Exploring the Roles of KAT2A and KAT2B in Keratinocyte Biology

A thesis submitted to the University of Manchester for the degree of Doctor of Philosophy in the Faculty of Biology, Medicine and Health.

School of Medical Sciences

2019

Benjamin W. Walters 2

LIST OF CONTENTS

LIST OF FIGURES ...... 7

LIST OF TABLES ...... 11

LIST OF ABBREVIATIONS ...... 12

ABSTRACT ...... 15

DECLARATION ...... 16

ACKNOWLEDGMENTS ...... 17

CHAPTER 1 - INTRODUCTION

1.1 Human Skin Anatomy and Physiology...... 19

1.1.1 The Subcutaneous Tissue ...... 19

1.1.2 The Dermis ...... 19

1.1.3 The Epidermal-Dermal Junction ...... 20

1.1.4 The Epidermis ...... 20

1.1.4.1 The Basal Layer ...... 20

1.1.4.2 The Spinous Layer ...... 21

1.1.4.3 The Granular Layer ...... 22

1.1.4.4 The Stratum Corneum ...... 22

1.2 In Vitro Systems of Epidermal Homeostasis ...... 23

1.2.1 Propagation of Primary Keratinocytes Using a Feeder Layer ...... 23

1.2.2 Propagation of Keratinocytes in Serum-free Media without a Feeder Layer ...... 24

1.2.3 Generation of Immortalised Keratinocytes ...... 24

1.2.4 Clonal Types of Cultured Keratinocytes ...... 25

1.2.5 Differentiation of Keratinocytes in Conventional Cultures ...... 25

1.3 Molecular Control of Epidermal Differentiation...... 26

1.3.1 Maintenance of Keratinocyte Stemness ...... 26

1.3.2 Regulation of the Basal to Spinous Cell Switch ...... 29

1.3.3 Molecular Drivers of Late Epidermal Differentiation ...... 29

1.4 Chromatin: Modifiers, Modifications, and Gene Regulation ...... 33 3

1.4.1 Nucleosome Structure and Function ...... 33

1.4.2 Histone Modifications Regulate Gene Expression...... 34

1.4.3 Histone Acetylation: A Mark of Transcriptional Activation ...... 35

1.4.4 Histone Acetyltransferases: Classification, Structure and Function ...... 36

1.4.4.1 The MYST Family ...... 36

1.4.4.2 The p300/CBP Family ...... 38

1.4.4.3 The GNAT Family ...... 40

1.4.5 STAGA and Related Complexes in Humans ...... 43

1.5 KAT2A and KAT2B in Stemness and Differentiation ...... 47

1.5.1 KAT2A and KAT2B Developmental Expression Patterns ...... 47

1.5.2 Developmental Roles of KAT2A and KAT2B...... 47

1.5.3 KAT2A and KAT2B in the Regulation of the Cell Cycle ...... 48

1.5.4 KAT2A as a Regulator of Stemness ...... 49

1.5.5 KAT2A as a Regulator of Cellular Differentiation ...... 50

1.5.6 KAT2B as a Regulator of Cellular Differentiation ...... 51

1.5.7 Concluding Remarks ...... 52

1.6 Hypothesis and Aims ...... 53

CHAPTER 2 - MATERIALS AND METHODS

2.1 Cell Culture ...... 54

2.1.1 Conditions for Maintaining Cell Cultures ...... 54

2.1.2 Differentiation of Keratinocyte Cultures ...... 55

2.1.3 Short Hairpin RNA (shRNA) Expression Constructs...... 56

2.1.4 Generation of KAT2A Expression Constructs ...... 57

2.1.5 Lentiviral Production and Transduction ...... 59

2.2 Proliferation Assays ...... 60

2.2.1 Trypan Blue Cell Counting Assay ...... 60

2.2.2 MTT Cell Proliferation Assay ...... 60

2.2.3 Cell Confluency Assay ...... 60

2.3 Gene Expression Analysis ...... 61 4

2.3.1 RNA Extraction ...... 61

2.3.2 cDNA Synthesis (Reverse Transcription) ...... 61

2.3.3 Quantitative-PCR ...... 62

2.3.4 RNA-seq Library Preparation and Resulting Sequencing Data Analysis ...... 65

2.3.5 Polysome Profiling ...... 65

2.3.6 RNAscope® In Situ Hybridization ...... 66

2.4 Analysis of Relative Levels and Subcellular Localisation of Proteins ...... 67

2.4.1 Whole Cell Protein Extraction ...... 67

2.4.2 Subcellular Fractionation for Protein Analysis ...... 68

2.4.3 SDS PAGE and Western Blotting ...... 68

2.4.4 Immunofluorescence-labelling in Cultured Cells and Tissues ...... 71

CHAPTER 3 - DYNAMICS IN GLOBAL HISTONE H3 MODIFICATIONS AND A SWITCH IN KAT2A AND KAT2B EXPRESSION ARE HALLMARKS OF DIFFERENTIATING KERATINOCYTES

3.1 Introduction ...... 73

3.1 Calcium-induced differentiation of keratinocyte monolayers mirrors in vivo epidermal homeostasis...... 74

3.2 Global levels of key histone acetylation modifications are reduced upon differentiation of immortalised keratinocytes...... 82

3.3 KAT2A and KAT2B are Inversely Expressed in Differentiating Keratinocytes In Vitro ...... 86

3.4 KAT2A and KAT2B are Inversely Expressed in Differentiating Keratinocytes In Vitro ...... 89

3.5 KAT2A and KAT2B are Inversely Expressed in the Adult Human Epidermis ...... 91

3.6 KAT2A and KAT2B are Inversely Expressed in the Developing Mouse Epidermis ...... 94

CHAPTER 4 - KAT2A FUNCTIONS IN UNDIFFERENTIATED KERATINOCYTES TO MAINTAIN STEMNESS FEATURES WHILST KAT2B PRIMARILY FUNCTIONS IN CALCIUM TREATED CELLS TO DRIVE DIFFERENTIATION

4.1 Introduction ...... 96

4.2 shRNA-mediated Knockdown Effectively Depletes KAT2A and KAT2B in Keratinocytes .... 97

4.3 KAT2A Depletion Negatively Impacts Proliferation of Primary Keratinocytes ...... 104

4.4 Immortalised Keratinocytes Cluster Upon Knockdown of KAT2A ...... 107 5

4.4.1 Characterisation of Morphological Changes in Keratinocytes Depleted for KAT2A and/or KAT2B ...... 107

4.4.2 Characterisation of Cell Adhesion Upon Loss of KAT2 and/or KAT2B ...... 110

4.4.3 KAT2A and KAT2B Knockdown Differentially Affects Vimentin Expression in Keratinocytes ...... 113

4.4.4 KAT2A Regulates Matrix Metalloproteinase Expression in Proliferative Keratinocytes 114

4.5 KAT2A Knockdown Triggers Premature Expression of Differentiation Markers in Proliferative Keratinocytes ...... 117

4.6 KAT2A and KAT2B Depletion Oppositely Impacts Keratinocyte Differentiation In Vitro ....121

4.6.1 Morphologies of Differentiated Keratinocytes Depleted for KAT2A and/or KAT2B ..... 122

4.6.2 Knockdown of KAT2A and/or KAT2B Alters the Kinetics of Differentiation Gene Expression upon Induction ...... 125

CHAPTER 5 - TRANSCRIPTOME PROFILING REVEALS DISTINCT REGULATORY ROLES FOR KAT2A AND KAT2B IN KERATINOCYTE DIFFERENTIATION

