Supplementary Material for “Fungi Are More Dispersal-Limited Than Bacteria 2 Among Flowers” 3

Total Page:16

File Type:pdf, Size:1020Kb

Supplementary Material for “Fungi Are More Dispersal-Limited Than Bacteria 2 Among Flowers” 3 1 Supplementary Material for “Fungi are more dispersal-limited than bacteria 2 among flowers” 3 4 5 6 7 Supplemental Figure S1 8 Thrips (Frankliniella occidentalis) were first fed a diet containing the antibacterial 9 chloramphenicol. Thrips were sterilized in batches through repeated washings inside 10 pipette chambers. Washing consisted of vortexing at maximum rpm and plunging out 11 solution with ethanol, water, bleach, and water three more times. The assay layout used 12 included 1/3 of wells beginning with microbes and waiting 24 hours for thrips to disperse 13 microbes. 14 15 16 17 18 Supplementary Figure S2—Relationship between cell number in suspension (plated) 19 and CFU detection on a) Reasoner’s Agar (R2A) and b) and yeast agar media (YMA) 20 plates, using the bacteria Acinetobacter nectaris and the yeast Metschnikowia reukaufii 21 for R2A and YMA plates, respectively. 22 23 24 A) Delpat ● Diccap ● 25 26 0.6 27 Colspa ● Asccor ● Staaju ● 28 0.4 Clapur ● R Mimaur ● ColhetTrilax● ● AscfasCyngra● ● ● 29 Penhet ● Delnud ● Erical 0.2 Trilan ● 30 Casocc ● PhacamSalcoa● ● Clacon ● Claung ● Amsmen ● Calocc Monvil● ● ● ● Asceri ● Aescal ScrcalChlpom● Clawil ● Dicvol ● Salmic ● 31 Lepcal ● Delhes ● 32 0.0 Antvex ● Salspa ● 33 Phacal ● 34 0 10 20 30 40 index 35 B) Diccap ● 36 0.8 Delpat ● 37 Asccor ● 38 0.6 Cyngra ● 39 40 0.4 Mimaur ● Colspa ● R ColhetAescal● ● Clapur ● Trilax ● Staaju ● Delnud ● 41 Penhet ● Erical ● Toxfre ● Trilan ●Salspa ● 0.2 ClaungMonvil● ● Scrcal ● Amsmen ● 42 Chlpom ● Phacam ● Salmic ● Ascfas ● Salcoa ● Clacon ● Lepcal ● Delhes ● 43 Calocc ● Asceri ● Casocc ● 0.0 Dicvol ● 44 Clawil ● Antvex ● Phacal ● 45 0 10 20 30 40 46 index 47 48 Supplementary Figure S3. Within-species correlation coefficients for Pearson 49 correlations between bacterial and fungal A) presence absence and B) abundance. 50 Points are colored black when the correlation is significant at FDR >0.05 and labeled 51 with genus and species abbreviations. Note that all but four correlation coefficients are 52 positive (above 0). 53 54 A) Bee Bio Stebbins 0.8 2016 0.4 variable 0.0 BactPres YeastPres 0.8 P(microbes) 2017 0.4 0.0 100 150 200 100 150 200 Julian 55 B) Bee Bio Stebbins 56 6 57 2016 4 58 2 59 variable 0 60 LogTotBact 61 6 LogTotFungi 2017 62 Log10(CFU+1) 4 63 2 64 0 100 150 200 100 150 200 65 Julian 66 Supplementary Figure S4. Seasonal patterns in the a) incidence of and b) 67 abundance of colony forming units on Reasoner’s agar (R2A) plates (bacteria, 68 blue) and colonies on yeast media agar plates (YMA, fungi, in orange) found in 69 floral nectar from two sampling sites in Northern California. In panel b) points are 70 only shown for non-zero values. Sites were sampled through the duration of the 71 main spring flowering period at both sites during 2016 and 2017. Lines represent 72 loess fit with 95% confidence values. Points represent individual nectar samples. 73 74 75 76 77 78 Supplementary Figure S5. Summary of taxa detected in pooled nectar samples. 79 Bacterial data were recovered from N=7 samples for 16S and N=17 samples for ITS 80 sequences. Chloroplast contamination accounted for 37% of reads in the ITS reads and 81 30% of reads in the 16S dataset. 