DEAMPLIFICATION OF SUPERNUMERARY

CENTROSOMES BY CENTROSOMAL CLUSTERING

By

Ezekiel Thomas

A Thesis Submitted to the Faculty of The Wilkes Honors College In Partial Fulfillment of the Requirements for the Degree of Bachelor of Arts in Liberal Arts and Sciences With a Concentration in Biology

Wilkes Honors College of Florida Atlantic University Jupiter, Florida

May 2012 Deamplification of Supernumerary Centrosomes by Centrosomal Clustering

By Ezekiel Thomas

This thesis was prepared under the direction of the candidate’s thesis advisor, Dr. Nicholas Quintyne, and has been approved by the members of the supervisory committee. It was submitted to the faculty of The Honors College and was accepted in partial fulfillment of the requirements for the Degree of Bachelor of Arts in Liberal Arts and Sciences.

SUPERVISORY COMMITTEE:

______

Dr. Nicholas Quintyne Date

______

Dr. Michelle Ivey Date

______

Dr. Jeffrey Buller Date Dean, Wilkes Honors College

ii

Acknowledgements

I would like to thank Dr. Quintyne for his mentoring, guidance, and patience;

April Schimmel for maintaining the lab and purchasing numerous antibodies; and Dr.

Ivey for her assistance as my second reader. I would also like to thank my family and friends for their support.

iii

Abstract

Author: Ezekiel Thomas

Title: Deamplification of Supernumerary Centrosomes by Centrosomal Clustering

Institution: Wilkes Honors College of Florida Atlantic University

Thesis Advisor: Dr. Nicholas Quintyne

Degree: Bachelor of Arts in Liberal Arts and Sciences

Concentration: Biology

Year: 2012

Supernumerary centrosomes can arise in a cell through a variety of methods. The presence of supernumerary centrosomes has been observed in nearly all types of cancer and promotes chromosomal instability, with rates of incident increasing as the cancer progresses. An oral squamous cell carcinoma line was treated with hydroxyurea to induce supernumerary centrosomes in the cells. NuMA was then knocked down using shRNA to promote centrosomal clustering and bipolar mitotic division in cells with supernumerary centrosomes. Immunofluorescence with an antibody against SAS 6 accurately stained the centrioles for observation. The cells exhibiting supernumerary centrosomes undergoing bipolar mitotic division were studied to look for a possible pattern in centrosomal clustering where the majority of centrosomes are at one pole with a single centrosome at the other pole. Initial results suggest the presence of such a mechanism, which would describe a previously unknown mechanism for cells to deamplify supernumerary centrosomes by centrosomal clustering. iv

Table of Contents List of Tables ...... vi List of Figures ...... vii Introduction ...... 1 The Centrosome: Function, Structure, and Lifecycle ...... 1 Development of Supernumerary Centrosomes ...... 2 Supernumerary Centrosomes and Multipolarity ...... 3 Centrosomal Deamplification ...... 4 Mechanisms for Centrosomal Clustering ...... 6 Materials and Methods ...... 8 Cell Culture ...... 8 Immunofluorescence ...... 8 Antibodies ...... 9 Transfection ...... 10 Drug Treatments ...... 11 Microscopy ...... 11 Results ...... 12 Induction of Supernumerary Centrosomes ...... 12 Immunofluorescent Methods for Centriole Observation ...... 14 Induction of Centrosomal Clustering ...... 17 Discussion ...... 18 Colcemid and Hydroxyurea Treatments ...... 19 Immunofluorescent Staining of Centrioles During Mitosis ...... 20 A Mechanism Promoting Preferential Clustering ...... 21 Continuing Research ...... 22 Conclusion ...... 22 References ...... 24

v

List of Tables

Table 1. Summary of 1° antibodies and successful methods for staining centrioles ...... 14

vi

List of Figures

Figure 1. Methods of dealing with supernumerary centrosomes ...... 6

Figure 2. Treatment to induce supernumerary centrosomes ...... 13

Figure 3. Microtubule differences in hydroxyurea and colcemid treated cells ...... 14

Figure 4. Staining of cells using SAS 6 antibody ...... 16

Figure 5. Staining of cells using CEP 250 antibody ...... 17

Figure 6. Preferential centrosomal clustering ...... 18

vii

I. Introduction

The Centrosome: Function, Structure, and Lifecycle

The centrosome is the cellular organelle that acts as the microtubule organizing center (MTOC) in most types of cells (Doxsey, 2001). Through the regulation of microtubules (MTs), the centrosome controls cell shape, cell motility, intracellular transport, and the positioning of organelles. The centrosome also plays a key role during division and is responsible for the formation of the spindle poles, which are vital to proper chromosomal segregation and cleavage plane localization (Nigg, 2002). The structure of the centrosome is divided into two main components, the centrioles and the pericentriolar material (PCM). The centrioles are two barrel-shaped objects aligned at right angles to each other and function to anchor the MTs and recruit the PCM. There is an older centriole having more associated proteins (the "mother centriole") and a newer centriole that doesn't have as many associated proteins (the "daughter centriole"). The

PCM contains a variety of proteins, most notably the γ-tubulin ring complex, which acts as a template for new MTs and serves as a site of MT nucleation (Doxsey, 2001).

The centrosome cycle is closely related to the chromosomal duplication cycle, and can be divided into five main steps: centriole disorientation, centriole duplication, centriole elongation, centrosome maturation, and centrosome separation (Nigg, 2002).

