Quikgene: a Gene Synthesis Method Integrated with Ligation-Free Cloning

Analytical Biochemistry 415 (2011) 21–26

Contents lists available at ScienceDirect

Analytical Biochemistry

journal homepage: www.elsevier.com/locate/yabio

Quikgene: A gene synthesis method integrated with ligation-free cloning

Yanjun Mao a,1, Juanyu Lin a,1, Aibin Zhou a, Kunmei Ji b, Jennifer S. Downey c, Ruichuan Chen a, ⇑ Aidong Han a, a MOE Key Laboratory for Cell Biology, School of Life Sciences, Xiamen University, Fujian 361005, China b School of Medicine, Shenzhen University, Shenzhen, Guangdong 518060, China c Division of Biomedical Science, Herman Ostrow School of Dentistry of University of Southern California, Los Angeles, CA 90089, USA article info abstract

Article history: Gene synthesis is a convenient tool that is widely used to make genes for a variety of purposes. All current Received 17 November 2010 protocols essentially take inside-out approaches to assemble complete genes using DNA oligonucleotides Received in revised form 30 March 2011 or intermediate fragments. Here we present an efficient method that integrates gene synthesis and clon- Accepted 4 April 2011 ing into one step. Our method, which is evolved from QuikChange mutagenesis, can modify, extend, or Available online 15 April 2011 even de novo synthesize relatively large genes. The genes are inserted directly into vectors without liga- tions or subcloning. We de novo synthesized a 600-bp gene through multiple steps of polymerase chain Keywords: reaction (PCR) directly into a bacterial expression vector. This outside-in gene synthesis method is called Gene synthesis Quikgene. Furthermore, we have defined an overlap region of a minimum of nine nucleotides in insertion Ligation-free cloning QuikChange primers that is sufficient enough to circularize PCR products for efficient transformation, allowing one to Quikgene significantly reduce the lengths of primers. Taken together, our protocol greatly extends the current length limit for QuikChange insertion. More importantly, it combines gene synthesis and cloning into one step. It has potential applications for high-throughput structural genomics. Ó 2011 Elsevier Inc. All rights reserved.

Gene synthesis provides convenient access to genes that are of genomic studies. Currently, several computer programs can help to interest for a multitude of studies. With genomic sequences of design genes into the sequences appropriate for target hosts [4]. many species publicly available, one can theoretically obtain any Gene synthesis can be carried out by chemical synthesis, ligase- gene by de novo synthesis. Standard methods involve extensive based synthesis, or polymerase chain reaction (PCR)2-based syn- time and expense after isolating or requesting complementary thesis. Khorana and coworkers first used chemical synthesis to gen- DNAs (cDNAs) and designing primers to clone the genes of interest erate yeast transfer RNA (tRNA) in 1972 [5,6]. A synthesized into various expression vectors. In addition, by expressing proteins promoter was found to be functional, and a gene coding for a func- outside of their origins, codon use can play vital roles in whether or tional protein, somatostatin, was successfully synthesized and ex- not there is any successful expression [1]. The negative factors, pressed in Escherichia coli [7,8]. However, the long DNA chemical including strong codon bias, unbalanced GC/AT composition, and synthesis was often discouraged due to the high cost and error rate unstable messenger RNA (mRNA), are often difficult to overcome [9]. Ligation and PCR extension were then developed using the short by traditional cloning methods. This is particularly true when using oligonucleotides that can be efficiently synthesized at a significantly bacterial or yeast expression systems for mammalian genes [2]. lower error rate [10,11]. These oligonucleotides were assembled into Furthermore, gene synthesis can often clean up those restriction complete genes by either ligation or PCR extension [12–14]. Liga- enzyme cleavage sites within genes for traditional cloning that re- tion-based oligonucleotide assembly requires those gel-purified lies on availability of cleavage sites [3]. QuikChange mutagenesis intermediate fragments and subsequent phosphorylation, which is (Stratagene) is often employed to remove those sites but can be time-consuming [12]. PCR-based oligonucleotide assembly can be tedious if there are too many. De novo gene synthesis can easily done in a single tube through dual asymmetrical PCR (DA–PCR) eliminate the majority of unwanted restriction sites by and a successive extension PCR protocol [9,14–17]. Young and Dong substitutions with alternative codons that are best used by appropriate expression hosts. Therefore, gene synthesis has be- come a preferable method to obtain genes of interest for structural 2 Abbreviations used: PCR, polymerase chain reaction; DA–PCR, dual asymmetrical

PCR; Tm, melting temperature; TAE–PAGE, Tris–acetate–EDTA–polyacrylamide gel electrophoresis; IPTG, isopropyl b-d-1-thiogalactopyranoside; SDS, sodium dodecyl ⇑ Corresponding author. Fax: +86 0592 218 8173. sulfate; GST, glutathione S-transferase; DTT, dithiothreitol; aa, amino acids; E1A, early E-mail address: [email protected] (A. Han). region 1A; CR3, conserved region 3; SCAI, suppressor of cancer cell invasion; SRF, 1 These authors contributed equally to this work. serum response factor.

