miR-301a Regulates Inflammatory Response to Japanese Encephalitis Virus Infection via Suppression of NKRF Activity

This information is current as Bibhabasu Hazra, Surajit Chakraborty, Meenakshi Bhaskar, of September 25, 2021. Sriparna Mukherjee, Anita Mahadevan and Anirban Basu J Immunol published online 16 September 2019 http://www.jimmunol.org/content/early/2019/09/13/jimmun ol.1900003 Downloaded from

Supplementary http://www.jimmunol.org/content/suppl/2019/09/13/jimmunol.190000 Material 3.DCSupplemental http://www.jimmunol.org/ Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication

by guest on September 25, 2021 *average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2019 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Published September 16, 2019, doi:10.4049/jimmunol.1900003 The Journal of Immunology

miR-301a Regulates Inflammatory Response to Japanese Encephalitis Virus Infection via Suppression of NKRF Activity

Bibhabasu Hazra,* Surajit Chakraborty,* Meenakshi Bhaskar,* Sriparna Mukherjee,* Anita Mahadevan,† and Anirban Basu*

Microglia being the resident macrophage of brain provides neuroprotection following diverse microbial infections. Japanese en- cephalitis virus (JEV) invades the CNS, resulting in neuroinflammation, which turns the neuroprotective role of microglia detri- mental as characterized by increased microglial activation and neuronal death. Several host factors, including microRNAs, play vital roles in regulating virus-induced inflammation. In the current study, we demonstrate that the expression of miR-301a is in-

creased in JEV-infected microglial cells and human brain. Overexpression of miR-301a augments the JEV-induced inflammatory Downloaded from response, whereas inhibition of miR-301a completely reverses the effects. Mechanistically, NF-kB–repressing factor (NKRF) functioning as inhibitor of NF-kB activation is identified as a potential target of miR-301a in JEV infection. Consequently, miR-301a–mediated inhibition of NKRF enhances nuclear translocation of NF-kB, which, in turn, resulted in amplified inflam- matory response. Conversely, NKRF overexpression in miR-301a–inhibited condition restores nuclear accumulation of NF-kBtoa basal level. We also observed that JEV infection induces classical activation (M1) of microglia that drives the production of

proinflammatory cytokines while suppressing alternative activation (M2) that could serve to dampen the inflammatory response. http://www.jimmunol.org/ Furthermore, in vivo neutralization of miR-301a in mouse brain restores NKRF expression, thereby reducing inflammatory response, microglial activation, and neuronal apoptosis. Thus, our study suggests that the JEV-induced expression of miR-301a positively regulates inflammatory response by suppressing NKRF production, which might be targeted to manage viral-induced neuroinflammation. The Journal of Immunology, 2019, 203: 000–000.

nflammatory response triggered by the activation of innate (2, 3). However, neuronal death as a result of excessive microglial arm of the immune system provides the first line of defense inflammation is a profound characteristic in most of the neuro- against host invasion by microbial pathogens (1). Although tropic flaviviral infections, including that of Japanese encephalitis

I by guest on September 25, 2021 this protective response elicited by the body operates to ensure virus (JEV) (4). JEV is a mosquito-borne ssRNA virus that belongs clearance of detrimental stimuli, an excessive inflammatory re- to the Flaviviridae family, which also includes dengue, Zika, sponse against pathogens can give rise to pathological conditions and West Nile. After entering the body, JEV invades the CNS, resulting into development of signs and symptoms such as fever, headache, and vomiting. About one-third of patients die, and al- *National Brain Research Centre, Manesar, Haryana 122052, India; and †Department of most half of the survivors suffer from permanent cognitive im- Neuropathology, National Institute of Mental Health and Neurosciences, Bangalore pairment (5). Albeit JEV-induced encephalitis is considered to be 560029, India the most prevalent viral encephalitis in the Asia–Pacific region, ORCIDs: 0000-0002-4837-1463 (A.M.); 0000-0002-5200-2054 (A.B.). incidences of the same have been reported nowadays across areas Received for publication January 3, 2019. Accepted for publication August 20, 2019. where the threat was previously unknown and has become the This work was supported by research grants from the Department of Biotechnology cause of worldwide pandemics (6). (BT/PR22341/MED/122/55/2016) and the Tata Innovation Fellowship (BT/HRD/35/ 01/02/2014) to A.B. During the course of infection, JEV entry in the CNS culminates A.B. and B.H. designed the study, generated the hypothesis, analyzed the data, and into massive inflammatory response in the cerebrospinal fluid (7). wrote the manuscript. B.H. and S.C. performed the experiments, interpreted the Although this response appears to play a defensive role against results, and wrote the manuscript. B.H. performed the statistical analysis. M.B. and virus, uncontrolled inflammatory response upon virus infection S.M. performed the experiments. A.M. provided the autopsied human brain sections and reviewed the manuscript. plays a major role in triggering the death of neurons as a bystander Address correspondence and reprint requests to Dr. Anirban Basu, National Brain effect (4, 8). Being a resident macrophage, microglia is considered Research Centre, Manesar, Haryana 122052, India. E-mail address: [email protected] to be the main effector of CNS inflammation, and production The online version of this article contains supplemental material. of various proinflammatory mediators in JEV infection has been Abbreviations used in this article: anti–miR-Con, anti–miR control; CBA, cyto- implicated in the process of microglial activation (9–12). metric bead array; Con-esiRNA, esiRNA control; COX-2, cyclooxygenase-2; DIG, MicroRNAs (miRNAs) are small RNA molecules of 21–22-nt digoxigenin; esiRNA, endoribonuclease-prepared small interfering RNA; FFPE, length that act as important regulators of gene expression (13). formalin-fixed, paraffin embedded; iNOS, inducible NO synthase; IRF1, IFN reg- ulatory factor 1; ISH, in situ hybridization; JEV, Japanese encephalitis virus; LNA, They act at the posttranscriptional level by targeting the 3ʹ locked nucleic acid; MI, mock infection, mock-infected; miR-301a–VM, miR-301a untranslated region (UTR) of mRNAs, resulting in translational Vivo-Morpholino; miRNA, microRNA; MOI, multiplicity of infection; NBRC, National Brain Research Centre; NKRF, NF-kB–repressing factor; NKRF esiRNA, esiRNA repression or degradation of the target. In addition to diverse specific for NKRF; PCNA, proliferating cell nuclear Ag; qRT-PCR, quantitative physiological processes, studies demonstrate miRNAs playing a RT-PCR; snRNA, small nuclear RNA; SOCS5, suppressor of cytokine signaling 5; UTR, vital role in the development of various pathological conditions untranslated region; VM-NC, Vivo-Morpholino negative control; WT, wild-type. (14, 15). Accumulating evidence suggests a decisive role for Copyright Ó 2019 by The American Association of Immunologists, Inc. 0022-1767/19/$37.50 miRNAs in various neuroinflammatory diseases (16, 17), including

www.jimmunol.org/cgi/doi/10.4049/jimmunol.1900003 2 miR-301a REGULATES JEV-INDUCED MICROGLIAL ACTIVATION viral encephalitis (18, 19). Recently, two miRNAs, miR-15b and 8 3 104 cells/cm2. The cells were then incubated at 37˚C and used for miR-19b-3p, have been reported to involve in astrocyte mediated further experiments. neuroinflammation in JEV infection (20, 21). Previously, our Virus propagation and titration group evaluated the effect of JEV infection on the profile of microglial miRNAs, which are reported to be playing important The GP78 strain of JEV was propagated in suckling BALB/c mice (postnatal day 2) of either sex. Following the onset of symptoms, the mice role in regulating the inflammatory response (19). Among the were sacrificed to collect the infected brains. Viral suspension was prepared miRNAs whose expression were modulated upon JEV infection, as reported earlier (18) and stored at 280˚C until needed for use. Viral we already reported the regulatory mechanism of two host miRNAs, titers in culture medium of cell lines and brain samples were assessed by miR-29b and miR-155, in JEV-induced microglial inflammation plaque assay. Plaque formation was performed on monolayers of porcine stable kidney cells as previously mentioned (24). (18, 19). In the current study, miR-301a, which was found to be increased in previous miRNA profiling data, was subjected to Viral infection of cells further investigation to decipher its role in JEV-triggered neuro- All cells were seeded at the desired density in culture plates as per the re- inflammation. It has been reported that miR-301a regulates Th quirements for different experiments. After the cells reached 80% confluence, cells, Th17 differentiation in autoimmune demyelination (22). In they were further incubated for 2 h in serum-free medium and infected with JEV pancreatic cancer, miR-301a is found to induce NF-kB activation (strain GP78) at an multiplicity of infection (MOI) of 5. Cells were harvested at by repressing NF-kB–repressing factor (NKRF) (23). We also different times for the time course study. For the dosage-dependent study, the cells were infected for 24 h separately with JEV at MOIs of 1, 5, or 10. Mock identified a crucial role of miR-301a in regulating antiviral IFN-b infection (MI) consisted of adding the same amount of medium as that con- response in JEV infection by suppressing IFN regulatory factor 1 taining the JEV inoculum but without virus.

(IRF1) and suppressor of cytokine signaling 5 (SOCS5) pro- Downloaded from Combined in situ hybridization and ductions (24). In this study, we demonstrate that enhanced ex- immunohistochemistry analysis pression of miR-301a in JEV-infected microglia augments the inflammatory response via targeting NKRF, a negative regulator Formalin-fixed, paraffin embedded (FFPE) sections of uninfected (MI) and of NF-kB activity. Furthermore, in vivo inhibition of miR-301a JEV-infected human brains were deparaffinized with xylene, hydrated in JEV-infected mice reduces overall neuroinflammation and using series of alcohol, and were processed for in situ hybridization (ISH) with the miRCURY LNA microRNA ISH Optimization Kit (Exiqon), neuronal cell death. as described previously (24). FFPE sections of hippocampus region of http://www.jimmunol.org/ JEV-infected autopsied human brains (CSF positive for JEV-IgM) and uninfected human brains (subjects who met with road traffic accidents with Materials and Methods minimal trauma to brain) were obtained from the archives of Human Brain Mice Bank, National Institute of Mental Health and Neurosciences, Bangalore, BALB/c mice of either sex were kept together with their respective mothers according to institutional ethics and confidentiality of the subjects. Brain under a 12 h dark/12 h light cycle at a constant temperature and humidity. sections from two uninfected brains (28- and 25-y-old male) and two All experiments were performed after getting approval from the Institu- JEV-infected patient’s brain (14- and 10-y-old male) were used for the tional Animal Ethics Committee of the National Brain Research Centre study. All the tissues are collected with written informed consent of close (NBRC) (approval no. NBRC/IAEC/2014/96 and NBRC/IAEC/2018/139). relatives of the deceased. The uninfected brain tissues are taken from

