DOCSLIB.ORG

US 2019 / 0032083 A1 Kotin Et Al

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
US 2019 / 0032083 A1 Kotin Et Al US 20190032083A1 ( 19) United States (12 ) Patent Application Publication ( 10) Pub . No. : US 2019 / 0032083 A1 Kotin et al. (43 ) Pub . Date: Jan . 31 , 2019 ( 54 ) CLOSED -ENDED LINEAR DUPLEX DNA Publication Classification FOR NON - VIRAL GENE TRANSFER (51 ) Int . Ci. C12N 15 /86 ( 2006 .01 ) ( 71) Applicant : University of Massachusetts , Boston , A61K 48 / 00 (2006 .01 ) MA (US ) A61P 27/ 02 ( 2006 .01 ) A61P 7 /04 ( 2006 . 01 ) (72 ) Inventors : Robert M . Kotin , Bethesda , MD (US ) ; A61P 1 / 16 ( 2006 . 01 ) Sylvain Cecchini, Westborough , MA A61P 3 / 00 ( 2006 .01 ) (US ) A61P 3 /08 ( 2006 .01 ) A61P 11 / 12 ( 2006 . 01 ) (52 ) U . S . CI. (73 ) Assignee : University of Massachusetts , Boston , CPC . CI2NC12N 1519 / 8086 ((2013 .01 VI )) ;, A61KA 48 /005 ( 2013 .01 ) ; A61P 27 / 02 ( 2018 .01 ) ; A61P 7 / 04 MA (US ) (2018 . 01 ) ; A61P 1 / 16 (2018 .01 ) ; A61K 48 /00 (21 ) Appl. No. : 16 /081 , 337 ( 2013 .01 ) ; A61P 3 /08 (2018 . 01) ; A61P 11 / 12 ( 2018 .01 ) ; A61K 48 / 0075 ( 2013 .01 ) ; C12N ( 22 ) PCT Filed : Mar. 3 , 2017 2750 / 14143 ( 2013 .01 ) ; CI2N 2750 / 14151 ( 2013 .01 ) ; A61P 3700 (2018 . 01 ) ( 86 ) PCT No. : PCT/ US17 /20828 (57 ) ABSTRACT § 371 (c )( 1 ), Aspects of the disclosure relate to a nucleic acid comprising ( 2 ) Date : Aug . 30 , 2018 a heterologous nucleic acid insert flanked by interrupted self - complementary sequences, wherein one self - comple mentary sequence is interrupted by a cross - arm sequence Related U . S . Application Data forming two opposing, lengthwise - symmetric stem - loops , (60 ) Provisional application No . 62/ 406 , 913, filed on Oct . and wherein the other of the self - complementary sequences 11, 2016 , provisional application No . 62 / 394 , 720 , is interrupted by a truncated cross - arm sequence . Methods of filed on Sep . 14 , 2016 , provisional application No. delivering the nucleic acid to a cell are also provided . 62 / 303 ,047 , filed on Mar . 3 , 2016 . Specification includes a Sequence Listing . Patent Application Publication Jan . 31, 2019 Sheet 1 of 18 US 2019 /0032083 A1 DUOOHOOOOOOOO SEQIDNO:24 OOOO . OOOOOOOO AA ? FUUUUUUUU " GC OOHOOOOO GUUUUUUUU- ? RBE 1| FIG.1A A 3'AACCGGTGAGGGAGAGACGCGCGAGCGAGCGAGTGACTCCGG. trs 5'AGGAACCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCC SEQIDNO:8D Patent Application Publication Jan . 31 , 2019 Sheet 2 of 18 US 2019 /0032083 A1 0 0 60OOOOOOOOOOOOOO SEQIDNO:14 OOOOOOOOOOOOOOOOO SEQIDNO:10 OOOO OOOOOOOO " un SEQIDNO:24 OOOO . OOOOOOOO GAC SEQIDNO:11 SEQIDNO:12 L3 ? SEQIDNO:13 RBE FIG.1B A IT GCCCGCTGGTTTCCAGCGGGCTGCGGGCCCGAAACGGGCCCGC– ortung yeyoteampten p y7 ??? III , •CGGGCCCGTGCGGGCCCAAAGGGCCCGC -AG=22.3kcal/moi GCCCGGGCACGCCCGGGTTTCCCGGGCG ? Patent Application Publication Jan . 