall of North American Mammals Educator's Guide
    Educator’s Guide THE JILL AND LEWIS BERNARD FAMILY HALL OF NORTH AMERICAN MAMMALS Featuring Carnivorans INSIDE: • Suggestions to Help You Come Prepared • Essential Questions for Student Inquiry • Strategies for Teaching in the Exhibition • Map of the Exhibition • Online Resources for the Classroom • Correlation to Standards • Glossary amnh.org/namammals Essential QUESTIONS More than 25 Museum expeditions across this continent produced the specimens displayed in this hall’s magnificent dioramas. Many belong to the order of mammals called Carnivora (carnivorans), one of the most diverse orders within the mammal group. Use the Essential Questions below to connect the dioramas to your curriculum. What is a mammal? How have traits of the Carnivora helped You might have grown up thinking that all mammals share the order survive and diversify? certain traits, like fur and giving birth to live young, and As environments change over time, living things must most living mammals do. But what defines this diverse respond by migrating, adapting, or sometimes going group of animals is that they all are descended from a com- extinct. Different traits are favored in different habitats mon ancestor shared with no other living animals. Because and are passed on to future generations. For example, of this common ancestor (and unlike other vertebrates), carnivorans take care of their young until they are old all mammals have three middle ear bones. The group is enough to hunt, which helps them live to adulthood. divided into over 20 orders, which include Primates (e.g. Also, the diversity of their teeth has helped carnivorans humans), Rodentia (e.g.
    [Show full text]
  • Ebook Download Seals and Sea Lions Ebook
    SEALS AND SEA LIONS PDF, EPUB, EBOOK John Crossingham,Bobbie Kalman | 32 pages | 28 Feb 2006 | Crabtree Publishing Co,Canada | 9780778713234 | English | New York, Canada Seals and sea lions - CodyCross Answers Cheats and Solutions In one legend, seals, whales and other marine mammals were formed from her severed fingers. The Greeks associated them with both the sea and sun and were considered to be under the protection of the gods Poseidon and Apollo. Pinnipeds can be found in facilities around the world, as their large size and playfulness make them popular attractions. Zoologist Georges Cuvier noted during the 19th century that wild seals show considerable fondness for humans and stated that they are second only to some monkeys among wild animals in their easily tamability. Francis Galton noted in his landmark paper on domestication that seals were a spectacular example of an animal that would most likely never be domesticated despite their friendliness and desire for comfort due to the fact that they serve no practical use for humans. Some modern exhibits have rocky backgrounds with artificial haul-out sites and a pool, while others have pens with small rocky, elevated shelters where the animals can dive into their pools. More elaborate exhibits contain deep pools that can be viewed underwater with rock-mimicking cement as haul-out areas. The most common pinniped species kept in captivity is the California sea lion as it is both easy to train and adaptable. Other species popularly kept include the grey seal and harbor seal. Larger animals like walruses and Steller sea lions are much less common.
    [Show full text]
  • Biogeography and Conservation of the Pinnipeds (Carnivora: Mammalia)
    Biogeography and conservation of the pinnipeds (Carnivora: Mammalia) by Jeffrey W. Higdon A Thesis submitted to the Faculty of Graduate Studies of The University of Manitoba in partial fulfilment of the requirements of the degree of DOCTOR OF PHILOSOPHY (PhD) Department of Environment and Geography University of Manitoba Winnipeg Copyright © 2011 by Jeffrey W. Higdon Abstract This thesis examines the biogeography of world pinnipeds, a unique group of marine mammals that have adapted to marine foraging while maintaining terrestrial (land or ice) habitat links. Comparative analyses of species range sizes controlled for phylogenetic relationships using a multi-gene supertree with divergence dates estimated using fossil calibrations. Adaptations to aquatic mating and especially sea ice parturition have influenced range size distribution, and ranges are larger than those of terrestrially mating and/or pupping species. Small range size is endangering for many taxa, and at risk pinnipeds are mainly terrestrial species with small ranges. Ancestral state reconstructions suggest that pinnipeds had a long association with sea ice, an adaptation that would have allowed early seals to expand into novel habitats and increase their distribution. Range sizes exhibit a strong Rapoport effect (positive relationship between range size and latitude) at the global scale, even after controlling for phylogeny and body size allometry. A latitudinal gradient in species diversity cannot explain the Rapoport effect for global pinniped ranges, as diversity is highest at mid-latitudes in both hemispheres. These regions are characterized by marginal ice zones and variable climates, supporting a mix of pagophilic and temperate species. The climatic variability hypothesis also did not explain the Rapoport effect.
