Resident Macrophages in Cystic Kidney Disease
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Identification and Interaction Analysis of Molecular Markers in Pancreatic
medRxiv preprint doi: https://doi.org/10.1101/2020.12.20.20248601; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Identification and Interaction Analysis of Molecular Markers in Pancreatic Ductal Adenocarcinoma by Integrated Bioinformatics Analysis and Molecular Docking Experiments Basavaraj Vastrad1 , Chanabasayya Vastrad *2, Anandkumar Tengli3 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics,Chanabasava Nilaya, Bharthinagar, Dharwad, Karanataka 580001, India. 3. Department of Pharmaceutical Chemistry, JSS College of Pharmacy, Mysuru and JSS Academy of Higher Education & Research, Mysuru- 570015, Karnataka, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice. medRxiv preprint doi: https://doi.org/10.1101/2020.12.20.20248601; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Abstract The current investigation aimed to mine therapeutic molecular targets that play an key part in the advancement of pancreatic ductal adenocarcinoma (PDAC). The expression profiling by high throughput sequencing dataset profile GSE133684 dataset was downloaded from the Gene Expression Omnibus (GEO) database. -
Cows Selected for Divergent Mastitis Susceptibility Display a Differential
J. Dairy Sci. 103:6364–6373 https://doi.org/10.3168/jds.2019-17612 © 2020, The Authors. Published by FASS Inc. and Elsevier Inc. on behalf of the American Dairy Science Association®. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/). Cows selected for divergent mastitis susceptibility display a differential liver transcriptome profile after experimental Staphylococcus aureus mammary gland inoculation A. Heimes,1 J. Brodhagen,1 R. Weikard,1 D. Becker,1 M. M. Meyerholz,2,3 W. Petzl,2 H. Zerbe,2 H.-J. Schuberth,3 M. Hoedemaker,4 M. Schmicke,5 S. Engelmann,6,7 and C. Kühn1,8* 1Leibniz Institute for Farm Animal Biology (FBN), Institute of Genome Biology, 18196 Dummerstorf, Germany 2Clinic for Ruminants with Ambulatory and Herd Health Services, Centre for Clinical Veterinary Medicine, Ludwig-Maximilians-University Munich, 85764 Oberschleißheim, Germany 3Immunology Unit, University of Veterinary Medicine Hannover, 30559 Hannover, Germany 4Clinic for Cattle, University of Veterinary Medicine Hannover, 30173 Hannover, Germany 5Faculty of Natural Sciences III, Martin-Luther Universität Halle-Wittenberg, 06120 Halle, Germany 6Technical University Braunschweig, Institute for Microbiology, 38023 Braunschweig, Germany 7Helmholtz Centre for Infection Research, Microbial Proteomics, 38124 Braunschweig, Germany 8Agricultural and Environmental Faculty, University Rostock, 18059 Rostock, Germany ABSTRACT Key words: BTA18, mastitis, somatic cell score, liver transcriptome, RNAseq Infection and inflammation of the mammary gland, and especially prevention of mastitis, are still major challenges for the dairy industry. Different approaches INTRODUCTION have been tried to reduce the incidence of mastitis. Rapid progress in molecular biology and genetics has Genetic selection of cows with lower susceptibility to made it possible to include information on genomic mastitis promises sustainable success in this regard. -
Supplemental Table S1. Primers for Sybrgreen Quantitative RT-PCR Assays
Supplemental Table S1. Primers for SYBRGreen quantitative RT-PCR assays. Gene Accession Primer Sequence Length Start Stop Tm GC% GAPDH NM_002046.3 GAPDH F TCCTGTTCGACAGTCAGCCGCA 22 39 60 60.43 59.09 GAPDH R GCGCCCAATACGACCAAATCCGT 23 150 128 60.12 56.52 Exon junction 131/132 (reverse primer) on template NM_002046.3 DNAH6 NM_001370.1 DNAH6 F GGGCCTGGTGCTGCTTTGATGA 22 4690 4711 59.66 59.09% DNAH6 R TAGAGAGCTTTGCCGCTTTGGCG 23 4797 4775 60.06 56.52% Exon junction 4790/4791 (reverse primer) on template NM_001370.1 DNAH7 NM_018897.2 DNAH7 F TGCTGCATGAGCGGGCGATTA 21 9973 9993 59.25 57.14% DNAH7 R AGGAAGCCATGTACAAAGGTTGGCA 