DOCSLIB.ORG

(12) Patent Application Publication (10) Pub. No.: US 2004/0016005 A1 Karatzas Et Al

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
(12) Patent Application Publication (10) Pub. No.: US 2004/0016005 A1 Karatzas Et Al US 2004001.6005A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2004/0016005 A1 KaratZas et al. (43) Pub. Date: Jan. 22, 2004 (54) PRODUCTION OF Related U.S. Application Data BUTYRYLCHOLINESTERASES IN TRANSGENIC MAMMALS (60) Provisional application No. 60/344.295, filed on Dec. 21, 2001. (76) Inventors: Costas N. Karatzas, Quebec (CA); Publication Classification Yue Jin Huang, Quebec (CA), (51) Int. Cl. ................................................ A01K 67/027 Anthoula Lazaris, Quebec (CA) (52) U.S. Cl. .................................... 800/7; 800/14; 800/18 (57) ABSTRACT Correspondence Address: DARBY & DARBY PC. The present invention provides methods for the large-scale P. O. BOX 5257 production of recombinant butyrylcholinesterase in cell cul NEW YORK, NY 10150-5257 (US) ture, and in the milk and/or urine of transgenic mammals. The recombinant butyrylcholinesterases of this invention (21) Appl. No.: 10/326,892 can be used to treat and/or prevent organophosphate pesti cide poisoning, nerve gas poisoning, cocaine intoxication, (22) Filed: Dec. 20, 2002 and Succinylcholine-induced apnea. Patent Application Publication Jan. 22, 2004 Sheet 2 of 13 US 2004/001.6005 A1 90 CTTCTGAATGAAGCATTTGTTGTCCCCTATGGGACTCCTTTGTCAGTAAACTTTGGTCCG 30 L. L N E A F W V P Y G T P L S. V N F G P 96.1 ACCCTGGATGGTGATTTTCTCACTGACATGCCAGACATATTACTTGAACTTGGACAATTT 321 T W D G D F L T D M P D T L L E L G Q F 1021 AAAAAAACCCAGATTTTGGTGGGTGTTAATAAAGATGAAGGGACAGCTTTTTTAGTCTAT 341 K K T C I L W G V N K D E G T A F L V Y O8. GGTGCTCCTGGCTTCAGCAAAGATAACAATAGTATCATAACTAGAAAAGAATTTCAGGAA 361 G A P G F S K D N N S I I T R K E F O E 1141 GGTTTAAAAATATTTTTTCCAGGAGTGAGTGAGTTTGGAAAGGAATCCATCCTTTTTCAT 381 G K. T. F. F. P G W S E E G K E S I L. F. H. 12 Ol TACACAGACTGGGTAGATGATCAGAGACCTGAAAACTACCGTGAGGCCTTGGGTGATGTT 4 Ol Y T D W W D D Q R P E N Y R E A L G D V 1261 GTTGGGGATTATAATTTCATATGCCCTGCCTTGGAGTTCACCAAGAAGTTCTCAGAATGG 421 W G D Y N F I C P A T E F T K K F S E W 321 GGAAATAATGCCTTTTTCTACTATTTTGAACACCGATCCTCCAAACTTCCGTGGCCAGAA 441 G N N A F F Y Y F E H R S S K L P W P E 138 TGGATGGGAGTGATGCATGGCTATGAAATTGAATTTGTCTTTGGTTTACCTCTGGAAAGA 461 W M G W M H G Y E E. F. W. F. G L P L E R. 1441 AGAGATAATTACACAAAAGCCGAGGAAATTTTGAGTAGATCCATAGTGAAACGGTGGGCA 481 R D N Y T K A E E L L S R S I V K R W A 5 O1. AATTTTGCAAAATATGGGAATCCAAATGAGACT CAGAACAATAGCACAAGCTGGCCTGTC 5 O. N F A K Y G N P N E T Q N N S T S W P V 156 TTCAAAAGCACTGAACAAAAATATCTAACCTTGAATACAGAGTCAACAAGAATAATGACG 521 F K S T E Q K. Y. L T L N T E S T R I M T. 1621 AAACTACGTGCTCAACAATGTCGATTCTGGACACATTTTTTCCAAAAGTCTGGAAATG 541 K L R A Q O C R F W T S F F P K V L E M 168 ACAGGAAATATTGATGAAGCAGAATCGGGAGTGGAAAGCAGGATTCCATCGCTGGAACAAT 56 T G. N. D E A E W E W K. A. G F PH. R. W. N. N. 1741 TACATGATGGACTGGAAAAATCAATTTAACGATTACACTAGCAAGAAAGAAAGTTGTGTG 58 Y M M D W. K. N. Q F N D Y T S K K E S C V 18O GGTCTCTAA 60 G k FIGURE 1B Patent Application Publication Jan. 22, 2004 Sheet 4 of 13 US 2004/001.6005 A1 -- Tetr BChE Dimer BChE-hSA Ca - Monomer BChE-hSA FIGURE 3 Patent Application Publication Jan. 22, 2004 Sheet 5 of 13 US 2004/0016005 A1 mature protein 214 ATG (130) 1 TAA (1938) Y. - Noti (16908) XXXXXXXXXXXXXXXXXXXX pUC18/BCNN 15595bp XhoI + B-casein SS Xho PCR 5' B-casein HH 1. XhoI digestion 2. Cloning into pCEM-T 1. Ligation 2. Transformation Not I 3' 3-casein (2219) pBCNN/BChE 17399bp XhoI (10675) 5' 3-casein FIGURE 4 Patent Application Publication Jan. 22, 2004 Sheet 6 of 13 US 2004/001.6005 A1 BChE encoding sequence a -exxx xxx xxxx xxxas YS 1. 