82 83 84 85 Supplementary Figure S6. Frequency of detection for most abundant microbial genera 86 found in floral nectar and identified by MALDI, plotted by flower morphology of plant 87 species from which it was isolated. Blue bars indicate that taxa was more frequently 88 detected than expected by chance and red bars indicate that taxa was less frequently 89 detected than expected by chance. Bar thickness is proportional to the number of times 90 this species was detected in each flower types. P-value indicates significance based on 91 an independence model for a contingency table. 92 B Exposed Within_corolla_short Within_corolla_mid Within_corolla_long Pearson residuals: 3.5 Acinetobacter Bacillus 2.0 Candida A Erwinia 0.0 Metschnikowia -2.0 Micrococcus -2.8 p-value = 1.9685e-10 Pseudomonas 93 94 Supplementary Figure S7. Frequency of detection for most abundant microbial genera 95 found in floral nectar and identified by MALDI, plotted by time of the flowering season, 96 defined by Julian date, where ‘early’<100, 100≤‘mid’<150, and ‘late’≥150. Blue bars 97 indicate that taxa was more frequently detected than expected by chance and red bars 98 indicate that taxa was less frequently detected than expected by chance. Bar thickness 99 is proportional to the number of times this species was detected. P-value indicates 100 significance based on an independence model for a contingency table. 101 B early late mid Pearson residuals: Acinetobacter 3.2 Bacillus Candida 2.0 Erwinia Lactobacillus A 0.0 Metschnikowia Micrococcus Pantoea -2.0 -2.7 Pseudomonas p-value = 1.3043e-06 Rosenbergiella 102 103 Supplementary Table S1. Microbial strains used in dispersal assays, closest BLAST 104 match for species and genus, host species sources, and identifying sequences. Primer 105 sequences used to amplify yeasts were NL1/NL4 or ITS1f/ITS4; bacteria were amplified 106 using 27F/1492R. 107 Strain ID Kingdom species_Genus Host plant or sequence insect source EC52 F Metschnikowia_reukaufii Epilobium_canu CCTTCGGGAATTGTATTTTGAAGGT GGGTTTGGTTAGGAAAAGTTACTTT m AAGTCCATTGGAAAATGGCGCCATG GAGGGTGATAGCCCCGTAAAAGTAT CCCTTTTCCTTTTATCCATTCCCTCC AAAGAGTCGAGTTGTTTGGGAATGC AGCTCTAAGTGGGTGGTAAATTCCA TCTAAAGCTAAATATTGGCGAGAGA CCGATAGCGAACAAGTACAGTGATG GAAAGATGAAAAGCACTTTGAAAAG AGAGTGAAAAAGTACGTGAAATTGT TGAAAGGGAAGGGCTTGCAAGCAG ACACAACCTCGGTTGGGCCAGCATC GGAGTGGGGGGAGACAAAAAAGAA AAGGAATGTAACTCATTGAGTATTAT AGCCTTTTTCTCATATCTCCACCCCC TTCCG EC124 B Rosenbergiella_nectarea Epilobium_canu TCTTTTGCAACCCACTCCCATGGTG TGACGGGCGGTGTGTACAAGGCCC m GGGAACGTATTCACCGTAACATTCT GATTTACGATTACTAGCGATTCCGA CTTCATGGAGTCGAGTTGCAGACTC CAATCCGGACTACGACGCACTTTAT GAGGTCCGCTTGCTCTCGCGAGGT CGCTTCTCTTTGTATGCGCCATTGTA GCACGTGTGTAGCCCTACTCGTAAG GGCCATGATGACTTGACGTCATCCC CACCTTCCTCCGGTTTATCACCGGC AGTCTCCTTTGAGTTCCCACCATTAC GTGCTGGCAACAAAGGATAAGGGTT GCGCTCGTTGCGGGACTTAACCCAA CATTTCACAACACGAGCTGACGACA GCCATGCAGCACCTGTCTCAGAGTT CCCGAAGGCACTAAAGCATCTCTGC TAAATTCTCTGGATGTCAAGAGTAG GTAAGGTTCTTCGCGTTGCATCGAA TTAAACCACATGCTCCACCGCTTGT GCGGGCCCCCGTCAATTCATTTGAG TTTTAACCTTGCGGCCGTACTCCCC A FO-03 B Rosenbergiella_sp Frankliniella_occi CTTGCTACTTTGCTGACGAGTGGCG GACGGGTGAGTAATGTCTGGGGAT dentalis CTGCCTGATGGAGGGGGATAACTAC TGGAAACGGTAGCTAATACCGCATA ATGTCGCAAGACCAAAGCGGGGGA CTTTCGGGCCTCGCACCATCAGATG AACCCAGATGGGATTAGCTAGTAGG TAAGGTAATGGCTTACCTAGGCGAC GATCCCTAGCTGGTCTGAGAGGATG ACCAGCCACACTGGAACTGAGACAC GGTCCAGACTCCTACGGGAGGCAG CAGTGGGGAATATTGCACAATGGGC GCAAGCCTGATGCAGCCATGCCGC GTGTATGAAGAAGGCCTTCGGGTTG