5.1 Introduction ...... 132

5.2 Quantitative Expression Analysis of HATs in Undifferentiated and Differentiated Keratinocytes ...... 134

5.3 Establishing Sample Variance and Relatedness ...... 136

5.4 Differential Gene Expression Analysis of KAT2A and/or KAT2B Depleted Keratinocytes ...139

5.5 Gene Ontology Analysis ...... 142

5.6 Gene Set Enrichment Analysis ...... 145

5.7 qPCR Validation of Gene Candidates Detected in the RNA-seq Analysis ...... 149

CHAPTER 6 - KAT2A FUNCTIONS PRIMARILY THROUGH ITS HAT ACTIVITY AND N-TERMINUS DOMAIN IN PROLIFERATIVE KERATINOCYTES TO REPRESS THE TERMINAL DIFFERENTIATION PROGRAM

6.1 Introduction ...... 153

6.1 Validation of Recombinant KAT2A Proteins for Functional Domain Analysis ...... 155

6.2 KAT2A Promotes Normal Growth Morphology of Proliferative Keratinocytes via its HAT and N-terminus Domain...... 158

6.3 KAT2A Represses the Keratinocyte Differentiation Gene Expression Program Primarily via a HAT-mediated Mechanism ...... 166

6.4 The Functional Contributions of KAT2A Domains for the Expression of KAT2B...... 171 6

6.5 KAT2A Functions to Maintain High Levels of H3K9ac in Undifferentiated Keratinocytes ...173

6.5.1 KAT2A and KAT2B are Predominantly Nuclear in Keratinocytes ...... 173

6.5.2 KAT2A, but not KAT2B, Specifically Acetylates H3K9 in Immortalised Keratinocytes 175

CHAPTER 7 - DISCUSSION

7.1 Summary of Key Results ...... 181

7.2 Global Histone H3 Modification Dynamics during Keratinocyte Differentiation ...... 182

7.3 KAT2A and KAT2B Expression Patterns during Keratinocyte Differentiation ...... 184

7.4 KAT2A as a Negative Regulator of Terminal Keratinocyte Differentiation ...... 186

7.4.1 KAT2A may Function to Sustain Self-Renewal of Rrimary Keratinocytes ...... 186

7.4.2 Clustering of shKAT2A-N/TERT-1 cells may Reflect a Transition to a Primed State .... 188

7.4.2.1 KAT2A may Modulate the Development of Adhesion Junctions...... 189

7.4.2.2 KAT2A may Modulate Keratinocyte Migration by Regulating Vimentin Expression ...... 189

7.4.2.3 KAT2A may Modulate Keratinocyte-ECM Interactions by Upregulating MMPs ....190

7.4.3 KAT2A Functions to Restrain the Differentiation Gene Expression Program ...... 191

7.4.3.1 KAT2A may Regulate Differentiation Gene Expression via Histone PTMs ...... 192

7.4.3.2 KAT2A may Regulate Differentiation Gene Expression via Non-histone Substrates ...... 193

7.5 KAT2B Promotes Late Keratinocyte Differentiation ...... 195

7.6 GRHL1 and POU2F3 as Master Regulators of Late Keratinocyte Differentiation ...... 197

7.7 KAT2A-depleted Phenotypes Dominate over KAT2B-depleted Phenotypes ...... 198

7.7 KAT2A and KAT2B Redundantly Regulate Innate Antiviral immunity ...... 199

CHAPTER 8 - CONCLUSIONS AND FUTURE DIRECTIONS …….……………...….....201

SUPPLEMENTARY MATERIAL ...... 206

REFERENCES ...... 208

Word count (main text): 53 717

LIST OF FIGURES

1.1 The structure of human epidermis 23 1.2 Key markers and molecular regulators of epidermal homeostasis 32 1.3 DNA is packaged into nucleosomes - the fundamental repeating units of 34 chromatin 1.4 Sequence relationship tree and domain organisation of the human nuclear 42 HAT enzymes 1.5 Modules and subunit composition of STAGA and ATAC in human 46 2.1 Components of the pLenti-Zip lentiviral vector 56 2.2 Circular map of plasmid vector pLenti-FLAG KAT2A-P2A-BSD used for 58 cloning KAT2A expression constructs 3.1 A schematic representation of the keratinocyte differentiation culture system 75 workflow timeline 3.2 Calcium-induced differentiation of keratinocyte monolayers recapitulates 76 cellular morphologies observed in vivo 3.3 Keratinocyte monolayers stratify in medium containing 1.8mM calcium ions 77 3.4 Keratinocyte monolayers treated with 1.8mM calcium ion levels express 78 keratin 10 and filaggrin 3.5 Keratinocyte monolayers treated with 1.8mM calcium ion levels express 79 keratin 10 and loricrin 3.6 Keratinocyte monolayers treated with 1.8mM calcium ion levels display gene 81 expression profiles akin to in vivo epidermal homeostasis 3.7 Global levels of histone modifications associated with gene activation are 84 reduced upon differentiation of immortalised keratinocytes 3.8 Global H3K9ac levels are depleted upon differentiation of immortalised 85 keratinocytes 3.9 KAT2A and KAT2B are inversely expressed in cultured keratinocytes induced 88 to differentiate 3.10 Inverse protein expression of KAT2A and KAT2B upon differentiation of 90 keratinocyte cultures

LIST OF FIGURES – continued from previous page

3.11 Differential expression of KAT2A and KAT2B in basal vs suprabasal cells of 92 adult human epidermis 3.12 Protein expression of KAT2A is limited to the basal and spinous cells of adult 93 human epidermis 3.13 Differential expression of KAT2A and KAT2B in basal vs suprabasal cells of 95 developing mouse epidermis 4.1 shKAT2A#1/shKAT2B#1 depletes KAT2A/KAT2B in immortalised 100 keratinocytes 4.2 shKAT2A#2/shKAT2B#2 depletes KAT2A/KAT2B in immortalised 101 keratinocytes 4.3 shKAT2A#1/shKAT2B#1 depletes KAT2A/KAT2B in primary 102 keratinocytes 4.4 KAT2B transcripts are highly translated and the protein is not readily 103 subjected to proteasome degradation in immortalised keratinocytes 4.5 Proliferation rates of immortalised keratinocytes are unaffected by KAT2A 105 or KAT2B depletion 4.6 KAT2A depletion triggers premature senescence and delayed proliferation in 106 primary keratinocytes 4.7 Clustering of proliferative immortalised keratinocytes expressing 108 shKAT2A#1 4.8 Clustering of proliferative immortalised keratinocytes expressing 109 shKAT2A#2 4.9 KAT2A depletion in proliferative immortalised keratinocytes selectively 112 upregulates cell-cell adhesion molecules 4.10 KAT2A and KAT2B knockdown differentially affects vimentin expression 114 in keratinocytes 4.11 Matrix metalloproteinase expression is deregulated upon knockdown of 116 KAT2A in proliferative immortalised keratinocytes 4.12 shKAT2A#1 expression in subconfluent immortalised and primary 118 keratinocytes upregulates differentiation genes 4.13 shKAT2A#2 expression in proliferative immortalised keratinocytes 119 upregulates differentiation genes