0003-2697/$ - see front matter Ó 2011 Elsevier Inc. All rights reserved. doi:10.1016/j.ab.2011.04.004 22 Gene synthesis method integrated with cloning / Y. Mao et al. / Anal. Biochem. 415 (2011) 21–26 developed a combined protocol called two-step PCR using as short as products were analyzed using either 1.2% agarose or 5% native 25-nt oligonucleotides to make the syntheses error free [11]. In gen- Tris–acetate–EDTA–polyacrylamide gel electrophoresis (TAE– eral, PCR-assembled genes have very limited errors due to error cor- PAGE) gels. Reaction mixtures were cleaved by adding 1 llofDpnI rection activity of DNA polymerase that can be further enhanced by (New England Biolabs) for 2 h before further purification with the high-fidelity Taq DNA polymerases [18]. The error rate can also be CyclePure kit (Omega) and quantified at k260. PCR product (60 ng) further reduced by adding a mismatch-cleaning endonuclease was used to transform E. coli XL1 Blue competent cells, and trans- [17,19,20]. formants were selected on 2 YT agar plates (per liter: 10 g yeast Specific mutations, including substitution, deletion, and inser- extract, 16 g tryptone, 5 g NaCl, and 15 g agar) with the appropriate tion, are frequently required in structural and functional studies antibiotics according to a molecular cloning manual [24]. Colonies of genes. Single-stranded DNA and restriction ligation can be used were counted after overnight incubation at 37 °C. to generate desired mutations [21,22]. In comparison, QuikChange is a simpler and faster protocol that uses a pair of complete over- Small-scale expression tests lapping primers with melting temperatures (Tm values) over 78 °C according to the manufacturer’s protocol (Stratagene) [23]. Expression constructs were subsequently transferred into sev- The essential elements of QuikChange bipartite primers are two eral E. coli strains for expression, including regular BL21/DE3, overlapping regions complementary to opposite strands of the BL21/DE3 Gold, and BL21/DE3 Rosetta pLysS. Two individual colo- template. These primers are often 25–45 nt long; however, if a nies were inoculated, and colonies were grown in 3 ml of 2 YT li- large insertion is needed, the primers can be as long as 90 nt. The quid medium (per liter: 10 g yeast extract, 16 g tryptone, and 5 g length of primers is associated with not only the overall cost of NaCl) for approximately 6 h to reach an OD600 of 0.6. Bacterial cul- the mutagenesis experiments but also the error rate introduced ture (200 ll) was transferred into 800 ll of fresh 2 YT containing by oligonucleotide synthesis [11]. Therefore, similar to gene syn- 1 mM isopropyl b-D-1-thiogalactopyranoside (IPTG) in 1.5-ml thesis, primer length should be kept to a minimum. tubes. These bacterial cultures were induced for 1 h with shaking QuikChange has proved to be a powerful mutagenesis tool. Here at different temperatures (37, 25, and 12 °C). The cells were col- we present a novel protocol, Quikgene, that uses the QuikChange lected by centrifugation at more than 10,000 rpm for 2 min. The li- insertion algorithm to assemble oligonucleotides into genes. How- quid medium was completely removed, and cell pellets were ever, unlike QuikChange, this method can assemble several hun- vortexed to homogeneity in 30 ll of distilled water and lysed with dreds of base pairs of genes. It can create complete de novo an equal volume of BugBuster (Invitrogen). At this point, the bacte- genes or just extend or modify existing genes. The final genes are rial mixtures were completely transparent unless the proteins directly synthesized on desired vectors without any ligation or were expressed in inclusion bodies. The mixtures as whole pro- subcloning steps. teins were analyzed on 15% sodium dodecyl sulfate (SDS)–PAGE. The supernatants after centrifugation (15,000g, >5 min, room tem- Materials and methods perature) can be used to check protein solubility.