TAAAGTACTTTCAGTCAGGAGGAAG GGTGTGAAATTAATACTTTCATGCAT TGACGTTACTGACAGAAGAAGCACC GGCTAACTCCGTGCCAKC SCC477 B Acinetobacter_pollinis Scrophularia_cali TACTAGCGATTCCGACTTCATGGAG TCGAGTTGCAGACTCCAATCCGGAC fornica TACGATCGGCTTTTTGAGATTAGCAT CACATCGCTGTGTAGCAACCCTCTG TACCGACCATTGTAGCACGTGTGTA GCCCTGGCCGTAAGGGCCATGATG ACTTGACGTCGTCCCCGCCTTCCTC CAGTTTGTCACTGGCAGTATCCTTA AAGTTCCCATCCGAAATGCTGGCAA GTAAGGAAAAGGGTTGCGCTCGTTG CGGGACTTAACCCAACATCTCACGA CACGAGCTGACGACAGCCATGCAG CACCTGTATCTAAGTTCCCGAAGGC ACCAATCTATCTCTAGAAAGTTCTTA GTATGTCAAGGCCAGGTAAGGTTCT TCGCGTTGCATCGAATTAAACCACA TGCTCCACCGCTTGTGCGGGCCCC CGTCAATTCATTTGAGTTTTAGTCTT GCGACCGTACTCCCCAGGCGGTCT ACTTATCGCGTTAGCTGCGCCACTA AGTCCTCAAAGGACCCAACGGCT FO-01 B Pantoea_agglomerans Frankliniella_occi TCTTTTGCAACCCACTCCCATGGTG TGACGGGCGGTGTGTACAAGGCCC dentalis GGGAACGTATTCACCGTGGCATTCT GAKCCAYGATYAMAMTCGYWTCCG ACTTCACGGAGTCGAGTTGCAGACT CCGATCCGGACTACGACGCACTTTG TGAGGTCCGCTTGCTCTCGCGAGGT CGCTTCTCTTTGTATGCGCCATTGTA GCACGTGTGTAGCCCTACTCGTAAG GGCCATGATGACTTGACGTCATCCC CACCTTCCTCCGGTTTATCACCGGC AGTCTCCTTTGAGTTCCCGACCGAA TCGCTGGCAACAAAGGATAAGGGTT GCGCTCGTTGCGGGACTTAACCCAA CATTTCACAACACGAGCTGACGACA GCCATGCAGCACCTGTCTCASSGTT CCCGAAGGCACYAAAGCATCTCTGC Q1F2 F Starmerella_bombi Bombus_vosnes AACTCGCATTCGGAGAGTCATGCCG TACTCGTCGTCCGCTTAGTGTGATA enskii TAGCGACTGAAGCTATAATACTCCG AGGAGTTACATTCTTCAGCTTTTATC TTCCCCCCAAACACGACTCTACGTG GTTAGCGGCCTACCCTTCCATTTCA ACAATTTCACGTACTTTTTCACTCTC TTTTCAAAGTTCTTTTCATCTTTCCTT CACAGTACTTGTTCGCTATCGGTCT CTCGCAGATATTTAGCTTTAGATGG AGCATACCACCCATTTGAGCTGCAT TCCCAAACAACTCGACTCCATGCCA AGGTCCTACAGTGGGGTCAATGTCG TACGGGGCTATCACCCTCCATGGCG CTCCTTTCCAGAAGACTTAGACATC GGTTTCCCAGGACCAAGGCTTCAGA ATACAATGCCCCGAAAGGCTTTCAA ATCTGAGCTCTTGCCTGTTCACTCG CCGCTACTAAGGCAATCCCTGTTGG TTTCTTTTCCACCGCTTTTGATATGC AAA EC102 F Aureobasidium_pullulans Epilobium_canu CCCGACCTCCAACCCTTTGTTGTTA AAACTACCTTGTTGCTTTGGCGGGA m CCGCTCGGTCTCGAGCCGCTGGGG ATTCGTCCCAGGCGAGCGCCCGCC AGAGTTAAACCAAACTCTTGTTATTT AACCGGTCGTCTGAGTTAAAATTTT GAATAAATCAAAACTTTCAACAACGG ATCTCTTGGTTCTCGCATCGATGAA GAACGCAGCGAAATGCGATAAGTAA TGTGAATTGCAGAATTCAGTGAATC ATCGAATCTTTGAACGCACATTGCG CCCCTTGGTATTCCGAGGGGCATGC CTGTTCGAGCGTCATTACACCACTC AAGCTATGCTTGGTATTGGGCGTCG TCCTTAGTTGGGCGCGCCTTAAAGA CCTCGGCGAGGCCACTCCGGCTTT AGGCGTAGTAGAATTTATTCGAACG TCTGTCAAAGGAGAGGAACTCTGCC GACTGAAACCTTTATATTTTTCTAGG TTGACCTCGGATCAGGTAGGGATAC CCGCTGAACTT EC69 F Metschnikowia_koreensi Epilobium_canu GCTCAAATTTGAAATCCTCCGGGAA TTGTAATTTGAAGGTGGGGTTGAAT s m AGGTCTAGATACTTTAAGTCCATTG GAAAATGGCGCCMTGGAGGGTGAT AGCCCCGTAAAAGTATTCAAACCTT CTTTTCTTCCCCTCCTAAGARTCGA GTTGTTTGGGAATGCAGCTCTAGTG GGTGGTAAATTCCATCTAAAGCTAA ATATTGGCGAGAGACCGATAGCGAA CAAGTACAGTGATGGAAAGATGAAA AGCACTTTGAAAAGARAGTGAAAAA GTACGTGAAATTGTTGAAAGGGAAG GGCTTGCAAGCAGACACAACCTCG GTTGGGCCAGCATCGGARTGGGGG GARACAAAAAAGGTTA SCC187 B Pantoea_agglomerans Calystegia_occid TCTTTTGCAACCCACTCCCATGGTG TGACGGGCGGTGTGTACAAGGCCC entalis GGGAACGTATTCACCGTGGCATTCT
Recommended publications
  • Microbial Diversity in the Floral Nectar of Seven Epipactis
