Regular Article Broad but Distinct Role of Pregnane X Receptor on the Expression of Individual Cytochrome P450s in Human Hepatocytes

Drug Metab. Pharmacokinet. 22 (4): 276–286 (2007).

Koki KOJIMA1,2, Kiyoshi NAGATA1,3,TsutomuMATSUBARA1 and Yasushi YAMAZOE1,* 1Division of Drug Metabolism and Molecular Toxicology, Graduate School of Pharmaceutical Sciences, Tohoku University, Miyagi, Japan

Full text of this paper is available at http://www.jstage.jst.go.jp/browse/dmpk

Summary: In the present study, we have utilized a target selective human pregnane X receptor-siRNA (hPXR-siRNA)-adenovirus expression system to examine the contribution of hPXR on the gene regulation of drug-metabolizing P450s in human hepatocytes. Introduction of the hPXR-siRNA adenoviral vector reduced the level of PXR mRNA. After infection with Ad hPXR-siRNA, the basal and ligand-activated CYP2A6, CYP2C8, CYP3A4 and CYP3A5 mRNA levels were decreased signiˆcantly in dose-dependent manners, whereas CYP2B6, CYP2C9 and CYP2C19 mRNA levels were moderately in‰uenced after infection with Ad hPXR-siRNA. These data suggest the distinct PXR in‰uences on the regulation of these genes. The expression of CYP1A2 and CYP2D6 mRNA were not aŠected by the introduction of hPXR-siRNA, suggesting that PXR plays no functional role in the expression of either of these genes. This is the ˆrst report to compare simultaneously the relative contribution of hPXR on the expression of nine forms of P450 in primary cultured human hepatocytes. Mutual sharing among nuclear receptors of their binding cis-elements becomes clear now. Thus, the present method using the combination of adenovirus-mediated hPXR-siRNA expression and human hepatocytes may oŠer clear information on the relative role of nuclear receptors such as hPXR on the expression of drug metabolizing genes.

Key words: PXR; CYP3A4; P450; siRNA; human hepatocytes

including drugs (e.g., macrolide antibiotics, antimycot- Introduction ics, glucocorticoids), herbs (e.g., St. John's wort) and It is now widely recognized that a number of nuclear pesticides (e.g., DDT, pyributicarb).1,3–5) Ligand-activa- receptors are involved in P450 gene regulation. Among tion of PXR andWor CAR stimulates expression of the these nuclear receptors pregnane X receptor (PXR; target gene through binding to elements located in the NR1I2) and constitutive androstane receptor (CAR; regulatory regions following dimerization with retinoid NR1I3) are major determinants in the expression of X receptor (RXRa;NR2B1).6–8) genes associated with various aspects of drug meta- The induction of CYP3A4 and CYP2B6 is mainly bolism, including oxidative metabolism, conjugation, mediated through activation of PXR and CAR, respec- and transport.1) PXR is expressed mainly in the liver and tively.9–14) However,ithasbeenreportedthatPXRand intestine, where it plays important roles in detoxiˆcation CAR are also involved in basic transactivation of both and elimination of xenobiotics from the body.2) PXR is CYP2B6 and CYP3A4 genes.15–17) Hepatic levels of activated by a structurally diverse array of xenobiotics, other P450, such as CYP2A6, CYP2C8, CYP2C9 and

Received; March 15, 2007, Accepted; May 22, 2007 *To whom correspondence should be addressed: Yasushi YAMAZOE, Division of Drug Metabolism and Molecular Toxicology, Graduate School of Pharmaceutical Sciences, Tohoku University, Aramaki-aoba 6-3, Aoba-ku, Sendai, Miyagi 980-8578, Japan. Tel. ＋81-22-795-6827, Fax. ＋81-22-795-6826, E-mail: yamazoe＠mail.tains.tohoku.ac.jp 2Current address: Exploratory Toxicology & DMPK Research Laboratories, Tanabe Seiyaku Co., Ltd., 2-50 Kawagishi 2-chome, Toda, Saitama 335-8505, Japan. 3Current address: Tohoku Pharmaceutical University, 4-4-1 Komatsushima, Aobaku, Sendai, Miyagi 981-8558, Japan. Abbreviations used are: PXR, pregnane X receptor; CAR, constitutive androstane receptor; HNF4a, hepatocyte nuclear factor-4a;RXRa,retinoid X receptor-a; FXR, farnesoid X receptor; GRa, glucocorticoid receptor-a; SHP, small heterodimer partner; P450, cytochrome P450; DMSO, dimethyl sulfoxide; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; siRNA, small interfering RNA; Ad hPXR-siRNA, hPXR- siRNA-expression adenovirus; PB, phenobarbital; CLO, clotrimazole; PCR, polymerase chain reaction; RT-PCR, reverse transcription- polymerase chain reaction; TCID50,50z titer culture infectious dose; MOI, multiplicity of infection.