Expression vectors GST puriﬁcation

All vectors and plasmids are listed in Table 1. pXA90 is similar Expression strain BL21/DE3 Rosetta pLysS with an expression to pGEX-6p vector with two major differences: p15 replication ori- construct above was grown in 500 ml of 2 YT medium to OD600 gin and chloramphenicol resistance. pET-His was constructed from of 0.6 at 37 °C and induced with 0.25 mM IPTG overnight at pRSET with new multiple cloning and thrombin cleavage sites. All 37 °C. The cells were harvested and lysed by sonication in 40 ml plasmids were propagated in E. coli XL1 Blue and purified using the of buffer (50 mM Tris [pH 8.0], 500 mM NaCl, 10% glycerol, 3 mM Omega Miniprep kit. EDTA, 2 mM dithiothreitol [DTT], and 3 mM b-mercaptoethanol). The supernatant was collected by high-speed centrifugation PCR amplification (20,000 rpm, 30 min, 4 °C). The rest of the purification was carried out using glutathione S-transferase (GST) affinity Sepharose at 4 °C Primers (Invitrogen, Shanghai) were designed manually and following the manufacturer’s protocol (GE Healthcare). Purified used without gel purification. 18 PCR cycles (94 °C for 45 s, 58 °C proteins were analyzed using 15% SDS–PAGE. for 30 s, and 68 °C for 15 min) were carried out in a thermocycler (Bio-Rad) with high-fidelity DNA polymerases (Taq, Pyrobest Results [Takara], FastPfu [TransGene], and Pfu Turbo [Stratagene]). PCR Short DNA synthesis by standard QuikChange deletion and insertion

Table 1 For the initial test, we wanted to replace the GST gene of pXA90 Plasmids used in this study. with a 69-bp linker that contains a 6 His tag and a PreScission Plasmid Relevant characteristics Sources protease cleavage site to generate the vector pXA-His (Fig. 1). We began with the QuikChange protocol; however, based on the Quik- pRSET His tag expression vector, AmpR Invitrogen pET-His pRSET with new MCS, thrombin This study Change manual, the two complete complementary primers would cleavage site, AmpR need to be 110 nt long. Primers longer than 59 nt can cost up to pXA90 pGEX-6p with a p15 replication origin, CmR Chen et al. [30] four times more for synthesis. Therefore, we designed a pair of pXA-His pXA90 with His/PreScission (3C) This study primers with a partial overlap of only 15 nt, as demonstrated by cleavage site linker, CmR 0 pGEX-E1A1 Adenovirus E1A 12S in pGEX-6p, AmpR X.J. Chen Zheng and coworkers [25]. The 3 ends of primers F and 15R (Ta- pGEX-E1A2 Adenovirus E1A 13S in pGEX-6p, AmpR This study ble 2) were complementary to 15–16 bp of pXA90 plasmid. Of 10 pET-SCAI1 pET-His with gene of SCAI (54–106aa), AmpR This study clones with the desired insert, three were identiﬁed as positive R pET-SCAI2 pET-His with gene of SCAI (54–263aa), Amp This study for the His and 3C protease cleavage linker by restriction digestion Note. AmpR, ampicillin resistance; CmR, chloramphenicol resistance; MCS, multiple and subsequently conﬁrmed by DNA sequencing (see Fig. 1S in cloning site. Supplementary material). Gene synthesis method integrated with cloning / Y. Mao et al. / Anal. Biochem. 415 (2011) 21–26 23

Fig.2. PCR products using primers with different lengths of overlapping sequences. Lanes 1–5: 3, 6, 9, 12, and 15 nt of overlapping sequences, respectively. DNA markers are indicated on the left. The sequences of all primers are listed in Table 2.

yields (Fig. 2). However, the number of positive clones clearly var- ied (Table 2). Interestingly, different high-fidelity polymerases, Pyrobest and Pfu turbo, produced slightly different positive cloning rates (see Table 1S in Supplementary material). Therefore, we pre- fer Pyrobest not only for its robustness but also for the significantly lower price and better productivity compared with Pfu turbo. Posi- tive clones generated by Pyrobest allowed an overlap as short as 9 nt, whereas for Pfu turbo the smallest overlap possible was 12 nt. On average, one positive clone was identified for every three Fig.1. Insertion of His/P linker into pXA-90 vector to replace the GST gene. The top represents original pXA-90 vector. The GST gene is colored in cyan. The light green or four colonies. Taken together, these data suggest that as little as arrow is the Ptac promoter, and the two purple arrows are complementary to the 9–12 nt overlap is sufficient for QuikChange to produce a number pXA-90 vector with tails that contain inserted the His/P fragment. The engineered of positive transformed colonies. PreScission (3C) cleavage site is underlined, and the original multiple cloning site linker is colored in yellow. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.) Small DNA fragment syntheses