The animals were maintained in strict accordance with good animal practice relatively normal zones, far away from the site of injury. Briefly, the by guest on September 25, 2021 as per the guidelines of the Committee for the Purpose of Control and sections were hybridized with 60 nM double digoxigenin (DIG)–labeled ʹ Supervision of Experiments on Animals, Ministry of Environment and locked nucleic acid (LNA) miR-301a probe (5 -GCTTTGACAATA- ʹ ʹ Forestry, Government of India. CTATTGCACTG-3 ; Exiqon) or 5 nM 5 -DIG–labeled LNA U6 small nuclear RNA (snRNA) probe (5ʹ-CACGAATTTGCGTGTCATCCTT-3ʹ; Cell culture Exiqon), followed by 1 h incubation with sheep anti-DIG/alkaline phos- phatase Ab (1:400 dilution; Roche Life Science). BCIP/NBT chromogen The human cell line of fetal microglial origin CHME3 and the mouse (Roche Life Science) was then added to develop blue color. Following microglial cell line BV2 are gifts from S. Levison (Rutgers University stringent washing with water, blocking solution (5% BSA in PBS) was Cancer Research Center, Newark, NJ), and porcine stable kidney cells, a added to these sections for 20 min before being incubated overnight with gift from G. R. Medigeshi (Translational Health Science and Technology rabbit derived anti-TMEM119 (microglia specific) (1:100; Abcam) Ab at Institute, Faridabad, India), wereculturedat37˚CinDMEMsup- 4 ˚C. After extensive washing with PBS, the sample slides were incubated plemented with 10% FBS, penicillin (100 U/ml), and streptomycin with biotinylated anti-rabbit Ig G (1:200; Vector Laboratories) and then it (100 mg/ml). All cell culture reagents were obtained from Sigma- was made to interact with HRP-conjugated streptavidin (1:250; Vector Aldrich, unless otherwise specified. Laboratories), thus developing a gray-black reaction product upon action Primary microglia culture of DAB Substrate Kit (SK-4100; Vector Laboratories). Slides were mounted with DPX (Qualigens Fine Chemicals) and observed with Nikon Primary microglial cells were isolated from postnatal days 0–2 (P0–P2) Eclipse Ti-S Inverted Microscope under appropriate magnification. BALB/c mouse pups according to a previously described method (10). The whole-brain cerebral cortex was dissected from BALB/c mouse pups, Transfection of cells with miRNA mimics and inhibitors followed by the removal of meninges from the cortex under dissecting To overexpress or inhibit miR-301a, transfection of cells were performed microscope. The tissue was then converted into single-cell suspension by with mimics of human or mouse miR-301a (dsRNAs that mimic mature the means of trypsin/DNase-I treatment at 37˚C along with mechanical endogenous miR-301a) or with miR-301a inhibitors (modified ssRNAs that dissociation. The single-cell suspension was passed through 130-mm cell specifically inhibit endogenous miR-301a activity) (Qiagen), respectively, strainer, followed by the centrifugation of the filtrate at 800 rpm for using HiPerFect Transfection Reagent (Qiagen) according to the manu- 10 min. The cell pellet formed was used for cell seeding in 75 cm2 cell facturer’s instructions. Twenty-four hours following transfection, the cells culture flask at a density of 2 3 105 cells/cm2 in complete MEM (sup- were harvested or infected with JEV for specific times, and then, the plemented with 10% FBS, 100 U/ml penicillin, 100 mg/ml streptomycin, abundances of the miRNAs, mRNAs, and proteins were analyzed. Nega- 0.6% glucose, and 2 mM glutamine). Exhausted media was changed every tive controls of the mimic or inhibitor (Ambion) were used in the trans- 2 d until the cell culture flask containing mixed glial population fections as the matched controls. An equal volume of HiPerFect reagent achieved full confluency. After completion of 12–14 d, the cell cul- ture flasks were subjected to horizontal shaking on an Excella E25 without any nucleic acid was treated to mock transfection cells. Orbital Shaker (New Brunswick Scientific, Edison, NJ) at 250 rpm Plasmid construction for 90 min at 37˚C for dislodging the microglial cells. Unattached cells obtained were plated in bacteriological petri dishes for 90 min The 1015-bp segment of cDNA encoding the 3ʹ UTR of human NKRF to allow the microglial cells to adhere to it. Followed by that, containing the putative miR-301a binding site were amplified by PCR from the unattached cells were discarded, and the microglial cells were CHME3 cDNA with the NKRF Luc primers (forward and reverse) scraped off, centrifuged, and plated on chamber slides at a density of (Supplemental Table I). The DNA fragment was cloned into the Spe I and The Journal of Immunology 3