    [Show full text]
  • Canids of the World Wolves, Wild Dogs, Foxes
    INTRODUCTION © Copyright, Princeton University Press. No part of this book may be distributed, posted, or reproduced in any form by digital or mechanical means without prior written permission of the publisher. RECOGNITION The Canid family is a lineage of terrestrial carnivorans, adapted for swift running, which includes Wolves, Coyotes, Jackals, Foxes, Dogs, Dingoes, Dholes and other Dog-like mammals, with a total of 13 genera and at least 37 extant species. They are mostly social animals, living together in family units or small groups and behaving cooperatively. Most are seasonal breeders producing a single litter each year. They exhibit many reproductive and behavioral traits uncommon in other mammals, such as monogamy with paternal care, long-term incorporation of young adults into the social group, alloparenting, inhibition of reproduction in subordinate individuals, monoestrus, and a copulatory tie. They inhabit temperate and tropical forests, savanna, tundra and deserts throughout the world, with the exception of some oceanic islands and Antarctica. Most Canids feed on mammalian prey, but vegetable matter, carrion, and invertebrates are also an important source of food in many species. Size and body shape (fig. 1): Canids vary widely in size, from the Gray Wolf, which may be up to 160 cm long, and can weigh up to 80 kg, to the diminutive Fennec Fox, which may be as little as 24 cm in length, and weighs less than 1 kg. Most Fox species weigh 1.5 to 9.0 kg, while most other species are 5 to 27 kg. Body lengths (without tail) range between 35 and 160 cm, and tail lengths are approximately 12 to 56 cm.
    [Show full text]
  • Molecular Phylogeny of the Carnivora (Mammalia): Assessing the Impact of Increased Sampling on Resolving Enigmatic Relationships
    Syst. Biol. 54(2):317–337, 2005 Copyright c Society of Systematic Biologists ! ISSN: 1063-5157 print / 1076-836X online DOI: 10.1080/10635150590923326 Molecular Phylogeny of the Carnivora (Mammalia): Assessing the Impact of Increased Sampling on Resolving Enigmatic Relationships JOHN J. FLYNN,1,2,4 JOHN A. FINARELLI,2,1 SARAH ZEHR,1 JOHNNY HSU,3,1 AND MICHAEL A. NEDBAL1,5 1Department of Geology, The Field Museum, 1400 S. Lake Shore Drive, Chicago, Illinois 60605, USA; E-mail: jfl[email protected] (J.J.F.) 2Committee on Evolutionary Biology, The University of Chicago, 1025 E. 57th Street, Chicago, Illinois 60637, USA 3Biological Sciences Collegiate Division, The University of Chicago, Chicago, Illinois 60637, USA 4Current Address: Division of Paleontology, American Museum of Natural History, Central Park West at 79th Street, New York, NY 10024, USA 5Current Address: P.O. Box 637, Maple Valley, Washington 98038, USA Abstract.—This study analyzed 76 species of Carnivora using a concatenated sequence of 6243 bp from six genes (nuclear TR-i-I, TBG, and IRBP; mitochondrial ND2, CYTB, and 12S rRNA), representing the most comprehensive sampling yet undertaken for reconstructing the phylogeny of this clade. Maximum parsimony and Bayesian methods were remarkably congruent in topologies observed and in nodal support measures. We recovered all of the higher level carnivoran clades that had been robustly supported in previous analyses (by analyses of morphological and molecular data), including the monophyly of Caniformia, Feliformia, Arctoidea, Pinnipedia, Musteloidea, Procyonidae Mustelidae sensu stricto, and a clade of (Hyaenidae (Herpestidae Malagasy carnivorans)). All of the traditional “families,”+ with the exception of Viver- ridae and Mustelidae,+ were robustly+ supported as monophyletic groups.
    [Show full text]
  • A Review of Bear Evolution
    A REVIEWOF BEAR EVOLUTION BRUCEMCLELLAN, Forest Sciences Research Branch,Revelstoke Forest District,RPO#3, Box 9158, Revelstoke, BC VOE3KO DAVIDC. REINER,U.S. Fish and WildlifeService, NS 312, Universityof Montana, Missoula, MT Abstract. Ursidae is a young family, evolving from early canids during the late Oligocene and early Miocene, about 20-25 million years ago. The family has frequently been divided into subfamilies. Although debated, these often include: (1) Hemicyoninae, (2) Agriotheriinae, (3) Tremarctinae,(4) Ursinae, and (5) Ailuropodidae. Based on scatteredliterature published over the past century, we trace the evolutionary lineage of the various genera and species found in these subfamilies; most are extinct, 8 species remain. Many if not most of the relationships have been disputed for many years and we may be far from the definitive history. Speculatedcauses of extinction usually involved climate change and competition. Primitive man may have been the major competitorof some extinct species and modem man is definitely a major influence on bear evolution today. Int. Conf. Bear Res. and Manage.9(1):85-96 Members of the bear family, Ursidae, currently however, have separatedthese 2 families but frequently inhabit North America, Europe, Asia, and South disagree on where the line between canids and ursids, America. Using generic names suggested by Hall and many other taxonomic boundaries, should be (1981), Nowak and Paradiso (1983), Goldman et al. drawn. Recently, the families Ursidae and Otariidae (1989), and Wayne et al. (1989), species found in Asia have been placed in the superfamily Ursoidea. These include the brown bear (Ursus arctos), Asiatic black 2 families have been joined with members of the bear (U.
    [Show full text]