LIST OF FIGURES – continued from previous page

4.14 KAT2A depletion triggers premature expression of differentiation markers at 120 the protein level in proliferative keratinocytes 4.15 Immortalised keratinocytes depleted for KAT2A display more stacks of 123 cornified cells when induced to differentiate 4.16 KAT2B depletion in primary keratinocytes delays the onset of morphological 124 changes characteristic of differentiation 4.17 KAT2A and/or KAT2B-depletion alters differentiation gene kinetics in 127 immortalised keratinocytes 4.18 The induction of FLG expression is compromised by shKAT2B#2 in 128 N/TERT-1 cells and shKAT2B#1 in NHEK-Neo cells 4.19 shKAT2A#1 and shKAT2B#1 differentially affects protein expression of 130 early and late differentiation markers in differentiating immortalised keratinocytes 4.20 Protein expression of late differentiation markers is negatively affected by 131 shKAT2B#2 in immortalised keratinocytes 5.1 KAT2A is preferentially expressed over KAT2B in undifferentiated 135 keratinocytes 5.2 Global transcriptional variance between biological replicates subjected to 137 RNA-seq analysis is minimal 5.3 Gene expression heatmap showing clustering of differentiation-associated 138 genes in immortalised keratinocytes depleted for KAT2A and/or KAT2B at subconfluency, confluency, and day 4 of differentiation 5.4 The number and commonality of differentially expressed genes in 141 undifferentiated and differentiated N/TERT-1 cells depleted for KAT2A and/or KAT2B 5.5 Functional classification of differentially expressed genes in undifferentiated 144 and differentiated N/TERT-1 cells depleted for KAT2A and/or KAT2B relative to shScr control cells 5.6 GSEA in proliferative and/or differentiated N/TERT-1 cells depleted for 147 KAT2A and/or KAT2B 5.7 qPCR analysis confirms deregulation of genes associated with cornification 150 in immortalised keratinocytes depleted for KAT2A and/or KAT2B

LIST OF FIGURES – continued from previous page

5.8 Genes associated with cornification are deregulated in immortalised 152 keratinocytes expressing shKAT2A#2 or shKAT2B#2 5.9 Genes associated with cornification are deregulated in primary keratinocytes 152 depleted for KAT2A or KAT2B 6.1 Schematic depicting the mutant KAT2A constructs generated for functional 155 domain analysis experiments 6.2 Mutant KAT2A constructs express stable nuclear proteins at the correct 157 molecular weights 6.3 The HAT activity and N-terminus of KAT2A are indispensable for reversing 159 the clustering phenotype associated with KAT2A depletion in proliferative immortalised keratinocytes 6.4 The HAT activity of KAT2A is important for regulating the expression of 161 several cell-cell adhesion genes in proliferative immortalised keratinocytes 6.5 The HAT activity and N-terminus of KAT2A are indispensable for regulating 163 vimentin expression in proliferative immortalised keratinocytes 6.6 The HAT activity of KAT2A is indispensable for it to repress ECM-related 165 genes in proliferative immortalised keratinocytes whilst the bromodomain and N-terminus enhance this function 6.7 The HAT activity of KAT2A is indispensable for it to repress differentiation 167 gene expression in proliferative immortalised keratinocytes whilst the bromodomain and N-terminus enhance this function 6.8 The HAT activity of KAT2A is indispensable for it to repress the protein 168 expression of differentiation markers in proliferative immortalised keratinocytes 6.9 Expression of FL-KAT2A in KAT2A-depleted cells restores the frequency 170 of cornified cell stacks to that in control cells 6.10 The HAT activity of KAT2A is indispensable for limiting KAT2B expression 172 in proliferative immortalised keratinocytes 6.11 KAT2A and KAT2B are localised in the nucleus prior to- and over the course 174 of differentiation in immortalised keratinocytes 6.12 KAT2A specifically acetylates H3K9 in proliferative immortalised 176 keratinocytes

LIST OF FIGURES – continued from previous page

6.13 Immunofluorescence staining of H3K9ac is reduced in proliferative 177 immortalised keratinocytes depleted for KAT2A 6.14 The bromodomain and N-terminus of KAT2A is dispensable for acetylating 178 H3K9 in keratinocytes 6.15 Assessment of the global levels of histone acetylation modifications in 180 proliferative primary keratinocytes depleted for KAT2A or KAT2B 7.1 Proposed model for the roles of KAT2A and KAT2B in keratinocyte 205 differentiation S.1 Antibody ab4441 is highly specific against histone H3 (acetyl K9) 206 S.2 Anti-KAT2A and anti-KAT2B do not cross react with KAT2B or KAT2A, 207 respectively

LIST OF TABLES

1.1 Components of the human protein complexes containing KAT2A/KAT2B 44

2.1 Media formulations for in vitro differentiation of N/TERT-1 and NHEK-Neo 55 keratinocytes 2.2 shScrambled, shKAT2A, and shKAT2B shRNA sequences 56 2.3 Primers used for cloning KAT2A expression constructs 58 2.4 Reaction components for cDNA synthesis 62 2.5 Cycling conditions for cDNA synthesis 62 2.6 Reaction mixture for qPCR 63 2.7 Sequence of forward (F) and reverse (R) primers used for qPCR 63 2.8 qPCR thermal profile 65 2.9 RIPA buffer volumes used for protein extraction of cultured keratinocytes 67 2.10 Primary antibodies used for Western blotting 69 2.11 Horseradish peroxidase-conjugated antibodies used for Western blotting 70 2.12 Primary antibodies used for immunofluorescence staining 71 5.1 GSEA leading edge genes in the “Epidermis development” gene set identified 149 in all three of the shKAT2A (subconfluent), shKAT2A/B (subconfluent) and shKAT2B (D4 differentiated) gene expression profiles 12

LIST OF ABBREVIATIONS

°C Degrees Celsius A Adenine Acetyl-CoA Acetyl-coenzyme A AP Activating protein BPE Bovine pituitary extract C/EBP CCAAT/enhancer binding protein CBX4 Chromobox homolog 4 CDK Cyclin-dependent kinase cDNA Complementary DNA CDS Coding sequence CH Cysteine/histidine ChIP Chromatin immunoprecipitation CREB cAMP response element-binding protein Ct Cycle threshold CYPA Cyclophilin A DAPI 4′,6-diamidino-2-phenylindole DMEM Dulbecco’s modified eagle media DSG Desmoglein E Embryonic day E1A Adenovirus early region 1A EB Embryoid body ECM Extracellular matrix EDC Epidermal differentiation complex EGF Epidermal growth factor EPU Epidermal proliferative unit ESCs Embryonic stem cells FBS Foetal bovine serum FDR False discovery rate FL Full-length G Guanine GCN5 General control nonrepressed-protein 5 GNAT GCN5-related N-acetyltransferase

LIST OF ABBREVIATIONS - continued from previous page

GO Gene ontology GSEA Gene set enrichment analysis HAT Histone acetyltransferase HDAC Histone deacetylase hEF1-alpha Human elongation factor-1 alpha HES1 Hairy and enhance of split-1 HLB Hypotonic lysis buffer Hrs Hours iASPP Inhibitor of apoptosis-stimulating proteins of p53 IF Immunofluorescence IFE Interfollicular epidermal IFN Interferon K Lysine KAT2A Lysine acetyltransferase 2A KAT2B Lysine acetyltransferase 2B KGM Keratinocyte growth medium KLF4 Kruppel-like factor 4 KRT Keratin KSFM Keratinocyte serum-free medium LCE Late cornified envelope mCMV Mouse cytomegalovirus MEF Mouse embryonic fibroblast MyoD Myoblast determination protein 1 NES Normalised enrichment score NF-κB Nuclear factor kappa B NHEK Neonatal normal human epidermal keratinocytes No. Number NTERT Human telomerase-immortalised newborn epidermal OCT Optimal cutting temperature compound PBS Phosphate buffered saline PCAF p300/CBP-associated factor