    ORIGINAL RESEARCH Microbial diversity in the floral nectar of seven Epipactis (Orchidaceae) species Hans Jacquemyn1, Marijke Lenaerts2,3, Daniel Tyteca4 & Bart Lievens2,3 1Plant Conservation and Population Biology, Biology Department, KU Leuven, Kasteelpark Arenberg 31, B-3001 Heverlee, Belgium 2Laboratory for Process Microbial Ecology and Bioinspirational Management (PME&BIM), Thomas More University College, De Nayer Campus, Department of Microbial and Molecular Systems (M2S), KU Leuven Association, B-2860 Sint-Katelijne-Waver, Belgium 3Scientia Terrae Research Institute, B-2860 Sint-Katelijne-Waver, Belgium 4Biodiversity Research Centre, Earth and Life Institute, Universite catholique de Louvain, B-1348 Louvain-la-Neuve, Belgium Keywords Abstract Bacteria, floral nectar, microbial communities, orchids, yeasts. Floral nectar of animal-pollinated plants is commonly infested with microor- ganisms, yet little is known about the microorganisms inhabiting the floral nec- Correspondence tar of orchids. In this study, we investigated microbial communities occurring Hans Jacquemyn, Plant Conservation and in the floral nectar of seven Epipactis (Orchidaceae) species. Culturable bacteria Population Biology, Biology Department, KU and yeasts were isolated and identified by partially sequencing the small subunit Leuven, Kasteelpark Arenberg 31, B-3001 (SSU) ribosomal RNA (rRNA) gene and the D1/D2 domains of the large sub- Heverlee, Belgium. Tel: +3216 321 530; unit (LSU) rRNA gene, respectively. Using three different culture media, we Fax: +32 16 321 968; E-mail: hans. [email protected] found that bacteria were common inhabitants of the floral nectar of Epipactis. The most widely distributed bacterial operational taxonomic units (OTUs) in Funding Information nectar of Epipactis were representatives of the family of Enterobacteriaceae, with This research was funded by the European an unspecified Enterobacteriaceae bacterium as the most common.
    [Show full text]
  • Acinetobacter Pollinis Sp
    TAXONOMIC DESCRIPTION Alvarez- Perez et al., Int. J. Syst. Evol. Microbiol. 2021;71:004783 DOI 10.1099/ijsem.0.004783 Acinetobacter pollinis sp. nov., Acinetobacter baretiae sp. nov. and Acinetobacter rathckeae sp. nov., isolated from floral nectar and honey bees Sergio Alvarez- Perez1,2†, Lydia J. Baker3†, Megan M. Morris4, Kaoru Tsuji5, Vivianna A. Sanchez3, Tadashi Fukami6, Rachel L. Vannette7, Bart Lievens1 and Tory A. Hendry3,* Abstract A detailed evaluation of eight bacterial isolates from floral nectar and animal visitors to flowers shows evidence that they rep- resent three novel species in the genus Acinetobacter. Phylogenomic analysis shows the closest relatives of these new isolates are Acinetobacter apis, Acinetobacter boissieri and Acinetobacter nectaris, previously described species associated with floral nectar and bees, but high genome- wide sequence divergence defines these isolates as novel species. Pairwise comparisons of the average nucleotide identity of the new isolates compared to known species is extremely low (<83 %), thus confirming that these samples are representative of three novel Acinetobacter species, for which the names Acinetobacter pollinis sp. nov., Aci- netobacter baretiae sp. nov. and Acinetobacter rathckeae sp. nov. are proposed. The respective type strains are SCC477T (=TSD- 214T=LMG 31655T), B10AT (=TSD-213T=LMG 31702T) and EC24T (=TSD-215T=LMG 31703T=DSM 111781T). The genus Acinetobacter (Gammaproteobacteria) is a physi- gene trees, but was nevertheless identified and described as ologically and metabolically diverse group of bacteria cur- a new species with the name Acinetobacter apis. However, rently including 65 validly published and correct names, plus several other tentative designations and effectively but not the diversity of acinetobacters associated with flowering validly published species names (https:// lpsn.