276 Contribution of PXR to P450 Gene Expression 277

CYP2C19 are also increased after treatment with rifam- sion andWor induction of nine drug-metabolizing P450s picin, a typical PXR activator.11,13,14) It is also reported to examine diŠerences in the contribution of PXR in the that CYP2C8, CYP2C9 and CYP2C19 are transactivat- expression of these genes. ed through CAR.18,19) At present, the exact contribution Materials and Methods of individual nuclear receptors on individual P450 gene expression in human liver remain unclear. Materials: William's medium E, insulin, transfer- For studies of gene transcriptional activation, report- rin, selenium, dexamethasone, phenobarbital and er gene assay systems are mostly used to investigate clotrimazole were obtained from Sigma Chemical (St. promoter and enhancer elements to provide information Louis, MO). Matrigel was purchased from BD Bioscien- on the gene regulation. The results, however, do not al- ce-Discovery Labware (Bedford, MA). Penicillin-Strep- ways re‰ect the induction proˆle that was observed in tomycin was purchased from Gibco BRL (Gaithersburg, vivo, possibly because of established cell lines, arti- MD). KHEM5310 was purchased from KAC (Shiga, ˆcially fused genes andWor over-expressed transfac- Japan). tors.20,21) In most studies of hepatic P450 gene regula- Cell cultures: Cryopreserved human hepatocytes tion, the HepG2 cell line, which is derived from human (lot. 582; Caucasian, female, aged 60 years) were pur- hepatocellular carcinoma, has been used.17–19,22–25) Ex- chased from XenoTech LLC (Lenexa, KS), and thawed pression of PXR is detectable but CAR is below the as recommended by the vendor prior to use for incuba- limit of detection in HepG2 cells.5) In addition, CAR tions. Viability of the cryopreserved hepatocytes was at translocates spontaneously to the nucleus in many cell least 85z at the start of the incubation. The hepatocytes lines, even after the over-expression. The nuclear trans- pellets were resuspended in KHEM5310 medium location of CAR is tightly regulated in the liver and pri- (KAC). Hepatocytes were plated at 2.5×105 cellsWwell mary hepatocytes.26) Recently, we have reported that the on 24-well plates, coated with collagen, type I (Iwaki, induction of both human CYP1A1 and CYP1A2 are Tokyo, Japan). Cells were allowed to attach for 4 h in a controlled simultaneously through common regulatory humidiˆed atmosphere of 5z CO2 at 379C. Culture dis- elements found inside the CYP1A1 gene.25) This ˆnding hes were gently mixed by swirling, and medium contain- suggests a possibility that gene expression might be ing unattached cells was then aspirated. Fresh ice-cold aŠected by neighboring genes. In addition, inconsistent serum-free William's medium E containing 0.1 mMdex- results are obtained from reporter gene assays using es- amethasone, 6.25 mgWmL insulin, 6.25 mgWmL transfer- tablished cell lines and from those in the liver. rin, 6.25 ngWmL selenium and 50 mgWmL Matrigel was To overcome these di‹culties, human primary added to each dish. hepatocytes are preferred for the analysis of the func- For virus experiments, the day after seeding, cells tion of PXR in the gene regulation of P450s. When were infected with 0.05 mL of the hPXR-siRNA hepatocytes are cultured under conditions that restore adenovirus expression vector (Ad hPXR-siRNA) stock 6 near-normal hepatocellular morphology and the expres- solution (1×10 TCID50 Wwell) for 1 h, and then medium sion of liver-speciˆc genes, P450 enzymes can be detect- was added to each well and the cells were cultured for an ed in hepatocytes in a manner re‰ecting that in vivo in additional 72 hrs. Multiplicity of infection (MOI) was terms of the magnitude and speciˆcity of P450 induc- calculated by dividing the TCID50 by the number of tion.27,28) cells. For the induction study including virus, medium Recently, target selective knock-down technology, us- containing 1 mM phenobarbital, 10 mM clotrimazole, or ing small interfering RNA (siRNA), has been devel- 0.1z (vWv) DMSO (vehicle alone) was added to the oped.29) This siRNA technology is applicable to speciˆ- wells 48 hrs after virus infection and cultured for an ad- cally suppress the expression of PXR and may contrib- ditional 24 hrs. 0.1z DMSO had little eŠect on expres- ute to the elucidation of the involvement of PXR in sion of target mRNAs. transcriptional activation of P450 genes involved in Construction of the Ad hPXR-siRNA and the infec- drug metabolism and disposition. However, the e‹cien- tion conditions have been reported previously.5) Ad cy of siRNA is largely dependent on the delivery system hPXR-siRNA strongly suppressed the expression of transports the siRNA into target cells. Adenoviral vec- hPXR protein to a similar degree as that of the mRNA. tors represent one of the most sophisticated expression Ad LacZ, which expresses b-galactosidase, was pro- systems available today.30) vided by Dr. Izumi Saito (Tokyo University). We The present study aims to investigate and understand demonstrated that this adenovirus and an adenovirus how PXR contributes to the regulation of endogenous expressing a non-targeting siRNA, mouse st2b2-target- human P450 genes in primary cultured hepatocytes. For ing siRNA, which does not match any human mRNA, this purpose we have constructed the hPXR-siRNA did not aŠect any of the mRNA levels evaluated in this adenovirus expression vector to selectively suppress experiment (data not shown). Thus, we used Ad LacZ as PXR expression and examined the eŠects on the expres- a control for the RNA knockdown experiments. 278 Koki KOJIMA, et al.

