US 20190032083A1 ( 19) United States (12 ) Patent Application Publication ( 10) Pub . No. : US 2019 / 0032083 A1 Kotin et al. (43 ) Pub . Date: Jan . 31 , 2019 ( 54 ) CLOSED -ENDED LINEAR DUPLEX DNA Publication Classification FOR NON - VIRAL GENE TRANSFER (51 ) Int . Ci. C12N 15 /86 ( 2006 .01 ) ( 71) Applicant : University of Massachusetts , Boston , A61K 48 / 00 (2006 .01 ) MA (US ) A61P 27/ 02 ( 2006 .01 ) A61P 7 /04 ( 2006 . 01 ) (72 ) Inventors : Robert M . Kotin , Bethesda , MD (US ) ; A61P 1 / 16 ( 2006 . 01 ) Sylvain Cecchini, Westborough , MA A61P 3 / 00 ( 2006 .01 ) (US ) A61P 3 /08 ( 2006 .01 ) A61P 11 / 12 ( 2006 . 01 ) (52 ) U . S . CI. (73 ) Assignee : University of Massachusetts , Boston , CPC . CI2NC12N 1519 / 8086 ((2013 .01 VI )) ;, A61KA 48 /005 ( 2013 .01 ) ; A61P 27 / 02 ( 2018 .01 ) ; A61P 7 / 04 MA (US ) (2018 . 01 ) ; A61P 1 / 16 (2018 .01 ) ; A61K 48 /00 (21 ) Appl. No. : 16 /081 , 337 ( 2013 .01 ) ; A61P 3 /08 (2018 . 01) ; A61P 11 / 12 ( 2018 .01 ) ; A61K 48 / 0075 ( 2013 .01 ) ; C12N ( 22 ) PCT Filed : Mar. 3 , 2017 2750 / 14143 ( 2013 .01 ) ; CI2N 2750 / 14151 ( 2013 .01 ) ; A61P 3700 (2018 . 01 ) ( 86 ) PCT No. : PCT/ US17 /20828 (57 ) ABSTRACT § 371 (c )( 1 ), Aspects of the disclosure relate to a nucleic acid comprising ( 2 ) Date : Aug . 30 , 2018 a heterologous nucleic acid insert flanked by interrupted self - complementary sequences, wherein one self - comple mentary sequence is interrupted by a cross - arm sequence Related U . S . Application Data forming two opposing, lengthwise - symmetric stem - loops , (60 ) Provisional application No . 62/ 406 , 913, filed on Oct . and wherein the other of the self - complementary sequences 11, 2016 , provisional application No . 62 / 394 , 720 , is interrupted by a truncated cross - arm sequence . Methods of filed on Sep . 14 , 2016 , provisional application No. delivering the nucleic acid to a cell are also provided . 62 / 303 ,047 , filed on Mar . 3 , 2016 . Specification includes a Sequence Listing . Patent Application Publication Jan . 31, 2019 Sheet 1 of 18 US 2019 /0032083 A1 DUOOHOOOOOOOO SEQIDNO:24 OOOO . OOOOOOOO AA ? FUUUUUUUU " GC OOHOOOOO GUUUUUUUU- ? RBE 1| FIG.1A A 3'AACCGGTGAGGGAGAGACGCGCGAGCGAGCGAGTGACTCCGG. trs 5'AGGAACCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCC SEQIDNO:8D Patent Application Publication Jan . 31 , 2019 Sheet 2 of 18 US 2019 /0032083 A1 0 0 60OOOOOOOOOOOOOO SEQIDNO:14 OOOOOOOOOOOOOOOOO SEQIDNO:10 OOOO OOOOOOOO " un SEQIDNO:24 OOOO . OOOOOOOO GAC SEQIDNO:11 SEQIDNO:12 L3 ? SEQIDNO:13 RBE FIG.1B A IT GCCCGCTGGTTTCCAGCGGGCTGCGGGCCCGAAACGGGCCCGC– ortung yeyoteampten p y7 ??? III , •CGGGCCCGTGCGGGCCCAAAGGGCCCGC -AG=22.3kcal/moi GCCCGGGCACGCCCGGGTTTCCCGGGCG ? Patent Application Publication Jan . 31 , 2019 Sheet 3 of 18 US 2019 /0032083 A1 Symmetric ITRS Asymmetric Terminal Palindromes (ATP ) . WYI . QATTT . * * * * * FIGFIG . 2A 2A 11TITXII Www Remem oma 31 . FIG . 2B Patent Application Publication Jan . 31 , 2019 Sheet 4 of 18 US 2019 /0032083 A1 (SLL)Bos WV Supong 52 ????? Gap m 093 us ME FIG.3 Coco . MY Sodoor ** WWWWWWW123 LOX 0HozG Patent Application Publication Jan . 