2 -3 4 56 N7 8 9 \ ATG STOP 5' UTR (47nt) Goat 3-casein genomic locus 1000bp FIGURES Patent Application Publication Jan. 22, 2004 Sheet 7 of 13 US 2004/001.6005 A1 Dimer rBChE -Ge. < Endogenous BChE dimer Monomer rBChE - Ge. FIGURE 6 Patent Application Publication Jan. 22, 2004 Sheet 8 of 13 US 2004/001.6005 A1 1- Tetramer BChE -H Dimer BChE *H Monomer BChE FIGURE 7 Patent Application Publication Jan. 22, 2004 Sheet 9 of 13 US 2004/001.6005 A1 Monomer BChE FIGURE 8 Patent Application Publication Jan. 22, 2004 Sheet 10 of 13 US 2004/0016005 A1 Noti (14920) WAP 3' Not I (2228) WAP Coding Insulator pWAP/BChE 15583bp BamHI (4661) Pme (10706) Signal Sequence FIGURE 9 Patent Application Publication Jan. 22, 2004 Sheet 11 of 13 US 2004/001.6005 A1 rf 4 \c ve c s g 2R O \d a & &S& &XXXXXC &SXXXXX r &S& CXCXXC O A 3. wit S y c eu A. C r e al Patent Application Publication Jan. 22, 2004 Sheet 12 of 13 US 2004/0016005 A1 Not I UM 3 gift XhoI Fsel Sgfl Insulator pUM/5S13 f 14kb (4647) BChE PCR productOOC Sgf -Digest with Fsel & Sgfl MS -Ligate FSe UM promoter UMSS Not I UM 3 Insulator pUM/BChE (4647) Sgf BChE UM SS UM promoter FIGURE 11 Patent Application Publication Jan. 22, 2004 Sheet 13 of 13 US 2004/0016005 A1 Not I UM3 Insulator Ascl FSel pUM/BChEmod AscI Sgf Mouse UPI PCR product UPII Promoter BChE UM promoter Digested with Asci-Fsel & ligation Sgfl Notl Insulator III.III.IIII pUPII/BChE1 nt Mouse UPII PCR product 14kb AscI 3 genomic sequence Digested with Sgfl-Notl & ligation UPII promoter Not I UPI 3. Insulator pUPII/BChE 14kb AscL SgfI W. BChE FSe s", , , , . .", UPII promoter UPII SS FIGURE 12 US 2004/001.6005 A1 Jan. 22, 2004 PRODUCTION OF BUTYRYLCHOLINESTERASES acetylcholine acetylhydrolase, (EC 3.1.1.7). Those enzymes IN TRANSGENIC MAMMALS which preferentially hydrolyze other types of esterS Such as butyrylcholine, and whose enzymatic acticity is Sensitive to 0001. This application claims priority to provisional U.S. the chemical inhibitor tetraiSopropylpyrophosphoramide application No. 60/344,295 filed Dec. 21, 2001 under 35 (also known as iso-OMPA), are called butyrylcholinest U.S.C. S 119(e), which is incorporated by reference. erases (BChE, EC 3.1.1.8). BChE is also known as pseudo cholinesterase or non-specific cholinesterase. Further clas FIELD OF THE INVENTION sifications of ChE’s are based on charge, hydrophobicity, 0002 The present invention provides methods for the interaction with membrane or extracellular structures, and large-scale production of recombinant butyrylcholinesterase Subunit composition. in cell culture, and in the milk and/or urine of transgenic 0006 Acetylcholinesterase (AChE), also known as true, mammals. The recombinant butyrylcholinesterases of this Specific, genuine, erythrocyte, red cell, or Type I ChE, is a invention can be used to treat and/or prevent organophoS membrane-bound glycoprotein and exists in Several molecu phate pesticide poisoning, nerve gas poisoning, cocaine lar forms. It is found in erythrocytes, nerve endings, lungs, intoxication, and Succinylcholine-induced apnea. Spleen, and the gray matter of the brain. Butyrylcholinest erase (BChE), also known as plasma, Serum, benzoyl, false, BACKGROUND OF THE INVENTION or Type II ChE, has more than eleven isoenzyme variants 0003) The general term cholinesterase (ChE) refers to a and preferentially uses butyrylcholine and benzoylcholine as family of enzymes involved in nerve impulse transmission. in vitro Substrates. BChE is found in mammalian blood The major function of ChE enzymes is to catalyze the plasma, liver, pancreas, intestinal mucosa, the white matter hydrolysis of the chemical compound acetylcholine at the of the central nervous System, Smooth muscle, and heart. cholinergic Synapses. Electrical Switching centers, called BChE is Sometimes referred to as Serum cholinesterase as Synapses, are found throughout the nervous Systems of opposed to red cell cholinesterase (AChE). humans, other vertebrates and insects. Muscles, glands, and 0007 AChE and BChE exist in parallel arrays of multiple neurons are Stimulated