31 , 2019 Sheet 3 of 18 US 2019 /0032083 A1 Symmetric ITRS Asymmetric Terminal Palindromes (ATP ) . WYI . QATTT . * * * * * FIGFIG . 2A 2A 11TITXII Www Remem oma 31 . FIG . 2B Patent Application Publication Jan . 31 , 2019 Sheet 4 of 18 US 2019 /0032083 A1 (SLL)Bos WV Supong 52 ????? Gap m 093 us ME FIG.3 Coco . MY Sodoor ** WWWWWWW123 LOX 0HozG Patent Application Publication Jan . 31, 2019 Sheet 5 of 18 US 2019 /0032083 A1 IAAV2TRexonhGBpoly(A)signal ITRA'stem trsdeltaITRCstem 1AAV2ITR ITRAstem hGHpoly(A)signal bGHpoly(A)signal ITRD'stemlITRAstem EE 1AAV2ITR ! DGHpoly(A)signal 8000 ITRAstem vectorgenomen UCE2290 FIG.4 YUVEAU Leber'sCongenitalAmaurosis-CentrasomalProtein290(9797bp) Maculardegeneration/neovascularization(4170bp) AN 12000! CMVpromoter17promoter intron2hBglobin ABCA4-Stargardt'sdisease(9179bp) CMVpromoter77 T miscellaneoushBglobinintron2 Usher'sdisease(6095bp) AAV2ITRII fliporientedDNARepbindingsites RepbindingsitesitrsfliporientedDNA AAV2ITR AAV2ITRI miscellaneous! Repbindingsitestrs miscellaneous Patent Application Publication Jan . 31, 2019 Sheet 6 of 18 US 2019 /0032083 A1 ITRAAV2 AAV2ITR ITRAstem ITRD'stemTRA'stem TRBstem trsRepbindingsites bGHpoly(A)signal TRAstem DGHpoly(A)signal PAAV2ITR stem'TRA"stemDITR ITRAstems wwwwwwwwwwwww bGHpoly(A)signal 5000 w 4000 WEHIS FIG.5 5000! 3000BDDEVINE 4000 10002000 VonWillebrandfactordisease-VWF 2500! T7promoter HemopheliaA-FactorVIII CMVenhancer CMVenhancer T7promoter AAV2ITRT7promoter CMVpromoter CMVenhancerCMVpromoter promoterCMVlitrssitesbindingRep fliporientedDNARepbindingsites fliporientedDNA HiporientedDNA AAV2ITR Repbindingsitestrs AAV2ITR1 Repbindingsit.trs Patent Application Publication Jan . 31 , 2019 Sheet 7 of 18 US 2019 /0032083 A1 ITRAstem 1AAV2ITR EGHpoly(A)signal AAV2ITR ITRAstemB EGHpoly(A)signal 21222324 AAV2ITR 4000 bGHpoly(A)signal ITRD'stemlTITRAstem TRD'stemLITRAstem ITRAstem TRBstem anamnepossam2500 2500 2000 3000 EANAPIBERIKUT 9999999999999, ismatarepeptide2000m ata7500 w FIG.6 SSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS signalpeptide 2000 9999999999999999999999 CMVpromoter T7promoter : CMVpromoter : : : : 17promoter 500TamanJaya1000 Hypercholesterolemia-Lecithincholesterolacetyltransferase : ccmenhancerunabandagoose : : CWenhancer. : CMVpromoter17promoter CMVenhanced 8 Phenylketonuria-phenylalaninehydroxylase CMVenhancer GOPCDisease-1StorageGlycogen : 8 : AAV2ITR 4 sang bindingsitesRepDNAorientedlip fliporientedDNARepbindingsites 29 RepbindingsitesItrs wwwwwwwwwwwwwwwwwww AAV2ITR Repbindingsitestrs Patent Application Publication Jan . 