Next we wanted to investigate whether this overlap could be After successfully generating pXA-His by inserting 69 bp, we shortened further. A series of primers were designed with overlap- wanted to determine whether this technique would also work with larger DNA synthesis. We decided to work on the adenovirus early ping regions of 3–15 nt and Tm values ranging from 10 to 50 °C. As shown in Table 2, the forward primer (F) remained the same and region 1A (E1A) gene. E1A is an important transcriptional regulator the overlap region was gradually deleted from the 50 sequence of where the N terminus binds several different proteins, including reverse primers. histone acetyltransferases such as p300 [26]. There are two forms To estimate the differences in mutagenesis efficiencies, we of E1A, 12S and 13S, where 12S lacks the conserved region 3 (CR3). compared the numbers of actual positive clones rather than simple We decided to generate E1A 13S (amino acids [aa] 1–194) from 12S PCR yields by restriction digestion. To take into account any varia- (aa 1–126) by inserting the missing CR3. The CR3 domain is coded tions in the PCR reaction, all PCR products were purified and quan- by a 138-bp fragment that is two times longer than the previous tified. We found that the PCR product did not appear to differ in linker we tested above. Therefore, for this fragment, two pairs of primers were designed (Fig. 3A). For the first step in PCR (out), forward (cr3F1) and reverse (cr3R1) primers (Table 3), which are complementary to pGEX-E1A1 12S, were used. The second step Table 2 of PCR was carried out using 0.5–1 ll of crude product from the Overlap length and its relationship with positive mutagenesis rate. first step of the PCR as a template and a second pair of internal Primer sequence Tm Positive primers (Fig. 3A, cr3F2 and cr3R2), which contain a 9-nt overlap (°C) (%) that was used for circularizing the linear PCR product for efficient F CACAGCGGCCTGGAA 50 transformation (Table 3, bold italic). PCR products were analyzed GTTCTGTTCCAGGGTCCGCATATGAAA by agarose gel before transformation (Fig. 3B). After transforma- GGATCCCCAGGAATTC 15R TTCCAGGCCGCTGTG 50 80 tion, positive clones were confirmed by restriction digestion and ATGATGATGATGATGGCTCATAAGCTT DNA sequencing. GAATACTGTTTCCTG Next we looked at the expression of the newly synthesized E1A 12R CAGGCCGCTGTG 42 30 13S in E. coli and compared it with the original E1A 12S. As shown ATGATGATGATGATGGCTCATAAGCTT in Fig. 2S in the Supplementary material, the E1A 13S (aa 1–194) GAATACTGTTTCCTG 9R GCCGCTGTG ATGATGATGATGATGGCTCATAAGCTT 32 30 was expressed and purified to a level similar to 12S from the origi- GAATACTGTTTCCTG nal construct. 6R GCTGTG ATGATGATGATGATGGCTCATAAGCTT 20 0 The success of these syntheses prompted us to attempt a de GAATACTGTTTCCTG novo gene synthesis. For this, we targeted a gene for suppressor 3R GTG ATGATGATGATGATGGCTCATAAGCTT 10 0 of cancer cell invasion (SCAI), which was recently identified to play GAATACTGTTTCCTG roles in transcriptional regulation of serum response factor (SRF) Note. Sequences of the primers for GST deletion are listed. The bold nucleotides [26]. A gene encoding SCAI (aa 54–106) based on the original Gen- represent complementary nucleotides to the DNA sequence of original pXA-90 Bank sequence (NM_173690) was designed using a codon opti- vector. The italic nucleotides are the overlapping sequences for bridging the plas- mizer [3]. To minimize the length of the plasmid, which could mid. Tm values were calculated only for the italic overlap nucleotides using the formula 4 (GC) + 2 (AT). The positive rate was determined by number of positive decrease PCR efficiency, we used a small His vector pET-His clones out of 10 colonies. (2.9 kb). Similarly, two PCR steps with two pairs of primers were 24 Gene synthesis method integrated with cloning / Y. Mao et al. / Anal. Biochem. 415 (2011) 21–26

Table 3 Primers designed for gene assemblies.