LIST OF ABBREVIATIONS - continued from previous page

PCR Polymerase chain reaction PI3K Phosphoinositide 3-kinase PKC Protein kinase C PolyA Polyadenylation PRC Polycomb repressive complex PTEN Phosphatase and tensin homolog PTM Post-translational modification qPCR Quantitative polymerase chain reaction R Arginine Rb Retinoblastoma protein RNAPII RNA polymerase II RNA-seq RNA-sequencing RPKM Reads per kilobase of exon model per million mapped reads RPL13A 60S ribosomal protein L13A ribosomal protein RT Room temperature RUNX2 Runt-related gene 2 s.d. Standard deviation SDS Sodium dodecyl sulphate SGF29 SAGA-associated factor 29 sh Short hairpin SPRR Small proline-rich region STAGA SPT3-TAF9-GCN5 acetyltransferase SWI/SNF SWItch/sucrose non-fermentable TAF TBP-associated factor TBK1 TANK-binding kinase 1 TBST Tris-buffered saline with 0.1% Tween-20 TBX5 T-box transcription factor 5 TGF Transforming growth factor TGM Transglutaminase Th CD4+ helper T cells UVR Ultraviolet radiation WT Wild type 15

ABSTRACT

The University of Manchester Benjamin W. Walters Doctor of Philosophy Exploring the Roles of KAT2A and KAT2B in Keratinocyte Biology

Reprogramming of gene expression by post-translational modification of chromatin is a hallmark of cellular differentiation. In particular, histone acetylation states in the cell, which are determined by a balance in the activities of histone acetyltransferases (HATs) and histone deacetylases, reflect the highly dynamic control of transcriptional activation and repression. In this study, I characterized the functions of two highly-related HAT paralogues, lysine acetyltransferase 2A (KAT2A) and lysine acetyltransferase 2B (KAT2B), in regulating the proliferation and differentiation of human keratinocytes. I found that keratinocytes switch from high KAT2A and low KAT2B expression under self-renewing conditions, to low KAT2A and high KAT2B expression upon cellular differentiation. In proliferative keratinocytes, depletion of KAT2A triggered changes in cell morphology, colony clustering, perturbation of cell trajectories, and led to premature expression of early and late differentiation markers in the absence of initiating signals. By contrast, KAT2B loss did not have a significant impact on the biology of proliferative keratinocytes. The effects of KAT2A depletion in self-renewing keratinocytes coincided with a specific and extensive loss of global H3K9ac levels, a histone modification known to affect transcriptional elongation. In addition, I found that the function of KAT2A in proliferating keratinocytes is wholly dependent on its acetyltransferase activity as I was able to rescue the aberrant culture morphology and premature differentiation of KAT2A-depleted cells with the expression of full-length KAT2A but not with an acetyltransferase-dead mutant isoform. On induction of differentiation, KAT2A-deficient cells differentiated rapidly in response to initial signals whilst KAT2B-depleted keratinocytes exhibited delayed differentiation morphology and decreased expression of mid-to late differentiation markers. Taken together, my results indicate that KAT2A functions primarily to support the maintenance of keratinocyte stemness, whilst KAT2B acts to promote cellular differentiation. These findings revealed a distinctive gene regulatory mechanism in which keratinocytes utilise a pair of highly homologous HATs to support divergent functions in stem cell self-renewal and differentiation. 16

DECLARATION

No portion of the work referred to in this thesis has been submitted in support of an application for another degree or qualification of this or any other university or other institute of learning.

COPYRIGHT STATEMENT i. The author of this thesis (including any appendices and/or schedules to this thesis) owns certain copyright or related rights in it (the “Copyright”) and s/he has given The University of Manchester certain rights to use such Copyright, including for administrative purposes. ii. Copies of this thesis, either in full or in extracts and whether in hard or electronic copy, may be made only in accordance with the Copyright, Designs and Patents Act 1988 (as amended) and regulations issued under it or, where appropriate, in accordance with licensing agreements which the University has from time to time. This page must form part of any such copies made. iii. The ownership of certain Copyright, patents, designs, trademarks and other intellectual property (the “Intellectual Property”) and any reproductions of copyright works in the thesis, for example graphs and tables (“Reproductions”), which may be described in this thesis, may not be owned by the author and may be owned by third parties. Such Intellectual Property and Reproductions cannot and must not be made available for use without the prior written permission of the owner(s) of the relevant Intellectual Property and/or Reproductions. iv. Further information on the conditions under which disclosure, publication and commercialisation of this thesis, the Copyright and any Intellectual Property and/or Reproductions described in it may take place is available in the University IP Policy (see http://documents.manchester.ac.uk/DocuInfo.aspx?DocID=24420), in any relevant Thesis restriction declarations deposited in the University Library, The University Library’s regulations (see http://www.library.manchester.ac.uk/about/regulations/) and in The University’s policy on Presentation of Theses

ACKNOWLEDGMENTS

First and foremost, I would like to sincerely thank my Ph.D. supervisor, Doctor Chin Yan Lim, for providing this opportunity and for her invaluable direction throughout this project. Special thanks to Doctor Leah Vardy and Doctor Ray Dunn for their insights and specific knowledge of this research area. I would also like to extend my gratitude to Doctor Matthew Ronshaugen and Doctor Kimberly Mace for all their support and positivity during my time in Manchester. I would like to thank The University of Manchester and The Agency for Science, Technology and Research, Singapore for their funding of this project, and Professor Christoph Ballestrem and Jessica Bowler for their tireless work in organising this Ph.D. programme.

To the present and past members of the “Epithelial Epigenetics and Development Lab” also known as “The CYL lab”, I would like to express my huge appreciation for all their scientific help and advice, particularly to Yasmin, Shakthee and Rifkhana. An enormous thank you to Marcus Lee for his impressive technical support throughout this project and his positive energy especially during the trickier times. My thanks also extend to all members of the Leah Vardy and Ray Dunn labs, particularly to Anisa, Shatarupa, and Vonny. I would also like to thank IMB-Microscopy Unit for their excellent suite of microscopes and wonderful services. From the Manchester side, I would like to thank Matthew Smith, Rachel Crompton, Charis Saville, and Anna Bornikoel for their support during my first year of study.

A big thank you to all my fellow students of the Manchester-Singapore research attachment programme, especially Richard, Stephen, Francesca, Will Ambler, Will Webb, Elizabeth, Anne, Tom, Pepe, Cam, Marilyne, Sean, Johanna, and Helena. Special thanks to Matt Cook for his remarkable musical accompaniment during the production of “Songs of an Ang Mo - Volume I” and for being an excellent kaya butter toast breakfast buddy. My dearest John, words cannot thank you enough for our deep intellectual conversations about things that are totally meaningless. I would also like to give a big thanks to Ebru for being an invaluable source of support and silliness during the unsilliest of times.