31 , 2019 Sheet 8 of 18 US 2019 /0032083 A1 |AAV2ITR bGHpoly(A)signal (BGHpolyA)signal AAV2ITR ??????????????????????? ITRD'stemUITRAstem ITRAstem Bstem 2500 5000 4000 2000 maturepeptide miscellaneous 3000 FIG.7 peptidesignalpromoterT7 2000 Y CMVpromoter vvvvvvvvvvvvvvvvvvv (CWenhancer. * * * (CMVenhancer CMVpromoterT7 24.crrr CysticFibrosis-CFTR AAV2ITR fliporientedDNARepbindingsites AAV2ITR Alpha1Antitrypsin RepbindingsitesItrs Patent Application Publication Jan . 31 , 2019 Sheet 9 of 18 US 2019 /0032083 A1 1 . 2 . 12 .. .. .. as FIG . 8AHORROR Patent Application Publication Jan . 31, 2019 Sheet 10 of 18 US 2019 /0032083 A1 ????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? ??????????????????????????????????????? .? ? . :- ? ?? ? 1 : ? ? ° ? ??? ? ?rimi 38: : ; M !fi ? :: ? ;: k ???? ? : ? ?fi , ??? : ?? ; % ? ?? ?FAM , ?22 ??? $- fii ? - ? . ?? ? ? ? ? ? ![3- ! rii . ?? ? ? : ? ;im . ? % ;; ' : ?? : ; ; :? ? ? www' ??? ???????????? ::1 ???? ???????? ? ? ?? . ?? ?? :? ! !! 1 ;.rr ? ? ?? ?. ?? w ? ??8 ? ???? ? ?? ??? . 18 ?? ? 21 ?????????? ????????????????????????? FIG . 8B Patent Application Publication Jan . 31, 2019 Sheet 11 of 18 US 2019 /0032083 A1 " . Visni 11 T 1 * WE !. ., .HRT . 12 :. 4 49 !Statii | 2013 , Will til | Vi HA ? 8 itis A . * wo. :: H :: :: . ** ** they 3 : 12 BE ** ** U 23 A . * !AN ito 3 . 22 :* u altifito :11 :Si , V 2 Will.! TOP 6 EX -0% . is ZA -: WH ir . DOW! W ini Ni tulit: Hii :UN SIN 270 '.. 1. ** 1 FIGoooooo . 8C Patent Application Publication Jan . 31, 2019 Sheet 12 of 18 US 2019 /0032083 A1 V ElectroporationSub-RetinalPO VYYYY YYYYYY 2239% 0 :5 ugut 0 .25 ugal IntravitrealInjectionnAdults2weeksafter 0. 25 ug ULS AT in. 2334 41 126224 FIG . 8D Patent Application Publication Jan . 31, 2019 Sheet 13 of 18 US 2019 /0032083 A1 ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? ... .. 202 : .: 10 . CetPEIN/P=8;0.36uL) FIG.9A 222 SYOOM € SX88M OG Patent Application Publication Jan . 31, 2019 Sheet 14 of 18 US 2019 /0032083 A1 CeDNA + JetPEI CeDNA 3 weeks 2 weeks . M 3 weeks (AAV9 -GFP ) 42RES S wi 20 weeks 5 weeks OS WWWWW Iba - 1 ceDNA * JetPEI FIG . 9B Patent Application Publication Jan . 31 , 2019 Sheet 15 of 18 US 2019 /0032083 A1 CeDNA + JetPE CeDNA ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? 3 weeks 2 weeks 3 weeks (AAVO -GFP ) WA !!! YA titi 20 weeks 5 weeks : NH WWW MHC - 11 WWW CEONA * JetPEL CeDNA SooooFIG . 9C Patent Application Publication Jan . 31, 2019 Sheet 16 of 18 US 2019 /0032083 A1 . - * - .: SEQIDNO:15. SEQIDNO:16 ir. SEQIDNO:17 SEQIDNO:18 SEQIDNO:19 iii. -iiniriiniriini11.rii SEQIDNO:15 SIV . faszagroszace hetblokS -iirrivii -irir.1,11inciriiiiiiiiiiiriiriiiriiicirr Liisiirrriii-iiiirii * WE oo -coverridir X 32 .ririiiiii . ther . RANCHMAULIDUR ucetococtötsegezettstegeccaces290x2940390804899*coxvacson1329483093cotraGt9o9Lyager . XXX . rrrr. DOCETOSCOCTOGOTCHIKToracoercoaceFACUARÓSCOGERCEMBOG3ecescaceauCroceRCOVERCREEKUOGADGONECOLOGIE . iiii.ii,cirriii:iniiriiirrorinnriniiriiiiiiirr ???? ?! . 