25 10073 10049 58.85 48.00% Exon junction 9989/9990 (forward primer) on template NM_018897.2 DNAI1 NM_012144.2 DNAI1 F AACAGATGTGCCTGCAGCTGGG 22 673 694 59.67 59.09 DNAI1 R TCTCGATCCCGGACAGGGTTGT 22 822 801 59.07 59.09 Exon junction 814/815 (reverse primer) on template NM_012144.2 RPGRIP1L NM_015272.2 RPGRIP1L F TCCCAAGGTTTCACAAGAAGGCAGT 25 3118 3142 58.5 48.00% RPGRIP1L R TGCCAAGCTTTGTTCTGCAAGCTGA 25 3238 3214 60.06 48.00% Exon junction 3124/3125 (forward primer) on template NM_015272.2 Supplemental Table S2. Transcripts that differentiate IPF/UIP from controls at 5%FDR Fold- p-value Change Transcript Gene p-value p-value p-value (IPF/UIP (IPF/UIP Cluster ID RefSeq Symbol gene_assignment (Age) (Gender) (Smoking) vs. C) vs. C) NM_001178008 // CBS // cystathionine-beta- 8070632 NM_001178008 CBS synthase // 21q22.3 // 875 /// NM_0000 0.456642 0.314761 0.418564 4.83E-36 -2.23 NM_003013 // SFRP2 // secreted frizzled- 8103254 NM_003013 -
Investigating Reptin Function in Acute Myeloid Leukaemia
INVESTIGATING REPTIN FUNCTION IN ACUTE MYELOID LEUKAEMIA Elena Armenteros Monterroso Developmental Biology and Cancer Section Institute of Child Health University College London A thesis submitted for the Degree of Doctor of Philosophy 2017 DECLARATION I, Elena Armenteros Monterroso, confirm that the work presented in this thesis is my own. Where information has been derived from other sources, I confirm that this has been indicated in the thesis. Signature …………………………………….. 2 ACKNOWLEDGEMENTS Firstly, I would like to express my sincere gratitude to my principal supervisor, Dr. Owen Williams, for his excellent advice, support and motivation during the past 4 years. I am extremely grateful for his guidance, but also for the freedom he has given me to pursue my own research. I could not have imagined having a better supervisor. I would also like to extend my gratitude to my second supervisor, Dr. Jasper de Boer. His help and advice have been invaluable. But also the fun environment he has provided in the lab, which made it easier to carry on during stressful times. I am also thankful to all the inspirational people working at the Cancer Section, particularly all the members of my lab, for their help and friendship during the past years. My sincere thanks also goes to all the members of the UCL Genomics team for their efficient work and their help with my sequencing experiments. I am also truly thankful to all my friends, both in the UK and in Spain, for providing the enthusiasm and support that I needed during my studies. I would like to specially thank Miriam, Clare and Heike for their friendship and fun times together. -
Engineered Type 1 Regulatory T Cells Designed for Clinical Use Kill Primary
ARTICLE Acute Myeloid Leukemia Engineered type 1 regulatory T cells designed Ferrata Storti Foundation for clinical use kill primary pediatric acute myeloid leukemia cells Brandon Cieniewicz,1* Molly Javier Uyeda,1,2* Ping (Pauline) Chen,1 Ece Canan Sayitoglu,1 Jeffrey Mao-Hwa Liu,1 Grazia Andolfi,3 Katharine Greenthal,1 Alice Bertaina,1,4 Silvia Gregori,3 Rosa Bacchetta,1,4 Norman James Lacayo,1 Alma-Martina Cepika1,4# and Maria Grazia Roncarolo1,2,4# Haematologica 2021 Volume 106(10):2588-2597 1Department of Pediatrics, Division of Stem Cell Transplantation and Regenerative Medicine, Stanford School of Medicine, Stanford, CA, USA; 2Stanford Institute for Stem Cell Biology and Regenerative Medicine, Stanford School of Medicine, Stanford, CA, USA; 3San Raffaele Telethon Institute for Gene Therapy, Milan, Italy and 4Center for Definitive and Curative Medicine, Stanford School of Medicine, Stanford, CA, USA *BC and MJU contributed equally as co-first authors #AMC and MGR contributed equally as co-senior authors ABSTRACT ype 1 regulatory (Tr1) T cells induced by enforced expression of interleukin-10 (LV-10) are being developed as a novel treatment for Tchemotherapy-resistant myeloid leukemias. In vivo, LV-10 cells do not cause graft-versus-host disease while mediating graft-versus-leukemia effect against adult acute myeloid leukemia (AML). Since pediatric AML (pAML) and adult AML are different on a genetic and epigenetic level, we investigate herein whether LV-10 cells also efficiently kill pAML cells. We show that the majority of primary pAML are killed by LV-10 cells, with different levels of sensitivity to killing. Transcriptionally, pAML sensitive to LV-10 killing expressed a myeloid maturation signature. -