Primer sequence Tm (°C) cr3F1 TGTTATATGCGTACTTGTGGTATGTTCGTTTATTC 46 TCCTGTGTCTGAACC cr3F2 CGTCGTAAC ACTGGTGATCCAGACATCATGTGTTCTCTG 38 TGTTATATGCGTAC cr3R1 CCCGGATGTTCAACATAATCCAGAACGAACTCTT 44 CACCCTCTTCATCC cr3R2 GTTACGACG ATGATAATGACAAGAACGACAACCATGA 44 CCCGGATGTTCAAC scF1 TCTGCAGGAAGTTGCGGCGTTCATCGAAGCGGACCCGGTT 54 GCTAGCTAACATCATCATC scF2 ACCCACCGTTTCAACACCGAAGACCAGGTTGAATGGAACCTGGT 46 TCTGCAGGAAGTTGC scF3 TTAAAGACCTGGTTAAAGAACTGTCTGACGAAATCGAAGACTAC 46 ACCCACCGTTTCAAC scF4 TTTCATCGTTGTTTGCCTGCTGCTGAACAAAATGGACGTTG 48 TTAAAGACCTGGTTAAAG scF5 ACCGTCCGGAACTGGTTGTTAAAAAACTGCGTTACTACGCGCG 44 TTTCATCGTTGTTTGC scF6 ACTACTCTC AGGTTAACAAAGAAG ACCGTCCGGAACTG 46 scR1 TAAACGTCGAAGGTACGACCGAAGTAAGACTGCCACTGTTTCTG 44 ACCATATTGTGGCAG scR2 CAGAACCTGACGGTGCTGCTGCTGGAATTTCCACAGTTTGGTG 46 TAAACGTCGAAGGTAC scR3 GCGATTTCACCGATCTGCCAACGTTTCAGACCGTAACGGTTGTC 48 CAGAACCTGACGGTG Fig.3. Converting E1A 12S–13S by filling in the missing CR3 fragment. (A) Strategy scR4 AGGTACGCAGGTAGTAGTGGTAGTACAGCTGACCGATTTTAGAC 46 for primer design of Quikgene for E1A gene extension. The overlapping regions of GCGATTTCACCGATC ‘‘out’’ primers to template are indicated in black. The 9 nt of overlapping sequences scR5 TCGCAGAGTAGAAAGAGAACGCTTCGTTCAGGTAAGAGGTTTCAG 44 in the middle ‘‘in’’ primers are shaded. The complementary regions between ‘‘in’’ AGGTACGCAGGTAG and ‘‘out’’ primers are blank. (B) PCR products using two primer pairs: cr3R1/cr3F1 scR6 GAGAGTAGT AAGAACGCTGACGGA TCGCAGAGTAGAAAG 44 and cr3R2/cr3F2. Lane 1: ‘‘out’’ PCR product from cr3R1/cr3F1; lane 2: ‘‘in’’ product from primers cr3R2/cr3F2. DNA size markers are indicated on the left. Note. CR3 E1A and SCAI (aa 107–263) extension primers are prefixed with cr3 and sc, respectively. The bold nucleotides were complementary to DNA sequences of the original constructs. The bold italic nucleotides were overlap sequences for bridging used to efficiently assemble the SCAI gene fragment into a plasmid the linear plasmid. Tm values were calculated only for the italic overlap nucleotides of pET-SCAI1 (Table 1 and Fig. 3SA and 3SB in Supplementary using the formula 4 (GC) + 2 (AT). material). pair of primers has not been defined previously. In this study, we Larger gene synthesis and protein expression tests first systematically shortened the overlap and found that the essential length of 9 nt allows a significant reduction to the total With the successful generation of the small fragment of SCAI (aa primer length for QuikChange, in particular for large insertions. 54–106), we next continued to extend it further. To add an addi- This lowers the cost of oligonucleotide synthesis. More important, tional 481-bp gene coding amino acids 107–263 of SCAI, we de- it minimizes the error rate that increases along with the length of signed six primer pairs (Table 3). scR6 and scF6 were internal primers [17]. It is noted that a 12-nt overlap can be preferably used primers that had the 9-nt overlap required for circularizing the in cases where primers are not long. We also found that our prim- plasmid DNA. A QuikChange PCR cycle was set up from the most ers worked more robustly than traditional primers (data not external primers scF1 and scR1 and template pET-SCAI1. In addi- shown). A similar observation was also described previously [25]. tion, 0.5–1 ll of its PCR product was used as a template for the sec- Interestingly, nonoverlapping primers worked after treatment with ond PCR reaction with primers scF2 and scR2 (Table 3). The cycles T4 polynucletotide kinase followed by rapid T4 ligase (data not were continued to the final primer pairs. The PCR product was then shown). However, frequent mutations were found in the ligated re- treated with DpnI before transformation (Table 3 and Fig. 4A). To gion (data not shown). improve PCR efficiency, the third round of PCR product was puri- The length of oligonucleotide has been shown to be the most fied for the next steps (Fig. 4A, lane 5). pET-SCAI2 with de novo important factor for gene synthesis. Primers from less than 25 nt synthesized SCAI gene (aa 54–263) was confirmed by sequencing. to more than 100 nt have been used successfully [17]. Although To examine whether the de novo SCAI gene was functional, we they have a lower error rate, shorter oligonucleotides apparently expressed SCAI (aa 54–263) in E. coli using a small-scale induction increase system complexity and overall cost due to more overlap- test. The induced cells were lysed in BugBuster and subjected to ping nucleotides [11]. Therefore, no more than 59 nt of primers has SDS–PAGE analysis. Expression of SCAI was shown to be abundant been shown to be the best economical choice, as suggested by at 37 and 25 °C compared with uninduced samples (Fig. 4B, lanes 3 Xiong and coworkers [10]. Errors in oligonucleotides less than and 4). However, SCAI was not soluble because there was not any 59 nt are rare due to the current chemical synthesis protocols protein left in supernatant (data not shown). We are now working and hardware, for example, a better depurination procedure for on the solubility for this protein domain. long oligonucleotides [27]. It is our routine to use such long oligonucleotides for either regular PCR-based cloning or mutagenesis. Discussion From all clones we have sequenced, we estimate the error rate to be less than 0.1%. QuikChange is currently a routine protocol for mutagenesis To successfully assemble chemical synthesized oligonucleo- where a pair of primers use 12–16 bp of overlapping region to tides, the complementary length between neighboring parallel the templates. However, the optimal overlap length between the primers is often 18–20 nt. Interestingly, the 6- to 9-nt overlap Gene synthesis method integrated with cloning / Y. Mao et al. / Anal. Biochem. 415 (2011) 21–26 25