2. YAKO . RKSGASLOXEXXTOXTASAZET6LCOOLCGEGEXCIEROC8856CCASIACT49*XCEECCORZ6263646CCCXCxECT690386GOESCGCGCRAMESWARO . W . Tunces ? . .iii . ir.iiicrciirr ? .-Ordershiperrrrrrrrrrrrrrrr . 06 .iiciiriiiiiiriin MUSSACHC%96 232328 399&acerzeksenok -. .7r Patent Application Publication Jan . 31, 2019 Sheet 17 of 18 US 2019 /0032083 A1 . -. .-1111111 37753 triqüviiriistvarnimi * SEQIDNO:21 SEQIDNO:22 SEQIDNO:23 OCONAIDAs * 20NO:IDSEQDescrisos ZZONCIOIS 111111111:.-' . 73473324305799324323333207323 . IX WA HISGS 101 . : . Panca EN 12-* " . .: . .' "171111 232323358.9333333333930630 .' . .:; 1111' . VEA . ., . .-:'" . D A . mamboerseuneuhvationsmateriaorganisturuwangerspannunang . 7.5:11 . WWR 1."' .* WY v*- 283, ng . .. viirivierrrrrrrrrrrrr. AR MOTORYZ159299917974022992299236700032782LI930093939993BOVIOKODY uricoda yuxuda 2.1114-'12 !.- 10 . : 05 .' .: . 492339596979330723
Load more

Recommended publications
  • Identification of Novel Pathways That Promote Anoikis Through Genome-Wide Screens
    University of Massachusetts Medical School eScholarship@UMMS GSBS Dissertations and Theses Graduate School of Biomedical Sciences 2016-10-14 Identification of Novel Pathways that Promote Anoikis through Genome-wide Screens Victoria E. Pedanou University of Massachusetts Medical School Let us know how access to this document benefits ou.y Follow this and additional works at: https://escholarship.umassmed.edu/gsbs_diss Part of the Biology Commons, and the Cancer Biology Commons Repository Citation Pedanou VE. (2016). Identification of Novel Pathways that Promote Anoikis through Genome-wide Screens. GSBS Dissertations and Theses. https://doi.org/10.13028/M27G6D. Retrieved from https://escholarship.umassmed.edu/gsbs_diss/889 This material is brought to you by eScholarship@UMMS. It has been accepted for inclusion in GSBS Dissertations and Theses by an authorized administrator of eScholarship@UMMS. For more information, please contact [email protected]. i TITLE PAGE IDENTIFICATION OF NOVEL PATHWAYS THAT PROMOTE ANOIKIS THROUGH GENOME-WIDE SCREENS A Dissertation Presented By VICTORIA ELIZABETH PEDANOU Submitted to the Faculty of the University of Massachusetts Graduate School of Biomedical Sciences, Worcester in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY OCTOBER 14TH, 2016 CANCER BIOLOGY ii SIGNATURE PAGE IDENTIFICATION OF NOVEL PATHWAYS THAT PROMOTE ANOIKIS THROUGH GENOME-WIDE SCREENS A Dissertation Presented By VICTORIA ELIZABETH PEDANOU This work was undertaken in the Graduate School of Biomedical Sciences Cancer Biology The signature of the Thesis Advisor signifies validation of Dissertation content ___________________________ Michael R. Green, Thesis Advisor The signatures of the Dissertation Defense Committee signify completion and approval as to style and content of the Dissertation __________________________________ Eric H.