Mlu I sites downstream of the firefly luciferase gene in the pMIR-REPORT mature mRNA and miRNA abundances, quantitative RT-PCR (qRT-PCR) plasmid. Site-directed mutagenesis at the miR-301a binding site was analysis was performed. Isolation of total RNA from treated cells and generated with the NKRF Luc mutant primers (forward and reverse; mouse brain followed by cDNA synthesis was performed as mentioned Supplemental Table I), as mentioned before (24). The NKRF cds primers above. mRNA from human brain sections was isolated according to a (forward and reverse; Supplemental Table I) were used to amplify the previously said protocol (9). qRT-PCR analysis of human and mouse genes 2084-bp coding region for NKRF from human cDNA. This PCR product were performed using Power SYBR Green PCR Master Mix (Applied was digested with Hind III and BamHI, and then cloned into the pcDNA 3. Biosystems) along with gene-specific primers (Supplemental Table I). 1 (+) plasmid (which was provided by D. Chattopadhyay, Amity Univer- The relative abundance of an mRNA of interest was determined by nor- 2ΔΔCt sity, Kolkata, India). However, all of the constructs were commercially malization to that of GAPDH mRNA through the 2 method (Ct sequenced at Invitrogen BioServices India, Gurgaon, India. refers to the threshold value). The isolation of miRNA and cDNA prep- aration was performed as described earlier (24). The primers of hu- Transfection of cells with endoribonuclease-prepared small man miR-301a, 5ʹ-CAGUGCAAUAGUAUUGUCAAAGC-3ʹ and mouse interfering RNA and plasmids miR-301a, 5ʹ-CAGUGCAAUAGUAUUGUCAAAGC-3ʹ were used as forward primers in qRT-PCR analysis as stated previously (24). The pro- Endoribonuclease-prepared small interferring RNA (esiRNA) specific for cedure of tissue preparation for miRNA isolation from human brain sec- human NKRF (EHU132691) as well as negative esiRNA control (Con- tions was similar as that of mRNA. The snRNA SNORD68 was used as a ʹ esiRNA) (sense, 5 -GTGAGCAAGGGCGAGGAGCTGTTCACCGGGG- normalization control. The thermal cycler ViiA 7 Real-Time PCR (Applied ʹ TGGTGCCCATCCTGGTCGAGCTG GA-3 ) were purchased from Biosystems) was used for qRT-PCR, and the data were analyzed with the Sigma-Aldrich. CHME3 cells were transfected with either esiRNAs or iCycler Thermal Cycler software (Applied Biosystems). plasmids encoding NKRF with Lipofectamine 2000 (Invitrogen), as described earlier (24). Twenty-four hours later, the cells were infected Western blotting with JEV (MOI, 5) for 24 h, and the cells or cell culture medium were Protein was isolated from cells and mouse tissue as previously described then subjected to mRNA or protein analysis. Transfection efficiency Downloaded from was assessed by measuring the amounts of the proteins of interest. (24), and concentration of each sample was estimated using the BCA re- agent (Sigma-Aldrich). Equal amounts of proteins were resolved by Luciferase reporter assays SDS-PAGE and transferred onto a nitrocellulose membrane and incubated with primary Abs specific for NKRF (1:1000; OriGene), inducible NO 4 CHME3 cells (2 3 10 ) were seeded in a 24-well plate for 16–18 h and synthase (iNOS) (1:1000; Abcam), cyclooxygenase-2 (COX-2) (1:1000; then were transiently transfected with firefly luciferase reporter constructs MilliporeSigma), NF-kB/p65 (1:10,000; Cell Signaling Technology), together with either an miR-301a mimic (Mimic–miR-301a) or inhibitor p–NF-kB/p65 (1:1000; Cell Signaling Technology), SOCS5 (1:1000; and their respective controls using Lipofectamine 2000. The cells were Abcam), IRF1 (1:1000; Cell Signaling Technology), NeuN (1:1000; http://www.jimmunol.org/ also cotransfected with a Renilla luciferase vector (pRL-TK, a gift from MilliporeSigma), Iba1 (1:1000; Wako Chemicals), proliferating cell nu- E. Sen, NBRC) for normalization of transfection efficiency. Twenty-four clear Ag (PCNA) (1:2000; Cell Signaling Technology), or b-actin hours later, the cells were harvested, and luciferase activity of each sample (1:10,000; Sigma-Aldrich). b-actin was used as internal control except for was measured as illustrated previously (24). In another set of experiments, samples containing nuclear proteins for which PCNA acted as the internal the cells were cotransfected with the inhibitor and reporter constructs. control. The secondary Abs used for detection were HRP-conjugated goat Twenty-four hours later, the cells were infected with JEV, and lumines- anti-mouse and goat anti-rabbit IgG (1:5000; Vector Laboratories). The cence was measured after 24 h of infection. For NF-kB activity analysis, blots were developed by exposure in UVITEC Chemiluminescence System CHME3 cells were cotransfected with different combinations of NF-kB (Cleaver Scientific) with NineAlliance software. luciferase reporter construct (a kind gift from E. Sen, NBRC), miR-301a inhibitor, esiRNA specific for NKRF (NKRF esiRNA), and plasmid Immunofluorescence encoding NKRF. Following 24 h of transfection, cell were infected with by guest on September 25, 2021 JEV for 24 h, and luminescence was measured. Mouse brain sections were permeabilized with 0.1% Triton X-100 in PBS and then incubated with blocking buffer for 1 h at room temperature, which NO measurement was followed by overnight incubation with either anti-TMEM119 (1:100; Abcam) and anti-NKRF (1:100; OriGene) Abs, or anti-TMEM119 and anti- Nitrite, a stable oxidized product of NO, was measured by using Griess CD68 (1:150; Abcam), or anti-TMEM119 and anti-CD86 (1:200; BD reagent (Sigma-Aldrich) as described earlier (12). Cell culture media of Pharmingen), or anti-TMEM119 and anti-CD206 (1:400; Abcam) at 4˚C. uninfected and treated cells was collected and centrifuged at 2000 rpm for After extensive washing, the sections were incubated with Alexa Fluor 5 min to remove cellular debris. The media (50 ml) was then reacted with 488– or Alexa Fluor 594– (1:1500; Molecular Probes) or fluorescein equal volume of Griess reagent for 15 min at room temperature in dark, (1:250; Vector Laboratories)–conjugated secondary Abs for 1 h. Finally, and absorbance was taken at 540 nm using microplate reader (Bio-Rad the sections were mounted with DAPI (Vector Laboratories) and observed Laboratories). Nitrite concentrations were determined using standard so- using a Zeiss ApoTome microscope at the specified magnification. FFPE lutions of sodium nitrite prepared in same medium used to grow cells. brain sections were deparaffinized by putting in xylene thrice, each for 15 min. These sections were then dehydrated in ethanol and following PBS Cytometric bead array wash subjected to the immunofluorescence analysis using anti-TMEM119 The expression of cytokines in culture medium obtained from control and (1:100; Abcam) and anti-NKRF (1:100; OriGene) Abs. Neuronal apoptosis treated CHME3 cells was measured using human inflammatory cytokine was assessed by TUNEL assay using In Situ Cell Death Detection Kit cytometric bead array (CBA) kit (BD Biosciences, San Diego, CA), whereas (Roche Life Science). Mouse brain sections were incubated with TMR red– mouse inflammation CBA kit was used to analyze the abundances of cy- conjugated TUNEL mixture followed by anti-NeuN (1:250; MilliporeSigma) tokines in BV2 cell culture medium and mouse brain lysate as per man- staining using Alexa Fluor 488–conjugated secondary Ab, and rest of the ufacturer instructions. Briefly, 30 ml of bead mixture of cytokines was procedure being same as mentioned above. mixed with test samples or standards, to which fluorescent dye was added. JEV infection and treatment of Vivo-Morpholino to mice Following 2 h of incubation in dark, the beads were washed and resus- pended in 300 ml of wash buffer, and acquired using BD FACSuite soft- For in vivo experiments, P10 mice of either sex were randomly assigned to three ware in FACSVerse System (Becton Dickinson, San Diego, CA). Data were groups. Among them, group 1 was the MI group and received only PBS, whereas analyzed using FCAP Array v3.0 Software (Becton Dickinson) and con- mice from the other two groups were injected i.p. with JEV (3 3 105 PFU). centrations of different cytokines were expressed as picograms per milliliter. After 24 h of infection, mice in groups 2 and 3 were treated intracranially with the single dosage of Vivo-Morpholino (Gene Tools), Vivo-Morpholino RT-PCR and quantitative RT-PCR negative control (VM-NC; 18 mg/kg), and miR-301a Vivo-Morpholino To determine the viral RNA expression, total RNA was isolated from (miR-301a–VM; 18 mg/kg), respectively. After 3 and 7 d of infection, the JEV-infected CHME3 and BV2 cells by using Tri Reagent (Sigma-Aldrich), mice were euthanized and brain samples were collected for qRT-PCR, and 250 ng of RNA was reverse transcribed with the Verso cDNA Synthesis CBA, and Western blotting analyses. Brain samples collected following Kit (Thermo Fisher Scientific). Then, 5 ml of cDNA reaction mixture was 7 d of infection were used for immunofluorescence analysis. subjected to PCR amplification (95˚C 30 s, 54˚C 45 s, and 68˚C 1 min for Statistical analysis 35 cycles) by using JEV- and GAPDH-specific primer pairs (Supplemental Table I). The PCR products were visualized after electrophoresis on a 1% All experiments were performed in triplicate unless otherwise indicated. agarose gel containing ethidium bromide. For quantitative determination of Student two-tailed unpaired t test was performed to analyze statistical 4 miR-301a REGULATES JEV-INDUCED MICROGLIAL ACTIVATION difference between two groups. Comparisons involving multiple groups We observed a contrasting result following anti–miR-301a were evaluated by one-way ANOVA followed by Bonferroni post hoc test, transfection as it reduced cytokine expression in both JEV- whereas two-way ANOVA followed by the Holm–Sidak method was used infected CHME3 and BV2 compared with that by anti–miR- in assessing differences between multiple groups influenced by two fac- tors. Any value of p , 0.05 was considered statistically significant. The Con–transfected cells (Fig. 2E, 2F). In addition to the secretome results are expressed as means 6 SD, and graphs were prepared with analysis, we measured the mRNA expression of some additional KyPlot (version 2.0 b 13) and SigmaPlot 11.0. proinflammatory markers in both JEV-infected CHME3 (CCL2, CCL5, and IFN-g) and BV2 (IL-1b and CCL5) cells transfected Results with either Mimic–miR-301a or anti–miR-301a. In both cases, miR-301a expression is enhanced during JEV infection overexpression of miR-301a increased the expression of these of microglia markers compared with negative control, whereas inhibition of Earlier work using miRNA PCR-based array to determine the miR-301a decreased their expression (Fig. 2G, 2H). This modu- miRNA expression profile upon JEV infection reported abundance lation of microglial inflammatory response was observed to be of a group of miRNAs with respect to uninfected cells (19). In this independent of viral propagation as demonstrated by viral titer study, we performed qRT-PCR to analyze the time-dependent analysis, which showed no significant differences in viral repli- expression profile of miR-301a in CHME3, a microglial cell cation in Mimic–miR-301a and inhibitor-transfected CHME3 and line of human origin. The significant increase in miR-301a BV2 cells when compared with negative control–transfected cells abundance was found up to 48 h, whereas a moderately declined (Fig. 2I, Supplemental Fig. 1A). pattern was observed beyond 24 h (Fig. 1A). Furthermore, CHME3 NKRF is a potential target of miR-301a cells also displayed a dosage-dependent increase in miR-301a upon Downloaded from infection with varying concentration of viruses for 24 h (Fig. 1B). To gain insight into the underlying mechanism of miR-301a JEV-infected autopsy brain samples also exhibited enhanced function, we analyzed the target genes that might play roles in abundance of miR-301a by qRT-PCR analysis (Fig. 1C). To enhancing inflammation in our model of JEV infection. Earlier evaluate miR-301a expression in human brain microglia, we reports indicate role of NKRF as a potential target gene for miR- performed both ISH analysis for miR-301a or U6 snRNA (as a 301a (23, 26). Alignment of miR-301a sequence with that of ʹ positive control) and immunohistochemical analysis of microglia its target site in the 3 UTR region of NKRF denoted conserved http://www.jimmunol.org/ specific marker TMEM119 (25) from uninfected and JEV-infected sequence complementarity across different species (Fig. 3A). A brain sections. Although the expression of U6 snRNA was found number of miRNA target prediction databases, including RNA- to be similar in both the cases, increased miR-301a expression was hybrid (27), Miranda (28), TargetScan (29), and Pictar (30), were observed in JEV-infected human brain sections with respect to used to perform the complementarity analysis. To validate the uninfected sections (Fig. 1D). Expression of miR-301a was further miRNA/mRNA interactions predicted by the above-mentioned validated in JEV-infected BV2 cells, and qRT-PCR analysis softwares, we cloned the 3ʹ UTR of human NKRF into a firefly showed both time- and dosage-dependent increase in its abun- luciferase reporter vector. We then generated nine-base mutations dance upon JEV infection (Fig. 1E, 1F). Similar time-dependent in the seed-matching site in the 3ʹ UTR of NKRF (Fig. 3B) to increased expression of miR-301a was observed in JEV-infected further test the miRNA/target interaction. CHME3 cells were then by guest on September 25, 2021 primary microglial cells (Fig. 1G). Together, these results indi- transfected with individual reporters containing wild-type (WT) or cate that miR-301a expression in microglia is enhanced in JEV mutant UTR together with either Mimic–miR-301a or miR-301a infection. inhibitor along with their negative controls. The Mimic–miR-301a effectively reduced the luciferase activity of the WT UTR reporter miR-301a regulates JEV-induced inflammatory response compared with that in cells transfected with the mimic control, Microglial activation during JEV infection is associated with ex- whereas the miR-301a–dependent reduction in luciferase activity aggerated secretion of proinflammatory cytokines. To assess the was disrupted by mutating the 3ʹ UTR binding site in NKRF role of miR-301a in JEV-triggered inflammatory response, over- (Fig. 3C). In contrast, anti–miR-301a significantly increased the expression and silencing studies of miR-301a were performed. We luciferase activity of the WT UTR reporter compared with that in transfected CHME3 and BV2 cells with either Mimic–miR-301a or anti–miR-Con–transfected cells and the mutation in UTR almost inhibitor (anti–miR-301a) for 24 h before the cells were left un- abolished the effect (Fig. 3C). We further analyzed effect of infected or infected with JEV. At 24 h of infection, transfection of Mimic–miR-301a and inhibitor transfection on mRNA and protein CHME3 and BV2 cells with Mimic–miR-301a demonstrated in- abundance of NKRF. Transfection of CHME3 and BV2 cells with creased miR-301a abundance in both uninfected and JEV-infected Mimic–miR-301a led to decline in both NKRF mRNA and protein cells with respect to control mimic. In contrast, transfection with abundance (Fig. 3D, 3E). In contrast, CHME3 and BV2 cells, anti–miR-301a resulted in decreased abundance of miR-301a when transfected with anti–miR-301a, exhibited increased abun- when compared with inhibitor control (anti–miR control [anti– dance of NKRF mRNA and protein (Fig. 3F, 3G). Further trans- miR-Con]) (Fig. 2A, 2B). Enhanced expression of a plethora of fection of primary microglia with Mimic–miR-301a substantially proinflammatory factors including NO, iNOS, and COX-2 were increased the abundance of miR-301a and subsequently attenuated observed following JEV infection in Mimic–miR-301a–trans- the production of NKRF mRNA (Fig. 3H) and protein (Fig. 3I). fected CHME3 and BV2 cells (Fig. 2C, 2D). In contrast, inhibition Unlike reported in our previous study, expression of SOCS5 and of miR-301a by anti–miR-301a led to significant decline in ex- IRF1 were demonstrated to be unchanged in response to miR- pression of these markers in JEV infection (Fig. 2C, 2D). We 301a activity modulation, hence reinforcing the neutral effect further investigated the role of miR-301a in production of JEV- of the miRNA upon microglial viral propagation (Supplemental induced proinflammatory cytokines. The amount of IL-1b, IL-12, Fig. 2A, 2B). TNF-a, IL-6, and IL-8 secreted by JEV-infected CHME3 (Fig. 2E) or the amount of IL-6, C-C motif CCL2, TNF-a, IL-12, JEV mitigates NKRF expression in microglia and IFN-g secreted by JEV-infected BV2 (Fig. 2F) were in- Because NKRF is a functional target of miR-301a, the expression creased in Mimic–miR-301a transfection compared with that by of NKRF in JEV-infected CHME3 and BV2 cells was investigated. control mimic–transfected cells as determined by CBA analysis. We observed that JEV infection resulted in an increase of miR-301a The Journal of Immunology 5 Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021