Finally, I would like to thank my parents for their endless support in every away.

CHAPTER 1 – INTRODUCTION

The rates of physiological cell turnover vary greatly between the different tissues and organs of the adult human body and positively correlate with their regenerative capacities. For instance, whilst neurogenesis and regeneration in most of the adult central nervous system is considered a rare and slow event (Spalding et al., 2005; Williams, 2014), epidermal turnover is typically completed every 36 days (Maeda, 2017; Weinstein et al., 1984), and cutaneous wound healing is relatively rapid and effective. Such inequalities have largely been attributed to differences in the relative abundance of resident stem cells between tissues and in their propensity to give rise to tissue-specific progenitors (Ahmed et al., 2017; Zhao et al., 2016). Normal tissue homeostasis of highly regenerative tissues relies on a delicate balance between stem cell self-renewal and differentiation. Resident stem cells must maintain their tissue-specific identity and avoid precocious differentiation whilst also being able to respond appropriately to activation signals. Disturbances of this balance can impair normal tissue/organ function or render them susceptible to carcinogenesis or degeneration (Dhawan and Laxman, 2015). Our understanding of the molecular components that regulate self-renewal and differentiation of adult stem cells is in its infancy (Biteau et al., 2011). Much research has focused on implicating extrinsic signalling pathways derived from the stem cell niche, and there is less insight into the roles intrinsic pathways play in regulating adult stem cell fate decisions (Chen et al., 2016).

Post-translational modification (PTM) of histones is a mechanism that integrates intrinsic and extrinsic signals to establish gene expression programs and therefore could play a fundamental role in maintaining those underpinning stemness. Indeed, research in the past decade collectively emphasise the importance of gene repression and derepression, through the writing and erasure of histone methylation at transcription start sites, in regulating stem cell fate decisions (Li et al., 2017; Tarayrah and Chen, 2013). Although there are several reports implicating histone deacetylation in this context, there is little research into the role that histone acetylation could play despite being an important modification linked to gene activation (Avgustinova and Benitah, 2016). The roles of histone acetylation in epidermal homeostasis are particularly ill-defined despite being an attractive setting to study such epigenetic mechanisms that govern adult stem cell fate and differentiation. This is mainly because of its rich source of adult stem cells that follow a well characterised path of differentiation which is also reproducible in vitro. Over the past decade, researchers have uncovered critical functions for histone methylation and histone deacetylation in epidermal 19 development and homeostasis but have again neglected histone acetylation as a mechanistic candidate for these processes. To address this paucity of research, the “Epithelial Epigenetics and Development Lab” headed by Doctor Chin Yan Lim at the Skin Research Institute of Singapore performed an immunofluorescence (IF) screen and showed that global histone acetylation modifications are highly dynamic between epidermal layers of undifferentiated and differentiated keratinocytes, suggestive of histone acetylation-based mechanisms for restricting and driving the differentiation of epidermal stem cells. The work presented here builds upon this research to identify and characterise the functions of histone acetyltransferases (HATs) that regulate epidermal cell self-renewal and differentiation.

1.1 Human Skin Anatomy and Physiology

The skin is a multifunctional organ that serves as the primary barrier of the body against external chemical, physical, and biological insults, in addition to controlling heat and water flow, transmitting sensory stimuli, and acting as a site of hormone and vitamin synthesis (Kolarsick et al., 2011). The skin is divided into three main layers: the subcutaneous tissue, the dermis - derived from the mesoderm, and the epidermis - derived from the ectoderm.

1.1.1 The Subcutaneous Tissue The subcutaneous tissue, the innermost layer, is composed of adipocytes divided into lobules by a network of fibrous septa that harbour small to medium-sized blood vessels, lymphatics, nerves, and collagen bundles that anchor the skin to the deep fascia (Rest, 1999). This layer was traditionally thought to simply provide buoyancy, insulation, a store of energy, and shock absorption, but in recent years it is also considered an endocrine organ in itself due to its ability to synthesise hormones such as estrone and leptin (Kershaw and Flier, 2004).

1.1.2 The Dermis The dermis sits atop of the subcutaneous tissues and is a loose connective tissue that comprises the bulk of the skin. It is principally composed of bundles of interwoven collagen and elastin fibres, which provide the skin with tensile strength and elasticity, respectively. These structural proteins are embedded in an amorphous ground substance and are all synthesised in high amounts by fibroblasts. Unlike keratinocytes, dermal fibroblasts do not undergo any obvious sequences of differentiation, but two subpopulations with different characteristics have been found to reside in distinct dermal sublayers: the reticular layer and the papillary layer (Sorrell, 2004). Although fibroblasts constitute most of the dermal cell population, other cells such as mast cells, mononuclear phagocytes, and lymphocytes reside in or transit through the dermis as part of immune surveillance and upon inflammation. Furthermore, several research groups have isolated multipotent stem cells (skin-derived 20 precursor cells) from human dermis biopsies (Budel and Djabali, 2017; Li et al., 2012), and one group has shown that these cells are localised specifically to a collagen type 5-rich niche in the papillary dermis (Hasebe et al., 2017), suggestive of mechanistic parallels with epidermal homeostasis. The rich vasculature of the dermis supports the epidermis above and the pilosebaceous units distributed throughout with nutrients.

1.1.3 The Epidermal-Dermal Junction The epidermal and dermal boundary undulates via interlocking upward (dermal papillae) and downward projections (rete ridges) of tissue to support cohesiveness. The interface between the epidermis and dermis is formed by a basement membrane that serves as an architectural link between the two tissues and as a semipermeable barrier for the exchange of chemical signals (McGrath et al., 2004). Keratin cytoskeletal networks of basal epidermal cells terminate at classical type I hemidesmosomes located at the basal intracellular face of the plasma membrane, which are in turn anchored to the basement membrane by clusters of transmembrane integrins with a high affinity for laminins (Stepp et al., 1990). These connections are further linked to anchoring fibrils which bridge the basement membrane with the underlying collagen fibrils of the papillary dermis (Behrens et al., 2012). Beyond tissue-level support, this connection has significant influence on keratinocyte behaviour by establishing cell polarity and direction of growth (Lee and Streuli, 2014).

1.1.4 The Epidermis The epidermis, the most superficial layer, is a stratified squamous epithelium predominantly populated by keratinocytes (80-85% of epidermal cells) that synthesise keratins (KRTs) which assemble to form the protective structural framework of the cell. Other cells that reside here include melanocytes (Westerhof, 2006 and references therein), Langerhans cells (Langerhans, 1868), and Merkel cells (Toyoshima et al., 1998) which serve as means of photoprotection, antigen presentation, and mechanoreception, respectively. The epidermis can be subdivided into four distinct layers corresponding to the degrees of keratinocyte differentiation as the cells transit towards the skin surface. From the innermost (least differentiated) to the outermost layer (most differentiated), they are as follows: the basal layer, the spinous layer, the granular layer, and the stratum corneum (Figure 1.1).