or inhibited by the constant firing of molecular forms composed of different numbers of catalytic Signals across these Synapses. Stimulating Signals are carried and non-catalytic Subunits. Both enzymes are composed of by the neurotransmitter acetylcholine, and discontinued by Subunits of about 600 amino acids each, and both are the action of ChE enzymes, which cause hydrolytic break glycosylated. AChE may be distinguished from the closely down of acetylcholine. These chemical reactions are going related BChE by its high specificity for the acetylcholine on all the time at a very fast rate, with acetylcholine causing substrate and sensitivity to selective inhibitors. While AChE Stimulation and ChE enzymes ending the Signals. The action is primarily used in the body to hydrolyze acetylcholine, the of ChE allows the muscle, gland, or nerve to return to its specific function of BChE is not as clear. BChE has no resting State, ready to receive another nerve impulse if need known specific natural Substrate, although it also hydrolyzes be. acetylcholine. 0004. If cholinesterase-inhibiting substances such as 0008. Despite the devastating effects of certain cholinest organophosphate compounds or carbamate insecticides or erase-inhibiting Substances on humans, these compounds are drugs are present, this System is thrown out of balance. not without therapeutic uses. Cholinesterase-inhibiting These cholinesterase-inhibiting Substances prevent the drugs are employed to treat a wide variety of diseases breakdown of acetylcholine, resulting in a buildup of ace including Alzheimer's and Parkinson's diseases, glaucoma, tylcholine, thereby causing hyperactivity of the nervous multiple Sclerosis, and myasthenia gravis. The cholinest System. Acetylcholine is not destroyed and continues to erase-inhibiting compound Succinyl choline is commonly Stimulate the muscarinic receptor sites (exocrine glands and used as a short-acting muscle relaxant in Surgical operations.
Load more

Recommended publications
  • Teratogenicity and Embryotoxicity of Organophosphorus Compounds in Animal Models - a Short Review
    Mil. Med. Sci. Lett. (Voj. Zdrav. Listy) 2012, vol. 81(1), p. 16-26 ISSN 0372-7025 DOI: 10.31482/mmsl.2012.003 REVIEW ARTICLE TERATOGENICITY AND EMBRYOTOXICITY OF ORGANOPHOSPHORUS COMPOUNDS IN ANIMAL MODELS - A SHORT REVIEW Syed M Nurulain and M Shafiullah Department of Pharmacology and Therapeutic, Faculty of Medicine and Health Sciences, UAE University, AlAin, UAE. P.O.Box 17666, Alain, UAE Received 9 th December 2011. Revised 12 th February 2012. Published 9 th March 2012. Summary Organophosphorus compounds (OPCs) are a wide group of compounds both structurally and functionally. Each OPC has a unique toxicological profile. The exposure to this type of poison is not limited only to certain occupationally exposed people but also to children, women, pregnant women; all have chances to be exposed to this poison. During the recent past years it has been reported in many poison epidemiological studies and case reports that exposure of OPCs during pregnancy caused malformed fetuses, neural tube defect (NTD) and shortening of pregnancy. The literature for animal models reveals inconclusive evidence. The generalized view is that they are neither teratogenic nor embryotoxic. But it is not true. There is a lack of systematic study and scarcity of reports on the topic. The present study was undertaken to investigate the teratogenicity induced by organophosphorus compounds in different animal models by literature review. Literature was searched by Toxicology Data NetWork (TOXNET), Developmental and Reproductive Toxicology Database (DART), Toxicology Literature Online (TOXLINE), Hazardous Substances Data Bank (HSDB), Pubmed Central, Entrez-Pubmed, Science Direct, Directory Of Open Access Journal (DOAJ), Google Scholar and International Program on Chemical Safety (IPCS-INCHEM), Embase.