    [Show full text]
  • Microbial Abundance, Composition, and Function in Nectar Are Shaped by Flower Visitor Identity Megan M
    FEMS Microbiology Ecology, 96, 2020, fiaa003 doi: 10.1093/femsec/fiaa003 Advance Access Publication Date: 10 January 2020 Research Article Downloaded from https://academic.oup.com/femsec/article-abstract/96/3/fiaa003/5700281 by University of California, Davis user on 16 June 2020 RESEARCH ARTICLE Microbial abundance, composition, and function in nectar are shaped by flower visitor identity Megan M. Morris1,2,3,†, Natalie J. Frixione1, Alexander C. Burkert2, Elizabeth A. Dinsdale1 and Rachel L. Vannette2,* 1Department of Biology, San Diego State University, San Diego, CA 92182, USA, 2Department of Entomology and Nematology, University of California, Davis, Davis, CA 95616, USA and 3Department of Biology, Stanford University, Stanford, CA 94305, USA ∗Corresponding author: 366 Briggs Hall, University of California Davis, Davis CA 95616. Tel: +1-530-752-3379; E-mail: [email protected] One sentence summary: This study uses a floral nectar model system to show that vector identity, in this case legitimate floral pollinators versus nectar robbers, determines microbial assembly and function. Editor: Paolina Garbeva †Megan M. Morris, http://orcid.org/0000-0002-7024-8234 ABSTRACT Microbial dispersal is essential for establishment in new habitats, but the role of vector identity is poorly understood in community assembly and function. Here, we compared microbial assembly and function in floral nectar visited by legitimate pollinators (hummingbirds) and nectar robbers (carpenter bees). We assessed effects of visitation on the abundance and composition of culturable bacteria and fungi and their taxonomy and function using shotgun metagenomics and nectar chemistry. We also compared metagenome-assembled genomes (MAGs) of Acinetobacter, a common and highly abundant nectar bacterium, among visitor treatments.
    [Show full text]
  • Exploration of Bacteria Associated with Anopheles Mosquitoes Around the World
    Digital Comprehensive Summaries of Uppsala Dissertations from the Faculty of Science and Technology 1691 Exploration of bacteria associated with Anopheles mosquitoes around the world For the prevention of transmission of malaria LOUISE K. J. NILSSON ACTA UNIVERSITATIS UPSALIENSIS ISSN 1651-6214 ISBN 978-91-513-0381-9 UPPSALA urn:nbn:se:uu:diva-352547 2018 Dissertation presented at Uppsala University to be publicly examined in A1:111a, BMC, Husargatan 3, Uppsala, Friday, 14 September 2018 at 09:15 for the degree of Doctor of Philosophy. The examination will be conducted in English. Faculty examiner: Professor Michael Strand (Department of Entomology, University of Georgia). Abstract Nilsson, L. K. J. 2018. Exploration of bacteria associated with Anopheles mosquitoes around the world. For the prevention of transmission of malaria. Digital Comprehensive Summaries of Uppsala Dissertations from the Faculty of Science and Technology 1691. 54 pp. Uppsala: Acta Universitatis Upsaliensis. ISBN 978-91-513-0381-9. Every year, hundreds of thousands of people die from malaria. Malaria is a disease caused by parasites, which are spread by female vector mosquitoes of the genus Anopheles. Current control measures against malaria are based on drugs against the parasites and vector control using insecticides. A problem with these measures is the development of resistance, both in the parasites against the drugs and the mosquitoes against the insecticides. Therefore, additional areas of malaria control must be explored. One such area involves the bacteria associated with the vector mosquitoes. Bacteria have been shown to affect mosquitoes at all life stages, e.g. by affecting choice of oviposition site by female mosquitoes, development of larvae and susceptibility to parasite infection in adults.
    [Show full text]
  • Microbial Diversity in the Floral Nectar of Linaria Vulgaris Along an Urbanization Gradient Jacek Bartlewicz1* , Bart Lievens2, Olivier Honnay1 and Hans Jacquemyn1
    Bartlewicz et al. BMC Ecol (2016) 16:18 DOI 10.1186/s12898-016-0072-1 BMC Ecology RESEARCH ARTICLE Open Access Microbial diversity in the floral nectar of Linaria vulgaris along an urbanization gradient Jacek Bartlewicz1* , Bart Lievens2, Olivier Honnay1 and Hans Jacquemyn1 Abstract Background: Microbes are common inhabitants of floral nectar and are capable of influencing plant-pollinator interactions. All studies so far investigated microbial communities in floral nectar in plant populations that were located in natural environments, but nothing is known about these communities in nectar of plants inhabiting urban environments. However, at least some microbes are vectored into floral nectar by pollinators, and because urbaniza- tion can have a profound impact on pollinator communities and plant-pollinator interactions, it can be expected that it affects nectar microbes as well. To test this hypothesis, we related microbial diversity in floral nectar to the degree of urbanization in the late-flowering plant Linaria vulgaris. Floral nectar was collected from twenty populations along an urbanization gradient and culturable bacteria and yeasts were isolated and identified by partially sequencing the genes coding for small and large ribosome subunits, respectively. Results: A total of seven yeast and 13 bacterial operational taxonomic units (OTUs) were found at 3 and 1 % sequence dissimilarity cut-offs, respectively. In agreement with previous studies, Metschnikowia reukaufii and M. gruessi were the main yeast constituents of nectar yeast communities, whereas Acinetobacter nectaris and Rosenbergiella epipactidis were the most frequently found bacterial species. Microbial incidence was high and did not change along the investigated urbanization gradient. However, microbial communities showed a nested subset structure, indicating that species-poor communities were a subset of species-rich communities.