The process begins in late G1 of the cell cycle once the cell has committed to division, and starts with the loss of orientation between the two centrioles. As the cell progresses into S phase where DNA synthesis occurs, the centrioles undergo duplication as well in a semi-conservative fashion from the perspective of the centrosome, while additional

1 pericentriolar material is also recruited (Balczon et al., 1999). This process continues into

G2 with centriole elongation. In G2, as elongation continues, centrosome maturation begins to occur with the new daughter centrosome recruiting associated proteins. This process does not fully complete until the following cell cycle, resulting in a mother centrosome that contains the mother centriole, and a daughter centrosome that contains the previously daughter centriole (Nigg and Stearns, 2011). Up through G2 in the cell cycle both pairs of centrioles continue to act as one centrosome to allow for proper MT organization. Once the cell enters mitosis, centrosome separation occurs to allow for the formation of separate spindle poles. Each daughter cell then inherits one functional centrosome.

Development of Supernumerary Centrosomes

When errors occur in the centrosome cycle, supernumerary centrosomes can develop in cells. There are four accepted models for the origin of supernumerary centrosomes (Nigg, 2002): 1) Overduplication of centrosomes can occur if there is a disconnect between centrosome duplication and chromosomal duplication during S phase of the cell cycle. Chromosomal damage can result in a halt of progression through S phase until the DNA damage is repaired, but meanwhile centrosomal duplication will occur again and again (Balczon et al., 1995). 2) If there is a failure during cellular division, such as an aberrant mitotic exit or incomplete cytokinesis, a cell could return to the cell cycle with twice the number of centrosomes it previously possessed (Millband et al., 2002). 3) Cellular fusion could occur between two normal cells, and oncoviruses with fusogenic properties have been shown to play a role in this occurrence (Shekhar et al.,

2

2002). 4) While previously only thought to occur in select cells, de novo formation of centrosomes has been shown to occur in many vertebrate somatic cells after centrosomal ablation with laser microsurgery (Khodjakov et al., 2002). The activation of this pathway could contribute to the development of supernumerary centrosomes.

These models do not have to be mutually exclusive, and currently no research exists that shows a preference for a particular model. One or more methods could occur simultaneously to play a role in the production of supernumerary centrosomes (Nigg,

2002). Two methods that have been shown to induce supernumerary centrosomes in cells are treatment with hydroxyurea or treatment with colcemid. Hydroxyurea follows the first model for overduplication for centrosomes by causing a separation between centrosome duplication and DNA synthesis in S phase (Balczon et al., 1995). Hydroxyurea acts as an inhibitor for ribonucleotide reductase, which prevents the synthesis of deoxyribonucleotide triphosphates at the replication forks for DNA synthesis, thus halting DNA replication (Koç et al., 2004). While DNA synthesis is stopped, centrosome duplication continues to occur. Colcemid follows the second model, resulting in an aborted mitosis. Colcemid is a MT toxin that depolymerizes MTs and prevents the cell from continuing through mitosis (Kleinfeld and Sisken, 1966). Eventually, the cell exits mitosis with twice the number of centrosomes and re-enters the cell cycle.

Supernumerary Centrosomes and Multipolarity

When cellular division progresses correctly, the two centrosomes present form two spindles and the chromosomes are correctly segregated to the two daughter cells.

However, each of the centrosomes present in the cell has the capability to act as a spindle

3 pole during division, so the presence of extra centrosomes can result in the formation of extra spindle poles and multipolar divisions (Pihan and Doxsey, 1999; Saunders et al.,

1999). During multipolar divisions, the chromosomes attempt to align themselves between the multiple poles, resulting in incorrect chromosomal segregation. Occurrences of extra centrosomes have been observed in nearly all studied cancers, including brain, breast, bile duct, colon, head and neck, lung, pancreas, and prostate cancers (Weber et al.,

1998; Lingle and Salisbury, 1999; Kuo et al., 2000; Gustafson et al., 2000; Pihan et al.,

1998; Sato et al., 2001; Pihan et al., 2001). The incorrect chromosomal segregation causes increase genomic instability, and both genomic instability and centrosome abnormalities have been shown to correlate with tumor progression (Pihan et al., 1998).

When taking into account multipolarity in cancer cells, out of the four models for the origin of supernumerary centrosomes aborted mitosis should be the preferred method owing to the increase in plodiy, which is the number of sets of chromosomes present in a cell. When undergoing multipolar divisions, polyploidy increases the chances that resulting daughter cells will contain a functional set of chromosomes. Furthermore, it has been observed that tetraploidy frequently occurs before aneuploidy, which agrees with aborted division simultaneously giving rise to supernumerary centrosomes and tetraploidy (Galipeau et al., 1996; Southern et al., 1997).

Centrosomal Deamplification

The presence of supernumerary centrosomes does not necessitate the occurrence of a multipolar division (Ring et al., 1982; Brinkley, 2001). Despite the potential benefits for cancerous cells to pick up an advantageous mutation during incorrect chromosomal

4 segregation, the much more frequent occurrence is the death of the daughter cells. To allow for the continued growth and proliferation of the cell line, there are three primary strategies to deal with supernumerary centrosomes: the discarding of excess centrosomes

(Figure 1B), the inactivation of excess centrosomes (Figure 1C), or the coalescence of centrosomes to form a functionally single centrosome (Figure 1D; Brinkley, 2001).

Illustrating the existence of a pathway to discard centrosomes, centrioles disappear during the development of mouse oocytes and are not detected again until late preimplantation.

The remaining MTOC contains some similarities to centrosomes, such as centrosomal antigens pericentrin and γ-tubulin, but lacks the normal centrosomal structure (Calarco,

2000). In Spisula solidissima, a type of clam, the fertilized oocyte results in a cell with three active centrosomes, two maternal centrosomes and one paternal centrosome.

Through differential regulation of the maternal and paternal centrosomes, the paternal centrosome's ability to nucleate MTs during meiosis I is selectively inhibited to allow for bipolar division to occur (Wu and Palazzo, 1998). While these two strategies are possible, there has been no evidence for their utilization in tumor cells with supernumerary centrosomes (Brinkley, 2001). Instead, experimental and observational data favor the method of centrosomal clustering (Ring et al., 1982; Lingle and Salisbury, 1999;

Quintyne et al., 2005).