FIGURE 1. miR-301a expression is induced in JEV-infected microglia. (A and B) CHME3 cells were infected with JEV at an MOI of 5 for the indicated times (A) or infected with indicated MOIs for 24 h (B). The relative abundances of miR-301a compared with uninfected (MI) were determined by qRT-PCR analysis and normalized to that of SNORD68 snRNA. RT-PCR was performed to determine JEV infection (lower panels). GAPDH expression was verified as loading control. *p , 0.05, ***p , 0.001. (C) miRNA was isolated from uninfected (MI) and JEV-infected human brain sections, and miR-301a expression was determined by qRT-PCR. Data are representative of two different brains per group. *p , 0.05 by Student t test, compared with uninfected human brain. (D) ISH of miR-301a (purple chromogen) in microglial cells (gray black chromogen) from human brain. Uninfected (MI) and JEV-infected brain sections were hybridized with the miRCURY LNA miR-301a probe or the LNA U6 snRNA probe, which was followed by immunohistochemistry analysis of microglia with 3,3ʹ-diaminobenzidine (DAB). Scale bar, 20 mm; original magnification 340. The ubiquitously expressed U6 snRNA (purple chromogen) was used as a positive control. Quantification was performed by calculating the percentage of ISH+ to total TMEM119+ (microglial marker) cells (right panel). Data are mean 6 SD from five fields per section (two sections per human brain of each group). **p , 0.01 by Student t test, compared with uninfected human brain (MI). (E and F) BV2 cells were exposed to JEV for the indicated times (E) or were infected with indicated MOIs of JEV for 24 h (F), and the abundance of miR-301a was evaluated by qRT-PCR analysis. JEV infection was assessed by RT-PCR (lower panels), and GAPDH was used as internal control. *p , 0.05, **p , 0.01, ***p , 0.001, compared with uninfected cells (MI). (G) Primary microglial cells were isolated from postnatal day 0 (P0) to P2 BALB/c mouse pups, cultured for 12–14 d, and infected with JEV for the indicated times. miR-301a abundance was quantified by qRT-PCR analysis, and the results are expressed as the fold change compared with that in uninfected cells (MI). All data in bar graphs are means 6 SD of three biological replicates. p values are calculated by ANOVA, followed by Bonferroni post hoc test. *p , 0.05, ***p , 0.001. h.p.i., hours postinfection. 6 miR-301a REGULATES JEV-INDUCED MICROGLIAL ACTIVATION Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021

FIGURE 2. miR-301a regulates JEV-mediated microglial inflammation. (A) CHME3 and (B) BV2 cells transfected with Mimic–miR-301a or a negative control (control mimic [Mimic-Con]) and miR-301a inhibitor (anti–miR-301a) or a negative control (anti–miR-Con) were left uninfected (MI) or were infected with JEV for 24 h. Relative miR-301a abundance was then determined by qRT-PCR analysis. The p values were calculated by two-way ANOVA, followed by the Holm–Sidak method. *p , 0.05, **p , 0.01, compared with the respective negative control. (C and D) After 24 h of transfection as in (A) and (B), CHME3 cells (C) or BV2 cells (D) were infected with JEV for another 24 h before the cell culture media were subjected to spectrophotometric analysis of NO production. Immunoblot was performed to determine the protein expression of iNOS and COX2 (lower panels). b-Actin served as a loading control. Western blots are representative of three independent experiments. *p , 0.05, **p , 0.01, ***p , 0.001, compared with the respective negative control. (E–H) Both cells were treated as in (C) and (D). Culture medium of CHME3 cells was analyzed by CBA to determine the amount of secreted IL-1b, IL-12, TNF-a, IL-6, and IL-8 (E), whereas secretary levels of IL-6, CCL2, TNF-a, IL-12, and IFN-g were assessed by CBA in BV2 cells (F). CHME3 cells were also subjected to qRT-PCR analysis to determine the relative abundances of CCL2, CCL5, and IFN-g mRNAs (G). The relative expression of IL-1b and CCL5 mRNAs in BV2 cells was determined by qRT-PCR analysis (H). *p , 0.05, **p , 0.01, ***p , 0.001, compared with the negative control. (I) The transfected CHME3 cells were infected with JEV for 24 h and viral titers in the culture supernatants were detected by plaque assay. All data are means 6 SD of three biological replicates. The p values were calculated by one-way ANOVA followed by Bonferroni post hoc test. The Journal of Immunology 7 Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021

FIGURE 3. NKRF is a functional target of miR-301a. (A) Predicted miR-301a binding site in the 3ʹ UTR of NKRF mRNA. Perfect matches in the seed regions are indicated in orange. (B) Diagram of construct containing the 3ʹ UTR of NKRF downstream of a luciferase reporter. The WT 3ʹ UTR (WT UTR) contains an intrinsic miR-301a binding site, whereas the mutant 3ʹ UTR (Mut UTR) contains mutations that eliminated the seed match with miR-301a. Mutations (magenta) in the 3ʹ UTR of NKRF were generated for reporter gene assays. (C) Dual luciferase assays of CHME3 (Figure legend continues) 8 miR-301a REGULATES JEV-INDUCED MICROGLIAL ACTIVATION abundance and decline in NKRF mRNA and protein levels in (Fig. 6A–C). Additionally, the reduction in the expression of these both dosage- and time-dependent fashion (Fig. 4A–D). Analysis of proinflammatory markers by miR-301a inhibitor was disrupted by JEV-infected primary microglia also indicated a reduction in the knockdown of NKRF (Fig. 6A–C). In contrast, NKRF over- NKRF mRNA and protein expression (Fig. 4E, 4F). We further expression decreased the NO production, iNOS and COX-2 pro- confirmed a decrease in NKRF mRNA and protein abundance in tein abundance, and the expression of proinflammatory cytokines microglia of JEV-infected human brain (Fig. 4G, 4H). in JEV-infected CHME3 (Fig. 6D–F). Transfection of miR-301a inhibitor–treated CHME3 cells with NKRF construct followed by JEV-mediated augmentation of miR-301a inhibits JEV infection reduced the expression of these proinflammatory NKRF expression markers compared with cells cotransfected with the control vector To further validate whether JEV-induced miR-301a induction in- (Fig. 6D–F). deed targets NKRF, we cotransfected CHME3 cells with miR-301a k inhibitor or the inhibitor control together with either WT or mutant miR-301a induces NF- B activation by targeting NKRF NKRF 3ʹ UTR reporter constructs, followed by JEV infection for in JEV-infected microglia 24 h. Profound luciferase activity was observed in JEV-infected NKRF, which was previously demonstrated to interact with spe- cells, which were transfected with anti–miR-301a and WT UTR cific negative regulatory elements to inhibit NF-kB transcriptional construct when compared with cells cotransfected with WT UTR activity, is also reported to interact directly with p65 subunit of construct and inhibitor control (Fig. 5A). In contrast, mutating the NF-kB and, in turn, negatively regulates NF-kB transactivational NKRF 3ʹ UTR blocked the anti–miR-301a–mediated increase in activities (31, 32). First, we examined the time-dependent acti- luciferase activity in CHME3 cells (Fig. 5A). To present direct vation of NF-kB and found that JEV infection increased the Downloaded from evidence that JEV-induced miR-301a suppressed the production of amount of the phosphorylated form of p65 (p-p65) in both NKRF protein, we examined the abundance of NKRF in CHME3 CHME3 and BV2 cells (Fig. 7A, 7B). Consistent with time- cells infected with JEV for different times as well as in cells in- dependent NF-kB activation, miR-301a expression in both these fected for a fixed time with different viral concentrations in which cells was found to increase significantly upon JEV infection miR-301a was inhibited. We observed that inhibition of miR-301a (Fig. 7A, 7B). For further validation, CHME3 cells were either left

reconstituted NKRF protein production in JEV-infected cells untransfected or transfected with either of Mimic–miR-301a and http://www.jimmunol.org/ compared with that in control inhibitor transfected cells (Fig. 5B, inhibitor before being infected with JEV for 24 h. Translocation of 5C). NKRF expression of JEV-infected BV2 cells was similarly p-p65 into the nucleus was observed to increase upon transfection restored upon transfection with anti–miR-301a when compared with Mimic–miR-301a when compared with that in control mimic with that in anti–miR-Con–transfected cells infected with JEV transfection (Fig. 7C). In contrast, anti–miR-301a transfection (Fig. 5D, 5E). To verify the efficacy of miR-301a in targeting reduced the nuclear accumulation of p-p65 in comparison with NKRF in vivo, we knocked down the expression of miR-301a in JEV-infected CHME3 cells transfected with control inhibitor BALB/c mice by administrating miR-301a–VM or VM-NC after (Fig. 7D). However, abundance of p65 in total cellular protein was 24 h of JEV infection. The substantial reduction of NKRF protein found to be unchanged in response to mimic or inhibitor trans- expression in VM-NC–treated mice was significantly recovered in fection (Fig. 7C, 7D). To validate that miR-301a is involved in the by guest on September 25, 2021 miR-301a–VM-treated mice as analyzed by immunofluorescence regulation of NF-kB signaling through NKRF, CHME3 cells were study with microglia specific TMEM119 (25) (Fig. 5F). transfected with miR-301a inhibitor or NKRF esiRNA or in com- bination before being infected with JEV for 24 h. The inhibition of miR-301a enhances the JEV-induced inflammatory response by nuclear translocation of p-p65 by miR-301a inhibitor was rescued suppressing NKRF abundance by the knockdown of NKRF (Fig. 7E). In contrast, cotransfection of To validate the role of NKRF in the induction of a proinflammatory CHME3 cells with miR-301a inhibitor and NKRF coding plasmid state upon miR-301a upregulation, we conducted experiments in prior to JEV infection for 24 h decreased the nuclear translocation which NKRF expression was subjected to knockdown and over- of p-p65 when compared with JEV-infected cells treated with expression. We cotransfected CHME3 cells with Con-esiRNA or anti–miR-301a alone (Fig. 7F). Both NKRF esiRNA and NKRF NKRF esiRNA and anti–miR-301a or control inhibitor for 24 h expressing plasmid had no effect on the abundances of total p65 prior to being infected with JEV for 24 h. NO production, abun- (Fig. 7E, 7F). To provide direct evidence of NF-kB inhibition by dance of iNOS, COX-2, and several proinflammatory cytokines NKRF, we performed NF-kB luciferase reporter assay in response (IL-1b, IL-12, TNF-a, IL-6, IL-8, CCL2, CCL5, and IFN-g) to transfection of NKRF esiRNA and NKRF coding plasmid. The in JEV infection were found to be increased in NKRF silencing decrease in NF-kB activity by miR-301a inhibitor observed in