    [Show full text]
  • Isolation of Potential New Biocontrol Strains from the Blossom of Malus
    Research Paper iMedPub Journals European Journal of Experimental Biology 2020 www.imedpub.com ISSN 2248-9215 Vol. 10 No. 6:117 Isolation of potential new biocontrol strains Elie Khoury1, Antoine abou fayad2,3,4, from the blossom of Malus trilobata against Dolla Karam Sarkis5, 1* the fire blight pathogen Erwinia amylovora Mireille kallassy awad 1 Biotechnology Laboratory, UR EGP, Saint- Abstract Joseph University, B.P. 11-514 Riad El Background: Fire blight is a contagious disease that affects members of the Rosaceae Solh Beirut1107 2050, Lebanon family, caused by the bacteria Erwinia amylovora, which invades apple trees via their blossom. 2 Department of Experimental Pathology, Methods: In this study, using culture dependent methods, we isolated for the first time the Immunology and Microbiology, American microorganisms colonizing the blossom of the wild apple tree, Malus trilobata, in Lebanon. University of Beirut, Beirut, Lebanon A total of 94 strains from the blossoms of trees originating from two regions, Ain Zhalta reserve and Dhour EL Choueir, were isolated. Genetic analysis of the strains revealed a wide 3 Center for Infectious Diseases Research and interesting variety of microorganisms quite different from those isolated from Malus domestica blossom. Direct and indirect inhibition assays of the isolates against E. amylovora (CIDR), American University of Beirut. were conducted. Findings: While some strains belong to species known for their antibacterial activity, 4 WHO Collaborating Center for Reference two new strains with interesting inhibitory activity against E. amylovora, have not been and Research on Bacterial Pathogens, previously described. The first strain is a fungi, Saccothecium sp., inhibiting E. amylovora American University of Beirut growth due to antimicrobial metabolite production and nutrient competition.
    [Show full text]
  • CARACTERIZAÇÃO DE Acinetobacter Spp. MULTIRRESISTENTES PRODUTORES DE CARBAPENEMASES, DOS TIPOS OXA E NDM, ISOLADOS DE DIFERENTES REGIÕES DO BRASIL
    MINISTÉRIO DA SAÚDE FUNDAÇÃO OSWALDO CRUZ INSTITUTO OSWALDO CRUZ Doutorado no Programa de Pós-Graduação em Medicina Tropical CARACTERIZAÇÃO DE Acinetobacter spp. MULTIRRESISTENTES PRODUTORES DE CARBAPENEMASES, DOS TIPOS OXA E NDM, ISOLADOS DE DIFERENTES REGIÕES DO BRASIL THIAGO PAVONI GOMES CHAGAS Rio de Janeiro Outubro de 2015 INSTITUTO OSWALDO CRUZ Programa de Pós-Graduação em Medicina Tropical THIAGO PAVONI GOMES CHAGAS Caracterização de Acinetobacter spp. multirresistentes produtores de carbapenemases, dos tipos OXA e NDM, isolados de diferentes regiões do Brasil Tese apresentada ao Instituto Oswaldo Cruz como parte dos requisitos para obtenção do título de Doutor em Ciências (Medicina Tropical). Orientador: Profª. Drª. Marise Dutra Asensi RIO DE JANEIRO Outubro de 2015 Ficha catalográfica elaborada pela Biblioteca de Ciências Biomédicas/ ICICT / FIOCRUZ - RJ C433 Chagas, Thiago Pavoni Gomes Caracterização de Acinetobacter spp. multirresistentes produtores de carbapenemases, dos tipos OXA e NDM, isolados de diferentes regiões do Brasil / Thiago Pavoni Gomes Chagas. – Rio de Janeiro, 2015. xiii, 118 f. : il. ; 30 cm. Tese (Doutorado) – Instituto Oswaldo Cruz, Pós-Graduação em Medicina Tropical, 2015. Bibliografia: f. 70-104 1. Acinetobacter spp.. 2. Resistência aos antimicrobianos. 3. Carbapenemases. 4. OXA-23. 5. NDM. 6. PFGE. 7. MLST. I. Título. CDD 616.92 INSTITUTO OSWALDO CRUZ Programa de Pós-Graduação em Medicina Tropical AUTOR: THIAGO PAVONI GOMES CHAGAS Caracterização de Acinetobacter spp. multirresistentes produtores de carbapenemases, dos tipos OXA e NDM, isolados de diferentes regiões do Brasil ORIENTADOR: Profª. Drª. Marise Dutra Asensi Aprovada em: 26/10/2015 REVISÃO: Profª Drª. Ana Paula D’Allincourt Carvalho Assef Instituto Oswaldo Cruz (IOC - FIOCRUZ) EXAMINADORES: Prof.