5

Figure 1: Methods of dealing with supernumerary centrosomes. (A) A tripolar mitotic cell that is not experiencing any centrosomal deamplification. (B) A cell that is undergoing a bipolar division because it discarded the extra centrosome. (C) A cell that is undergoing a bipolar division because it silenced the extra centrosome. The centrosome is present, but has lost its ability to nucleate MTs. (D) A cell displaying centrosomal clustering to allow for a bipolar division.

Mechanisms for Centrosomal Clustering

Cancer cells deal with supernumerary centrosome by centrosomal clustering that allows for the creation of two functional spindle poles, which can consist of multiple individual centrosomes. This occurs through the functions of MT associated proteins and

MT motors that help organize the spindle poles. For example, dynein and HSET, MT motors, nuclear mitotic apparatus protein (NuMA), and actin organization have been 6 shown to play an important role in centrosomal clustering (Quintyne et al., 2005; Kwon et al., 2008). Also, the presence of spindle assembly checkpoint associated proteins are required, possibly signaled by an abnormal kinetochore attachment, allowing the time for clustering mechanisms to form two functional poles (Kwon et al., 2008).

Previous research shows that NuMA specifically is critical for spindle formation, and its gene maps to one of the most frequently amplified chromosome segments in cancerous cells (Gaglio et al., 1995; Huang et al., 2002) . NuMA is responsible for providing the cohesive force to maintain spindle MTs around a single centrosome, with overexpression of NuMA inhibiting centrosomal clustering (Gaglio et al., 1996; Quintyne et al., 2005). Oral squamous cell carcinoma cell line 103 (UPCI:SCC103) has been shown to express high levels of NuMA as well as a high rate of multipolarity. Through knockdown of NuMA by transfection with siRNA, centrosomal clustering can be reestablished in UPCI:SCC103, and the rate of multipolarity is reduced significantly

(Quintyne et al., 2005). An analysis of the resulting transfected cells can reveal whether or not there is a pattern in centrosomal clustering resulting in a pair of centrioles placed at one pole and the remaining centrioles placed at the opposite pole to form two separate functional centrosomes. The presence of such a mechanism would allow for one daughter cell to return to a normal centrosome cycle.

7

II. Materials and Methods

Cell Culture

Oral squamous cell carcinoma, UPCI:SCC103 (gift of S. Gollin, University of

Pittsburgh, Pittsburgh, PA), was grown in MEM (Sigma, St. Louis, MO), supplemented with 10% FBS (Sigma), L-glutamine, non-essential amino acids (Sigma), and gentamicin sulfate (MP Biomedicals, Solon, OH). They were incubated at 37°C in an environment with 5% CO2 and atmospheric O2 conditions.

Immunofluorescence

To seed cover slips, the cells were washed with Phosphate Buffered Saline (PBS) and then treated with 3 mL of 0.05% of Trypsin-EDTA (MP Biomedicals) and allowed to incubate for 5 minutes at 37°C. The total volume was then brought to 10mL with media and pipetted up and down several times to break clumps. Cells were then placed on cover slips at a 2.0 x 105 cells per mL density and incubated overnight to allow them to adhere.

To fix the cells, the media was aspirated and the cells were washed with PBS. For methanol fixation, cells were treated with -20°C methanol for 5 minutes at -20°C and then the methanol was aspirated. If cells were undergoing extraction with detergent, they were treated with a 0.05% dilution of Triton X-100 solution in PBS before methanol fixation for pre-extraction and after methanol fixation for post-extraction. For paraformaldehyde fixation, the cells were treated with 4% paraformaldehyde diluted in

PBS for 30 minutes at room temperature. Then the cells were washed three times with

PBS for 5 minutes each wash, treated with a 0.2% dilution of Triton X-100 solution in

8

PBS for 30 minutes at room temperature, and again washed three times with PBS for 5 minutes each wash.

After fixation, the cover slips were treated with Phosphate Buffer Saline Tween-

20/Bovine Serum Albumin (PBST/BSA) for 15 minutes. 150 µL of 1° antibody was given to each cover slip, and the cover slips were incubated at room temperature for 30 minutes, overnight at 4°C, or for 2 hours at 37°C. The 1° antibody was then aspirated, and each cover slip was washed with PBS three times for 3 minutes each wash. 150 µL of

2° antibody was added to each cover slip and left to incubate for 15 minutes at room temperature or 2 hours at 37°C. The 2° antibody was then aspirated, and each cover slip was again washed three times with PBS for 3 minutes each wash. 100 µL of 4’,6- diamidino-2-phenylindole, dihydrochloride (DAPI, Roche, Nutley, NJ) was then added for 30 seconds and aspirated, followed by three washes of H2O for 30 seconds each wash with the final wash left on the cover slips. Each cover slip was then mounted on to a slide with one drop of 1 g/L p-Phenylene diamine in 90% glycerol (mounting media), dried, and sealed with nail polish. Slides were stored at -20°C.

Antibodies

Primary antibodies were diluted in PBST/BSA and prepared as follows: rabbit γ- tubulin (Sigma) in a 1:500 dilution (30 min at room temperature), mouse α-tubulin

(Sigma) in a 1:250 dilution (30 min at room temperature), rabbit Centrin (Sigma) in a dilution range of 1:50 – 1:1000 (various fixations and incubations), goat Centrin 2 (Santa

Cruz Biotechnology, Santa Cruz, CA) in a dilution range of 1:50 – 1:1000 (various fixations and incubations), mouse Centrin 3 (Abnova, Taipei, Taiwan) in a 1:250 dilution

9

(2h at 37°C and 2° antibody for 1h at 37°C), rabbit Ninein (Abcam, Cambridge, MA) in a

1:250 dilution (overnight at 4°C), mouse Protein 4.1 (Abnova) in a dilution range of 1:50