Table 1. Primers and Probes for TaqMan analysis

Gene Probe Sequence Accession No. Reference

PXR Forward primer GGCCACTGGCTATCACTTCAA AF061056 39 Reverse primer TTTCATGGCCCTCCTGAAAA Probe TCATGACATGTGAAGGATGCAAGGGC CAR Forward primer GCAAGGGTTTCTTCAGGAGAAC NM_005122 Reverse primer CTTCACAGCTTCCAGCAAAGG Probe TCAGCAAAAGCATTGGTCCCACC HNF4a Forward primer GAGGAACCAGTGCCGCTACT NM_000457 Reverse primer TCTGGACGGCTTCCTTCTTC Probe CTCAAGAAATGCTTCCGGGCTGGC RXRa Forward primer AAGGACCGGAACGAGAATGA NM_002957 Reverse primer ATCCTCTCCACCGGCATGT Probe CGACCAGCAGCGCCAACGAG FXR Forward primer AGGTAGCAGAGATGCCTGTAACAA NM_005123 Reverse primer CACAGCTCATCCCCTTTGATC Probe ATGGGCGCGTCAGCAGGG SHP Forward primer GGTGCAGTGGCTTCAATGC NM_021969 Reverse primer GGTTGAAGAGGATGGTCCCTTT Probe CCTTCTGGAGCCTGGAGCTTAGC GRa Forward primer GAGGAGGAGCTACTGTGAAGGTTT NM_000176 Reverse primer GCTGCTTGGAGTCTGATTGAGA Probe TGCGTCTTCACCCTCACTGGCTGT VDR Forward primer TAGAGCTGTCCCAGCTCTCCAT NM_000376 Reverse primer TGACCTTTTGGATGCTGTAACTGA Probe CTGCCCCACCTGGCTGACCT CYP1A2 Forward primer TGTTCAAGCACAGCAAGAAGG AF182274 38 Reverse primer TGCTCCAAAGACGTCATTGAC Probe CTAGAGCCAGCGGCAACCTCATCCCA CYP2A6 Forward primer TTTTGGTGGCCTTGCTGGT AF182275 38 Reverse primer GGAGTTGTACATCTGCTCTGTGTTCA Probe TGCCTGACTGTGATGGTCTTGATGTCTGTT CYP2B6 Forward primer CCCCAAGGACACAGAAGTATTTC AF182277 38 Reverse primer GATTGAAGGCGTCTGGTTTTTC Probe TGAGCACTGCTCTCCATGACCCACACTA CYP2C8 Forward primer GGACTTTATGGATTGCTTCCTG NM_000770 38 Reverse primer CCATATCTCAGAGTGGTGCTTG Probe TTGGCACTGTAGCTGATCTATTTGTTGCTGGA CYP2C9 Forward primer GACATGAACAACCCTCAGGACTTT M61857 38 Reverse primer TGCTTGTCGTCTCTGTCCCA Probe AAAACACTGCAGTTGACTTGTTTGGAGC CYP2C19 Forward primer GAACACCAAGAATCGATGGACA NM_000769 38 Reverse primer TCAGCAGGAGAAGGAGAGCATA Probe TAATCACTGCAGCTGACTTACTTGGAGCTGGG CYP2D6 Forward primer CCTACGCTTCCAAAAGGCTTT NM_000106 38 Reverse primer AGAGAACAGGTCAGCCACCACT Probe CAGCTGGATGAGCTGCTAACTGAGCACA CYP3A4 Forward primer GATTGACTCTCAGAATTCAAAAGAAACTGA AF182273 38 Reverse primer GGTGAGTGGCCAGTTCATACATAATG Probe AGGAGAGAACACTGCTCGTGGTTTCACAG CYP3A5 Forward primer CCTTACCCCAGTTTTTGAAGCA NM_000777 38 Reverse primer TCCAGATCAGACAGAGCTTTGTG Probe TTTCTTTCGAATTCTGGGAGTCAATCATC ABCB1 Forward primer GTCCCAGGAGCCCATCCT NM_000927 40 Reverse primer CCCGGCTGTTGTCTCCATA Probe TTGACTGCAGCATTGCTGAGAACATTGC ABCC2 Forward primer ACTGTTGGCTTTGTTCTGTCCA NM_000392 38 Reverse primer CAACAGCCACAATGTTGGTCTCTA Probe CTCAATATCACACAAACCCTGAACTGGCTG GAPDH Forward primer TCATGGGTGTGAACCATGAGA AF261085 38 Reverse primer ACTGTGGTCATGAGTCCTTCCA Probe CAGCCTCAAGATCATCAGCAATGCCTC Contribution of PXR to P450 Gene Expression 279

Real-time polymerase chain reaction: At the end of the culture period, the medium was removed and total RNA was extracted from human hepatocytes using TRIzol reagent (Invitrogen) and RNeasy Mini Kits (Qia- gen) according to manufacturers' protocols. Optical density (OD) measurements were determined on the RNA samples at 260 nm. For the real-time PCR analysis, the TaqMan One-Step RT-PCR Master Mix rea- gents Kit (Applied Biosystems) with gene-speciˆc primers and probes were used in a reaction volume of 25 mLWtube. The primer pairs and the TaqMan probes for the target mRNAs are listed in Table 1. The primers and ‰uorogenic probes for the real-time PCR were pur- Fig. 1. Time-course of PXR mRNA expression in cultured human chased from Operon Technologies, Inc. (Alameda, hepatocytes after transfection with hPXR-siRNA adenovirus expres- CA). The real-time probe consisted of a reporter dye sion. Human hepatocytes were seeded and cultured as described in (6-FAM) conjugated to the 5? end and a quencher dye Materials and Methods. Cells were infected with hPXR-siRNA (TAMRA) conjugated to the 3? end. Real-time PCR was adenovirus for one hour and cultured for various times, as shown in performed in a total volume of 25 mL consisting of 2x the ˆgure. Values were expressed as the mean±SEM from four independent samples. *,pº0.05, **,pº0.01 when treated samples TaqMan Universal PCR Master Mix (Applied were compared with controls using student's t-test. Biosystems), 300 nM forward primer, 900 nM reverse primers, 200 nM TaqMan probe, 40x MultiScribe & RNase inhibitor mix, and 25 ng of template. Ampliˆca- expression by the Ad hPXR-siRNA on the level of PXR tion and detection were performed on an ABI PRISM mRNA, the changes in the level of speciˆc PXR mRNA 7900HT Sequence Detection System (Applied were determined in primary human hepatocytes by real- Biosystems). The cycling conditions were 10 min at 95 time PCR after infection with 4 MOI of Ad hPXR-siR- 9C for initial denaturation and activation of AmpliTaq NA. Gold DNA polymerase, followed by 40 cycles of 15s at PXR mRNA levels were decreased to 22z,28z and 959C for denaturation, 1 min at 609C for combined an- 28z of controls after 3, 5 and 7 days post-infection with nealing and primer extension. A relative standard curve the Ad hPXR-siRNA, respectively (Fig. 1). In hepato- was generated by serial dilutions of total RNA. Ct cytes transfected with a control virus (Ad LacZ), there values of standards were plotted against the log of the was no apparent change in the expression of hPXR respective dilution factors. The slope and y-intercept of compared with virus-free hepatocytes. From these the standard curve line were determined by linear regres- results, three days post-infection was selected as the sion and used to calculate the input amount of the point of determination in the following experiments. unknown samples for the respective genes. To stan- Speciˆcity of Ad hPXR-siRNA: It is well known dardize the amount of sample, the calculated amount of that several types of nuclear receptors are involved in the gene of interest was divided by the calculated P450 regulation. To verify the speciˆcity of the hPXR- amount of the constitutively expressed glyceraldehyde- siRNA used throughout this study, we transfected cul- 3-phosphate dehydrogenase (GAPDH) gene in the sam- tured hepatocytes with various concentrations of Ad ple. These normalized amounts were then used to com- hPXR-siRNA (0.04–4 MOI) for 3 days and determined pare the relative amount of target mRNA between the speciˆc levels of PXR, CAR, FXR, RXRa,HNF4a, diŠerent samples. SHP, GRa and VDR mRNAs by real-time PCR. Statistical analysis: Data were expressed as the Although clear decreases of speciˆc PXR mRNA were mean±SEM from three or four independent experi- observed in a dose dependent manner after the introduc- ments. Comparison of two groups was performed with tion of hPXR-siRNA (Fig. 2), no signiˆcant in‰uences two-tailed Student's t-test. Comparison of multiple were detected on the levels of CAR, FXR, RXRa, groups was evaluated using one-way ANOVA with the HNF4a,SHP,andGRa mRNAs. VDR mRNA was not BonferroniWDunn post hoc test with Bonferroni's ad- estimated quantitatively, due to the low detectable level. justment in a level and the levels of probability were The reduction of PXR mRNA after introduction of noted (*,pº0.05, **,pº0.01). hPXR-siRNA was reproducible in duplicate experiments. Results Speciˆc PXR mRNA levels were reduced to 68z,74 EŠect of Ad hPXR-siRNA on expression of PXR z,57z and 22z of the controls after transfection at mRNA: To determine the in‰uence of hPXR-siRNA 0.12, 0.4, 1.2 and 4 MOI of Ad hPXR-siRNA, respec- 280 Koki KOJIMA, et al.