    [Show full text]
  • Mimickers of Urothelial Carcinoma and the Approach to Differential Diagnosis
    Review Mimickers of Urothelial Carcinoma and the Approach to Differential Diagnosis Claudia Manini 1, Javier C. Angulo 2,3 and José I. López 4,* 1 Department of Pathology, San Giovanni Bosco Hospital, 10154 Turin, Italy; [email protected] 2 Clinical Department, Faculty of Medical Sciences, European University of Madrid, 28907 Getafe, Spain; [email protected] 3 Department of Urology, University Hospital of Getafe, 28905 Getafe, Spain 4 Department of Pathology, Cruces University Hospital, Biocruces-Bizkaia Health Research Institute, 48903 Barakaldo, Spain * Correspondence: [email protected]; Tel.: +34-94-600-6084 Received: 17 December 2020; Accepted: 18 February 2021; Published: 25 February 2021 Abstract: A broad spectrum of lesions, including hyperplastic, metaplastic, inflammatory, infectious, and reactive, may mimic cancer all along the urinary tract. This narrative collects most of them from a clinical and pathologic perspective, offering urologists and general pathologists their most salient definitory features. Together with classical, well-known, entities such as urothelial papillomas (conventional (UP) and inverted (IUP)), nephrogenic adenoma (NA), polypoid cystitis (PC), fibroepithelial polyp (FP), prostatic-type polyp (PP), verumontanum cyst (VC), xanthogranulomatous inflammation (XI), reactive changes secondary to BCG instillations (BCGitis), schistosomiasis (SC), keratinizing desquamative squamous metaplasia (KSM), post-radiation changes (PRC), vaginal-type metaplasia (VM), endocervicosis (EC)/endometriosis (EM) (müllerianosis),
    [Show full text]
  • Disclosures Objectives
    1/16/2015 RbRober tLHllt L. Holley, MSMDFPMRSMSc, MD, FPMRS Professor of Obstetrics and Gynecology Division of Urogynecology and Pelvic Reconstructive Surgery Department of Obstetrics and Gynecology University of Alabama at Birmingham School of Medicine Disclosures I have no conflicts of interest pertinent to this lecture. Objectives Appreciate the history associated with the development of the cystoscope Review indications for diagnostic cystourethroscopy Become familiar with instrumentation for diagnostic and operative cystoscopy Become familiar with normal bladder/urethral anatomy and identify abnormal cystoscopic findings 1 1/16/2015 Howard Kelly Bladder distension Scope introduced using an obturator, with pt in kneeknee--chestchest position Negative intraintra--abdominalabdominal pressure allowed air to distend bladder Head mirror to reflect light Greatly improved visualization 20th Century and Today Hopkins/Kopany 1954 FiberFiber--opticoptic scope Rod lens system Angled scopes Complex instrumentation Flexible cystoscope General surgeons developed Urology subspecialty Ob/Gyn combined program decreased cystoscopy training by gynecologists Granting Of Privileges For Cystourethroscopy “Should be based on training, experience and demonstrated competence” “Implies that the physician has knowledge and compete ncy in t he inst ru me ntat io n a nd su r gi cal technique; can recognize normal and abnormal bladder and urethral findings: and has knowledge of pathology, diagnosis and treatment of specific diseases of the lower
    [Show full text]
  • Leigh Syndrome: One Disorder, More Than 75 Monogenic Causes
    Title: Leigh Syndrome: One disorder, more than 75 monogenic causes Running head: Leigh Syndrome: One disorder, many genes Author list: Nicole J. Lake, MSc,1,2 Alison G. Compton, PhD,1,2 Shamima Rahman, MD, PhD,3 and David R. Thorburn, PhD1,2,4 Affiliations: From the 1Murdoch Childrens Research Institute, Royal Children's Hospital, Melbourne, Victoria, Australia; 2Department of Paediatrics, The University of Melbourne, Melbourne, Victoria, Australia; 3Mitochondrial Research Group, Genetics and Genomic Medicine, Institute of Child Health, University College London and Metabolic Unit, Great Ormond Street Hospital, London, United Kingdom; 4Victorian Clinical Genetic Services, Royal Children's Hospital, Melbourne, Victoria, Australia. Corresponding author: Prof. David Thorburn Email [email protected] Telephone +61 3 8341 6235 Fax +61 3 8341 6212 Address Murdoch Childrens Research Institute, The Royal Children’s Hospital, 50 Flemington Rd, Parkville, Victoria, 3052, Australia Number of characters in the title and running head: 51 and 35, respectively Number of words in the abstract (107), and the body of manuscript not including abstract (4877) Number of figures (3), colour figures (1/3), and tables (3) 1 Abstract Leigh syndrome is the most common pediatric presentation of mitochondrial disease. This neurodegenerative disorder is genetically heterogeneous, and to date pathogenic mutations in more than 75 genes have been identified, encoded by two genomes (mitochondrial and nuclear). More than a third of these disease genes have been characterized in the last 5 years alone, reflecting the significant advances made in understanding its etiological basis. We review the diverse biochemical and genetic etiology of Leigh syndrome and associated clinical, neuroradiological and metabolic features that can provide clues for diagnosis.