– 1:1000 (various fixations and incubations), mouse ε-tubulin (Sigma) in a dilution range of 1:50 – 1:1000 (various fixations and incubations), rabbit EB-1 (Sigma) in a dilution range of 1:50 – 1:1000 (various fixations and incubations), rabbit NINL (Sigma) in a dilution range of 1:50 – 1:1000 (various fixations and incubations), mouse MPM2

(Millipore, Temecula, CA) in a dilution range of 1:50 – 1:1000 (various fixations and incubations), rabbit Cyclin E (US Biological, Swampscott, MA) in a dilution range of

1:50 – 1:1000 (various fixations and incubations), rabbit CEP 170 (Invitrogen, Camarillo,

CA) in a dilution range of 1:50 – 1:1000 (various fixations and incubations), mouse CEP

250 (Sigma) in a 1:250 dilution (overnight at 4°C), and rabbit SAS 6 (Santa Cruz) in a

1:250 dilution (overnight at 4°C). Secondary antibodies were prepared by diluting Texas

Red anti-rabbit (Invitrogen) and Alexa 488 anti-mouse (Invitrogen) in PBST/BSA in a

1:250 dilution.

Transfection

Cells were seeded and allowed to incubate overnight until approximate 70% confluency, the amount of an area that is covered with cells, was obtained. In a 1.5 mL conical tube, 3 µL of FuGene6 (Roche Diagnostics, Indianapolis, IN) was added directly into 100 µL of OPTIMEM (Sigma) and tapped to mix. After 5 minutes at room temperature, NuMA shRNA (Sigma) was added directly to the solution and tapped to mix.

Four different NuMA shRNA variations were used: A2 (sequence CCGGGCCTTGAAG

AGAAGAACGAAACTCGAGTTTCGTTCTTCTCTTCAAGGCTTTTTG) at 0.6 µL,

10

1.2 µL, or 2.4 µL; F1 (sequence CCGGCTTCTCCATCACAACCAGATTCTCGAGAA

TCTGGTTGTGATGGAGAAGTTTTTG) at 0.5 µL, 1.0 µL, or 2.0 µ L ; G1 (sequence

CCGGCCACATCTGAAGACCTGCTATCTCGAGATAGCAGGTCTTCAGATGTGG

TTTTTG) at 0.5 µL, 1.0 µL, or 2.0 µL; and H1 (sequence CCGGCCTTGAAGAGAAGA

ACGAAATCTCGAGATTTCGTTCTTCCTCTTCAAGGTTTTTG) at 0.75 µL, 1.5 µL, or 3 µL. After 15 minutes at room temperature, approximately 100 µL was added to each cover slip.

Drug Treatments

Colcemid Treatment: To induce extra centrosomes with colcemid, cells were first seeded and allowed to incubate overnight. When confluency reached approximately 80% the cells were treated with 27 nM colcemid (Irvine Scientific, Santa Ana, CA) diluted in media. Colcemid-containing media was replaced after 24 hours. After 24 or 48 hours, the cells were prepared according to the immunofluorescence procedure.

Hydroxyurea Treatment: To induce extra centrosomes with hydroxyurea, cells were first seeded and allowed to incubate overnight. When confluency reached approximately 70% the cells were treated with 20 mM hydroxyurea (MP Biomedicals) diluted in media. After 24 or 48 hours, the cells were prepared according to the immunofluorescence procedure.

NuMA Knockdown: After treatment with hydroxyurea for 48 hours, each cover slip was transfected as described above and given 3 mL of fresh media. Cells were then prepared at 24, 36, 48, or 52 hours according to the immunofluorescence procedure.

11

Microscopy

Slides were viewed on an Olympus IX81 Inverted Fluorescence Microscope

(Olympus America Inc., Center Valley, PA) with DAPI, FITC, and TRITC filters. The microscope has a 100X objective and a numerical aperture of 1.65. Images were captured using a Hamamatsu C4742-95 CCD camera (Hamamatsu Corporation, Bridgewater, NJ) and recorded using Slidebook version 5.0 (Intelligent Imaging Innocation Inc., Denver,

CO).

III. Results

The cell line UPCI:SCC103 was chosen because it has been shown to have high levels of NuMA, which promotes high rates of multipolarity (Quintyne et al., 2005).

UPCI:SCC103 had an observed mitotic index of 5 ± 0.5% and rate of multipolarity of

11 ± 4%. Mitotic index is calculated by counting the number of cells undergoing mitosis out of the total number of cells, and rate of multipolarity is calculated by counting the number of mitotic cells with more than two poles out of the total number of mitotic cells.

The rate of multipolarity was lower than previously found, but is still relatively high compared to normal cell lines (Quintyne et al., 2005). Because of the high rate of multipolarity, UPCI:SCC103 is a viable candidate to induce supernumerary centrosomes, promote centrosomal clustering through NuMA knockdown, and observe for any patterns in centrosomal clustering.

Induction of Supernumerary Centrosomes

To induce supernumerary centrosomes, cells were treated with two different drugs, colcemid and hydroxyurea, that induce supernumerary centrosomes through different

12 methods. In the first method, cells were exposed to 20 mM hydroxyurea for 24 or 48 hours. Treatments of both 24 and 48 hours showed a significant increase of supernumerary centrosomes from the control, with an increase also seen from 24 hours to

48 hours (Figure 2). For the second method, cells were exposed to 27 nM colcemid for 24 or 48 hours. Results obtained were similar to treatment with hydroxyurea, again showing a significant increase from the control, and again 48 hours showing a greater increase

(Figure 2).

Figure 2: Treatment to induce supernumerary centrosomes. Both hydroxyurea and colcemid treatments show a significant increase in the number of excess centrosomes, with a greater increase at 48 hours than at 24 hours. Error bars indicate standard deviation.