Fig. 2. Dose-dependency of hPXR-siRNA adenovirus expression on mRNA expression of various nuclear receptors in human hepatocytes. Hu- man hepatocytes were seeded and cultured as described in Materials and Methods. Cells were infected with various MOI of hPXR-siRNA adenovirus for one hour and cultured for seventy-two hours. Values were expressed as the mean±SEM from three or four independent samples. *, pº0.05, **,pº0.01 when treated samples were compared with controls using one-way ANOVA with BonferroniWDunn post hoc test with Bonfer- roni's adjustment in a level.

tively. Thus, the IC50 for hPXR was calculated to be trols, respectively. The IC50 values of Ad hPXR-siRNA 1.15 MOI of Ad hPXR-siRNA. for CYP2A6, CYP2C8 and CYP3A5 mRNAs expres- Changes in the basal levels of various P450 mRNAs: sion were calculated to be 0.198 MOI, 0.303 MOI, and To conˆrm the in‰uence of hPXR-siRNA expression on 1.20 MOI, respectively. The levels of CYP2B6, well-known PXR target genes, speciˆc levels of CYP2C9 and CYP2C19 mRNAs in human hepatocytes CYP3A4 mRNA were determined in human hepato- were 58z,63z and 45z of their controls, respectively, cytes transfected with various MOI of Ad hPXR-siR- after infection with 4 MOI of Ad hPXR-siRNA. Large NA. Levels of speciˆc CYP3A4 mRNA were reduced in deviations between experiments were observed for a dose-dependent manner with increasing MOI of Ad CYP2C19 mRNA levels due to the low abundance in hPXR-siRNA (Fig. 3). The expression levels of primary hepatocytes. Thus, changes in CYP2C19 CYP3A4 mRNA in human hepatocytes were 59z,32 mRNA did not reach statistical signiˆcance in this ex- z,34z and 18z of control after infection with 0.12, periment; although a decreasing trend was observed. 0.4, 1.2 and 4 MOI of Ad hPXR-siRNA, respectively In‰uences on phenobarbital and clotrimazole induc-

(statistically signiˆcant). The IC50 of Ad hPXR-siRNA tion: To assess the contribution of ligand-activated for CYP3A4 was calculated to be 0.224 MOI. hPXR on the expression of CYP3A4, the in‰uence of To characterize the eŠect of hPXR-siRNA expression hPXR-siRNA on ligand-mediated P450 induction was on speciˆc P450 mRNA levels other than the CYP3A4, evaluated in human hepatocytes. The expression of the levels of CYP1A2, CYP2A6, CYP2B6, CYP2C8, hPXR was clearly attenuated following the introduction CYP2C9, CYP2C19, CYP2D6 and CYP3A5 mRNAs of Ad hPXR-siRNA, even in the presence of phenobar- were determined. Speciˆc mRNA levels of seven out of bital or clotrimazole. The presence of phenobarbital or the nine P450s examined were aŠected by the introduc- clotrimazole did not in‰uence the level of PXR mRNA tion of hPXR-siRNA. in either the Ad LacZ and Ad hPXR-siRNA treated Speciˆc mRNA levels of CYP2A6, CYP2C8 and groups (Fig. 4). Phenobarbital (1 mM) and clotrimazole CYP3A5 were strikingly suppressed, and those of (10 mM) signiˆcantly enhanced the expression of CYP2B6, CYP2C9 and CYP2C19 were moderately at- CYP3A4 mRNA, to 3.3 and 2.0 times of vehicle control tenuated following infection with increasing MOI of Ad (DMSO), respectively. The induction of CYP3A4 hPXR-siRNA. There was no clear in‰uence of the Ad mRNA by treatment with phenobarbital or clotrimazole hPXR-siRNA on the expression of CYP1A2 and was signiˆcantly suppressed to 9.7z and 16z, respec- CYP2D6 mRNAs. tively, relative to the virus control (Ad LacZ) after in- Levels of CYP2A6, CYP2C8 and CYP3A5 mRNAs fectionwithAdhPXR-siRNA. in human hepatocytes after infection with 4 MOI of Ad Ligand-activated mRNA levels of CYP1A2, hPXR-siRNA reached 16z,29z and 31z of their con- CYP2A6, CYP2B6, CYP2C8, CYP2C19, CYP2D6 and Contribution of PXR to P450 Gene Expression 281