cells transfected with WT or Mut NKRF 3ʹ UTR luciferase constructs along with either the Mimic–miR-301a or miR-301a inhibitor (anti–miR-301a), or their negative controls were performed. Firefly luciferase activity was normalized to Renilla luciferase activity. Data are shown as the relative luciferase activity of cells transfected with the Mimic–miR-301a or miR-301a inhibitor compared with that of cells transfected with their negative control. Data are means 6 SD of nine experiments from three independent transfections. **p , 0.01, ***p , 0.001, by Student t test. (D and E) Following 24 h of transfection with Mimic–miR-301a or control mimic, CHME3 cells (D) and BV2 cells (E) were subjected to Western blotting and qRT-PCR analysis of the abundances of NKRF proteins (left) and mRNA (right). (F and G) CHME3 cells (F) and BV2 cells (G) were transfected with miR-301a inhibitor or its negative control. After 24 h, Western blotting and qRT-PCR analysis were performed to evaluate the abundances of NKRF proteins (left) and mRNA (right). b-Actin served as a loading control. All of the blots are a representative of three experiments with similar results. The relative abundance of miR-301aas determined by qRT-PCR analysis of each set of cells is shown below the blots to confirm effective transfection. (H) Primary microglia isolated from P2 BALB/c was transfected with Mimic–miR-301a or control mimic for 24 h and NKRF expression was evaluated by qRT-PCR analysis. The mimic transfection was evaluated by analyzing miR-301a expression by qRT-PCR (lower panels). Data are means 6 SD of three independent experiments. (I) Following 24 h of transfection, primary microglial cells were further evaluated for NKRF protein expression by coimmunofluorescence study with microglial Iba1 protein. Scale bar, 50 mm; original magnification 320. *p , 0.05, **p , 0.01, ***p , 0.001, by one-way ANOVA, followed by Bonferroni post hoc test. MT, mock transfection. The Journal of Immunology 9 Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021

FIGURE 4. NKRF expression is reduced in JEV infection. (A and B) CHME3 cells were infected with JEV at an MOI of 5 for the indicated times (A)or infected with indicated MOIs for 24 h (B). The relative abundances of NKRF mRNA were determined by qRT-PCR analysis. Western blot was performed to detect NKRF protein expression (lower panels). (C and D) The relative expressions of NKRF mRNA and protein in BV2 cells infected with JEV at an MOI of 5 for the indicated times (C) or infected with indicated MOIs for 24 h (D) were assessed by qRT-PCR and Western blot (lower panels) analysis re- spectively. b-Actin was used as a loading control. Western blots are representative of three independent experiments. The relative abundance of miR-301a in each set of cells was determined by qRT-PCR analysis and is shown below the blots. (E) Following JEV infection (MOI, 5) for the indicated times, the relative abundance of NKRF mRNA in primary microglia was determined by qRT-PCR analysis. The expression of miR-301a in each set of cells was provided (lower panel). The results are expressed as the mean 6 SD of three independent experiments. The p values were obtained by one-way ANOVA followed by Bonferroni multiple comparisons. *p , 0.05, **p , 0.01, ***p , 0.001, compared with uninfected cells (MI). (F) NKRF protein expression in MI and JEV-infected (JEV) primary microglial cells as in (E) was further evaluated by coimmunofluorescence study with microglial Iba1. Scale bar, 50 mm; original magnification 320. (G) The relative abundance of NKRF mRNA was assessed in uninfected (MI) and JEV human brain sections by qRT-PCR analysis. Data are representative of two different brains per group. *p , 0.05, by Student t test, compared with uninfected human brain. (H) Sections from uninfected (MI) and JEV human brains were evaluated for NKRF protein expression by coimmunofluorescence study with microglial TMEM119 protein. Scale bar, 50 mm; original magnification 320. h.p.i., hours postinfection.

JEV-infected CHME3 cells was enhanced by the knockdown of plethora of inflammatory cytokines and chemokines. In contrast, NKRF (Fig. 7G). In contrast, miR-301a inhibitor transfected cells M2 microglia has been observed to induce an anti-inflammatory with plasmid encoding NKRF reduced NF-kB activity in JEV response by releasing numerous protective factors. To analyze the infection compared with cells cotransfected with control vector role of miR-301a in M1/M2 microglial polarization, CHEM3 and (Fig. 7G). Hence, our results clearly indicate that JEV-induced BV2 cells were subjected to anti–miR-301a transfection before miR-301a upregulation promotes NF-kB activity via downregu- being infected with JEV for 24 h, followed by the evaluation of lation of NKRF. M1/M2 marker expressions by qRT-PCR analysis. JEV-induced increase in abundance of M1 microglial markers in control in- Inhibition of miR-301a induces M1 to M2 polarization in hibitor–transfected CHME3 (CD68, CD86, IL-1b, and TNF-a) JEV-infected microglia and BV2 (CD68, IL-1b, and TNF-a) was found to be significantly Microglia tend to polarize either into M1 or M2 phenotype, impaired in miR-301a inhibitor–transfected cells (Fig. 8A, 8B). depending upon combinations of different stimuli (33). M1 phe- On the contrary, abundance of M2 microglial markers in CHME3 notype is reported to promote proinflammatory state by secreting a (IL-4, IL-10, arginase-1, and CD206) and BV2 (IL-4, IL-10, and 10 miR-301a REGULATES JEV-INDUCED MICROGLIAL ACTIVATION Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021

FIGURE 5. JEV-induced miR-301a suppresses NKRF protein production. (A) CHME3 cells were cotransfected with either the miR-301a inhibitor (anti–miR-301a) or the negative control (anti–miR-Con) together with a firefly luciferase reporter plasmid encoding the WT or mutant 3ʹ UTRs of NKRF. Twenty-four hours later, the cells were infected with JEV for 24 h before luciferase activities were measured with a dual luciferase assay kit and normalized to that of Renilla luciferase. Data are expressed as the relative luciferase activity of the anti–miR- 301a–transfected cells compared with that of the anti–miR-Con–transfected cells. Data are means 6 SD of nine experiments from three independent transfections. **p , 0.01, by Student t test. (B and C) CHME3 cell were transfected with either miR-301a inhibitor or negative control (anti–miR-Con) and then were either infected with JEV at an MOI of 5 for the indicated times (B) or infected for 24 h with JEV at the indicated MOIs (C). The cells were analyzed by Western blotting to determine the relative abundance of NKRF protein. (D and E) Following transfection with either miR-301a inhibitor or negative control BV2 cells were infected with JEV as in (B and C). The time- (D) and dosage- dependent (E) protein expression of NKRF was analyzed by Western blot. b-Actin was used as a loading control. Blots are representative of three independent experiments. The relative abundance of miR-301a in each set of cells was determined by qRT-PCR analysis and is shown below the blots to confirm effective transfection. Data are means 6 SD of three individual experiments. (F) Postnatal day 10 (P10) BALB/c mice were treated with PBS (MI) or were infected with JEV (3 3 105 PFU) and treated with either miR-301a–VM, which targets mature miR- 301a (JEV with miR-301a–VM [JEV + miR-301a–VM]), or scrambled Vivo-Morpholino that was designed as a negative control (JEV with VM-NC [JEV + VM-NC]). Brains were collected on day 7 for the evaluation of NKRF protein expression by coimmunofluorescence study with microglial TMEM119 protein. Scale bar, 50 mm; original magnification 320. Data are representative of four mice per group. h.p.i., hours postinfection. arginase-1) cells in miR-301a–inhibited condition was observed to In vivo miR-301a inhibition attenuates neuroinflammation and be upregulated in comparison with inhibitor control transfection inhibits neuronal death (Fig. 8C, 8D). To further validate the role of miR-301a in M1/M2 Pathological changes like microglia activation, increased expres- marker polarization in vivo, we knocked down miR-301a ex- sion of proinflammatory cytokines, and neuronal death are con- pression in BALB/c mice by administrating miR-301a–VM or sidered to be the cardinal features of in vivo JEV infection. To VM-NC following 24 h of JEV infection. JEV-induced expression evaluate the effect of miR-301a inhibition on the neuroinflammation of M1 microglial markers like CD68 and CD86 were reduced in vivo, we used Vivo-Morpholino–mediated delivery of anti–miR- upon miR-301a–VM treatment in comparison with VM-NC ad- 301a in mouse brain. The Vivo-Morpholino system has already ministration (Fig. 8E, 8F). Concomitantly, miR-301a inhibition in been reported to result in very efficient delivery of antisense JEV-infected mice increased the abundance of M2 marker CD206 oligomers into a diverse range of tissues in experimental mice compared with that of VM-NC–treated mice as evaluated by im- (34). As mentioned in our previous study (24), Vivo-Morpholino– munofluorescence analysis (Fig. 8G). packaged anti–miR-301a specifically targeting the seed sequence The Journal of Immunology 11 Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021