Comparing hydroxyurea and colcemid treatment, both have the ability to induce supernumerary centrosomes at 24 and 48 hours. Hydroxyurea produced a slightly higher rate of extra centrosomes in both cases, but neither is significant. The primary difference between the two was the effect on MTs, with colcemid interfering with MT formation while hydroxyurea left the MTs intact (Figure 3). 13

Figure 3: Microtubule differences in hydroxyurea and colcemid treated cells. MT/α- tubulin (green), Centrosomes/γ-tubulin (red), DNA (blue). (A) Treatment with hydroxyurea leaves MT intact. Arrows denote several centrosomes. (B) Treatment with colcemid disrupts MT nucleation. Bar = 10 µm.

Immunofluorescent Methods for Centriole Observation

Several variations to the indirect immunofluorescent procedure were used for a number of different antibodies (Ab) against proteins associated with the centrosome in attempt to accurately stain the centrioles (Table 1).

Table 1: Summary of 1° antibodies and successful methods for staining centrioles. Proper staining of centrioles was not obtained for many antibodies, which instead stained the whole centrosome or lacked a specific localization. SAS 6 provided the only adequate centriole staining.

1° Ab Characteristics of Protein Success Conditions Centrin No success Centrin 2 No success Family of calcium-binding Intermittently stains phosphoproteins found in the centrioles when 1°Ab Centrin 3 centriole and PCM1 incubated for 2h at 37°C and 2°Ab incubated for 1h at 37°C 14

Poorly stains centrioles Centrosome associated protein Ninein when incubated overnight at involved in centrosome maturation2 4°C Structural protein associated with Protein 4.1 No success centriole and PCM3 Involved in centriole duplication, ε-tubulin associated with distal ends of the No success centrioles4 Involved in centrosome EB-1 maturation, localized at distal cap of No success mother centriole5 Ninein-like protein involved in NINL No success centrosome maturation6 Mitotic protein that localizes at MPM2 the centrosome and assists in No success nucleation ability of centrosomes7 Cell cycle protein that localizes at Cyclin E No success the centrosome8 Centrosome associated protein, CEP 170 preferentially marking mature No success centrioles9 Clearly stains mother Centrosome associated protein centriole but dissociates from CEP 250 preferentially marking mature centriole during mitosis. centrioles10 Incubated overnight at 4°C Clearly stains centrioles Required for proper daughter SAS 6 when incubated overnight at centriole formation11 4°C

1Baron et al., 1992; 2Bouckson-Castaing et al., 1996; 3Krauss et al., 1997; 4Chang et al., 2003; 5Louie et al., 2004; 6Wang and Zhan, 2007; 7Vandre et al., 2000; 8Matsumoto and Maller, 2004; 9Guarguaglini et al., 2005; 10Mack et al., 1998; 11Leidel et al., 2005

15

Out of all the attempted antibodies, overnight incubation with the antibody against

SAS 6 at 4°C produced the only usable staining to properly observe centrioles (Figure 4).

Staining achieved by antibodies against Centrin 3 and Ninein produced results, but the inconsistency of the staining was not overcome through variations in the procedure. The antibody against CEP 250 produced clear stains, but the protein became dissociated with the centrioles during mitosis (Figure 5).

Figure 4: Staining of cells using SAS 6 antibody. Centrioles/SAS 6 (green), DNA (blue). (A) Quadpolar mitotic cell with two centrioles at each pole. Magnification of all zoom boxes is 3x. (B) Bipolar mitotic cell with two centrioles at each pole. Magnification of both zoom boxes is 2x. Bar = 10 µm.

16

Figure 5: Staining of cells using CEP 250 antibody. Centrioles/CEP250 (green), Centrosomes/ γ-tubulin (red), DNA (blue). Lower right image is merging of all three layers. (A) The centrioles can be clearly seen during interphase. Magnification of zoom box is 4x. (B) CEP 250 dissociates during mitosis, and the centrioles can no longer be observed. Bar = 10 µm.

Induction of Centrosomal Clustering

To induce centrosomal clustering, hydroxyurea treated cells were transfected with shRNA to knockdown NuMA (Quintyne et al., 2005). Four different shRNA sequences were used at varying concentrations, and the cells were allowed to recover for 24 to 60 hours. Lower recovery times prevented the cells from recovering enough NuMA to undergo mitosis, but cells died off after transfection preventing an adequate recovery time. To help reduce the recovery time required, smaller amounts of shRNA were used for the transfection. The reduced amount of shRNA also resulted in a reduced transfection efficiency, so not as many cells exhibited centrosomal clustering.

NuMA F1 shRNA resulted in the least amount of cell death, and out of a variety of attempted combinations only five cells were identified that exhibited centrosomal

17 clustering. All five of these cells displayed preferential centrosomal clustering where one pole's centrosome contained only two centrioles and the other pole contained the remaining centrioles (Figure 6).

Figure 6: Preferential centrosomal clustering. Centrioles (green), DNA (blue). Both zoom boxes are 3x magnification. The pole on the top left contains multiple centrioles while the pole on the bottom right only has two centrioles. The bottom right centrioles are located on top of each other making it difficult to see in a flat 2D image, but result in a brighter foci in the flattened image. Bar = 10 µm.

IV. Discussion

Supernumerary centrosomes can arise in cells through overduplication during S- phase, aborted mitosis, cellular fusion, or de novo formation, none of which are mutually exclusive (Nigg, 2002). Each centrosome possess the ability to create a mitotic spindle during mitosis, so cells with supernumerary centrosomes can undergo multipolar divisions, increasing chromosomal instability (Saunders et al., 1999; Pihan et al., 1998).

However, because multipolar divisions most frequently result in cell death, cells primarily exhibit centrosomal clustering to form two functional poles to allow bipolar 18 division (Ring et al., 1982; Lingle and Salisbury, 1999; Quintyne et al., 2005). If a mechanism existed that preferentially clustered the majority of centrosomes at one pole with a single centrosome at the other, one of the daughter cells could return to a normal centrosomal cycle. In this fashion, deamplification of excess centrosomes could be accomplished through centrosomal clustering.