Fig. 3. Dose-dependency of hPXR-siRNA adenovirus expression on mRNA expression of various P450s in human hepatocytes. Human hepatocytes were seeded and cultured as described in Materials and Methods. Cells were infected with various MOI of hPXR-siRNA adenovirus for one hour and cultured for seventy-two hours. Values were expressed as the mean±SEM from three or four independent samples. *,pº0.05, **, pº0.01 when treated samples were compared with controls using one-way ANOVA with BonferroniWDunn post hoc test with Bonferroni's adjustment in a level.

CYP3A5 were also determined to characterize the eŠect (Ad LacZ) (statistically signiˆcant). of hPXR-siRNA expression on these P450s. Seven of Clotrimazole (10 mM) signiˆcantly enhanced not only the nine P450s examined were altered by the introduc- the expression of CYP2B6 and CYP3A5 mRNA but tion of hPXR-siRNA. also that of CYP1A2 mRNA. The levels of CYP1A2, Speciˆc mRNA levels of CYP2A6, CYP2B6, CYP2B6 and CYP3A5 mRNA increased to 12, 7.2 and CYP2C8, CYP2C9, CYP2C19 and CYP3A5, were en- 3.2 times that of their controls, respectively. However hanced after 1 mM phenobarbital treatment to 4.1, 16, clotrimazole treatment did not signiˆcantly aŠect the ex- 2.8, 1.9, 1.6 and 2.0 fold of their controls, respectively. pression of CYP2A6, CYP2C8, CYP2C9, and Introduction of Ad hPXR-siRNA resulted in variable CYP2C19 mRNAs in the control virus group. The in- degrees of changes in the level of P450 mRNA species. creased expression of CYP2B6 and CYP3A5 mRNAs by The enhanced expression levels of CYP2A6, CYP2B6, clotrimazole was attenuated to 24z and 19z, respec- CYP3A5, CYP2C8, CYP2C9 and CYP2C19 by tively, relative to the virus control (Ad LacZ) after in- phenobarbital were attenuated following the introduc- troduction of Ad hPXR-siRNA (statistically sig- tion of Ad hPXR-siRNA to 14z,16z,16z,30z,39 niˆcant). In contrast, expression of hPXR-siRNA did z and 53z, respectively, relative to the virus control not aŠect the expression of CYP1A2 mRNA. 282 Koki KOJIMA, et al.

Fig. 4. EŠect of hPXR-siRNA on the expression of various P450s. Human hepatocytes were exposed to solvent (0.1z DMSO), 1 mM phenobarbital, or 10 mM clotrimazole for twenty-four hours, forty-eight hours after infection with the hPXR-siRNA adenovirus. Results were expressed as relative expression levels vs. controls. Values were expressed as the mean±SEM from four independent samples. *,pº0.05, **,pº0.01 when treated samples were compared with control using one-way ANOVA with BonferroniWDunn post hoc test with Bonferroni's adjustment in a level.

ed recently.5) Discussion The introduction of hPXR-siRNA reduced the levels In the present study, we have determined the contri- of PXR mRNA in human hepatocytes in a dose-depen- bution of hPXR on gene expression of hepatic P450s us- dent manner, without obvious in‰uences on the levels of ing an adenovirus-mediated target speciˆc siRNA ex- CAR, FXR, RXRa,HNF4a,SHP,andGRa mRNAs pression system in human hepatocytes as a model after treatment for 3 days (Fig. 2). relevant to in vivo states. The most advantageous appli- Concomitant with the loss of PXR mRNA, the basal cation of siRNA is through the ability to verify speciˆ- expression level of CYP3A4 mRNA was reduced with cally by knockdown of the role of the functional trans- increasing amounts of Ad hPXR-siRNA (Fig. 3). Ad factor in a gene transcriptional pathway. This hPXR- hPXR-siRNA diŠerently aŠected the expression of in- siRNA expression system selectively reduced the levels dividual P450s in the absence or presence of typical in- of hPXR mRNA and protein in HepG2 cells, as report- ducers. Phenobarbital and clotrimazole rather than Contribution of PXR to P450 Gene Expression 283

Fig. 4. (Continued) rifampicin are used in the present study. The reason for PXR, were more intensely suppressed at lower con- remains unclear, but the treatment with rifampicin, it- centrations of Ad hPXR-siRNA. The extent of suppres- self, resulted in the repressed expression of hPXR in our sion for CYP3A5 and CYP2C8 mRNAs was similar to preliminary experiments. that of PXR. The extent of suppression for CYP2B6, Introduction of hPXR-siRNA resulted in signiˆcantly CYP2C9 and CYP2C19 were lesser than that of PXR. decreased expression of CYP2A6, CYP2C8, CYP3A4 EŠect of hPXR-siRNA on the expression of P450s and CYP3A5 mRNAs at both the basal and ligand-acti- diŠered among CYP2A6, CYP2B6, CYP2C8, CYP2C9, vated conditions, suggesting a possibility that PXR is a CYP2C19, CYP3A4 and CYP3A5. These results might main determinant of the P450 expression in hepato- be re‰ected in the diŠerential susceptibilities of the cytes. These results are roughly consistent with those P450s shown above. The mechanistic cause of the identiˆed previously through the use of the reporter variability is unclear, further studies are necessary but it gene assay methods,15,19,31,32) although the expression of is possible to be a consequence of the number of PXR CYP2C8 was not up-regulated by over-expression of binding sites in the regulatory regions of these genes. PXR in the previous study.19) Interestingly, speciˆc lev- More than three PXR binding sites have been observed els of mRNA for CYP3A4 and CYP2A6, rather than in the enhancer regions of the CYP3A4 and CYP2A6 284 Koki KOJIMA, et al.