Fig.5. Schematic diagram of Quikgene method. Gene assembly starts step by step from cyan to red fragment. Pairs of primers are indicated in the arrow with distinct colors. (For interpretation of the references to color in this ﬁgure legend, the reader is referred to the Web version of this article.)

PCR efficiency, computer programs can be developed to aid oligonucleotide design as DNAWorks is used for traditional gene synthesis [17,29]. High-fidelity Taq DNA polymerases usually work well with DNA fragments smaller than 2 kb. However, plasmids are often longer than 3 kb, so PCR is not as efficient as with the short DNA fragments. Two solutions might help: (i) using small expression vectors such as pRSET (Invitrogen), pQE (Qiagen), and our pET-His and (ii) using those Taq DNA polymerases developed especially for long DNA templates, for example, Phusion (NEB) and Advantage Fig.4. SCAI gene assembly and expression test. (A) PCR products of SCAI gene extension (aa 107–263) assembled in six steps. Lanes 1–3: first to third PCR steps; HD (Clontech). It is worthwhile to note that Phusion DNA polymer- lane 4: gel-extracted PCR product from third round of PCR; lanes 5–7: fourth to ase clearly worked less efficiently in either traditional QuikChange sixth PCR steps. DNA markers are indicated on the left. (B) Small-scale induction or our Quikgene experiments, although it might serve well for reg- test for entire SCAI (aa 54–263) gene fragment. Lanes 1 and 2: samples without ular PCRs. IPTG at 37 and 25 °C, respectively; lanes 3 and 4: whole cell lysates of IPTG-induced In summary, we combined algorithms of DNA synthesis and cells at 37 and 25 °C, respectively. Arrows indicate the expressed 26-kDa SCAI protein (with His-tag fusion). Molecular weight markers are indicated on the left. QuikChange to quickly assemble synthesized oligonucleotides to genes of interest (Fig. 5). Although it derives from the insertion module of QuikChange, this technique can create genes coding was successfully used for parallel neighbor oligonucleotides previ- for a few hundred amino acids rather than just a few amino acids. ously in gene assembly [28]. However, the longer overlap of Similar to QuikChange, this synthesis protocol can be completed in approximately 20 bp was believed to guarantee correct assembly 1–2 days for short genes. More important, the genes are synthe- [13]. In our Quikgene protocol, we follow QuikChange primer sized directly on the vectors, eliminating gel purification and fur- guidelines to keep 12–16 bp with a Tm of 36–50 °C between paral- ther subcloning steps. Due to the ease of use, speed, and lel neighbor primers so that one program is used for all PCR efficiency of this method, we refer to it as Quikgene. This method reactions. expands the current QuikChange module and will be very useful We then used step-by-step PCR to synthesize the genes of inter- for molecular biology laboratories to extend/patch an existing gene est as depicted in Fig. 5. One-step PCR might be possible when or even perform de novo gene synthesis. optimized ratios of all primer pairs are found [10,14]. However, the step-by-step protocol is better controlled because we can Acknowledgments check PCR products at every step by gel to make sure that successful amplification occurs. Moreover, the original template is diluted The authors thank Xiaojiang Chen (University of Southern Cali- in such a step-by-step procedure so that the amount of wild-type fornia) for kindly providing pXA-90 vector and pGEX-6p-E1A 12S colonies is highly suppressed. In most cases, we do not need to construct. We thank Dr. Quanwen Jin (Xiamen University) for crit- gel purify the PCR products. However, if the PCR yield is low due ically reading the manuscript and Chen Wang for helping with the to contaminations from multiple steps, gel purification should figures and tables. This work was supported by the National Natu- help. Failed PCR can also result from low quality of oligonucleo- ral Science Foundation of China (30840027 and 90919036 to A.H.), tides, secondary structures, or errors in chemical synthesis. In prac- Project 985, and the Fujian Science Advancing Program tice, the PCR setups, such as template/primer ratio and annealing (2009J1010). This work was also supported by Project 111 temperature, can be optimized. To minimize errors and increase (B06016 to Y.M. and J.L.). 26 Gene synthesis method integrated with cloning / Y. Mao et al. / Anal. Biochem. 415 (2011) 21–26