Colcemid and Hydroxyurea Treatments

Cells normally have one or two centrosomes, depending on what stage of the cell cycle they are in, so cells were considered to have supernumerary centrosomes when they possessed more than two centrosomes. Both hydroxyurea and colcemid were successful in the production of supernumerary centrosomes, showing a significant increase compared to the control. Looking at the differences between treatment times, there was an increase in supernumerary cells from 24 hours to 48 hours as expected due to the increased exposure time. After 48 hours, both hydroxyurea and colcemid displayed similar efficiency at producing supernumerary centrosomes. The percent of cells with supernumerary centrosomes increased from 6.0 ± 1.4% to 41 ± 4% for hydroxyurea treated cells and to 38 ± 4% for colcemid treated cells.

While ability to produce supernumerary centrosomes is similar, a noticeable difference between the two treatments was the confluency of the cells after treatment.

While the number of cells that were present did not significantly drop during treatment with hydroxyurea, treatment with colcemid resulted in cell death that increased with exposure time. This difference results from the different mechanisms by which the supernumerary centrosomes are produced. Hydroxyurea induces extra centrosomes by

19 interfering with DNA synthesis, decoupling DNA synthesis from centrosome synthesis allowing centrosome duplication to occur over and over again (Balczon et al., 1995).

Colcemid on the other hand is a MT depolymerizing drug that results in failed mitosis and the production of extra centrosomes (Kleinfeld and Sisken, 1966). While hydroxyurea only causes a delay in S phase, colcemid disrupts MTs which interferes with vital cellular functions, such as intracellular transport. Because both produced similar results but hydroxyurea did not cause cell death, hydroxyurea was used for the remainder of the experiment.

Immunofluorescent Staining of Centrioles During Mitosis

A common and easy way to stain the centrosomes is through the use of antibodies to γ-tubulin, which is a vital component of the PCM (Doxsey, 2001). During centrosomal clustering however, tagging the PCM does not always correctly reflect the number of centrosomes that are present. Instead, the individual centrioles must be observed to accurately tell the number of centrosomes present at each pole. Observation of the centriole is more difficult than observation of the centrosome because of the small size of the centriole as well as the level of specificity required to distinguish it from the PCM.

Because of this, a large number of antibodies had to be tested before an antibody and method was found that sufficiently stained the centrioles.

While many of these antibodies are adequate for other scientific procedures such as Western Blots, they produce poor stains during immunofluorescence and stain the whole centrosome instead of specifically the centrioles. Centrin 3 and Ninein were able to stain the centrioles specifically, but both were unreliable and varied in staining quality

20 from cell to cell. CEP 250 produced very clear stains during interphase, but this clarity was lost during mitosis as a result of CEP 250 dissociating from the centrioles. SAS 6 was the only antibody that resulted in clear labeling of the centriole during mitosis.

A Mechanism Promoting Preferential Clustering

NuMA was knocked down in cells with shRNA to promote centrosomal clustering. As expected, cells observed shortly after transfection were unable to undergo mitosis. NuMA is involved in providing the cohesive force maintaining spindle MTs around a single centrosome, so low levels of NuMA prevent the cell from forming spindle poles required for division (Compton and Cleveland, 1993; Merdes et al., 1996;

Quintyne et al., 2005). Recovery time allows for the cells to once again undergo mitosis, but unexpectedly a large number of cells died as time progressed. The reason for this occurrence is unknown, as knockdown of NuMA has not previously been shown to result in cell death. The fact that control cells also experienced some cell death suggest that there is an error in transfection methodology, but repeated transfections all produced similar occurrences of cell death during recovery. There were differences in the amount of cell death depending on which variation of NuMA shRNA was used though, with

NuMA F1 shRNA transfected cells not experiencing as much cell death relative to the cells transfected with other shRNA variations. This trend suggests that even if a flaw in methodology is to blame, the knockdown of NuMA itself does play a small role in contributing to the amount of cell death.

As a result of these complications, only five cells were observed that displayed centrosomal clustering. However, all five of the observed cells displayed preferential

21 clustering with one pole containing two centrioles (one centrosome) with the remaining centrioles at the other pole. These initial results favor the existence of a mechanism that promotes the deamplification of excess centrosomes by centrosomal clustering.

Continuing Research

More data must be obtained to confirm the existence of a mechanism for preferential clustering. To most easily accomplish this, the reason behind the amount of cell death during transfection recovery should be identified. If further results confirm the existence of preferential clustering, the mechanism by which this occurs should be more closely examined. The pole with the singular centrosome should be observed to determine if it is preferentially a mother centrosome, daughter centrosome, or the process is random. The daughter centrosome could be desired because it is newer, or the mother centrosome could be preferred in an attempt to avoid any errors that could be in the daughter centrosome, possibly related to the reason for the existence of supernumerary centrosomes in the first place.

V. Conclusion

There are four models explaining how supernumerary centrosomes can arise in cells: overduplication, mitotic failure, cellular fusion, and de novo formation (Nigg,

2002). Treatment of cells with hydroxyurea or colcemid successfully produces supernumerary centrosomes in cells through the first two models, respectively. Extra centrosomes possess the ability to produce extra mitotic spindles during mitosis, which can lead to chromosomal instability or cell death (Pihan and Doxsey, 1999; Saunders et al., 1999). Cells are known to overcome the presence of supernumerary centrosomes by

22 deamplifying centrosomes through the discarding of excess centrosomes, silencing the excess centrosomes, or clustering the centrosomes into two functional poles (Brinkley,

2001). Centrosomal clustering is the most commonly observed method by which cells cope with supernumerary centrosomes (Ring et al., 1982; Lingle and Salisbury, 1999;

Quintyne et al., 2005). By observing centrosomal clustering through inducing supernumerary centrosomes with hydroxyurea and then promoting clustering by the knockdown of NuMA, initial results suggest that a method of preferential centrosomal clustering occurs. Further study is required for certainty, but all observed cells preferentially formed one pole containing a single centrosome and clustered the remaining centrosomes at the other pole. This clustering pattern would allow one daughter cell to return to a normal centrosome count, and illustrates a previously undescribed mechanism for cells to cope with supernumerary centrosomes by undergoing centrosomal deamplification through centrosomal clustering.