    [Show full text]
  • Organophosphate Poisoning : a Review
    120 Sinha and Sharma Med J Indones Organophosphate poisoning : A review Parmod K. Sinha, Ashok Sharma Abstrak Pestisida organofosfat digunakan secara luas di seluruh dunia. Keracunan oleh bahan ini merupakan masalah kesehatan masyarakat, terutama di negara berkembang. Zat neurotoksik organofosfat merupakan bahan yang dianggap mengancam dalam bidang militer dan terorisme. Mekanisme toksisitas bahan ini adalah dengan cara menghambat asetilkolinesterase yang mengakibatkan menumpuknya neurotransmitor asetilkolin dan terjadi rangsangan terus-menerus pada reseptor asetilkolin pada sistem saraf sentral maupun perifer. Selain krisis kolinergik, organofosfat dapat menimbulkan berbagai sindrom neurologis, baik akut maupun kronik. Sedangkan gejala peralihan ( intermediate) terjadi 1-4 hari setelah krisis kolinergik teratasi. Pengobatan standar terdiri dari reaktivasi asetilkolinesterase dengan antidot golongan oksim (prolidoksim, oksidoksime, HI-6 dan HLo7), dan pengendalian efek biokimia asetilkolin dengan menggunakan atropin. Golongan oksim yang baru HI-6 dan Hlo7 merupakan reaktivator asetilkolinesterase yang lebih cocok dan efektif untuk keracunan akut dan berat dibandingkan dengan prolidoksim dan obidoksim. Penderita yang mendapat pengobatan segera, biasanya dapat sembuh dari toksisitas akut, namun gejala neurologis ikutan dapat saja terjadi. (Med J Indones 2003; 12: 120-6) Abstract Organophosphate pesticides are used extensively worldwide, and poisoning by these agents, particularly in developing nations is a public health problem. Organophosphorous
    [Show full text]
  • Chemical Name Federal P Code CAS Registry Number Acutely
    Acutely / Extremely Hazardous Waste List Federal P CAS Registry Acutely / Extremely Chemical Name Code Number Hazardous 4,7-Methano-1H-indene, 1,4,5,6,7,8,8-heptachloro-3a,4,7,7a-tetrahydro- P059 76-44-8 Acutely Hazardous 6,9-Methano-2,4,3-benzodioxathiepin, 6,7,8,9,10,10- hexachloro-1,5,5a,6,9,9a-hexahydro-, 3-oxide P050 115-29-7 Acutely Hazardous Methanimidamide, N,N-dimethyl-N'-[2-methyl-4-[[(methylamino)carbonyl]oxy]phenyl]- P197 17702-57-7 Acutely Hazardous 1-(o-Chlorophenyl)thiourea P026 5344-82-1 Acutely Hazardous 1-(o-Chlorophenyl)thiourea 5344-82-1 Extremely Hazardous 1,1,1-Trichloro-2, -bis(p-methoxyphenyl)ethane Extremely Hazardous 1,1a,2,2,3,3a,4,5,5,5a,5b,6-Dodecachlorooctahydro-1,3,4-metheno-1H-cyclobuta (cd) pentalene, Dechlorane Extremely Hazardous 1,1a,3,3a,4,5,5,5a,5b,6-Decachloro--octahydro-1,2,4-metheno-2H-cyclobuta (cd) pentalen-2- one, chlorecone Extremely Hazardous 1,1-Dimethylhydrazine 57-14-7 Extremely Hazardous 1,2,3,4,10,10-Hexachloro-6,7-epoxy-1,4,4,4a,5,6,7,8,8a-octahydro-1,4-endo-endo-5,8- dimethanonaph-thalene Extremely Hazardous 1,2,3-Propanetriol, trinitrate P081 55-63-0 Acutely Hazardous 1,2,3-Propanetriol, trinitrate 55-63-0 Extremely Hazardous 1,2,4,5,6,7,8,8-Octachloro-4,7-methano-3a,4,7,7a-tetra- hydro- indane Extremely Hazardous 1,2-Benzenediol, 4-[1-hydroxy-2-(methylamino)ethyl]- 51-43-4 Extremely Hazardous 1,2-Benzenediol, 4-[1-hydroxy-2-(methylamino)ethyl]-, P042 51-43-4 Acutely Hazardous 1,2-Dibromo-3-chloropropane 96-12-8 Extremely Hazardous 1,2-Propylenimine P067 75-55-8 Acutely Hazardous 1,2-Propylenimine 75-55-8 Extremely Hazardous 1,3,4,5,6,7,8,8-Octachloro-1,3,3a,4,7,7a-hexahydro-4,7-methanoisobenzofuran Extremely Hazardous 1,3-Dithiolane-2-carboxaldehyde, 2,4-dimethyl-, O- [(methylamino)-carbonyl]oxime 26419-73-8 Extremely Hazardous 1,3-Dithiolane-2-carboxaldehyde, 2,4-dimethyl-, O- [(methylamino)-carbonyl]oxime.