1.1.4.1 The Basal Layer The basal layer is comprised of proliferative columnar cells that adhere to one another via desmosomal junctions on their lateral membranes to form a single sheet of keratinocytes. Although the basal layer is considered the source of epidermal cell replenishment, there is still debate regarding whether all or just some of the cells in this layer are bona fide stem 21 cells. Pioneering histological studies in the early 1970s posited a hierarchical model in which the epidermis is organised into discrete epidermal proliferative units (EPU) each comprised of one slow-cycling cell that gives rise to rapidly cycling cell progeny capable of dividing several times before differentiating upwards (Mackenzie, 1970; Potten, 1974). Slow-cycling and rapid cycling were considered a characteristics of stem cells and transit amplifying cells, respectively (Kaur, 2006). These differences in cycling frequency have been exploited to visualise and confirm the existence of EPUs in mouse epidermis using DNA-label-retention assays (Bickenbach, 1981). More contemporary studies employing lineage-tracing and live cell imaging approaches instead support a more simplified stochastic model without regulated asymmetric divisions of slow-cycling cells (Lim et al., 2013; Rompolas et al., 2016). The Rompolas study, which circumvented the potential biases inherent in basal cell labelling used in earlier experiments, ultimately concludes that the basal layer exists as a population of equipotent stem cells, first proposed by the Jones group (Clayton et al., 2007).

1.1.4.2 The Spinous Layer Given certain cues, basal layer cells execute a coordinated program of terminal differentiation that begins with their exit from the cell cycle, detachment from the basement membrane, and migration into the spinous layer. As committed cells transit into this layer, their morphologies, gene expression profiles, and adhesion junctions undergo dramatic changes. The cells adopt polyhedral and slightly flattened morphologies and are larger in size with a more rounded nucleus compared to their basal cell counterparts. These changes are accompanied by an enrichment of desmosomal junctions between both basal cells and neighbouring spinous cells (McMillan et al., 2003). Cell-cell adhesiveness is amplified by the interlinking of these junctions with nascent KRT1 and KRT10 networks generated by a rapid induction in their transcription (Fuchs and Green, 1980). These robust filamentous networks contribute to the resistive properties of the epidermis to mechanical stress. Some markers of the basal layer are also lost. For instance, β1 integrins, which are largely confined to the basal layer, lose their affinity to extracellular matrix (ECM) ligands and their expression is gradually supressed as spinous cells stratify and disassociate with the basement membrane (Adams and Watt, 1990; Hotchin and Watt, 1992). Additionally, downregulation of KRT5 and KRT14 mRNA expression, a KRT pair thought to be exclusively localised to the basal layer, is considered an early event that marks the onset of keratinocyte differentiation (Lersch and Fuchs, 1988). Spinous cells become increasingly bigger and flatter as they continue to stack on top of one another to yield a layer of between 5-10 cells thick. Keratinocytes of the upper spinous layers begin to form lamellar granules, small membrane-bound organelles rich in hydrolytic enzymes, glycoproteins, glycolipids, and 22 phospholipids. This cargo is extruded into the intercellular space to serve as the precursors to the water impermeable lipid lamellae of the stratum corneum (Wertz, 2018).

1.1.4.3 The Granular Layer Upper spinous cells eventually transition into the granular layer so called because of its abundance of lamellar granules and large irregular basophilic granules of keratohyalin. Keratinocytes of the granular layer are considerably flatter than spinous cells and, depending upon the location of the body, form smaller stacks of 2-5 cell layers. As granular cells move into the stratum corneum they begin to adopt the form of a flattened squame as their keratin cytoskeleton collapses during keratinisation, a process where keratin filaments are aggregated by filaggrin peptides derived from the keratohyalin granules (Blanpain and Fuchs, 2009). Although still viable, granular cells do show some evidence of programmed cell death in the form of nuclear degeneration and organelle dissolution through the activity of lysosomal enzymes.

1.1.4.4 The Stratum Corneum The corneocyte, a protein-rich yet non-viable anucleated cell, represents the end product of terminal differentiation. 10-20 layers of corneocytes stack together embedded in a hydrophobic extracellular lipid matrix to form the stratum corneum. Here, cells undergo an abrupt process of cornification whereby the now vacant intracellular compartment is filled with a compact keratin cytoskeleton and the plasma membrane is replaced with a cornified cell envelope (Eckhart et al., 2013). The latter is formed from an amalgamation of involucrin, loricrin and small proline-rich (SPRRs) proteins that have been highly crosslinked by transglutaminases (TGMs) anchored at the cell periphery (Candi et al., 2005). Specialised adhesion junctions termed corneodesmosomes are integrated in the cornified envelope to permit corneocyte cohesion. They differ from their granular cell desmosome counterparts in that they are rendered static by enzymatic crosslinking and possess an additional glycoprotein component called corneodesmosin at the desmoglea (Haftek, 2015). Appropriate desquamation relies on a fine balance between levels of serine proteases, which degrade corneodesmosin, and their respective inhibitors (Kitajima, 2015). Together, these biochemical and structural changes ensure that the stratum corneum protects the epidermis from mechanical stress, bacterial invasion, and improper water flow. 23

Figure 1.1 The structure of human epidermis. Histological section of haematoxylin (dark purple, nuclei) and eosin (pink, cytoplasm) stained human abdominal skin highlighting the multiple layers of the epidermis. The basal layer comprises the keratinocyte stem cell populations. The degree of differentiation progressively increases as committed keratinocytes transit from the lower spinous layers to the stratum corneum. The papillary dermis is situated immediately below the epidermis. Adapted from: (Platzer, 2008).

1.2 In Vitro Systems of Epidermal Homeostasis

Over recent decades, monolayer keratinocyte cultures have proven to be an important tool for understanding the molecular mechanisms underpinning epidermal homeostasis. Two approaches in culturing keratinocytes are currently in use. One utilises a serum-containing medium and a feeder layer of cells, and the other relies on a serum-free media in the absence of a feeder layer (Tenchini et al., 1992).

1.2.1 Propagation of Primary Keratinocytes Using a Feeder Layer Prior to 1975, keratinocytes were notoriously difficult to serially culture in vitro, owing to a poor understanding of their nutritional requirements and a tendency for primary cultures to be outcompeted by fibroblasts. James Rheinwald and Howard Green overcame these difficulties when they established culture methods utilising serum-containing medium and a feeder layer of irradiated murine 3T3 fibroblasts (Rheinwald and Green, 1975a, 1975b). The success of this method relies both on the complex, and still poorly elucidated, interactions between 3T3 fibroblasts and keratinocytes, and on a high-nutrient medium derived from a mixture of Dulbecco's Modified Eagle Medium (DMEM, 75%) and Ham’s F12 nutrient mixture (25%). This media is supplemented with foetal bovine serum (FBS) and a cocktail 24 of additives including, epidermal growth factor (EGF), which enhances growth rate; cholera toxin, which increases intracellular levels of cyclic adenosine monophosphate (Green, 1978); and hormones, such as hydrocortisone, triiodothyronine and insulin, which further promote proliferation and stimulate stratification (Green et al., 1979). Primary keratinocytes are seeded at a clonal density in the presence of the feeder layer. As colonies grow, they displace the 3T3 fibroblasts until they fuse with neighbouring colonies to form a continuous multi-layered sheet of keratinocytes. At this point, primary keratinocytes can be further propagated up until the sixth passage after which proliferation rates significantly decrease and senescent cells begin to accumulate (Tenchini et al., 1992). This method of culture affords excellent keratinocyte growth in a relatively short period of time, and because of this it has been utilised extensively for clinical applications, including for the preparation of epithelial sheets for grafting. However, the feeder layer and the serum in the medium respectively represent contaminating and ill-defined factors that limit the utility of this technique for basic science research where conditions aim to be controlled and free from variability.