in the regulation of CYP2C9 and CYP2C19. Consistent with the present results, CYP2C9 and CYP2C19 have been reported to be up-regulated following over-expression of PXR and CAR.18,19,23) While the introduction of hPXR-siRNA strongly suppressed the ligand-activated expression of CYP2B6, basal expression was only marginally suppressed by the introduction of hPXR-siRNA. Thus, PXR is likely to be essential in ligand-activated expression of CYP2B6, but may not be obligatory on the basal expression of CYP2B6. CAR might play a prominent role in the basal expression of CYP2B6. Although further experiments are necessary, the distinct contribution of PXR in basal and ligand-activated expression of CYP2B6 may suggest functional diŠerences between two PXR binding sites in the enhancer region of CYP2B6.17,22) The level of CYP1A2 mRNA was strongly enhanced after treatment with clotrimazole. This is the ˆrst report to show that clotrimazole is an inducer of CYP1A2 in human hepatocytes, although clotrimazole has been shown to enhance expression of rodent CYP1A1W2.33) The clotrimazole-activated expression of CYP1A2 mRNA was however, not suppressed after the introduction of hPXR-siRNA. These results suggest that PXR has no clear role in the expression of CYP1A2. CYP1A2 induction via activation of the aryl hydrocarbon receptor (AhR) is well established.25,34) On the other hand, speciˆc levels of CYP2D6 mRNA were not altered after introduction of hPXR-siRNA or PXR ligand. These results suggest again that PXR plays no clear role in the expression of CYP2D6. Induction studies in human hepatocytes after treatment with typical PXR ligands suggest the association of PXR in the regulation of CYP2A6, CYP2B6, CYP2C8, CYP2C9, CYP2C19, CYP3A4 and CYP3A5; although PXR involvement has not been shown di- 9–14,19,32) Fig. 5. EŠect of hPXR-siRNA on the expression of ABCB1 and rectly. The combination use of human hepato- ABCC2. Human hepatocytes were exposed to solvent (0.1z DMSO), cytes and the adenovirus-mediated target speciˆc siRNA 1 mM phenobarbital, or 10 mM clotrimazole for twenty-four hours, expression system facilitates clear identiˆcation of the forty-eight hours after infection with the hPXR-siRNA adenovirus. involvement of PXR in transcriptional activation of Results were expressed as relative expression levels vs. controls. P450 genes. In the present study, CYP2A6, CYP2B6, Values were expressed as the mean±SEM from four independent CYP2C8, CYP2C9, CYP2C19, CYP3A4 and CYP3A5, samples. *,pº0.05, **,pº0.01 when treated samples were compared with control using one-way ANOVA with BonferroniWDunn post hoc but not CYP1A2 and CYP2D6, have been shown to be test with Bonferroni's adjustment in a level. under the control of PXR. From the evidence obtained in these experiments, PXR plays a prominent role, not only in the regulation of CYP3A4, but also in the regu- genes.15,31) Two PXR binding sites were found in the en- lation of other major human hepatic P450s, in varying hancer region of CYP2C8,19) but at present only a single degrees. The detailed mechanisms by which PXR regu- PXR binding site has been found in the enhancer region lates each of the P450 genes were not clariˆed in the of CYP3A5.32) present study and await further studies. Introduction of hPXR-siRNA moderately decreased Induction studies in human hepatocytes after treat- the basal and ligand-activated expression of CYP2C9 ment with typical PXR ligands suggest the involvement and CYP2C19 in dose-dependent manners. These of PXR in the regulation of multidrug resistance protein resultssuggesttheroleofPXRontheexpressionof 1(MDR1WABCB1), and multi-drug resistance-associ- CYP2C9 and CYP2C19. CAR may play a auxiliary role ated protein 2 (MRP2WABCC2); although PXR involve- Contribution of PXR to P450 Gene Expression 285 ment has not been shown directly.35–37) In this study, in- 10) Watkins, R. E., Maglich, J. M., Moore, L. B., Wisely, troduction of hPXR-siRNA also resulted in signiˆcantly G.B.,Noble,S.M.,Davis-Searles,P.R.,Lambert,M. decreasedexpressionofABCB1andABCC2mRNAsat H.,Kliewer,S.A.andRedinbo,M.R.:2.1Acrystal both the basal and ligand-activated conditions, suggest- structure of human PXR in complex with the St. John's ing that ABCB1 and ABCC2 are under control of PXR wort compound hyperforin. Biochemistry, 42: 1430– in human hepatocytes (Fig. 5). 1438 (2003). 