Appendix A. Supplementary data [15] K. Majumder, Ligation-free gene synthesis by PCR: synthesis and mutagenesis at multiple loci of a chimeric gene encoding ompA signal peptide and hirudin, Gene 116 (1992) 115–116. Supplementary data associated with this article can be found, in [16] A.S. Xiong, R.H. Peng, J. Zhuang, J.G. Liu, F. Gao, J.M. Chen, Z.M. Cheng, Q.H. Yao, the online version, at doi:10.1016/j.ab.2011.04.004. Non-polymerase-cycling-assembly-based chemical gene synthesis: strategies methods and progress, Biotechnol. Adv. 26 (2008) 121–134. [17] A.S. Xiong, R.H. Peng, J. Zhuang, F. Gao, Y. Li, Z.M. Cheng, Q.H. Yao, Chemical References gene synthesis: Strategies, softwares, error corrections, and applications, FEMS Microbiol. Rev. 32 (2008) 522–540. [1] C. Gustafsson, S. Govindarajan, J. Minshull, Codon bias and heterologous [18] T.G. Mamedov, N.V. Padhye, H. Viljoen, A. Subramanian, Rational de novo gene protein expression, Trends Biotechnol. 22 (2004) 346–353. synthesis by rapid polymerase chain assembly (PCA) and expression of [2] J.F. Kane, Effects of rare codon clusters on high-level expression of endothelial protein-C and thrombin receptor genes, J. Biotechnol. 131 (2007) heterologous proteins in Escherichia coli, Curr. Opin. Biotechnol. 6 (1995) 379–387. 494–500. [19] M. Fuhrmann, W. Oertel, P. Berthold, P. Hegemann, Removal of mismatched [3] R.H. Scheller, R.E. Dickerson, H.W. Boyer, A.D. Riggs, K. Itakura, Chemical bases from synthetic genes by enzymatic mismatch cleavage, Nucleic Acids synthesis of restriction enzyme recognition sites useful for cloning, Science Res. 33 (2005) e58. 196 (1977) 177–180. [20] J. Smith, P. Modrich, Removal of polymerase-produced mutant sequences from [4] P. Puigbo, E. Guzman, A. Romeu, S. Garcia-Vallve, OPTIMIZER: a web server for PCR products, Proc. Natl Acad. Sci. USA 94 (1997) 6847–6850. optimizing the codon usage of DNA sequences, Nucleic Acids Res. 35 (2007) [21] M.J. Zoller, M. Smith, Oligonucleotide-directed mutagenesis using M13- W126–W131. derived vectors: An efficient and general procedure for the production of [5] H.G. Khorana, H. Buchi, M.H. Caruthers, S.H. Chang, N.K. Gupta, A. Kumar, E. point mutations in any fragment of DNA, Nucleic Acids Res. 10 (1982) 6487– Ohtsuka, V. Sgaramella, H. Weber, Progress in the total synthesis of the gene 6500. for ala-tRNA, Cold Spring Harb. Symp. Quant. Biol. 33 (1968) 35–44. [22] J.K. Ko, J. Ma, A rapid and efficient PCR-based mutagenesis method applicable [6] K.L. Agarwal, H. Buchi, M.H. Caruthers, N. Gupta, H.G. Khorana, K. Kleppe, A. to cell physiology study, Am. J. Physiol. Cell. Physiol. 