31, 2019 Sheet 5 of 18 US 2019 /0032083 A1 IAAV2TRexonhGBpoly(A)signal ITRA'stem trsdeltaITRCstem 1AAV2ITR ITRAstem hGHpoly(A)signal bGHpoly(A)signal ITRD'stemlITRAstem EE 1AAV2ITR ! DGHpoly(A)signal 8000 ITRAstem vectorgenomen UCE2290 FIG.4 YUVEAU Leber'sCongenitalAmaurosis-CentrasomalProtein290(9797bp) Maculardegeneration/neovascularization(4170bp) AN 12000! CMVpromoter17promoter intron2hBglobin ABCA4-Stargardt'sdisease(9179bp) CMVpromoter77 T miscellaneoushBglobinintron2 Usher'sdisease(6095bp) AAV2ITRII fliporientedDNARepbindingsites RepbindingsitesitrsfliporientedDNA AAV2ITR AAV2ITRI miscellaneous! Repbindingsitestrs miscellaneous Patent Application Publication Jan . 31, 2019 Sheet 6 of 18 US 2019 /0032083 A1 ITRAAV2 AAV2ITR ITRAstem ITRD'stemTRA'stem TRBstem trsRepbindingsites bGHpoly(A)signal TRAstem DGHpoly(A)signal PAAV2ITR stem'TRA"stemDITR ITRAstems wwwwwwwwwwwww bGHpoly(A)signal 5000 w 4000 WEHIS FIG.5 5000! 3000BDDEVINE 4000 10002000 VonWillebrandfactordisease-VWF 2500! T7promoter HemopheliaA-FactorVIII CMVenhancer CMVenhancer T7promoter AAV2ITRT7promoter CMVpromoter CMVenhancerCMVpromoter promoterCMVlitrssitesbindingRep fliporientedDNARepbindingsites fliporientedDNA HiporientedDNA AAV2ITR Repbindingsitestrs AAV2ITR1 Repbindingsit.trs Patent Application Publication Jan . 31 , 2019 Sheet 7 of 18 US 2019 /0032083 A1 ITRAstem 1AAV2ITR EGHpoly(A)signal AAV2ITR ITRAstemB EGHpoly(A)signal 21222324 AAV2ITR 4000 bGHpoly(A)signal ITRD'stemlTITRAstem TRD'stemLITRAstem ITRAstem TRBstem anamnepossam2500 2500 2000 3000 EANAPIBERIKUT 9999999999999, ismatarepeptide2000m ata7500 w FIG.6 SSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS signalpeptide 2000 9999999999999999999999 CMVpromoter T7promoter : CMVpromoter : : : : 17promoter 500TamanJaya1000 Hypercholesterolemia-Lecithincholesterolacetyltransferase : ccmenhancerunabandagoose : : CWenhancer. : CMVpromoter17promoter CMVenhanced 8 Phenylketonuria-phenylalaninehydroxylase CMVenhancer GOPCDisease-1StorageGlycogen : 8 : AAV2ITR 4 sang bindingsitesRepDNAorientedlip fliporientedDNARepbindingsites 29 RepbindingsitesItrs wwwwwwwwwwwwwwwwwww AAV2ITR Repbindingsitestrs Patent Application Publication Jan . 31 , 2019 Sheet 8 of 18 US 2019 /0032083 A1 |AAV2ITR bGHpoly(A)signal (BGHpolyA)signal AAV2ITR ??????????????????????? ITRD'stemUITRAstem ITRAstem Bstem 2500 5000 4000 2000 maturepeptide miscellaneous 3000 FIG.7 peptidesignalpromoterT7 2000 Y CMVpromoter vvvvvvvvvvvvvvvvvvv (CWenhancer. * * * (CMVenhancer CMVpromoterT7 24.crrr CysticFibrosis-CFTR AAV2ITR fliporientedDNARepbindingsites AAV2ITR Alpha1Antitrypsin RepbindingsitesItrs Patent Application Publication Jan . 31 , 2019 Sheet 9 of 18 US 2019 /0032083 A1 1 . 2 . 12 .. .. .. as FIG . 8AHORROR Patent Application Publication Jan . 31, 2019 Sheet 10 of 18 US 2019 /0032083 A1 ????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? ??????????????????????????????????????? .? ? . :- ? ?? ? 