    [Show full text]
  • The List of Extremely Hazardous Substances)
    APPENDIX A (THE LIST OF EXTREMELY HAZARDOUS SUBSTANCES) THRESHOLD REPORTABLE INVENTORY RELEASE QUANTITY QUANTITY CAS NUMBER CHEMICAL NAME (POUNDS) (POUNDS) 75-86-5 ACETONE CYANOHYDRIN 500 10 1752-30-3 ACETONE THIOSEMICARBAZIDE 500/500 1,000 107-02-8 ACROLEIN 500 1 79-06-1 ACRYLAMIDE 500/500 5,000 107-13-1 ACRYLONITRILE 500 100 814-68-6 ACRYLYL CHLORIDE 100 100 111-69-3 ADIPONITRILE 500 1,000 116-06-3 ALDICARB 100/500 1 309-00-2 ALDRIN 500/500 1 107-18-6 ALLYL ALCOHOL 500 100 107-11-9 ALLYLAMINE 500 500 20859-73-8 ALUMINUM PHOSPHIDE 500 100 54-62-6 AMINOPTERIN 500/500 500 78-53-5 AMITON 500 500 3734-97-2 AMITON OXALATE 100/500 100 7664-41-7 AMMONIA 500 100 300-62-9 AMPHETAMINE 500 1,000 62-53-3 ANILINE 500 5,000 88-05-1 ANILINE,2,4,6-TRIMETHYL- 500 500 7783-70-2 ANTIMONY PENTAFLUORIDE 500 500 1397-94-0 ANTIMYCIN A 500/500 1,000 86-88-4 ANTU 500/500 100 1303-28-2 ARSENIC PENTOXIDE 100/500 1 THRESHOLD REPORTABLE INVENTORY RELEASE QUANTITY QUANTITY CAS NUMBER CHEMICAL NAME (POUNDS) (POUNDS) 1327-53-3 ARSENOUS OXIDE 100/500 1 7784-34-1 ARSENOUS TRICHLORIDE 500 1 7784-42-1 ARSINE 100 100 2642-71-9 AZINPHOS-ETHYL 100/500 100 86-50-0 AZINPHOS-METHYL 10/500 1 98-87-3 BENZAL CHLORIDE 500 5,000 98-16-8 BENZENAMINE, 3-(TRIFLUOROMETHYL)- 500 500 100-14-1 BENZENE, 1-(CHLOROMETHYL)-4-NITRO- 500/500 500 98-05-5 BENZENEARSONIC ACID 10/500 10 3615-21-2 BENZIMIDAZOLE, 4,5-DICHLORO-2-(TRI- 500/500 500 FLUOROMETHYL)- 98-07-7 BENZOTRICHLORIDE 100 10 100-44-7 BENZYL CHLORIDE 500 100 140-29-4 BENZYL CYANIDE 500 500 15271-41-7 BICYCLO[2.2.1]HEPTANE-2-CARBONITRILE,5-
    [Show full text]
  • Ambient Water Quality Criteria for Chlorpyrifos
    United State. Office of Water EPA 440/5-86~05 Environmental Protection Regulations and Standards September 1986 Amy l. lea~erry Agency Criteria and Standards Division Washington DC 20460 Water &EPA Ambient Wat'er Quality Criteria for Chlorpyrifos - 1986 &~IENT AQUATIC LIFE WATER QUALITY CRITERIA FOR CHLORPYRIFOS U.S. ENVIRONMENTAL PROTECTION AGENCY OFFICE OF RESEARCH AND DEVELOPMENT ENVIRONMENTAL RESEARCH LABORATORIES DULUTH, MINNESOTA NARRAGANSETT, RHODE ISLAND NOTICES This document has been reviewed by the Criteria and Standards Division, Office of Water Regulations and Standards, U.S. Environmental Protection Agency, and approved for publication. Mention of trade names or commercial products does not constitute endorsement or recommendation for use. This document is availaryle to the public throu~h the National Technical Inf0rmation Service (NTIS), 5285 Port Royal Road, Springfield, VA 22161. 11 FOREWORD Section 304(a)(1) of the Clean Water Act of 1977 (P.L. 95-217) requires the Administrator of the Environmental Protection Agency to publish water quality criteria that accurately reflect the latest scientific knowledge on the kind and extent of all identifiable effects on health and welfare that might be expected from the presence of pollutants in any body of water~ including ground water. This document is a revision of proposed criteria based upon consideration of comments received from other Federal agencies~ State agencies~ special interest groups~ and individual scientists. Criteria contained in this document replace any previously published EPA aquatic life criteria for the same pollutant(s). The term "water quality criteria" is used in two sections of the Clean Water Act~ section 304(a)(1) and section 303(c)(2).