288 (2005) C1273–C1278. Kumar, E. Ohtsuka, U.L. Rajbhandary, J.H. Van de Sande, V. Sgaramella, H. [23] M.P. Weiner, G.L. Costa, W. Schoettlin, J. Cline, E. Mathur, J.C. Bauer, Site- Weber, T. Yamada, Total synthesis of the gene for an alanine transfer directed mutagenesis of double-stranded DNA by the polymerase chain ribonucleic acid from yeast, Nature 227 (1970) 27–34. reaction, Gene 151 (1994) 119–123. [7] H.L. Heyneker, J. Shine, H.M. Goodman, H.W. Boyer, J. Rosenberg, R.E. [24] J. Sambrook, E.F. Fritsch, T. Maniatis (Eds.), Molecular Cloning: A Laboratory Dickerson, S.A. Narang, K. Itakura, S. Lin, A.D. Riggs, Synthetic lac operator Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989. DNA is functional in vivo, Nature 263 (1976) 748–752. [25] L. Zheng, U. Baumann, J.L. Reymond, An efficient one-step site-directed and [8] K. Itakura, T. Hirose, R. Crea, A.D. Riggs, H.L. Heyneker, F. Bolivar, H.W. Boyer, site-saturation mutagenesis protocol, Nucleic Acids Res. 32 (2004) e115. Expression in Escherichia coli of a chemically synthesized gene for the hormone [26] S.M. Frisch, J.S. Mymryk, Adenovirus-5 E1A: paradox and paradigm, Nat. Rev. somatostatin, Science 198 (1977) 1056–1063. Mol. Cell Biol. 3 (2002) 441–452. [9] H.O. Smith, C.A. Hutchison 3rd, C. Pfannkoch, J.C. Venter, Generating a [27] E.M. LeProust, B.J. Peck, K. Spirin, H.B. McCuen, B. Moore, E. Namsaraev, M.H. synthetic genome by whole genome assembly: PhiX174 bacteriophage from Caruthers, Synthesis of high-quality libraries of long (150mer) synthetic oligonucleotides, Proc. Natl Acad. Sci. USA 100 (2003) 15440–15445. oligonucleotides by a novel depurination controlled process, Nucleic Acids [10] A.S. Xiong, Q.H. Yao, R.H. Peng, X. Li, H.Q. Fan, Z.M. Cheng, Y. Li, A simple rapid Res. 38 (2010) 2522–2540. high-fidelity and cost-effective PCR-based two-step DNA synthesis method for [28] K. Jayaraman, S.A. Fingar, J. Shah, J. Fyles, Polymerase chain reaction-mediated long gene sequences, Nucleic Acids Res. 32 (2004) e98. gene synthesis: Synthesis of a gene coding for isozyme c of horseradish [11] L. Young, Q. Dong, Two-step total gene synthesis method, Nucleic Acids Res. 32 peroxidase, Proc. Natl Acad. Sci. USA 88 (1991) 4084–4088. (2004) e59. [29] D.M. Hoover, J. Lubkowski, DNAWorks: an automated method for designing [12] W. Mandecki, T.J. Bolling, FokI method of gene synthesis, Gene 68 (1988) 101– oligonucleotides for PCR-based gene synthesis, Nucleic Acids Res. 30 (2002) 107. e43. [13] W.P. Stemmer, A. Crameri, K.D. Ha, T.M. Brennan, H.L. Heyneker, Single-step [30] X.S. Chen, T. Stehle, S.C. Harrison, Interaction of polyomavirus internal protein assembly of a gene and entire plasmid from large numbers of VP2 with the major capsid protein VP1 and implications for participation of oligodeoxyribonucleotides, Gene 164 (1995) 49–53. VP2 in viral entry, EMBO J. 17 (1998) 3233–3240. [14] G.S. Sandhu, R.A. Aleff, B.C. Kline, Dual asymmetric PCR: one-step construction of synthetic genes, BioTechniques 12 (1992) 14–16.