1.2.2 Propagation of Keratinocytes in Serum-free Media without a Feeder Layer The need for a completely defined keratinocyte culture system stimulated a series of investigations that eventually led to the formulation of a new basal media called MCDB 153 (Boyce and Ham, 1985, 1983). The composition of MCDB 153 differs from the basal media used in the feeder layer approach both qualitatively and quantitatively with respect to ions and nutrients and in the addition of a cocktail of trace elements. The composition of the supplements was also further modified from that used in the feeder layer basal media in order to support the growth of keratinocytes in serum-free conditions. Of relevance are the supplements: bovine pituitary extract (BPE), monoethanolamine, and phoethanolamine. Under these conditions, primary keratinocytes have a growth advantage over other cell types and can undergo five passages before the onset of senescence. Numerous commercial companies have since developed serum-free media based on MCDB153. The media used in this study for propagating primary keratinocytes is Lonza’s KGM™ Gold Keratinocyte Growth Medium. Overall, this method successfully removes the need of a feeder layer and the presence of serum whilst maintaining comparable growth rates with the approach described by Rheinwald and Green. Research studying the biological properties of keratinocytes favour this method to this day.

1.2.3 Generation of Immortalised Keratinocytes The limited replicative lifespan of primary keratinocytes renders them impractical for long- term study, particularly when the aim is to generate stable knockdown cell lines. This 25 limitation has been attributed to progressive telomere shortening that eventually triggers cellular senescence. To circumvent this process, The Rheinwald laboratory ectopically expressed the human telomerase reverse transcriptase catalytic unit, hTERT, in human primary neonatal foreskin keratinocytes. These cells lines underwent spontaneous deletions at the CDK2NA/INK4A locus to render them deficient in p16INK4A expression. The combination of these changes successfully immortalised primary keratinocytes without affecting other major growth control systems (Dickson et al., 2000). They are commonly referred to as N/TERT cells.

1.2.4 Clonal Types of Cultured Keratinocytes Cultured human keratinocytes are heterogenous in their capacity for growth. This is best evaluated by clonal analysis, whereby the progeny of a single founding cell is inoculated onto several indicator dishes, cultivated for 12 days, and then stained with Rhodamine B. Microscopic examination reveals three types of colonies with differing capacities of proliferation: holoclones, meroclones, and paraclones. Holoclones have characteristics of stem cells, including self-renewal ability, a high proliferative potential, and abundant expression of p63 (Pellegrini et al., 2001). Meroclones have properties of early transit amplifying cells, including a limited proliferative capacity without the ability to self-renew. Paraclones have characteristics of late transit amplifying cells, in that they have a short replicate life span, after which they terminally differentiate (Barrandon and Green, 1987).

1.2.5 Differentiation of Keratinocytes in Conventional Cultures The mammalian epidermis possesses a calcium gradient, with low calcium levels in the basal and lower spinous layers, and higher calcium levels in upper spinous and granular layers, before declining gradually in the stratum corneum (Elias et al., 2002). Calcium ions drive growth and differentiation of keratinocytes both in vivo and in vitro. They do so in part by promoting cell-cell adhesion through the formation of various calcium-dependent adhesion molecules, including desmosomes, adherens junctions, and tight junctions; and by modulating protein kinase C (PKC) activity. Keratinocytes are typically propagated at low calcium concentrations (0.3mM) in vitro to promote the formation of some cell-cell contacts to encourage growth and to limit differentiation. Subconfluent keratinocytes cluster within hours of switching to a media containing a high concentration of calcium ions (1.2-1.8mM). The duration that keratinocytes are exposed to this media correlates with their degree of differentiation in terms of morphology and their expression of early and late differentiation genes (Bikle et al., 2012). High cell density is another driving factor for keratinocyte differentiation in vitro. Confluent keratinocytes have higher mRNA levels of KRT1, filaggrin, and involucrin compared to subconfluent cultures. Experiments presented in this 26 dissertation induced keratinocyte differentiation by culturing immortalised and primary cultures to a high cell density followed by a switch to a medium containing 1.8mM calcium chloride. Recently, the kinetics and patterns of differentiation gene expression was compared between primary adult human keratinocytes derived from abdominal or breast skin and N/TERT-1 cells. It was found that N/TERT-1 cells express terminal differentiation genes at similar levels as primary keratinocytes albeit at an earlier timepoint following induction. Furthermore, N/TERT-1 cells are capable of forming three-dimensional human skin equivalents (organotypic skin models) that accurately recapitulate the morphologies and spatiotemporal differentiation gene expression patterns characteristic of stratified human epidermis (Smits et al., 2017).

1.3 Molecular Control of Epidermal Differentiation

Whilst biochemical and gene expression profiles across human epidermal differentiation are well characterised, the precise molecular regulators and signalling pathways that govern this process is less well understood. Insight has largely been garnered from mouse genetic experiments that highlight an important interplay between multiple signalling pathways and an array of transcription factors in the pioneering and late events of epidermal differentiation (Figure 1.2).

1.3.1 Maintenance of Keratinocyte Stemness An enduring view has been that adult stem cells adopt differentiation as a default fate if self- renewal is not maintained and if differentiation programs are not actively repressed (Song et al., 2004). A multitude of molecular regulators have been identified that maintain keratinocyte stem cells in a state of self-renewal to ensure that the epidermis is constantly regenerated throughout life.

The most pivotal experiments implicating a single transcription factor in the regulation of epidermal homeostasis came in back-to-back reports in 1999 describing a striking epithelial developmental defect in mice deleted for p63, a homolog of the p53 family (Mills et al., 1999; Yang et al., 1999). It was found that skin development of p63 knockout mice essentially ceased prior to the onset of epidermal stratification. Knockout of a splice variant of p63 that lacks an amino-terminal domain (ΔNp63) causes premature terminal differentiation of disorganised epidermal cells during mouse embryogenesis (Romano et al., 2012). Since ΔNp63 is specifically localised to the basal epidermal layer (Nylander et al., 2002) it is thought that the ΔNp63-depleted phenotype represents an exhaustion of epidermal progenitors due to a diminished self-renewal capacity. In line with these observations, p63 staining is intense in holoclones but weak in meroclones and paraclones from rat epidermis 27

(Senoo et al., 2007). In addition, several components of signalling pathways involved in the regulation of stemness are under the transcriptional control of ΔNp63. Notable examples include: frizzled-7, a receptor for WNT signalling proteins (Chakrabarti et al., 2014); and integrin β1, a component of the integrin cell signalling pathway (Carroll et al., 2006). ΔNp63 has also been shown to induce KRT5 and KRT14 (basal keratins) expression through direct interactions with enhancers located upstream of each gene (Romano et al., 2009, 2007). These observations and others have established ΔNp63 as a master regulator of keratinocyte stemness.

What regulates p63 expression itself has been the subject of much study (Soares and Zhou, 2018). One group has shown that epidermal p63 mRNA is subjected to silencing through microRNAs regulated by inhibitor of iASPP (apoptosis-stimulating proteins of p53). Interestingly, p63 was found to be a direct positive regulator of iASPP transcription, revealing a complex autoregulatory feedback loop underpinning the regulation of p63 in the epidermis (Chikh et al., 2011). Furthermore, a more recent study suggests that transcriptional control of p63 is also regulated in a positive autoregulatory manner through a long-range enhancer (Antonini et al., 2015).