    [Show full text]
  • Original Communication Genomic and Expression Array Profiling of Chromosome 20Q Amplicon in Human Colon Cancer Cells
    128 Original Communication Genomic and expression array profiling of chromosome 20q amplicon in human colon cancer cells Jennifer l Carter, Li Jin,1 Subrata Sen University of Texas - M. D. Anderson Cancer Center, 1PD, University of Cincinnati sion and metastasis.[1,2] Characterization of genomic BACKGROUND: Gain of the q arm of chromosome 20 in human colorectal cancer has been associated with poorer rearrangements is, therefore, a major area of investiga- survival time and has been reported to increase in frequency tion being pursued by the cancer research community. from adenomas to metastasis. The increasing frequency of chromosome 20q amplification during colorectal cancer Amplification of genomic DNA is one such form of rear- progression and the presence of this amplification in carci- rangement that leads to an increase in the copy num- nomas of other tissue origin has lead us to hypothesize ber of specific genes frequently detected in a variety of that 20q11-13 harbors one or more genes which, when over expressed promote tumor invasion and metastasis. human cancer cell types. Our laboratory has been in- AIMS: Generate genomic and expression profiles of the terested in characterizing amplified genomic regions in 20q amplicon in human cancer cell lines in order to identify genes with increased copy number and expression. cancer cells based on the hypothesis that these seg- MATERIALS AND METHODS: Utilizing genomic sequenc- ments harbor critical genes associated with initiation and/ ing clones and amplification mapping data from our lab or progression of cancer. Gain of chromosome 20q in and other previous studies, BAC/ PAC tiling paths span- ning the 20q amplicon and genomic microarrays were gen- human colorectal cancer has been associated with erated.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Identification of Differentially Expressed Genes in Human Bladder Cancer Through Genome-Wide Gene Expression Profiling
    521-531 24/7/06 18:28 Page 521 ONCOLOGY REPORTS 16: 521-531, 2006 521 Identification of differentially expressed genes in human bladder cancer through genome-wide gene expression profiling KAZUMORI KAWAKAMI1,3, HIDEKI ENOKIDA1, TOKUSHI TACHIWADA1, TAKENARI GOTANDA1, KENGO TSUNEYOSHI1, HIROYUKI KUBO1, KENRYU NISHIYAMA1, MASAKI TAKIGUCHI2, MASAYUKI NAKAGAWA1 and NAOHIKO SEKI3 1Department of Urology, Graduate School of Medical and Dental Sciences, Kagoshima University, 8-35-1 Sakuragaoka, Kagoshima 890-8520; Departments of 2Biochemistry and Genetics, and 3Functional Genomics, Graduate School of Medicine, Chiba University, 1-8-1 Inohana, Chuo-ku, Chiba 260-8670, Japan Received February 15, 2006; Accepted April 27, 2006 Abstract. Large-scale gene expression profiling is an effective CKS2 gene not only as a potential biomarker for diagnosing, strategy for understanding the progression of bladder cancer but also for staging human BC. This is the first report (BC). The aim of this study was to identify genes that are demonstrating that CKS2 expression is strongly correlated expressed differently in the course of BC progression and to with the progression of human BC. establish new biomarkers for BC. Specimens from 21 patients with pathologically confirmed superficial (n=10) or Introduction invasive (n=11) BC and 4 normal bladder samples were studied; samples from 14 of the 21 BC samples were subjected Bladder cancer (BC) is among the 5 most common to microarray analysis. The validity of the microarray results malignancies worldwide, and the 2nd most common tumor of was verified by real-time RT-PCR. Of the 136 up-regulated the genitourinary tract and the 2nd most common cause of genes we detected, 21 were present in all 14 BCs examined death in patients with cancer of the urinary tract (1-7).