FIGURE 6. miR-301a induces JEV-triggered inflammation by repressing NKRF. (A–C) CHME3 cells were transfected with either anti–miR-Con or anti– miR-301a, together with Con-esiRNA or NKRF esiRNA for 24 h before being infected with JEV at an MOI of 5. Twenty-four hours postinfection, (A)NO production was assessed by spectrophotometric analysis. Western blot of cellular extracts was performed to analyze NKRF, iNOS, and COX2 protein abundances (lower panels). b-Actin served as a loading control. Culture medium was also subjected to CBA analysis to determine the amount of secreted IL-1b, IL-12, TNF-a, IL-6, and IL-8 (B). The relative abundances of CCL2, CCL5, and IFN-g mRNAs were quantified by qRT-PCR analysis (C). Data are means 6 SD of three independent experiments. *p , 0.05, **p , 0.01, ***p , 0.001, as analyzed by one-way ANOVA followed by Bonferroni multiple comparisons. (D–F) CHME3 cells were transfected with either anti–miR-Con or anti–miR-301a, together with the indicated combinations of plasmid constructs. Twenty-four hours later, the cells were infected with JEV at an MOI of 5. At 24 h of infection, NO production in (Figure legend continues) 12 miR-301a REGULATES JEV-INDUCED MICROGLIAL ACTIVATION of miR-301a (miR-301a–VM) and an appropriate negative control in the brain play crucial roles in microglial inflammation. miR-155 (VM-NC) possessing 5-nt mutation in the seed sequence were is elevated in M1-polarized microglia and regulates their proin- used for further investigations. BALB/c mice were left uninfected flammatory responses (43). Recently, miR-9 was demonstrated to or were infected with JEV and treated with VM-NC or miR-301a– promote microglial activation by targeting monocyte chemotactic VM at 24 h postinfection (Fig. 9A). Mice brain samples were protein-induced protein-1 (44). However, altered abundance of collected at 3 and 7 d postinfection. Although JEV-infected mice cellular miRNAs in viral infection may reshape cellular gene administered with VM-NC exhibited increase in miR-301a abun- expression and that could be detrimental to the host. Several dance with respect to uninfected brain sample, treatment with inflammatory pathway–related genes including TNF-a–induced miR-301a–VM resulted in disruption of the miR-301a upregula- protein 3 (TNFAIP3) (19), SH-2 containing inositol 5ʹ poly- tion (Fig. 9B). The degree of body weight loss was significantly phosphatase 1 (SHIP1) (18), Ring Finger Protein 125 (RNF125) reduced in the mice treated with miR-301a–VM compared with (21), and Ring Finger Protein 11 (RNF11) (20) were reported to be those of mice treated with VM-NC (Supplemental Fig. 3A). targeted by different miRNAs, thus regulating neuroinflammatory Decreased NKRF protein and mRNA abundances in the VM- response during JEV infection. In this study, we observed sub- NC–treated, JEV-infected mice were significantly restored in the stantial enhancement of microglial miR-301a expression following JEV-infected mice treated with miR-301a–VM (Fig. 9C, 9D). JEV infection, which led us to investigate its modulatory action Additionally, miR-301a–VM-treated mice exhibited reduced ex- in JEV-induced inflammatory response. To date, no such reports pression of Iba1 and increased abundance of NeuN protein com- demonstrate the role of miR-301a in the context of any virus- pared with VM-NC–treated, JEV-infected mice (Fig. 9C). To mediated inflammatory response. Although miR-301a expression determine whether the rescue of NKRF imparts any effect upon has not been detected in a recent study involving the miRNA array Downloaded from concentration of proinflammatory cytokines, we evaluated the of JEV-infected human microglial cells (45), in the current study, expression of IL-6, TNF-a,IL-12,IFN-g, and CCL2 by CBA we found that miR-301a is upregulated in JEV-infected human and analysis. All of these cytokines were observed to be substantially mouse microglial cells, thus culminating into the production of decreased in the mice treated with miR-301a–VM when compared different proinflammatory mediators and cytokines. with VM-NC–treated one (Fig. 9E). Furthermore, neuronal apo- Because miR-301a is found to be overexpressed during JEV

ptosis was analyzed by TUNEL assay coupled with immuno- infection, and miR-301a acts as a positive regulator of the in- http://www.jimmunol.org/ fluorescence study of neuronal marker, NeuN. TUNEL assay is flammatory response, we hypothesized that miR-301a might be characterized by detection of DNA fragmentation by labeling the inhibiting important suppressors of inflammatory signaling. Con- 3ʹ hydroxyl termini in the dsDNA breaks generated during apo- sistent with a previous report (23), we found that miR-301a di- ptosis. Substantial numbers of neuronal cells were observed un- rectly targets NKRF, which is a negative regulator of NF-kB dergoing apoptosis in JEV infection, as reflected by increased activation. JEV-infected microglial cells and human brain exhibited number of NeuN- and TUNEL-positive cells in VM-NC–treated decline in expression of NKRF. Furthermore, overexpression of mice, whereas knockdown of miR-301a significantly reduced miR-301a into microglial cells resulted in decreased NKRF pro- neuronal death in JEV-infected mice (Fig. 9F). Although the tein and mRNA abundances, whereas knockdown of miR-301a in increased abundance of viral RNA and viral titer in JEV with JEV-infected microglial cells substantially rescued the NKRF by guest on September 25, 2021 VM-NC–treated mice brain was found to be reduced upon miR-301a expression, demonstrating the role of JEV-induced miR-301a in inhibition (Supplemental Fig. 3B, 3C), the miR-301a–VM treatment suppressing NKRF. had no effect on viral load in microglia (Fig. 9G). NKRF acts as transcriptional repressor that counteracts the basal activity of several NF-kB-driven inflammatory molecules. NKRF Discussion exerts its effect either by binding with negative regulatory ele- Microglia acts as a key player in initiating both innate and adaptive ments in the respective promoters (IL-8, IFN-b, and iNOS) immune responses of CNS upon pathogenic invasion (35). The (46, 47) or by direct interaction with NF-kB/p65 protein, which activation of microglia is considered to be the cardinal hallmark can bind with the promoter of some genes (matrix metalloproteinase of neuroinflammation, and is characterized by its morphological 2 [MMP-2] and COX-2) (23). Furthermore, NKRF inhibits NF-kB change to M1 phenotype, as well as secretion of a series of activation by a direct protein/protein interaction with NF-kBsub- proinflammatory mediators. M1 activation of microglia followed unit (31). Recently, a study demonstrates that suppression of NKRF by neuroinflammation is a common feature of Japanese enceph- is associated to systemic inflammation in patients suffering from alitis (36). Following JEV invasion, glial cells elicit immune re- chronic obstructive pulmonary disease (48). Knockdown of NKRF sponse against pathogens; however, viral replication within in JEV-infected microglia in our present study significantly en- microglia results in bystander neuronal death by secretion of in- hanced proinflammatory cytokine production. Furthermore, silenc- flammatory mediators (4). In addition to JEV, neurotropic viruses, ing of NKRF rescued the inhibitory effect of miR-301a inhibitor on such as dengue (37), Zika (38), Chandipura (8), influenza (39), HIV-1 the abundance of JEV-induced proinflammatory molecules. Con- (40), HSV (41), and vesicular stomatitis virus (42), have been reported versely, ectopic expression of NKRF in JEV-infected microglia to infect microglia, thus contributing to neuropathogenesis. was shown to suppress the expression of proinflammatory cyto- miRNAs have emerged as a key player of posttranscriptional kines along with further enhancement of the inhibitory effect gene regulation in virus-induced inflammation, thus shaping the of miR-301a inhibitor on the production of JEV-induced proin- host antiviral immune response. Several miRNAs that are enriched flammatory molecules. Together, these observations point toward

culture medium and protein expression of NKRF, iNOS, and COX2 in cells (lower panels) were evaluated by spectrophotometric and immunoblot analysis, respectively (D). b-Actin used as a loading control. All blots are representative of three independent experiments. Culture medium was also analyzed by CBA to determine the amount of secreted IL-1b, IL-12, TNF-a, IL-6, and IL-8 (E). qRT-PCR analysis was performed to measure the relative abundances of CCL2, CCL5, and IFN-g mRNAs (F). Data are means 6 SD of three independent experiments. *p , 0.05, **p , 0.01, ***p , 0.001, as calculated by one- way ANOVA followed by Bonferroni post hoc test. h.p.i., hours postinfection; ns, not significant. The Journal of Immunology 13 Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021

FIGURE 7. JEV-induced miR-301a activates NF-kB signaling via targeting NKRF. (A and B) Cells were left uninfected (MI) or were infected with JEV at an MOI of 5 for indicated times. Nuclear extracts were isolated to evaluate p65 protein expression in CHME3 (A) and BV2 (B) cells by Western blotting analysis. PCNA was used as loading control. The relative abundance of miR-301a in each set of cells was determined by qRT-PCR analysis and is shown below the blots. (C and D) Transfection of CHME3 cells was performed with Mimic–miR-301a, inhibitor, or their negative controls for 24 h, followed by JEV infection at 5 MOI for 24 h. Untransfected CHME3 cells were left uninfected as control studies. Nuclear and cytoplasmic (Figure legend continues) 14 miR-301a REGULATES JEV-INDUCED MICROGLIAL ACTIVATION Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021 FIGURE 8. Inhibition of miR-301a induces M1 to M2 polarization in JEV-infected microglia. (A and B) CHME3 (A) and BV2 (B) cells were left uninfected (MI) or infected for 24 h following 24 h of transfection with anti–miR-Con or anti–miR-301a, and the mRNA expression of M1 markers were determined by qRT-PCR analysis. (C and D) In the same treatment, the mRNA expression of M2 markers were analyzed by qRT-PCR study in CHME3 (C) and BV2 cells (D). All data are mean 6 SD of three experiments. *p , 0.05, **p , 0.01, ***p , 0.001, one-way ANOVA followed by Bonferroni post hoc test. (E–G) BALB/c mice were infected with JEV (3 3 105 PFU) and treated with either miR-301a–VM, which targets mature miR-301a (JEV with miR-301a–VM [JEV + miR-301a–VM]), or JEV with VM-NC (JEV + VM-NC). Brains were collected on day 7 to assess the expression of M1 marker CD68 (E) and CD86 (F) as well as M2 marker CD206 (G) by coimmunofluorescence study with microglial TMEM119 protein. Scale bar, 50 mm; original magnification 320. Data are representative of four mice per group. the role of miR-301a in contributing to the uncontrolled inflam- viral titer with either Mimic–miR-301a or inhibitor suggests the mation via its effects on NKRF. In our previous study (24), the view that miR-301a is responsible for enhanced microglial in- role of miR-301a to promote viral replication in neuron by tar- flammatory response in a virus replication-independent fashion. geting SOCS5 and IRF1 further prompted us to check whether the Conversely, the significant reduction in viral replication in miR- contribution of microglial miR-301a in regulating inflammatory 301a–VM-treated mice brain further prompted us to check the response is mediated via effect on viral replication. We measured viral load in mice brain microglia. Unaltered expression of viral virus titer in supernatant of microglial cells treated with Mimic– protein in microglia of miR-301a–VM-treated mice compared miR-301a or inhibitor, followed by JEV infection. No change in with VM-NC–treated mice puts forward the fact that the observed

fractions of the cells were then isolated and analyzed by Western blotting with Abs specific for the indicated proteins. In another set of cells with similar treatment, total cellular protein was isolated and checked the p65 protein expression by immunoblotting. In nuclear extracts PCNA served as loading control, whereas same was served by b-actin in cytoplasmic and total protein extracts. (E and F) Transfections of either NKRF esiRNA or NKRF plasmid construct with indicated combinations of miR-301a inhibitor were performed for 24 h before being infected with JEV at an MOI of 5 for 24 h. Nuclear and cy- toplasmic fractions of the cells were then isolated and analyzed by Western blotting with Abs specific for the indicated proteins. In another set of ex- periments with parallel transfection condition p65 expression in total cellular extracts was evaluated by immunoblotting. Whereas b-actin served as loading controls for cytoplasmic and total cellular extracts, PCNA used as internal control for nuclear extracts. All of the blots are a representative of three in- dependent experiments with similar results. (G) CHME3 cells were transfected with NF-kB luciferase reporter construct alone (MI, JEV) and together with indicated combinations of esiRNAs/anti–miR-301a or plasmids/anti–miR-301a. Twenty-four hours later, cells were left uninfected or were infected with JEV at an MOI of 5 for 24 h and luciferase activities were measured with a dual luciferase assay kit and normalized to that of Renilla luciferase. Data are means 6 SD of nine experiments from three independent transfections. *p , 0.05, **p , 0.01, by one-way ANOVA followed by Bonferroni post hoc test. h.p.i., hours postinfection. The Journal of Immunology 15 Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021