    [Show full text]
  • The Role of the Aders Two Component System and the Adeabc RND Efflux
    The Role of the AdeRS Two Component System and the AdeABC RND Efflux Pump in Antibiotic Resistance, Biofilm Formation and Virulence in Acinetobacter baumannii by Grace Emma Richmond A thesis submitted to the University of Birmingham for the degree of DOCTOR OF PHILOSOPHY Antimicrobials Research Group Institute of Microbiology and Infection College of Medical and Dental Sciences University of Birmingham July 2016 University of Birmingham Research Archive e-theses repository This unpublished thesis/dissertation is copyright of the author and/or third parties. The intellectual property rights of the author or third parties in respect of this work are as defined by The Copyright Designs and Patents Act 1988 or as modified by any successor legislation. Any use made of information contained in this thesis/dissertation must be in accordance with that legislation and must be properly acknowledged. Further distribution or reproduction in any format is prohibited without the permission of the copyright holder. Abstract Acinetobacter baumannii is a nosocomial pathogen and causes infections in hospitals worldwide. This organism is often multi-drug resistant (MDR), can persist in the environment and forms a biofilm on environmental surfaces and wounds. This thesis describes research that investigates the role of the two component system AdeRS, which regulates production of the AdeABC MDR efflux pump. Its role in MDR, biofilm formation and virulence of A. baumannii was determined in mutants constructed for this study. Deletion of AdeRS or AdeABC resulted in increased susceptibility to antibiotics, decreased biofilm formation on biotic and abiotic surfaces and decreased virulence in a strain dependent manner. RNA-Seq revealed that loss of AdeRS or AdeB significantly altered the transcriptome, resulting in changed expression of many genes, notably those associated with antimicrobial resistance and virulence interactions.
    [Show full text]
  • Bacterial Communities of Herbivores and Pollinators That Have Co-Evolved Cucurbita Spp
    bioRxiv preprint doi: https://doi.org/10.1101/691378; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 2 Bacterial communities of herbivores and pollinators that have co-evolved Cucurbita spp. 3 4 5 Lori R. Shapiro1, 2, Madison Youngblom3, Erin D. Scully4, Jorge Rocha5, Joseph Nathaniel 6 Paulson6, Vanja Klepac-Ceraj7, Angélica Cibrián-Jaramillo8, Margarita M. López-Uribe9 7 8 1 Department of Applied Ecology, North Carolina State University, Raleigh, NC, 27695 USA 9 2 Department of Organismic and Evolutionary Biology, Harvard University, Cambridge MA, 10 USA 02138 11 3 Department of Medical Microbiology & Immunology, University of Wisconsin-Madison, 12 Madison WI, 53706 USA 13 4 Center for Grain and Animal Health Research, Stored Product Insect and Engineering Research 14 Unit, USDA-Agricultural Research Service, Manhattan, KS, 66502 USA 15 5 Conacyt-Centro de Investigación y Desarrollo en Agrobiotecnología Alimentaria, San Agustin 16 Tlaxiaca, Mexico 42162 17 6 Department of Biostatistics, Product Development, Genentech Inc., South San Francisco, 18 California 94102 19 7 Department of Biological Sciences, Wellesley College, Wellesley, MA 02481 USA 16803 20 8 Laboratorio Nacional de Genómica para la Biodiversidad, Centro de Investigación y de 21 Estudios Avanzados del IPN, Irapuato, Mexico 36284 22 9 Department of Entomology, Center for Pollinator Research, Pennsylvania State University, 23 University Park, PA 24 bioRxiv preprint doi: https://doi.org/10.1101/691378; this version posted July 3, 2019.
    [Show full text]
  • Description of Acinetobacter Pollinis Sp. Nov
    Taxonomic Description 1 Acinetobacter pollinis sp. nov., Acinetobacter baretiae 2 sp. nov., and Acinetobacter rathckeae sp. nov., 3 isolated from floral nectar and honeybees 4 Author names 5 Sergio Álvarez-Pérez1,2,†, Lydia J. Baker3,†, Megan M. Morris4, Kaoru Tsuji5, Vivianna A. Sanchez3, 6 Tadashi Fukami6, Rachel L. Vannette7, Bart Lievens1, Tory A. Hendry3,* 7 8 ORCID IDs 9 Sergio Álvarez-Pérez: http://orcid.org/0000-0002-6587-8995 10 Lydia J. Baker: https://orcid.org/0000-0002-1453-421X 11 Megan M. Morris: https://orcid.org/0000-0002-7024-8234 12 Kaoru Tsuji: https://orcid.org/0000-0001-5020-5184 13 Vivianna A. Sanchez: https://orcid.org/0000-0002-8935-7991 14 Tadashi Fukami: http://orcid.org/0000-0001-5654-4785 15 Rachel L. Vannette: https://orcid.org/0000-0002-0447-3468 16 Bart Lievens: https://orcid.org/0000-0002-7698-6641 17 Tory A. Hendry: https://orcid.org/0000-0002-8001-1783 18 19 Affiliations 20 1Laboratory for Process Microbial Ecology and Bioinspirational Management (PME&BIM), 21 Department of Microbial and Molecular Systems, KU Leuven, Willem De Croylaan 46, B-3001 Leuven, 22 Belgium. 23 2Department of Animal Health, Complutense University of Madrid, 28040 Madrid, Spain. 24 3Department of Microbiology, Cornell University, Ithaca, NY 14853, USA. 25 4Physical and Life Sciences Directorate, Lawrence Livermore National Laboratory,7000 East Avenue, 26 Livermore, CA 94550, USA. 27 5Center for Ecological Research, Kyoto University Hirano 2, Otsu, Shiga 520-2113, Japan. 28 6Department of Biology, Stanford University, Stanford, CA 94305, USA. 29 7Department of Entomology and Nematology, University of California Davis, Davis, CA 95616, USA.