    [Show full text]
  • Genetics of Gene Expression: 2010 Lab
    Genetics of gene expression: 2010 lab VJ Carey July 28, 2010 Contents 1 eQTL concepts and discovery tools 2 1.1 Checking for informative variants for a specified gene . .3 1.2 Components of the workflow; refinements . .4 1.2.1 Data representation: smlSet .....................6 1.2.2 Analysis: snp.rhs.tests; permutation testing . .8 1.2.3 Context: GenomicRanges and rtracklayer .............9 2 Comprehensive eQTL surveys: performance issues 11 2.1 A study of genes coresident on chromosome 20 . 11 2.2 Expanding to genes on multiple chromosomes . 13 2.3 Exercises . 15 3 Investigating allele-specific expression with RNA-seq data 17 3.1 Thedata.................................... 17 3.2 Filtering to \coding SNP"; checking for de novo variants . 18 3.3 Assessing allelic imbalance in transcripts harboring SNPs . 20 3.4 Checking consistency of findings with GENEVAR expression arrays . 23 3.5 Exercises . 24 4 Appendix: samtools pileup format, from samtools distribution site 25 5 Session information 26 1 Figure 1: A schematic illustrating various nonexclusive mechanisms by which DNA variants can affect transcript abundance (Williams et al., 2007). 1 eQTL concepts and discovery tools The basic concern in the lab is the relationship between structural variation in DNA and variation in mRNA abundance. DNA variants of interest are primarily SNP as identified through • direct genotyping in the Sanger sequencing paradigm (yielding HapMap phase II genotypes, for example) • array-based genotyping (yielding HapMap phase III) • NGS-based variant calling (as provided for 1000 genomes (1KG)) • hybrids of array-based and imputed genotypes (imputation to the 1KG panel) mRNA variation is typically characterized using gene expression microarrays, but RNA- seq can also be considered.
    [Show full text]
  • Case Report Pseudomembranous Trigonitis in a Male with Klinefelter Syndrome: a Case Report and Evidence of a Hormonal Etiology
    Int J Clin Exp Pathol 2014;7(6):3375-3379 www.ijcep.com /ISSN:1936-2625/IJCEP0000435 Case Report Pseudomembranous trigonitis in a male with Klinefelter syndrome: a case report and evidence of a hormonal etiology Derrick WQ Lian1, Fay X Li2, Caroline CP Ong2, CH Kuick1, Kenneth TE Chang1 Departments of 1Pathology and Laboratory Medicine, 2Paediatric Surgery, KK Women’s and Children’s Hospital, Singapore Received April 6, 2014; Accepted May 26, 2014; Epub May 15, 2014; Published June 1, 2014 Abstract: Klinefelter syndrome is a clinical syndrome with a distinct 47, XXY karyotype. Patients are characterized by a tall eunuchoid stature, small testes, hypergonotrophic hypogonadism, gynecomastia, learning difficulties and infertility. These patients have also been found to have raised estrogen levels. We report a 16 year old boy with Kline- felter syndrome presenting to our institution with gross hematuria. Cystoscopy and biopsy revealed the diagnosis of pseudomembranous trigonitis. Immunohistochemical stains showed an increase in estrogen and progesterone receptors in the trigone area but not in the rest of the bladder. In view of the patient’s mildly raised estrogen levels and the histological findings, we postulate that estrogen is the driver of the development of pseudomembranous trigonitis. This is the first reported case of pseudomembranous trigonitis seen in association with Klinefelter syn- drome, and also the first case of pseudomembranous trigonitis occurring within the male adolescent age group. Keywords: Klinefelter syndrome, pseudomembranous trigonitis, pediatric Introduction with a sense of incomplete voiding. These epi- sodes were initially treated with a course of oral Klinefelter syndrome is the most common chro- antibiotics by a primary care physician with no mosomal aberration in males and the most resolution of symptoms.