    [Show full text]
  • SECRETARY HICKEL BANS USE of 16 PESTICIDES on ANY INTERIOR LANDS OR PROGRAMS -- June 18, 1970
    i DEPARTMENT of the INTERIOR news release OFFICE OF THE SECRETARY For Release Thursday, June 18, 1970 SECRETARYHICKEL BANS USE OF 16 PESTICIDES ON ANY INTERIOR LANDS OR PROGRAMS Secretary of the Interior Walter J. Hickel today announced a new policy flatly banning the use of 16 types of pesticides on any lands managed by the Department's bureaus and agencies, or in any program run by them. The Department administers approximately 70 percent of all federally owned lands. Included in this list of prohibited pesticides are such widely-known substances as DDT, Aldrin, 2, 4, 5,-T, Dieldrin, Endrin, Heptachlor, Lindane and Toxaphene. Also on the list of unconditionally banned items are Amitrol, arsenical compounds (inorganic), Azodrin, Bidrin, DDD (TDE), mercurial compounds, Strobane, and Thallium Sulfate. The Secretary pointed out that nearly all use of these pesticides has been banned on Interior Lands during recent years. The purpose of the new statement, he said, is to establish a policy for guidance of all Interior personnel. Another group of chemical pesticides, titled the Restricted List, are to be used only when non-chemical techniques have been considered and found inadequate, and when use can be limited to small-scale applications. Secretary Hickel emphasized that the use of any chemical pesticide by his agencies must be aimed at a specific pest problem, and involve minimum strength and minimum frequency of application. "We in the Interior Department-- the Nation's chief conservation agency have a special obligation to protect the environment for all the people,“’ Secretary Hickel said. "We are charged by law with responsibility for protecting interstate and coastal water quality, our fish and wildlife resources, the integrity of our national parks, public lands, and recreation areas," the Secretary continued.
    [Show full text]
  • Acutely / Extremely Hazardous Waste List
    Acutely / Extremely Hazardous Waste List Federal P CAS Registry Acutely / Extremely Chemical Name Code Number Hazardous 4,7-Methano-1H-indene, 1,4,5,6,7,8,8-heptachloro-3a,4,7,7a-tetrahydro- P059 76-44-8 Acutely Hazardous 6,9-Methano-2,4,3-benzodioxathiepin, 6,7,8,9,10,10- hexachloro-1,5,5a,6,9,9a-hexahydro-, 3-oxide P050 115-29-7 Acutely Hazardous Methanimidamide, N,N-dimethyl-N'-[2-methyl-4-[[(methylamino)carbonyl]oxy]phenyl]- P197 17702-57-7 Acutely Hazardous 1-(o-Chlorophenyl)thiourea P026 5344-82-1 Acutely Hazardous 1-(o-Chlorophenyl)thiourea 5344-82-1 Extemely Hazardous 1,1,1-Trichloro-2, -bis(p-methoxyphenyl)ethane Extemely Hazardous 1,1a,2,2,3,3a,4,5,5,5a,5b,6-Dodecachlorooctahydro-1,3,4-metheno-1H-cyclobuta (cd) pentalene, Dechlorane Extemely Hazardous 1,1a,3,3a,4,5,5,5a,5b,6-Decachloro--octahydro-1,2,4-metheno-2H-cyclobuta (cd) pentalen-2- one, chlorecone Extemely Hazardous 1,1-Dimethylhydrazine 57-14-7 Extemely Hazardous 1,2,3,4,10,10-Hexachloro-6,7-epoxy-1,4,4,4a,5,6,7,8,8a-octahydro-1,4-endo-endo-5,8- dimethanonaph-thalene Extemely Hazardous 1,2,3-Propanetriol, trinitrate P081 55-63-0 Acutely Hazardous 1,2,3-Propanetriol, trinitrate 55-63-0 Extemely Hazardous 1,2,4,5,6,7,8,8-Octachloro-4,7-methano-3a,4,7,7a-tetra- hydro- indane Extemely Hazardous 1,2-Benzenediol, 4-[1-hydroxy-2-(methylamino)ethyl]- 51-43-4 Extemely Hazardous 1,2-Benzenediol, 4-[1-hydroxy-2-(methylamino)ethyl]-, P042 51-43-4 Acutely Hazardous 1,2-Dibromo-3-chloropropane 96-12-8 Extemely Hazardous 1,2-Propylenimine P067 75-55-8 Acutely Hazardous 1,2-Propylenimine 75-55-8 Extemely Hazardous 1,3,4,5,6,7,8,8-Octachloro-1,3,3a,4,7,7a-hexahydro-4,7-methanoisobenzofuran Extemely Hazardous 1,3-Dithiolane-2-carboxaldehyde, 2,4-dimethyl-, O- [(methylamino)-carbonyl]oxime 26419-73-8 Extemely Hazardous 1,3-Dithiolane-2-carboxaldehyde, 2,4-dimethyl-, O- [(methylamino)-carbonyl]oxime.