FIGURE 9. Inhibition of miR-301a in vivo attenuates microglial inflammation and inhibits neuronal death. (A) BALB/c mice were treated with PBS(MI)orwereinfectedwithJEV(33 105 PFU) and treated intracranially with either miR-301a–VM which targets mature miR-301a (JEV with miR-301a–VM [JEV + miR-301a–VM]) or JEV with VM-NC (JEV + VM-NC). Brain samples were collected on day 3 and 7 of JEV infection. (B) The abundance of miR-301a in brain samples was quantified by qRT-PCR analysis. Data are means 6 SD of four mice from each group. (C and D) Brain samples from the mice described in (A) were analyzed by Western blotting (C) with Ab specific for NKRF, NeuN, and Iba1. b-Actin served as loading control. Blots are representative of four mice from each group. The relative abundance of NKRF mRNA was also assessed by qRT-PCR analysis (D). (E) Brain samples were also subjected to CBA analysis to determine the protein abundance of IL-6, TNF-a,IL-12,IFN-g, and CCL2. Data are means 6 SD of four mice from each group. (F and G) BALB/c mice were treated as in (A), and brain samples were collected on day 7 for the evaluation of TUNEL expression by coimmunofluorescence study with neuronal NeuN protein. Scale bar, 50 mm; original magnification 320. (G) The coimmunofluorescence of JEV NS3 protein with microglial marker TMEM119 was also performed in collected brain samples. Scale bar, 50 mm; original magnification 320. Data are representative of four mice in each group. *p , 0.05, **p , 0.01, ***p , 0.001, as calculated by one-way ANOVA followed by Bonferroni multiple comparisons. d.p.i., days postinfection. reduction in viral load might be due to the decreased viral repli- strengthen the lack of relationship between microglial viral prop- cation in neuronal cells. No change in SOCS5 and IRF1 abun- agation and miR-301a–regulated inflammatory response. Probable dance in response to microglial mir-301a overexpression further reasons for the unaltered viral titer in response to changes in cytokine 16 miR-301a REGULATES JEV-INDUCED MICROGLIAL ACTIVATION production may be due to the fact that the expression level of that miR-301a–VM mediated impairment of JEV propagation in the cytokines and chemokines might not be sufficient enough to neurons might thus account for the reduction in viral burden. suppress JEV replication in microglia. In addition to that, JEV In summary, we have identified a microglia specific host/virus might be modulating the downstream signaling effectors of the interplay, demonstrating the role of miR-301a in promoting cytokines, resulting in dampening of anticipated immune response JEV-mediated neuroinflammation. Augmentation of miR-301a and perturbation of viral propagation. expression exerts its effect by suppressing NKRF expression, Because optimal NF-kB activity is considered to be indis- resulting in NF-kB activation–mediated increased production of pensable for peripheral immune cell survival, appropriate regu- proinflammatory cytokines. Inhibition of JEV-induced miR-301a lation of NF-kB signaling remains critical for management of a expression conversely impaired this molecular pathway, thereby normal immune process (49). Persistent activation of NF-kB reducing M1 polarization of microglia and subsequent inflam- signaling is known to promote inflammation in different cells matory response. Extensive gliosis is a hallmark of JEV infection, including microglia (50). Bystander killing of neuronal cells by which results in the abrupt production of inflammatory cytokines microglial inflammation is also mediated by NF-kB activa- and subsequently leads to neuronal cell damage (4). Therefore, tion (51). Additional evidences suggest the role of a number of suppression of an excessive inflammatory response can potentially miRNAs including miR-301a in regulation of NF-kB signaling terminate the progression of events leading to neuronal death and (23, 52). Therefore, it was of interest to evaluate the effect of miR- seems to be a promising remedy against JEV infection. In previ- 301a in regulating JEV-induced NF-kB activity in microglia. We ous study, we found that increased expression of miR-301a in observed that treatment of cells with Mimic–miR-301a enhances JEV-infected neuron repressed type I IFN by targeting IRF1 and

NF-kB activation, whereas inhibitor interferes with the nuclear SOCS5. Neutralization of JEV-induced miR-301a reinforced host Downloaded from accumulation of phosphorylated NF-kB in JEV infection. In ad- innate immunity by restoring IFN-b expression and restricted viral dition, silencing of NKRF disrupts the inhibitory effect of miR- propagation. miR-301a inhibition thus holds the potential to act as 301a inhibitor on nuclear accumulation of NF-kB in JEV-infected a double-edged sword by reinforcing type I IFN–mediated innate microglia. In contrast, the miR-301a inhibitor–mediated de- immunity as well as by preventing bystander damage of neurons cline in nuclear NF-kB translocation from cytoplasm is am- via reduction of microglial overactivation. Thus targeting miR-

plified by the ectopic expression of NKRF. Furthermore, the 301a could truly provide a new insight to develop an effective http://www.jimmunol.org/ effect of miR-301a inhibition on NF-kB activity in JEV- antiviral strategy in combating JEV infection. infected microglia was found to be substantially regulated by NKRF expression. Thus, these findings illustrate the role Acknowledgments of JEV-induced miR-301a in potentiating NF-kB signaling We are grateful to S. Levison (Rutgers University), G. R. Medigeshi (Trans- through NKRF suppression. lational Health Science and Technology Institute), E. Sen (NBRC), and Microglia polarization is sometimes categorized into classical D. Chattopadhyay (Amity University) for providing cell lines and plasmids. (M1) and alternative (M2) activation in response to various stimuli. We also acknowledge the help of Distributed Information Centre of NBRC The M1 phenotype is characterized by secretion of various for computer related technical and infrastructural support. We are thankful proinflammatory mediators and induces neuropathology, whereas to K. L. Kumawat for helping to perform all animal experiments. We also by guest on September 25, 2021 M2 microglia tends to reduce inflammation and that could have a thank M. Dogra for technical assistance. neuroprotective role (53). JEV infection results in microglial po- larization to M1 phenotype that secretes increased amount of Disclosures proinflammatory cytokines. Evidences demonstrate crucial roles The authors have no financial conflicts of interest. played by miRNAs in M1/M2 polarization of microglia. Whereas several promote M2 phenotype, some other miRNAs, including References miR-125b, miR-155, and miR-29b, target negative regulators’ 1. Cook, D. N., D. S. Pisetsky, and D. A. Schwartz. 2004. Toll-like receptors in the NF-kB activation and thereby promote M1 macrophage polari- pathogenesis of human disease. Nat. Immunol. 5: 975–979. zation (19, 43, 54). We found that knockdown of miR-301a in 2. Chen, C. J., S. L. Liao, M. D. Kuo, and Y. M. Wang. 2000. Astrocytic alteration JEV infection inhibited the expression of cell surface markers of induced by Japanese encephalitis virus infection. Neuroreport 11: 1933–1937. 3. Sochocka, M., B. S. Diniz, and J. Leszek. 2017. Inflammatory response in the M1 microglia (CD86 and CD68) as well as the production of CNS: friend or foe? Mol. Neurobiol. 54: 8071–8089. proinflammatory cytokines in vivo and in vitro. Furthermore, 4. Ghoshal, A., S. Das, S. Ghosh, M. K. Mishra, V. Sharma, P. Koli, E. Sen, and A. Basu. 2007. Proinflammatory mediators released by activated microglia in- the expression of M2 microglia surface marker (CD206) and duces neuronal death in Japanese encephalitis. Glia 55: 483–496. anti-inflammatory cytokine production increased in miR-301a 5. Solomon, T., N. M. Dung, R. Kneen, M. Gainsborough, D. W. Vaughn, and silencing, thus suggesting that JEV-induced miR-301a posi- V. T. Khanh. 2000. Japanese encephalitis. J. Neurol. Neurosurg. Psychiatry 68: 405–415. tively regulates M1 polarization of microglia. 6. Solomon, T. 2006. Control of Japanese encephalitis--within our grasp? N. Engl. We further investigated the in vivo effect of miR-301a in a J. Med. 355: 869–871. JEV-infected mouse model with miR-301a–VM. Previously, we 7. Chen, C.-J., J.-H. Chen, S.-Y. Chen, S.-L. Liao, and S.-L. Raung. 2004. Up- regulation of RANTES gene expression in neuroglia by Japanese encephalitis reported that miR-301a–VM offers a neuroprotective role and virus infection. J. Virol. 78: 12107–12119. blocks viral replication in mice brain by inducing antiviral IFN-b 8. Verma, A. K., S. Ghosh, S. Pradhan, and A. Basu. 2016. Microglial activation induces neuronal death in Chandipura virus infection. Sci. Rep. 6: 22544. response (24). In this study, we administered miR-301a–VM into 9. Nazmi, A., S. Mukherjee, K. Kundu, K. Dutta, A. Mahadevan, S. K. Shankar, mice to demonstrate its potential application against JEV-induced and A. Basu. 2014. TLR7 is a key regulator of innate immunity against Japanese inflammatory response. Inhibition of miR-301a restored the abun- encephalitis virus infection. Neurobiol. Dis. 69: 235–247. 10. Kaushik, D. K., R. Mukhopadhyay, K. L. Kumawat, M. Gupta, and A. Basu. dances of mRNA and protein of NKRF and effectively resulted in 2012. Therapeutic targeting of Kru¨ppel-like factor 4 abrogates microglial acti- substantial reduction in expression of proinflammatory cytokines. vation. J. Neuroinflammation 9: 57. Further, in vivo knockdown of miR-301a inhibited microglia ac- 11. Kaushik, D. K., M. Gupta, K. L. Kumawat, and A. Basu. 2012. NLRP3 inflammasome: key mediator of neuroinflammation in murine Japanese tivation and reduced neuronal death. Evaluation of viral RNA load encephalitis. PLoS One 7: e32270. revealed a significant reduction in miR-301a–VM-treated mice 12. Kaushik, D. K., M. Gupta, S. Das, and A. Basu. 2010. Kru¨ppel-like factor 4, a novel transcription factor regulates microglial activation and subsequent neuro- brain but unchanged expression of viral protein in brain microglia, inflammation. J. Neuroinflammation 7: 68. corroborating the outcome of our previous study (24) and suggesting 13. Ambros, V. 2004. The functions of animal microRNAs. Nature 431: 350–355. The Journal of Immunology 17