11) Madan, A., Graham, R. A., Carroll, K. M., Mudra, D. The combination use of hPXR-siRNA adenovirus ex- R.,Burton,L.A.,Krueger,L.A.,Downey,A.D., pression and human hepatocytes would oŠer informa- Czerwinski, M., Forster, J., Ribadeneira, M. D., Gan, tion on the relative contribution of hPXR in these gene L. S., LeCluyse, E. L., Zech, K., Robertson, P. Jr., regulations. This is the ˆrst report to simultaneously Koch, P., Antonian, L., Wagner, G., Yu, L. and Par- compare the relative contribution of hPXR in the regu- kinson, A.: EŠects of prototypical microsomal enzyme lation of P450 involving drug metabolism in primary inducers on cytochrome P450 expression in cultured hu- cultured human hepatocytes. man hepatocytes. Drug Metab. Dispos., 31: 421–431 (2003). References 12) Faucette,S.R.,Wang,H.,Hamilton,G.A.,Jolley,S. 1) Chang, T. K. and Waxman, D. J.: Synthetic drugs and L.,Gilbert,D.,Lindley,C.,Yan,B.,Negishi,M.and natural products as modulators of constitutive an- LeCluyse, E. L.: Regulation of CYP2B6 in primary hu- drostane receptor (CAR) and pregnane X receptor man hepatocytes by prototypical inducers. Drug Metab. (PXR). Drug Metab. Rev., 38: 51–73 (2006). Dispos., 32: 348–358 (2004). 2) Honkakoski, P. and Negishi, M.: Regulation of 13) Donato, M. T., Serralta, A., Jimenez, N., Perez, G., cytochrome P450 (CYP) genes by nuclear receptors. Castell,J.V.,Mir,J.andGomez-Lechon,M.J.:Liver Biochem. J., 347: 321–337 (2000). grafts preserved in Celsior solution as source of hepato- 3) Lemaire,G.,deSousa,G.andRahmani,R.:APXR cytes for drug metabolism studies: comparison with sur- reporter gene assay in a stable cell culture system: gical liver biopsies. Drug Metab. Dispos., 33: 108–114 CYP3A4 and CYP2B6 induction by pesticides. Biochem. (2005). Pharmacol., 68: 2347–2358 (2004). 14) Girault, I., Rougier, N., Chesne, C., Lidereau, R., 4) Noracharttiyapot, W., Nagai, Y., Matsubara, T., Miya- Beaune, P., Bieche, I. and de Waziers, I.: Simultaneous ta, M., Shimada, M., Nagata, K. and Yamazoe, Y.: measurement of 23 isoforms from the human Construction of several human-derived stable cell lines cytochrome P450 families 1 to 3 by quantitative reverse displaying distinct proˆles of CYP3A4 induction. Drug transcriptase-polymerase chain reaction. Drug Metab. Metab. Pharmacokinet., 21: 99–108 (2006). Dispos., 33: 1803–1810 (2005). 5) Matsubara, T., Noracharttiyapot, W., Toriyabe, T., 15) Goodwin, B., Hodgson, E. and Liddle, C.: The orphan Yoshinari, K., Nagata, K. and Yamazoe, Y.: Assessment human pregnane X receptor mediates the transcriptional of human pregnane X receptor-involvement in pesticide- activation of CYP3A4 by rifampicin through a distal en- mediated activation of CYP3A4 gene. Drug Metab. hancer module. Mol. Pharmacol., 56: 1329–1339 (1999). Disp., in press. 16) Tirona,R.G.,Lee,W.,Leake,B.F.,Lan,L.B.,Cline, 6) Blumberg, B., Sabbagh, W., Jr., Juguilon, H., Bolado, C.B.,Lamba,V.,Parviz,F.,Duncan,S.A.,Inoue,Y., J.,Jr.,vanMeter,C.M.,Ong,E.S.andEvans,R.M.: Gonzalez,F.J.,Schuetz,E.G.andKim,R.B.:Theor- SXR, a novel steroid and xenobiotic-sensing nuclear phan nuclear receptor HNF4alpha determines PXR- and receptor. Genes Dev., 12: 3195–3205 (1998). CAR-mediated xenobiotic induction of CYP3A4. Nat. 7) Kliewer, S. A., Moore, J. T., Wade, L., Staudinger, J. Med., 9: 220–224 (2003). L.,Watson,M.A.,Jones,S.A.,McKee,D.D.,Oliver, 17) Wang, H., Faucette, S., Sueyoshi, T., Moore, R., Fergu- B.B.,Willson,T.M.,Zetterstrom,R.H.,Perlmann,T. son, S., Negishi, M. and LeCluyse, E. L.: A novel distal and Lehmann, J. M.: An orphan nuclear receptor acti- enhancer module regulated by pregnane X receptorWcon- vated by pregnanes deˆnes a novel steroid signaling path- stitutive androstane receptor is essential for the maximal way. Cell, 92: 73–82 (1998). induction of CYP2B6 gene expression. J. Biol. Chem., 8) Lehmann, J. M., McKee, D. D., Watson, M. A., 278: 14146–14152 (2003). Willson, T. M., Moore, J. T. and Kliewer, S. A.: The 18) Chen, Y., Ferguson, S. S., Negishi, M. and Goldstein, J. human orphan nuclear receptor PXR is activated by A.: Identiˆcation of constitutive androstane receptor compounds that regulate CYP3A4 gene expression and and glucocorticoid receptor binding sites in the cause drug interactions. J. Clin. Invest., 102: 1016–1023 CYP2C19 promoter. Mol. Pharmacol., 64: 316–324 (1998). (2003). 9) Maglich, J. M., Stoltz, C. M., Goodwin, B., Hawkins- 19) Ferguson,S.S.,Chen,Y.,LeCluyse,E.L.,Negishi,M. Brown, D., Moore, J. T. and Kliewer, S. A.: Nuclear andGoldstein,J.A.:HumanCYP2C8istranscription- pregnane x receptor and constitutive androstane receptor ally regulated by the nuclear receptors constitutive an- regulate overlapping but distinct sets of genes involved in drostane receptor, pregnane X receptor, glucocorticoid xenobiotic detoxiˆcation. Mol. Pharmacol., 62: 638–646 receptor, and hepatic nuclear factor 4alpha. Mol. Phar- (2002). macol., 68: 747–757 (2005). 286 Koki KOJIMA, et al.