    [Show full text]
  • Comprehensive Genome Sequence Analysis of a Breast Cancer Amplicon
    Letter Comprehensive Genome Sequence Analysis of a Breast Cancer Amplicon Colin Collins,1,6 Stanislav Volik,1 David Kowbel,1 David Ginzinger,1 Bauke Ylstra,1 Thomas Cloutier,2 Trevor Hawkins,3 Paul Predki,3 Christopher Martin,4 Meredith Wernick,1 Wen-Lin Kuo,1 Arthur Alberts,5 and Joe W. Gray1 1University of California San Francisco Cancer Center, San Francisco, California 94143-0808, USA; 2Lawrence Berkeley National Laboratory, Berkeley, California 94143, USA; 3Department of Energy Joint Genome Institute, Walnut Creek, California 94958, USA; 4Novartis Agricultural Discovery Institute, San Diego, California 92121, USA; 5Van Andel Institute, Grand Rapids, Michigan 49503, USA Gene amplification occurs in most solid tumors and is associated with poor prognosis. Amplification of 20q13.2 is common to several tumor types including breast cancer. The 1 Mb of sequence spanning the 20q13.2 breast cancer amplicon is one of the most exhaustively studied segments of the human genome. These studies have included amplicon mapping by comparative genomic hybridization (CGH), fluorescent in-situ hybridization (FISH), array-CGH, quantitative microsatellite analysis (QUMA), and functional genomic studies. Together these studies revealed a complex amplicon structure suggesting the presence of at least two driver genes in some tumors. One of these, ZNF217, is capable of immortalizing human mammary epithelial cells (HMEC) when overexpressed. In addition, we now report the sequencing of this region in human and mouse, and on quantitative expression studies in tumors. Amplicon localization now is straightforward and the availability of human and mouse genomic sequence facilitates their functional analysis. However, comprehensive annotation of megabase-scale regions requires integration of vast amounts of information.
    [Show full text]
  • Genetic Testing Policy Number: PG0041 ADVANTAGE | ELITE | HMO Last Review: 04/11/2021
    Genetic Testing Policy Number: PG0041 ADVANTAGE | ELITE | HMO Last Review: 04/11/2021 INDIVIDUAL MARKETPLACE | PROMEDICA MEDICARE PLAN | PPO GUIDELINES This policy does not certify benefits or authorization of benefits, which is designated by each individual policyholder terms, conditions, exclusions and limitations contract. It does not constitute a contract or guarantee regarding coverage or reimbursement/payment. Paramount applies coding edits to all medical claims through coding logic software to evaluate the accuracy and adherence to accepted national standards. This medical policy is solely for guiding medical necessity and explaining correct procedure reporting used to assist in making coverage decisions and administering benefits. SCOPE X Professional X Facility DESCRIPTION A genetic test is the analysis of human DNA, RNA, chromosomes, proteins, or certain metabolites in order to detect alterations related to a heritable or acquired disorder. This can be accomplished by directly examining the DNA or RNA that makes up a gene (direct testing), looking at markers co-inherited with a disease-causing gene (linkage testing), assaying certain metabolites (biochemical testing), or examining the chromosomes (cytogenetic testing). Clinical genetic tests are those in which specimens are examined and results reported to the provider or patient for the purpose of diagnosis, prevention or treatment in the care of individual patients. Genetic testing is performed for a variety of intended uses: Diagnostic testing (to diagnose disease) Predictive
    [Show full text]
  • Topical Use of Cortisone in Urology T
    Topical Use of Cortisone in Urology T. L. SCHULTE, M.D., LLOYD R. REYNOLDS, M.D., and HOWARD J. HAMMER, M.D., San Francisco TOPICAL APPLICATION of cortisone acetate has been * Cortisone was instilled into the bladder in used by the authors in treatment of interstitial the treatment of interstitial cystitis and con- cystitis including contracted bladder, inflammation tracted bladder, trigonitis and urethritis in fe- of the wall of the bladder, trigonitis and urethritis males, nonspecific urethritis in males, and in- in females, and non-specific urethritis in males. flammation of the wall of the bladder. In infec- To determine whether or not any of the results tious cases the hormonal therapy was used after of topical therapy might be owing to systemic ab- antibacterial measures had failed. Improvement sorption of cortisone, study was made of the eosino- occurred quickly in most cases soon after corti- phil content of the blood of patients receiving topical sone therapy was given. In a few cases of inter- therapy. The eosinophil content was determined at stitial cystitis and contracted bladder the relief hourly intervals for six hours after treatment, and obtained was inadequate and it was necessary no significant change was noted. It was concluded to carry out overdistention procedures under that if there was systemic absorption it was so slight visualization. When that was done, however, it that it could not be considered a factor in results. was noted that the condition of the bladder was In all cases in which there were indications of improved as compared with the conditions us- infectious disease of the urinary tract, attempt was ually observed in cases in which cortisone treat- made to clear it by use of antibacterial drugs, but ment is not given before the procedure.
    [Show full text]