14. Ardekani, A. M., and M. M. Naeini. 2010. The role of microRNAs in human 35. Olson, J. K., and S. D. Miller. 2004. Microglia initiate central nervous system diseases. Avicenna J. Med. Biotechnol. 2: 161–179. innate and adaptive immune responses through multiple TLRs. J. Immunol. 173: 15. Ha, T.-Y. 2011. MicroRNAs in human diseases: from cancer to cardiovascular 3916–3924. disease. Immune Netw. 11: 135–154. 36. Bian, P., C. Ye, X. Zheng, J. Yang, W. Ye, Y. Wang, Y. Zhou, H. Ma, P. Han, 16. Cardoso, A. L., J. R. Guedes, and M. C. P. de Lima. 2016. Role of microRNAs in H. Zhang, et al. 2017. Mesenchymal stem cells alleviate Japanese encephalitis the regulation of innate immune cells under neuroinflammatory conditions. Curr. virus-induced neuroinflammation and mortality. Stem Cell Res. Ther. 8: 38. Opin. Pharmacol. 26: 1–9. 37. Jhan, M.-K., T.-T. Tsai, C.-L. Chen, C.-C. Tsai, Y.-L. Cheng, Y.-C. Lee, 17. Brites, D., and A. Fernandes. 2015. Neuroinflammation and depression: micro- C.-Y.Ko,Y.-S.Lin,C.-P.Chang,L.-T.Lin,andC.-F.Lin.2017.Dengue glia activation, extracellular microvesicles and microRNA dysregulation. Front. virus infection increases microglial cell migration. Sci. Rep. 7: 91. Cell. Neurosci. 9: 476. 38. Lum, F.-M., D. K. S. Low, Y. Fan, J. J. L. Tan, B. Lee, J. K. Y. Chan, L. Re´nia, 18. Thounaojam, M. C., K. Kundu, D. K. Kaushik, S. Swaroop, A. Mahadevan, F. Ginhoux, and L. F. P. Ng. 2017. Zika virus infects human fetal brain microglia S. K. Shankar, and A. Basu. 2014. MicroRNA 155 regulates Japanese en- and induces inflammation. Clin. Infect. Dis. 64: 914–920. cephalitis virus-induced inflammatory response by targeting Src homology 39. Sadasivan, S., M. Zanin, K. O’Brien, S. Schultz-Cherry, and R. J. Smeyne. 2015. 2-containing inositol phosphatase 1. J. Virol. 88: 4798–4810. Induction of microglia activation after infection with the non-neurotropic A/CA/ 19. Thounaojam, M. C., D. K. Kaushik, K. Kundu, and A. Basu. 2014. MicroRNA-29b 04/2009 H1N1 influenza virus. PLoS One 10: e0124047. modulates Japanese encephalitis virus-induced microglia activation by targeting 40. Garden, G. A. 2002. Microglia in human immunodeficiency virus-associated tumor necrosis factor alpha-induced protein 3. J. Neurochem. 129: 143–154. neurodegeneration. Glia 40: 240–251. 20. Ashraf, U., B. Zhu, J. Ye, S. Wan, Y. Nie, Z. Chen, M. Cui, C. Wang, X. Duan, 41. Schachtele, S. J., S. Hu, M. R. Little, and J. R. Lokensgard. 2010. Herpes H. Zhang, et al. 2016. MicroRNA-19b-3p modulates Japanese encephalitis virus- simplex virus induces neural oxidative damage via microglial cell toll-like re- mediated inflammation via targeting RNF11. J. Virol. 90: 4780–4795. ceptor-2. J. Neuroinflammation 7: 35. 21. Zhu, B., J. Ye, Y. Nie, U. Ashraf, A. Zohaib, X. Duan, Z. F. Fu, Y. Song, H. Chen, 42. Chauhan, V. S., S. R. Furr, D. G. Sterka, Jr., D. A. Nelson, M. Moerdyk- and S. Cao. 2015. MicroRNA-15b modulates Japanese encephalitis virus-mediated Schauwecker, I. Marriott, and V. Z. Grdzelishvili. 2010. Vesicular stomatitis inflammation via targeting RNF125. J. Immunol. 195: 2251–2262. virus infects resident cells of the central nervous system and induces replication- 22. Mycko, M. P., M. Cichalewska, A. Machlanska, H. Cwiklinska, M. Mariasiewicz, dependent inflammatory responses. Virology 400: 187–196. and K. W. Selmaj. 2012. MicroRNA-301a regulation of a T-helper 17 immune 43. Cardoso, A. L., J. R. Guedes, L. Pereira de Almeida, and M. C. Pedroso de Lima. response controls autoimmune demyelination. Proc. Natl. Acad. Sci. USA 109: 2012. miR-155 modulates microglia-mediated immune response by down-regulating Downloaded from E1248–E1257. SOCS-1 and promoting cytokine and nitric oxide production. Immunology 23. Lu, Z., Y. Li, A. Takwi, B. Li, J. Zhang, D. J. Conklin, K. H. Young, R. Martin, 135: 73–88. and Y. Li. 2011. miR-301a as an NF-kB activator in pancreatic cancer cells. 44. Yao, H., R. Ma, L. Yang, G. Hu, X. Chen, M. Duan, Y. Kook, F. Niu, K. Liao, EMBO J. 30: 57–67. M. Fu, et al. 2014. MiR-9 promotes microglial activation by targeting MCPIP1. 24. Hazra, B., K. L. Kumawat, and A. Basu. 2017. The host microRNA miR-301a Nat. Commun. 5: 4386. blocks the IRF1-mediated neuronal innate immune response to Japanese en- 45. Kumari, B., P. Jain, S. Das, S. Ghosal, B. Hazra, A. C. Trivedi, A. Basu, cephalitis virus infection. Sci. Signal. 10: eaaf5185. J. Chakrabarti, S. Vrati, and A. Banerjee. 2016. Dynamic changes in global

25. Bennett, M. L., F. C. Bennett, S. A. Liddelow, B. Ajami, J. L. Zamanian, microRNAome and transcriptome reveal complex miRNA-mRNA regulated host http://www.jimmunol.org/ N. B. Fernhoff, S. B. Mulinyawe, C. J. Bohlen, A. Adil, A. Tucker, et al. 2016. response to Japanese Encephalitis Virus in microglial cells. Sci. Rep. 6: 20263. New tools for studying microglia in the mouse and human CNS. Proc. Natl. 46. Feng, X., Z. Guo, M. Nourbakhsh, H. Hauser, R. Ganster, L. Shao, and Acad. Sci. USA 113: E1738–E1746. D. A. Geller. 2002. Identification of a negative response element in the human 26. Huang, L., Y. Liu, L. Wang, R. Chen, W. Ge, Z. Lin, Y. Zhang, S. Liu, Y. Shan, inducible nitric-oxide synthase (hiNOS) promoter: the role of NF-kappa Q. Lin, and M. Jiang. 2013. Down-regulation of miR-301a suppresses pro- B-repressing factor (NRF) in basal repression of the hiNOS gene. Proc. inflammatory cytokines in toll-like receptor-triggered macrophages. Immunology Natl. Acad. Sci. USA 99: 14212–14217. 140: 314–322. 47. Nourbakhsh, M., S. Kalble, A. Dorrie, H. Hauser, K. Resch, and M. Kracht. 27. Rehmsmeier, M., P. Steffen, M. Hochsmann, and R. Giegerich. 2004. Fast and 2001. The NF-kappa b repressing factor is involved in basal repression and in- effective prediction of microRNA/target duplexes. RNA 10: 1507–1517. terleukin (IL)-1-induced activation of IL-8 transcription by binding to a con- 28. John, B., A. J. Enright, A. Aravin, T. Tuschl, C. Sander, and D. S. Marks. 2004. served NF-kappa b-flanking sequence element. J. Biol. Chem. 276: 4501–4508. Human microRNA targets. [Published erratum appears in 2005 PLoS Biol. 3: 48. Lee, K.-Y., S.-C. Ho, Y.-F. Chan, C.-H. Wang, C.-D. Huang, W.-T. Liu,

e264.] PLoS Biol. 2: e363. S.-M. Lin, Y.-L. Lo, Y.-L. Chang, L.-W. Kuo, and H.-P. Kuo. 2012. Re- by guest on September 25, 2021 29. Lewis, B. P., C. B. Burge, and D. P. Bartel. 2005. Conserved seed pairing, often duced nuclear factor-kB repressing factor: a link toward systemic inflammation flanked by adenosines, indicates that thousands of human genes are microRNA in COPD. Eur. Respir. J. 40: 863–873. targets. Cell 120: 15–20. 49. Li, Q., and I. M. Verma. 2002. NF-kappaB regulation in the immune system. 30. Krek, A., D. Gru¨n, M. N. Poy, R. Wolf, L. Rosenberg, E. J. Epstein, [Published erratum appears in 2002 Nat. Rev. Immunol. 2: 975.] Nat. Rev. P. MacMenamin, I. da Piedade, K. C. Gunsalus, M. Stoffel, and N. Rajewsky. Immunol. 2: 725–734. 2005. Combinatorial microRNA target predictions. Nat. Genet. 37: 495–500. 50. Karin, M., and F. R. Greten. 2005. NF-kappaB: linking inflammation and im- 31. Reboll, M. R., A. T. Schweda, M. Bartels, R. Franke, R. Frank, and munity to cancer development and progression. Nat. Rev. Immunol. 5: 749–759. M. Nourbakhsh. 2011. Mapping of NRF binding motifs of NF-kappaB p65 51. Von Bernhardi, R., L. Eugenı´n-von Bernhardi, and J. Eugenı´n. 2015. Microglial subunit. J. Biochem. 150: 553–562. cell dysregulation in brain aging and neurodegeneration. Front. Aging Neurosci. 32. Nourbakhsh, M., and H. Hauser. 1999. Constitutive silencing of IFN-beta pro- 7: 124. moter is mediated by NRF (NF-kappaB-repressing factor), a nuclear inhibitor of 52. Ma, X., L. E. Becker Buscaglia, J. R. Barker, and Y. Li. 2011. MicroRNAs in NF-kappaB. EMBO J. 18: 6415–6425. NF-kappaB signaling. J. Mol. Cell Biol. 3: 159–166. 33. Orihuela, R., C. A. McPherson, and G. J. Harry. 2016. Microglial M1/M2 po- 53. Tang, Y., and W. Le. 2016. Differential roles of M1 and M2 microglia in neu- larization and metabolic states. Br. J. Pharmacol. 173: 649–665. rodegenerative diseases. Mol. Neurobiol. 53: 1181–1194. 34. Morcos, P. A., Y. Li, and S. Jiang. 2008. Vivo-Morpholinos: a non-peptide trans- 54. Parisi, C., G. Napoli, S. Amadio, A. Spalloni, S. Apolloni, P. Longone, and porter delivers Morpholinos into a wide array of mouse tissues. Biotechniques 45: C. Volonte´. 2016. MicroRNA-125b regulates microglia activation and motor 613–623. neuron death in ALS. Cell Death Differ. 23: 531–541.