23

VI. References

Balczon, R., L. Bao, W.E. Zimmer, K. Brown, R.P. Zinkowski, B.R.Brinkley. 1995.

Dissociation of Centrosome Replication Events from Cycles of DNA Synthesis

and Mitotic Division in Hydroxyurea-arrested Chinese Hamster Ovary Cells. J.

Cell Biol. 130: 105-115.

Balczon, R., C.E. Varden, T.A. Schroer. 1999. Role for Microtubules in Centrosome

Doubling in Chinese Hamster Ovary Cells. Cell Motil. Cytoskeleton 42: 60-72.

Baron, A.T., T.M. Greenwood, C.W. Bazinet, J.L. Salisbury. 1992. Centrin is a

Component of the Pericentriolar Lattice. Biol. Cell 76: 383-8.

Bouckson-Castaing, V., M. Moudjou, D.J.P. Ferguson, S. Mucklow, Y. Belkaid, G.

Milon, P.R. Crocker. 1996. Molecular Characterisation of Ninein, a New Coiled-

Coil Protein of the Centrosome. J. Cell Sci. 109: 179-90.

Brinkley, B.R. 2001. Managing the Centrosome Numbers Game: From Chaos to Stability

in Cancer Cell Division. Trends Cell Biol. 11: 18-21.

Calarco, P.G. 2000. Centrosome Precursors in the Acentriolar Mouse Oocyte. Microsc.

Res. Tech. 49: 428-34.

Chang, P., T.H. Giddings Jr., M. Winey, T. Stearns. 2003. ε-Tubulin is Required for

Centriole Duplication and Microtubule Organization. Nature Cell Biol. 5: 71-6.

Compton, D.A. and D.W. Cleveland. 1993. NuMA is Required for the Proper

Completion of Mitosis. J. Cell Biol. 120: 947-57.

Doxsey, S. 2001. Re-evaluating Centrosome Function. Nature Rev. Mol. Cell Biol.

2: 688-98.

24

Gaglio, T., A. Saredi, and D.A. Compton. 1995. NuMA Is Required for the Organization

of Microtubules into Aster-Like Mitotic Arrays. J. Cell Biol. 131: 693-708.

Gaglio, T., A. Saredi, J.B. Bingham, M.J. Hasbani, S.R. Gill, T.A. Schroer,

D.A. Compton. 1996. Opposing Motor Activities Are Required for the

Organization of the Mammalian Mitotic Spindle Pole. J. Cell Biol. 135: 399-414.

Galipeau, P.C., D.S. Cowan, C.A. Sanchez, M.T. Barrett, M.J. Emond, D.S. Levine,

P.S. Rabinovitch, B.J. Reid. 1996. 17p (p53) Allelic Losses, 4N (G2/tetraploid)

Populations, and Progression to Aneuploidy in Barrett's Esophagus. Proc. Natl.

Acad. Sci. U.S.A. 93: 7081-4.

Guarguaglini, G., P.I. Duncan, Y.D. Stierhof, T. Holmström, S. Duensing, E.A. Nigg.

2005. The Forkhead-associated Domain Protein Cep170 Interacts with Polo-like

Kinase 1 and Serves as a Marker for Mature Centrioles. Mol. Biol. Cell

16: 1095-107.

Gustafson, L.M., L.L. Gleich, K. Fukasawa, J. Chadwell, M.A. Miller, P.J. Stambrook,

J.L. Gluckman. 2000. Centrosome Hyperamplification in Head and Neck

Squamous Cell Carcinoma: A Potential Phenotypic Marker of Tumor

Aggressiveness. Laryngoscope 110: 1798-1801.

Huang, X., S.M. Gollin, S. Raja, T.E. Godfrey. 2002. High-resolution Mapping of the

11q13 Amplicon and Identification of a gene, TAOS1, That Is Amplified and

Overexpressed in Oral Cancer Cells. Proc. Natl. Acad. Sci. U.S.A. 99: 11369-74.

25

Khodjakov, A., C.L. Rieder, G. Sluder, G. Cassels, O. Sibon, C.L. Wang. 2002. De novo

Formation of Centrosomes in Vertebrate Cells Arrested During S Phase. J. Cell

Biol. 158: 1171-81.

Kleinfeld, R.G. and J.E. Sisken. 1966. Morphological and Kinetic Aspects of Mitotic

Arrests by and Recovery from Colcemid. J. Cell Biol. 31: 369-79.

Koç, A., L.J. Wheeler, C.K. Mathews, G.F. Merrill. 2004. Hydroxyurea Arrests DNA

Replication by a Mechanism That Preserves Basal dNTP Pools. J. Biochemical

Chem. 279: 223-30.

Krauss, S.W., J.A. Chasis, C. Rogers, N. Mohandas, G. Krockmalnic, S. Penman. 1997.

Structural Protein 4.1 is Located in Mammalian Centrosomes. Proc. Natl. Acad.

Sci. U.S.A. 94: 7297-302.

Kuo, K.K., N. Sato, K. Mizumoto, N. Maehara, H. Yonemasu, C.G. Ker, P.C. Sheen,

M. Tanaka. 2000. Centrosome Abnormalities in Human Carcinomas of the

Gallbladder and Intrahepatic and Extrahepatic Bile Ducts. Hepatology 31: 59-64.