20) Duncan,S.A.,Navas,M.A.,Dufort,D.,Rossant,J. sion cassette. J. Virol., 72: 2289–2296 (1998). and StoŠel, M.: Regulation of a transcription factor net- 31) Itoh, M., Nakajima, M., Higashi, E., Yoshida, R., work required for diŠerentiation and metabolism. Nagata, K., Yamazoe, Y. and Yokoi, T.: Induction of Science, 281: 692–695 (1998). human CYP2A6 is mediated by the pregnane X receptor 21) Aouabdi, S., Gibson, G. and Plant, N.: Transcriptional with peroxisome proliferator-activated receptor-sgamma regulation of the PXR gene: identiˆcation and charac- tcoactivator 1salphat. J. Pharmacol. Exp. Ther., 319: terization of a functional peroxisome proliferator-acti- 693–702 (2006). vated receptor alpha binding site within the proximal 32) Burk,O.,Koch,I.,Raucy,J.,Hustert,E.,Eichelbaum, promoter of PXR. Drug Metab. Dispos., 34: 138–144 M., Brockmoller, J., Zanger, U. M. and Wojnowski, L.: (2006). The induction of cytochrome P450 3A5 (CYP3A5) in the 22) Sueyoshi, T., Kawamoto, T., Zelko, I., Honkakoski, P. human liver and intestine is mediated by the xenobiotic and Negishi, M.: The repressed nuclear receptor CAR sensors pregnane X receptor (PXR) and constitutively responds to phenobarbital in activating the human activated receptor (CAR). J. Biol. Chem., 279: CYP2B6 gene. J. Biol. Chem., 274: 6043–6046 (1999). 38379–38385 (2004). 23) Chen, Y., Ferguson, S. S., Negishi, M. and Goldstein, J. 33) Kobayashi, Y., Matsuura, Y., Kotani, E., Fukuda, T., A.: Induction of human CYP2C9 by rifampicin, hyper- Aoyagi,T.,Tobinaga,S.,Yoshida,T.andKuroiwa,Y.: forin, and phenobarbital is mediated by the pregnane X Structural requirements for the induction of hepatic receptor. J. Pharmacol. Exp. Ther., 308: 495–501 microsomal cytochrome P450 by imidazole- and (2004). pyridine-containing compounds in rats. J. Biochem. 24) Pitarque, M., Rodriguez-Antona, C., Oscarson, M. and (Tokyo), 114: 697–701 (1993). Ingelman-Sundberg, M.: Transcriptional regulation of 34) Whitlock, J. P. Jr.: Induction of cytochrome P4501A1. the human CYP2A6 gene. J. Pharmacol. Exp. Ther., Annu. Rev. Pharmacol. Toxicol., 39: 103–125 (1999). 313: 814–822 (2005). 35) Geick, A., Eichelbaum, M. and Burk, O.: Nuclear recep- 25) Ueda, R., Iketaki, H., Nagata, K., Kimura, S., Gonza- tor response elements mediate induction of intestinal lez,F.J.,Kusano,K.,Yoshimura,T.andYamazoe,Y.: MDR1 by rifampin. J. Biol. Chem., 276: 14581–14587 A common regulatory region functions bidirectionally in (2001). transcriptional activation of the human CYP1A1 and 36) Synold, T. W., Dussault, I. and Forman, B. M.: The or- CYP1A2 genes. Mol. Pharmacol., 69: 1924–1930 (2006). phan nuclear receptor SXR coordinately regulates drug 26) Kawamoto, T., Sueyoshi, T., Zelko, I., Moore, R., metabolism and eŒux. Nat. Med., 7: 584–590 (2001). Washburn, K. and Negishi, M.: Phenobarbital–respon- 37) Kast,H.R.,Goodwin,B.,Tarr,P.T.,Jones,S.A., sive nuclear translocation of the receptor CAR in induc- Anisfeld, A. M., Stoltz, C. M., Tontonoz, P., Kliewer, tion of the CYP2B gene. Mol. Cell Biol., 19: 6318–6322 S.,Willson,T.M.andEdwards,P.A.:Regulationof (1999). multidrug resistance-associated protein 2 (ABCC2) by 27) Sidhu,J.S.,Farin,F.M.andOmiecinski,C.J.:In- the nuclear receptors pregnane X receptor, farnesoid X- ‰uence of extracellular matrix overlay on phenobarbital- activated receptor, and constitutive androstane receptor. mediated induction of CYP2B1, 2B2, and 3A1 genes in J. Biol. Chem., 277: 2908–2915 (2002). primary adult rat hepatocyte culture. Arch. Biochem. 38) Nishimura, M., Yoshitsugu, H., Naito, S. and Hiraoka, Biophys., 301: 103–113 (1993). I.: Evaluation of gene induction of drug-metabolizing 28) LeCluyse, E., Madan, A., Hamilton, G., Carroll, K., enzymes and transporters in primary culture of human DeHaan, R. and Parkinson, A.: Expression and regula- hepatocytes using high-sensitivity real-time reverse tran- tion of cytochrome P450 enzymes in primary cultures of scription PCR. Yakugaku Zasshi, 122: 339–361 (2002). human hepatocytes. J. Biochem. Mol. Toxicol., 39) Nishimura, M., Naito, S. and Yokoi, T.: Tissue-speciˆc 14:177–188 (2000). mRNA expression proˆles of human nuclear receptor 29) Fire,A.,Xu,S.,Montgomery,M.K.,Kostas,S.A., subfamilies. Drug Metab. Pharmacokinet., 19: 135–149 Driver,S.E.andMello,C.C.:Potentandspeciˆcgenet- (2004). ic interference by double-stranded RNA in Caenorhabdi- 40) Langmann, T., Mauerer, R., Zahn, A., Moehle, C., tis elegans. Nature, 391: 806–811 (1998). Probst, M., Stremmel, W. and Schmitz, G.: Real-time 30) Massie, B., Couture, F., Lamoureux, L., Mosser, D. D., reverse transcription-PCR expression proˆling of the Guilbault, C., Jolicoeur, P., Belanger, F. and Langelier, complete human ATP-binding cassette transporter su- Y.: Inducible overexpression of a toxic protein by an perfamily in various tissues. Clin. Chem., 49: 230–238 adenovirus vector with a tetracycline-regulatable expres- (2003).