    [Show full text]
  • Inhibition of Mercaptan Odor in Organothiophosphate Biocides
    Europa,schesP_ MM M II M MM IN Ml MM I M Ml J European Patent Office _ _ _ © Publication number: 0 378 303 B1 Office_„. europeen des brevets EUROPEAN PATENT SPECIFICATION © Date of publication of patent specification: 05.04.95 © Int. CI.6: A01 N 57/02 © Application number: 90300080.0 @ Date of filing: 04.01.90 © Inhibition of mercaptan odor in organothiophosphate biocides. © Priority: 04.01.89 US 293244 © Proprietor: ZENECA LIMITED 15 Stanhope Gate @ Date of publication of application: London W1Y 6LN (GB) 18.07.90 Bulletin 90/29 @ Inventor: Chen, Chia-Chung © Publication of the grant of the patent: 124 Farragut Street 05.04.95 Bulletin 95/14 Hercules, California 94547 (US) Inventor: Rider, Richard H. © Designated Contracting States: 1308 Norvell Street AT BE CH DE DK ES FR GB GR IT LI LU NL SE El Cerrito, California 94530 (US) Inventor: Lo, Ray J. © References cited: 2908 Bayview Drive EP-A- 0 210 608 Alameda, California 94501 (US) FR-A- 2 196 751 CENTRAL PATENTS INDEX, BASIC AB- © Representative: Bishop, Nigel Douglas et al STRACTS JOURNAL, section C, 1967, ab- Intellectual Property Department stract no.67-8304g, Derwent Publications Ltd, ZENECA Agrochemicals London, GB; & JP-A-42 003 381 Jealotts Hill Research Station P.O. Box 3538 CHEMICAL ABSTRACTS, vol. 99, no. 6, 8th Bracknell August 1983, page 147, abstract no. 40962r, Berkshire RG12 6YA (GB) Columbus, Ohio, US; 00 00 o 00 00 00 Note: Within nine months from the publication of the mention of the grant of the European patent, any person may give notice to the European Patent Office of opposition to the European patent granted.
    [Show full text]
  • Qsar Analysis of the Chemical Hydrolysis of Organophosphorus Pesticides in Natural Waters
    QSAR ANALYSIS OF THE CHEMICAL HYDROLYSIS OF ORGANOPHOSPHORUS PESTICIDES IN NATURAL WATERS. by Kenneth K. Tanji Principal Investigator and Jonathan 1. Sullivan Graduate Research Assistant Department of Land, Air and Water Resources University of California, Davis Technical Completion Report Project Number W-843 August, 1995 University of California Water Resource Center The research leading to this report was supported by the University of California Water Resource Center as part of Water Resource Center Project W-843. Table of Contents Page Abstract 2 Problem and Research Objectives 3 Introduction 5 Theoretical Background 6 QSAR Methodology 7 Molecular Connectivity Theory 8 Organophosphorus Pesticides 12 Experimental Determination of Rates 15 Results and Discussion 17 Principal Findings and Significance 19 References 34 List of Tables Page Table 1. Statistical relationship between OP pesticides and first-order MC/'s. 30 Table 2. Inherent conditions of waters used in experimental work. 16 Table 3. Estimated half-lives for organophosphorus esters derived from model. 31 Table 4. Half-lives and first-order MCI' sfor model calibration data set. 31 Table 5. Experimental kinetic data for validation set compounds, Sacramento. 33 List of Figures Page Figure 1. Essential Features OfQSAR Modeling Methodology. 21 Figure 2. Regression plot for In hydrolysis rate vs. 1st order MCl' s. 22 Figure 3. a 3-D molecular model, a line-segment model and a graphical model. 23 Figure 4. Molecular connectivity index suborders. 24 Figure 5. Chlorpyrifos and its fourteen fourth order path/cluster fragments. 25 Figure 6. Abridged MClndex output. 26 Figure 7. Parent acids of most common organophosphorus pesticides. 12 Figure 8.