Kwon, M., S.A. Godinho, N.S. Chandhok, N.J. Ganem, A. Azioune, M. Thery, D.

Pellman. 2008. Mechanisms to Suppress Multipolar Divisions in Cancer Cells

with Extra Centrosomes. Genes & Dev. 22: 2189-203.

Leidel, S., M. Delattre, L. Cerutti, K. Baumer, P. Gönczy. 2005. SAS-6 Defines a Protein

Family Required for Centrosome Duplication in C. elegans and in Human Cells.

Nature Cell Biol. 7: 115-25.

Lingle, W.L. and J.L. Salisbury. 1999. Altered Centrosome Structure Is Associated with

Abnormal Mitoses in Human Breast Tumors. Am. J. Pathol. 155: 1941-51.

26

Louie, R.K., S. Bahmanyar, K.A. Siemers, V. Votin, P. Chang, T. Stearns, W.J. Nelson,

A.I.M. Barth. 2004. Adenomatous Polyposis Coli and EB1 Localize in Close

Proximity of the Mother Centriole and EB1 is a Functional Component of

Centrosomes. J. Cell Sci. 117: 1117-28.

Mack, G.J., J. Rees, O. Sandblom, R. Balczon, M.J. Fritzler, J.B. Rattner. 1998.

Autoantibodies to a Group of Centrosomal Proteins in Human Autoimmune Sera

Reactive with the Centrosome. Arthritis Rheumatism 41: 551-8.

Matsumoto, Y. and J.L. Maller. 2004. A Centrosomal Localization Signal in Cyclin E

Required for Cdk2-Independent S Phase Entry. Science 306: 885-8.

Merdes, A., K. Ramyar, J.D. Vechio, D.W. Cleveland. 1996. A Complex of NuMA and

Cytoplasmic Dynein is Essential for Mitotic Spindle Assembly. Cell 87: 447-58.

Millband, D.N., L. Campbell, and K.G. Hardwick. 2002. The Awesome Power of

Multiple Model Systems: Interpreting the Complex Nature of Spindle Checkpoint

Signaling. Trends Cell Biol. 12: 205-209.

Nigg, E.A. 2002. Centrosome Aberrations: Cause or Consequence of Cancer

Progression? Nature Rev. Cancer 2: 815-26.

Nigg, E.A. and T. Stearns. 2011. The Centrosome Cycle: Centriole Biogenesis,

Duplication and Inherent Asymmetries. Nature Cell Biol. 13: 1154-1160.

Pihan, G.A., A. Purohit, J. Wallace, H. Knecht, B. Woda, P. Quesenberry, S.J. Doxsey.

1998. Centrosome Defects and Genetic Instability in Malignant Tumors. Cancer

Res. 58: 3974-85.

27

Pihan, G.A., A. Purohit, J. Wallace, R. Malhotra, L. Liotta, S.J. Doxsey. 2001.

Centrosome Defects Can Account for Cellular and Genetic Changes That

Characterize Prostate Cancer Progression. Cancer Res. 61: 2212-9.

Pihan, G.A. and S.J. Doxsey. 1999 The Mitotic Machinery as a Source of Genetic

Instability in Cancer. Semin. Cancer Biol. 9: 289-302.

Quintyne, N.J., J.E. Reing, D.R. Hoffelder, S.M. Gollin, W.S. Saunders. 2005. Spindle

Multipolarity Is Prevented by Centrosomal Clustering. Science 307: 127-9.

Ring, D., R. Hubble, and M. Kirschner. 1982. Mitosis in a Cell with Multiple Centrioles.

J. Cell Biol. 94: 549-56.

Sato, N., K. Mizumoto, M. Nakamura, N. Maehara, Y.A. Minamishima, S. Nishio,

E. Nagai, M. Tanaka. 2001. Correlation Between Centrosome Abnormalities and

Chromosomal Instability in Human Pancreatic Cancer Cells. Cancer Genet.

Cytogenet. 126: 13-9.

Saunders, W.S., M. Shuster, X. Huang, B. Gharaibeh, A.H. Enyenihi, I. Petersen,

S.M. Gollin. 1999. Chromosomal Instability and Cytoskeletal Defects in Oral

Cancer Cells. Proc. Natl. Acad. Sci. U.S.A. 97: 303-8.

Shekhar, M.P., A. Lyakhovich, D.W. Visscher, H. Heng, N. Kondrat. 2002. Rad6

Overexpression Induces Multinucleation, Centrosome Amplification, Abnormal

Mitosis, Aneuploidy, and Transformation. Cancer Res. 62: 2115-124.

Southern, S.A., M.F. Evans, C.S. Herrington. 1997. Basal Cell Tetrasomy in Low-Grade

Cervical Squamous Intraepithelial Lesions Infected with High-Risk Human

Papillomaviruses. Cancer Res. 57: 4210-3.

28

Vandre, D.D., Y. Feng, and M. Ding. 2000. Cell Cycle-Dependent Phosphorylation of

Centrosomes: Localization of Phosphopeptide Specific Antibodies to the

Centrosome. Microsc. Res. Tech. 49: 458-66.

Wang, Y., and Q. Zhan. 2007. Cell Cycle-dependent Expression of Centrosomal Ninein-

like Protein in Human Cells is Regulated by the Anaphase-promoting Complex.

J. Biological Chem. 282: 17712-9.

Weber, R.G., J.M. Bridger, A. Benner, D. Weisenberger, V. Ehemann, G. Reifenberger,

P. Lichter. 1998. Centrosome Amplification as a Possible Mechanism for

Numerical Chromosome Aberrations in Cerebral Primitive Neuroectodermal

Tumors with TP53 Mutations. Cytogenet. Cell Genet. 83: 266-9.

Wu X., and R.E. Palazzo. 1999. Differential Regulation of Maternal vs. Paternal

Centrosomes. Proc. Natl. Acad. Sci. U.S.A. 96: 1397-1402.

29