1 Novel Expression Signatures Identified by Transcriptional Analysis
ARD Online First, published on October 7, 2009 as 10.1136/ard.2009.108043 Ann Rheum Dis: first published as 10.1136/ard.2009.108043 on 7 October 2009. Downloaded from Novel expression signatures identified by transcriptional analysis of separated leukocyte subsets in SLE and vasculitis 1Paul A Lyons, 1Eoin F McKinney, 1Tim F Rayner, 1Alexander Hatton, 1Hayley B Woffendin, 1Maria Koukoulaki, 2Thomas C Freeman, 1David RW Jayne, 1Afzal N Chaudhry, and 1Kenneth GC Smith. 1Cambridge Institute for Medical Research and Department of Medicine, Addenbrooke’s Hospital, Hills Road, Cambridge, CB2 0XY, UK 2Roslin Institute, University of Edinburgh, Roslin, Midlothian, EH25 9PS, UK Correspondence should be addressed to Dr Paul Lyons or Prof Kenneth Smith, Department of Medicine, Cambridge Institute for Medical Research, Addenbrooke’s Hospital, Hills Road, Cambridge, CB2 0XY, UK. Telephone: +44 1223 762642, Fax: +44 1223 762640, E-mail: [email protected] or [email protected] Key words: Gene expression, autoimmune disease, SLE, vasculitis Word count: 2,906 The Corresponding Author has the right to grant on behalf of all authors and does grant on behalf of all authors, an exclusive licence (or non-exclusive for government employees) on a worldwide basis to the BMJ Publishing Group Ltd and its Licensees to permit this article (if accepted) to be published in Annals of the Rheumatic Diseases and any other BMJPGL products to exploit all subsidiary rights, as set out in their licence (http://ard.bmj.com/ifora/licence.pdf). http://ard.bmj.com/ on September 29, 2021 by guest. Protected copyright. 1 Copyright Article author (or their employer) 2009. -
SF3B1-Mutated Chronic Lymphocytic Leukemia Shows Evidence Of
SF3B1-mutated chronic lymphocytic leukemia shows evidence of NOTCH1 pathway activation including CD20 downregulation by Federico Pozzo, Tamara Bittolo, Erika Tissino, Filippo Vit, Elena Vendramini, Luca Laurenti, Giovanni D'Arena, Jacopo Olivieri, Gabriele Pozzato, Francesco Zaja, Annalisa Chiarenza, Francesco Di Raimondo, Antonella Zucchetto, Riccardo Bomben, Francesca Maria Rossi, Giovanni Del Poeta, Michele Dal Bo, and Valter Gattei Haematologica 2020 [Epub ahead of print] Citation: Federico Pozzo, Tamara Bittolo, Erika Tissino, Filippo Vit, Elena Vendramini, Luca Laurenti, Giovanni D'Arena, Jacopo Olivieri, Gabriele Pozzato, Francesco Zaja, Annalisa Chiarenza, Francesco Di Raimondo, Antonella Zucchetto, Riccardo Bomben, Francesca Maria Rossi, Giovanni Del Poeta, Michele Dal Bo, and Valter Gattei SF3B1-mutated chronic lymphocytic leukemia shows evidence of NOTCH1 pathway activation including CD20 downregulation. Haematologica. 2020; 105:xxx doi:10.3324/haematol.2020.261891 Publisher's Disclaimer. E-publishing ahead of print is increasingly important for the rapid dissemination of science. Haematologica is, therefore, E-publishing PDF files of an early version of manuscripts that have completed a regular peer review and have been accepted for publication. E-publishing of this PDF file has been approved by the authors. After having E-published Ahead of Print, manuscripts will then undergo technical and English editing, typesetting, proof correction and be presented for the authors' final approval; the final version of the manuscript will -
MS4A6A Antibody Cat