    [Show full text]
  • Genome Biol Evol-2014-Touchon
    The genomic diversification of the whole Acinetobacter genus: origins, mechanisms, and consequences. Marie Touchon, Jean Cury, Eun-Jeong Yoon, Lenka Krizova, Gustavo C Cerqueira, Cheryl Murphy, Michael Feldgarden, Jennifer Wortman, Dominique Clermont, Thierry Lambert, et al. To cite this version: Marie Touchon, Jean Cury, Eun-Jeong Yoon, Lenka Krizova, Gustavo C Cerqueira, et al.. The genomic diversification of the whole Acinetobacter genus: origins, mechanisms, and consequences.. Genome Biology and Evolution, Society for Molecular Biology and Evolution, 2014, 6 (10), pp.2866- 82. 10.1093/gbe/evu225. pasteur-01132634 HAL Id: pasteur-01132634 https://hal-pasteur.archives-ouvertes.fr/pasteur-01132634 Submitted on 18 Mar 2015 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Distributed under a Creative Commons Attribution - NonCommercial - ShareAlike| 4.0 International License GBE The Genomic Diversification of the Whole Acinetobacter Genus: Origins, Mechanisms, and Consequences Marie Touchon1,2, Jean Cury1,2, Eun-Jeong Yoon3, Lenka Krizova4, Gustavo C. Cerqueira5, Cheryl Murphy5, Michael Feldgarden5, Jennifer Wortman5, Dominique Clermont6, Thierry Lambert3, Catherine Grillot-Courvalin3, Alexandr Nemec4,*, Patrice Courvalin3,*, and Eduardo P.C. Rocha1,2,* 1Microbial Evolutionary Genomics, Institut Pasteur, Paris, France 2CNRS, UMR3525, Paris, France 3Unite´ des Agents Antibacte´riens, Institut Pasteur, Paris, France Downloaded from 4Laboratory of Bacterial Genetics, National Institute of Public Health, Prague, Czech Republic.
    [Show full text]
  • Acinetobacter Nectaris Sp. Nov. and Acinetobacter T 8127 ), Isolated from Floral Nectar of the Plant Species Boissieri Sp
    Acinetobacter nectarissp. nov. andAcinetobacter boissieri sp. nov., isolated from floral nectar of wild Mediterranean insect-pollinated plants Sergio A´ lvarez-Pe´rez,13 Bart Lievens,2,33 Hans Jacquemyn4 and Carlos M. Herrera1 Correspondence 1Estacio´n Biolo´gica de Don˜ana, Consejo Superior de Investigaciones Cient´ı ficas (CSIC), Avda. S. A´ lvarez-Pe´rez Ame´rico Vespucio, E-41092 Sevilla, Spain [email protected] 2Laboratory for Process Microbial Ecology and Bioinspirational Management (PME&BIM), Lessius B. Lievens University College, De Nayer Campus, Consortium for Industrial Microbiology and Biotechnology [email protected] (CIMB), Department of Microbial and Molecular Systems (M2S), KU Leuven Association, B-2860 Sint-Katelijne-Waver, Belgium 3Scientia Terrae Research Institute, B-2860 Sint-Katelijne-Waver, Belgium 4Division of Plant Ecology and Systematics, Biology Department, KU Leuven, B-3001 Heverlee, Belgium The taxonomic status of 14 strains of members of Acinetobacterthe genus isolated from floral nectar of wild Mediterranean insect-pollinated plants, which did not belong to any previously described species within this genus, was investigated following a polyphasic approach. Confirmation that these strains formed two separate lineages within Acinetobacterthe genus was obtained from comparative analysis of the partial sequences of the 16S rRNA gene and the gene encoding theb-subunit of RNA polymeraserpoB (), DNA–DNA reassociation data, determination of the DNA +GC content and physiological tests. The Acinetobacternames nectarissp. nov. and Acinetobacter boissierisp. nov. are proposed. The type strainA. nectarisof sp. nov. is SAP 763.2T (5LMG 26958T5CECT 8127T) and that A.of boissierisp. nov. is SAP 284.1T (5LMG 26959T5CECT 8128T). Members of the genus Acinetobacter are generally regarded environmental sources, such as forest soils (Kim et al., as common, free-living saprophytes that show extensive 2008), seawater (Vaneechoutte et al., 2009) and wetlands metabolic versatility and potential to adapt to different (Anandham et ,al 2010).
    [Show full text]