    [Show full text]
  • Gas-Phase Chemical Reduction (GPCR)
    Gas-Phase Chemical Reduction (GPCR) Name of Process: Status: Gas-Phase Chemical Reduction (GPCR) A Commercial system operated in Australia for more than 5 years, treating Vendor: more than 2,500 tons of PCB’s, DDT and other POPs. In 1999 a full-scale test ELI Eco Logic International Inc. on HCB was conducted using the commercial plant. Web site: http://www.ecologic.ca Eco Logic’s partners in Japan have recently built a semi-mobile GPCR plant for Applicable Pesticides and related the treatment of PCB wastes, which will be operational in 2003. POPs wastes: Pesticides such as Hexachlorobenzene, In combination with Foster Wheeler and Kvaerner the company is DDT, Aldrin, Dieldrin, HCB’s, DDT, PCB’s, participating at present in the ACWA (Army Chemical Weapons Assessment) dioxins and furans and other POPs. Program for the destruction of chemical warfare agents. Eco Logic has partnered with Torftech Inc. for the treatment of soils and sediments at rates of up to 20 tons per hour. Eco Logic has also been selected by UNIDO for a pilot project for treatment of 1000 tons of PCB wastes in Slovakia. Additional approvals received: -for PCB and dioxin waste in Japan -for PCB’s TSCA permit in USA -for PCB’s and other toxic compounds in the Province of Ontario (Canada) Technology description: Eco Logic’s GPCR technology involves the gas-phase chemical reduction of organic compounds by hydrogen at a temperature of 850°C or higher. Chlorinated hydrocarbons, such as HCB, polychlorinated dibenzo-p-dioxins (dioxins) and other POPs, are chemically reduced to methane and hydrogen chloride (HCl).
    [Show full text]
  • Recommended Classification of Pesticides by Hazard and Guidelines to Classification 2019 Theinternational Programme on Chemical Safety (IPCS) Was Established in 1980
    The WHO Recommended Classi cation of Pesticides by Hazard and Guidelines to Classi cation 2019 cation Hazard of Pesticides by and Guidelines to Classi The WHO Recommended Classi The WHO Recommended Classi cation of Pesticides by Hazard and Guidelines to Classi cation 2019 The WHO Recommended Classification of Pesticides by Hazard and Guidelines to Classification 2019 TheInternational Programme on Chemical Safety (IPCS) was established in 1980. The overall objectives of the IPCS are to establish the scientific basis for assessment of the risk to human health and the environment from exposure to chemicals, through international peer review processes, as a prerequisite for the promotion of chemical safety, and to provide technical assistance in strengthening national capacities for the sound management of chemicals. This publication was developed in the IOMC context. The contents do not necessarily reflect the views or stated policies of individual IOMC Participating Organizations. The Inter-Organization Programme for the Sound Management of Chemicals (IOMC) was established in 1995 following recommendations made by the 1992 UN Conference on Environment and Development to strengthen cooperation and increase international coordination in the field of chemical safety. The Participating Organizations are: FAO, ILO, UNDP, UNEP, UNIDO, UNITAR, WHO, World Bank and OECD. The purpose of the IOMC is to promote coordination of the policies and activities pursued by the Participating Organizations, jointly or separately, to achieve the sound management of chemicals in relation to human health and the environment. WHO recommended classification of pesticides by hazard and guidelines to classification, 2019 edition ISBN 978-92-4-000566-2 (electronic version) ISBN 978-92-4-000567-9 (print version) ISSN 1684-1042 © World Health Organization 2020 Some rights reserved.
    [Show full text]
  • Chlorpyrifos Hazards to Fish, Wildlife, and Invertebrates: a Synoptic Review
    Biological Report Contaminant Hazard Reviews March 1988 Report No. 13 CHLORPYRIFOS HAZARDS TO FISH, WILDLIFE, AND INVERTEBRATES: A SYNOPTIC REVIEW By Edward W. Odenkirchen Department of Biology The American University Washington, DC 20016 And Ronald Eisler U.S. Fish and Wildlife Service Patuxent Wildlife Research Center Laurel, MD 20708 SUMMARY Chlorpyrifos (phosphorothioic acid O, O,-diethyl 0-(3,5,6,-trichloro-2-pyridinyl) ester), an organophosphorus compound with an anticholinesterase mode of action, is used extensively in a variety of formulations to control a broad spectrum of agricultural and other pestiferous insects. Domestic use of chlorpyrifos in 1982 was about 3.6 million kg; the compound is used mostly in agriculture, but also to control mosquitos in wetlands (0.15 million kg applied to about 600,000 ha) and turf-destroying insects on golf courses (0.04 million kg). Accidental or careless applications of chlorpyrifos have resulted in the death of many species of nontarget organisms such as fish, aquatic invertebrates, birds, and humans. Applications at recommended rates of 0.028 to 0.056 kg/surface ha for mosquito control have produced mortality, bioaccumulation, and deleterious sublethal effects in aquatic plants, zooplankton, insects, rotifers, crustaceans, waterfowl, and fish; adverse effects were also noted in bordering invertebrate populations. Degradation rate of chloropyrifos in abiotic substrates varies, ranging from about 1 week in seawater (50% degradation) to more than 24 weeks in soils under conditions of dryness, low temperatures, reduced microbial activity, and low organic content; intermediate degradation rates reported have been 3.4 weeks for sediments and 7.6 weeks for distilled water.
    [Show full text]