MS4A6A Antibody Cat. No.: 6593 Western blot analysis of MS4A6A in 293 cell lysate with MS4A6A antibody at (A) 1 and (B) 2 μg/mL. Immunohistochemistry of MS4A6A in rat brain tissue with Immunofluorescence of MS4A6A in rat brain tissue with MS4A6A antibody at 2.5 μg/mL. MS4A6A antibody at 20 μg/mL. Specifications HOST SPECIES: Rabbit SPECIES REACTIVITY: Human, Mouse, Rat MS4A6A antibody was raised against a 19 amino acid synthetic peptide near the amino terminus of human MS4A6A. IMMUNOGEN: The immunogen is located within the first 50 amino acids of MS4A6A. TESTED APPLICATIONS: ELISA, IF, IHC-P, WB September 25, 2021 1 https://www.prosci-inc.com/ms4a6a-antibody-6593.html MS4A6A antibody can be used for detection of MS4A6A by Western blot at 1 - 2 μg/mL. Antibody can also be used for immunohistochemistry starting at 2.5 μg/mL. For immunofluorescence start at 20 μg/mL. APPLICATIONS: Antibody validated: Western Blot in human samples; Immunohistochemistry in rat samples and Immunofluorescence in rat samples. All other applications and species not yet tested. At least three isoforms of MS4A6A are known to exist; this antibody will detect the two SPECIFICITY: longer isoforms. MS4A6A antibody is predicted to not cross-react with MS4A family members. POSITIVE CONTROL: 1) Cat. No. 1210 - HEK293 Cell Lysate Properties PURIFICATION: MS4A6A Antibody is affinity chromatography purified via peptide column. CLONALITY: Polyclonal ISOTYPE: IgG CONJUGATE: Unconjugated PHYSICAL STATE: Liquid BUFFER: MS4A6A Antibody is supplied in PBS containing 0.02% sodium azide. CONCENTRATION: 1 mg/mL MS4A6A antibody can be stored at 4˚C for three months and -20˚C, stable for up to one STORAGE CONDITIONS: year. -
MS4A3 Rabbit Polyclonal Antibody – TA358035 | Origene
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for TA358035 MS4A3 Rabbit Polyclonal Antibody Product data: Product Type: Primary Antibodies Applications: WB Reactivity: Human Host: Rabbit Clonality: Polyclonal Specificity: Expected reactivity: Human Homology: Human: 100% Formulation: Liquid. Purified antibody supplied in 1x PBS buffer with 0.09% (w/v) sodium azide and 2% sucrose. Note that this product is shipped as lyophilized powder to China customers. Concentration: lot specific Purification: Affinity Purified Conjugation: Unconjugated Storage: For short term use, store at 2-8°C up to 1 week. For long term storage, store at -20°C in small aliquots to prevent freeze-thaw cycles. Stability: Shelf life: one year from despatch. Predicted Protein Size: 24kDa Gene Name: membrane spanning 4-domains A3 Database Link: NP_006129 Entrez Gene 932 Human Q96HJ5 Background: This gene encodes a member of the membrane-spanning 4A gene family. Members of this protein family are characterized by common structural features and similar intron/exon splice boundaries and display unique expression patterns among hematopoietic cells and nonlymphoid tissues. This family member likely plays a role in signal transduction and may function as a subunit associated with receptor complexes. The gene encoding this protein is localized to 11q12, among a cluster of related family members. Alternative splicing may result in multiple transcript variants; however, not all variants have been fully described. This product is to be used for laboratory only. Not for diagnostic or therapeutic use. -
Hypoxia As an Evolutionary Force
“The genetic architecture of adaptations to high altitude in Ethiopia” Gorka Alkorta-Aranburu1, Cynthia M. Beall2*, David B. Witonsky1, Amha Gebremedhin3, Jonathan K. Pritchard1,4, Anna Di Rienzo1* 1 Department of Human Genetics, University of Chicago, Chicago, Illinois, United States of America, 2 Department of Anthropology, Case Western Research University, Cleveland, Ohio, United States of America, 3 Department of Internal Medicine, Faculty of Medicine, Addis Ababa University, Addis Ababa, Ethiopia, 4 Howard Hughes Medical Institute * E-mail: [email protected] and [email protected] Corresponding authors: Anna Di Rienzo Department of Human Genetics University of Chicago 920 E. 58th Street Chicago, IL 60637, USA. Cynthia M. Beall Anthropology Department