1 : ? ? ° ? ??? ? ?rimi 38: : ; M !fi ? :: ? ;: k ???? ? : ? ?fi , ??? : ?? ; % ? ?? ?FAM , ?22 ??? $- fii ? - ? . ?? ? ? ? ? ? ![3- ! rii . ?? ? ? : ? ;im . ? % ;; ' : ?? : ; ; :? ? ? www' ??? ???????????? ::1 ???? ???????? ? ? ?? . ?? ?? :? ! !! 1 ;.rr ? ? ?? ?. ?? w ? ??8 ? ???? ? ?? ??? . 18 ?? ? 21 ?????????? ????????????????????????? FIG . 8B Patent Application Publication Jan . 31, 2019 Sheet 11 of 18 US 2019 /0032083 A1 " . Visni 11 T 1 * WE !. ., .HRT . 12 :. 4 49 !Statii | 2013 , Will til | Vi HA ? 8 itis A . * wo. :: H :: :: . ** ** they 3 : 12 BE ** ** U 23 A . * !AN ito 3 . 22 :* u altifito :11 :Si , V 2 Will.! TOP 6 EX -0% . is ZA -: WH ir . DOW! W ini Ni tulit: Hii :UN SIN 270 '.. 1. ** 1 FIGoooooo . 8C Patent Application Publication Jan . 31, 2019 Sheet 12 of 18 US 2019 /0032083 A1 V ElectroporationSub-RetinalPO VYYYY YYYYYY 2239% 0 :5 ugut 0 .25 ugal IntravitrealInjectionnAdults2weeksafter 0. 25 ug ULS AT in. 2334 41 126224 FIG . 8D Patent Application Publication Jan . 31, 2019 Sheet 13 of 18 US 2019 /0032083 A1 ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? ... .. 202 : .: 10 . CetPEIN/P=8;0.36uL) FIG.9A 222 SYOOM € SX88M OG Patent Application Publication Jan . 31, 2019 Sheet 14 of 18 US 2019 /0032083 A1 CeDNA + JetPEI CeDNA 3 weeks 2 weeks . M 3 weeks (AAV9 -GFP ) 42RES S wi 20 weeks 5 weeks OS WWWWW Iba - 1 ceDNA * JetPEI FIG . 9B Patent Application Publication Jan . 31 , 2019 Sheet 15 of 18 US 2019 /0032083 A1 CeDNA + JetPE CeDNA ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? 3 weeks 2 weeks 3 weeks (AAVO -GFP ) WA !!! YA titi 20 weeks 5 weeks : NH WWW MHC - 11 WWW CEONA * JetPEL CeDNA SooooFIG . 9C Patent Application Publication Jan . 31, 2019 Sheet 16 of 18 US 2019 /0032083 A1 . - * - .: SEQIDNO:15. SEQIDNO:16 ir. SEQIDNO:17 SEQIDNO:18 SEQIDNO:19 iii. -iiniriiniriini11.rii SEQIDNO:15 SIV . faszagroszace hetblokS -iirrivii -irir.1,11inciriiiiiiiiiiiriiriiiriiicirr Liisiirrriii-iiiirii * WE oo -coverridir X 32 .ririiiiii . ther . RANCHMAULIDUR ucetococtötsegezettstegeccaces290x2940390804899*coxvacson1329483093cotraGt9o9Lyager . XXX . rrrr. DOCETOSCOCTOGOTCHIKToracoercoaceFACUARÓSCOGERCEMBOG3ecescaceauCroceRCOVERCREEKUOGADGONECOLOGIE . iiii.ii,cirriii:iniiriiirrorinnriniiriiiiiiirr ???? ?! . 2. YAKO . RKSGASLOXEXXTOXTASAZET6LCOOLCGEGEXCIEROC8856CCASIACT49*XCEECCORZ6263646CCCXCxECT690386GOESCGCGCRAMESWARO . W . Tunces ? . .iii . ir.iiicrciirr ? .-Ordershiperrrrrrrrrrrrrrrr . 06 .iiciiriiiiiiriin MUSSACHC%96 232328 399&acerzeksenok -. .7r Patent Application Publication Jan . 31, 2019 Sheet 17 of 18 US 2019 /0032083 A1 . -. .-1111111 37753 triqüviiriistvarnimi * SEQIDNO:21 SEQIDNO:22 SEQIDNO:23 OCONAIDAs * 20NO:IDSEQDescrisos ZZONCIOIS 111111111:.-' . 73473324305799324323333207323 . IX WA HISGS 101 . : . Panca EN 12-* " . .: . .' "171111 232323358.9333333333930630 .' . .:; 1111' . VEA . ., . .-:'" . D A . mamboerseuneuhvationsmateriaorganisturuwangerspannunang . 7.5:11 . WWR 1."' .* WY v*- 283, ng . .. viirivierrrrrrrrrrrrr. AR MOTORYZ159299917974022992299236700032782LI930093939993BOVIOKODY uricoda yuxuda 2.1114-'12 !.- 10 . : 05 .' .: . 492339596979330723