Case Western Reserve University 238 Mather Memorial Building 11220 Bellflower Road Cleveland, OH 44106, USA. 1 ABSTRACT Although hypoxia is a major stress on physiological processes, several human populations have survived for millennia at high altitudes, suggesting that they have adapted to hypoxic conditions. This hypothesis was recently corroborated by studies of Tibetan highlanders, which showed that polymorphisms in candidate genes show signatures of natural selection as well as well-replicated association signals for variation in hemoglobin levels. We extended genomic analysis to two Ethiopian ethnic groups: Amhara and Oromo. For each ethnic group, we sampled low and high altitude residents, thus allowing genetic and phenotypic comparisons across altitudes and across ethnic groups. Genome- wide SNP genotype data were collected in these samples by using Illumina arrays. We find that variants associated with hemoglobin variation among Tibetans or other variants at the same loci do not influence the trait in Ethiopians. -
Which Modulates T Cell Activation Adapter, Expressed by Regulatory T Cells, MS4A4B Is a GITR-Associated Membrane
MS4A4B Is a GITR-Associated Membrane Adapter, Expressed by Regulatory T Cells, Which Modulates T Cell Activation This information is current as Duncan Howie, Kathleen F. Nolan, Stephen Daley, Emma of October 3, 2021. Butterfield, Elizabeth Adams, Hugo Garcia-Rueda, Claire Thompson, Nigel J. Saunders, Stephen P. Cobbold, Yukiko Tone, Masahide Tone and Herman Waldmann J Immunol 2009; 183:4197-4204; Prepublished online 14 September 2009; doi: 10.4049/jimmunol.0901070 Downloaded from http://www.jimmunol.org/content/183/7/4197 Supplementary http://www.jimmunol.org/content/suppl/2009/09/14/jimmunol.090107 http://www.jimmunol.org/ Material 0.DC1 References This article cites 36 articles, 19 of which you can access for free at: http://www.jimmunol.org/content/183/7/4197.full#ref-list-1 Why The JI? Submit online. by guest on October 3, 2021 • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2009 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology MS4A4B Is a GITR-Associated Membrane Adapter, Expressed by Regulatory T Cells, Which Modulates T Cell Activation1 Duncan Howie,2* Kathleen F. -
Dual Functions for Insulinoma-Associated 1 in Retinal Development
University of Kentucky UKnowledge Theses and Dissertations--Biology Biology 2015 DUAL FUNCTIONS FOR INSULINOMA-ASSOCIATED 1 IN RETINAL DEVELOPMENT Marie A. Forbes-Osborne University of Kentucky, [email protected] Right click to open a feedback form in a new tab to let us know how this document benefits ou.y Recommended Citation Forbes-Osborne, Marie A., "DUAL FUNCTIONS FOR INSULINOMA-ASSOCIATED 1 IN RETINAL DEVELOPMENT" (2015). Theses and Dissertations--Biology. 31. https://uknowledge.uky.edu/biology_etds/31 This Doctoral Dissertation is brought to you for free and open access by the Biology at UKnowledge. It has been accepted for inclusion in Theses and Dissertations--Biology by an authorized administrator of UKnowledge. For more information, please contact [email protected]. STUDENT AGREEMENT: I represent that my thesis or dissertation and abstract are my original work. Proper attribution has been given to all outside sources. I understand that I am solely responsible for obtaining any needed copyright permissions. I have obtained needed written permission statement(s) from the owner(s) of each third-party copyrighted matter to be included in my work, allowing electronic distribution (if such use is not permitted by the fair use doctrine) which will be submitted to UKnowledge as Additional File. I hereby grant to The University of Kentucky and its agents the irrevocable, non-exclusive, and royalty-free license to archive and make accessible my work in whole or in part in all forms of media, now or hereafter known. I agree that the document mentioned above may be made available immediately for worldwide access unless an embargo applies.