Canonical WNT signalling has emerged as an important regulator of keratinocyte stemness. Primary human keratinocytes with a high proliferative potential (putative stem cells) express a higher level of noncadherin-associated β-catenin than populations of a lower proliferative potential, presumed to be transit amplifying cells (Zhu and Watt, 1999). Transduction of these cultures with stable β-catenin increases the proportion of cells that are putative stem cells, whilst introduction of a dominant-negative form of β-catenin stimulates exit from the stem cell compartment. Conditional overexpression or deletion of β-catenin leads to hyperthickening of the mouse epidermis, suggesting that an optimal level of canonical WNT signalling is required for normal proliferation of epidermal progenitors (Lo Celso et al., 2004; Teulière et al., 2004). Evidence presented by the Nusse lab show that Axin2, a WNT/β- catenin target gene, is selectively expressed in interfollicular epidermal (IFE) stem cells constituting the majority of the basal compartment (Lim et al., 2013). These Axin2- expressing cells require WNT/β-catenin signalling to self-renew and regulate this pathway in an autocrine fashion via secretion of the ligands WNT4 and WNT10A. Furthermore, p63 has been shown to upregulate the Myc proto-oncogene via the WNT/β-catenin signalling pathway to regulate keratinocyte proliferation (Wu et al., 2012).

Multiple epigenetic mechanisms have been identified that contribute to the correct function of IFE stem cells. Chromobox homolog 4 (CBX4), a component of the polycomb repressive 28 complex (PRC) 1 and a direct target of p63, protects IFE stem cells from senescence and mediates the p63-dependent suppression of non-epidermal genes through a PRC-dependent mechanism (Luis et al., 2011; Mardaryev et al., 2016). CBX4 also functions to repress terminal differentiation genes and cell cycle inhibitor genes in IFE stem cells by way of its small ubiquitin-like modifier E3 ligase activity (Mardaryev et al., 2016). The histone H4 lysine (K) 20 monomethylation (H4K20me1) histone methyltransferase, KMT5A, has also proven to be a critical regulator of IFE stem cell homeostasis. Deletion of KMT5A in basal epidermal cells arrests proliferation and exhausts IFE stem cells (Driskell et al., 2012). This is associated with a reduction in p63 expression and an increase in p53 expression. Driskell et al. proposed a model by which KMT5A represses p53, putatively via H4K20me1, thereby allowing p63 to be expressed in order to promote self-renewal. Interestingly, they also find that KMT5A is a transcriptional target of c-MYC. In addition to histone methylation, histone deacetylation has been demonstrated to be an important mechanism linked to the self- renewal capacity of IFE stem cells. Sarah E. Millar and colleagues have shown that epidermal ablation of both histone deacetylase (HDAC) 1 and HDAC2 leads to severe defects in epidermal proliferation and stratification that phenocopy loss of p63 (LeBoeuf et al., 2010). Indeed, it was found that HDAC1/2 directly mediate the transcriptional repression of p63 target genes, including the cell cycle inhibitor genes, p21 and p16INK4A. This mechanism is supported by a later study demonstrating HDAC1, HDAC2, and ΔNp63 existing in a trimeric, transcriptional repressor complex in squamous cell carcinoma cells (Ramsey et al., 2011).

To summarise, whilst our knowledge of the molecular regulators and signalling pathways that maintain keratinocyte stemness is incomplete, it is evident from numerous reports by different research groups that ΔNp63 and canonical WNT signalling are major players with activities that likely intersect at multiple levels. Furthermore, the striking defects in IFE stem cell survival and self-renewal observed in mice harbouring deletions for KMT5A or HDAC1/2 highlights the importance of chromatin remodelling in generating a histone acetylome and methylome that favours a stem cell gene expression program. Evidence linking both histone modifiers with the function of ΔNp63 in keratinocytes could explain these phenotypes and supports a model in which chromatin modifications work in concert with master regulators of keratinocyte stemness. 29

1.3.2 Regulation of the Basal to Spinous Cell Switch Multiple highly-conserved signalling pathways, including transforming growth factor beta/SMAD (TGFβ/SMAD) (Hoot et al., 2008; Yang et al., 2005), nuclear factor-kappa B (NF-κB) (Zhang et al., 2004) and phosphoinositide 3-kinase/phosphatase and tensin homolog (PI3K/PTEN) (Suzuki et al., 2003), have been implicated in driving the basal to spinous cell transition. However, the most well-studied and apparently central pathway in this process is the canonical Notch pathway. Deletion of Notch1 in the mouse epidermis results in hyperplasia and ectopic expression of KRT14 and β1 integrin in superficial epidermal layers. In differentiating primary mouse keratinocyte cultures, Notch1 is activated to supress growth and induce KRT1 and involucrin expression through distinct RBP-J (recombination signal binding protein for immunoglobulin kappa J region) -dependent and -independent mechanisms, respectively (Rangarajan et al., 2001). These effects have also been observed in primary human keratinocyte cultures but with a more gradual loss of clonogenic potential (Lowell et al., 2000). Another study proposes a mechanism in which activated Notch induces the expression of early differentiation genes and the repression of basal cell genes through a hairy and enhance of split-1 (HES1)-dependent and -independent mechanism, respectively (Blanpain et al., 2006). Further dissection of epidermal Notch- signalling reveals a synergistic link with the activating protein (AP) 2 family of transcription factors in regulating the CCAAT-enhancer-binding proteins (C/EBP) to govern the basal to spinous cell switch (X. Wang et al., 2008; Zhu et al., 1999). Crosstalk between p63 and Notch signalling has also been reported as a means of balancing epidermal stem cell self- renewal and differentiation. Activation of Notch1 supresses p63 expression by downregulating interferon-responsive genes whilst p63 negatively modulates Notch1 target genes including Hes1 (Nguyen et al., 2006) in an antagonistic manner. Furthermore, a different study has proposed a negative feedback loop linking p63-induced expression of IKK1 with Notch1 expression and the subsequent acquisition of spinous cell gene markers (Xin et al., 2011). ΔNp63 has also been shown to synergise with Notch signalling to induce KRT1 expression in differentiating keratinocytes (Nguyen et al., 2006). Because most Notch receptors are expressed suprabasally alongside their ligands, it is has been speculated that Notch signalling is controlled by coordinated spatial and temporal expression of its key components (Favier et al., 2000).

1.3.3 Molecular Drivers of Late Epidermal Differentiation Successful epidermal barrier formation relies on sustained and coordinated expression of the epidermal differentiation complex (EDC). In humans, this cassette of genes spans 2 megabases on 1q21.3 and encodes approximately 70 protein-coding genes divided into three 30 families: (i) Cornified envelope precursors, including involucrin, late cornified envelope (LCE) proteins and the small SPRRs; (ii) calcium binding proteins (S100) that contain EF hand domains; (iii) and S100 fused genes in which FLG belongs (Kypriotou et al., 2012; Toulza et al., 2007).

Extracellular and intracellular pools of calcium ions concentrated in the upper epidermal layers serve as potent signals for widespread expression of the EDC through the PKC pathway (Dlugosz and Yuspa, 1993; Lee and Lee, 2018). Downstream of this, additional levels of regulation are exerted on a gene-specific level by numerous ubiquitous transcription factors. AP1 complexes bind to sites located upstream of involucrin, loricrin, SPRR1A, and TGM1 genes to upregulate their expression during late keratinocyte differentiation (Han et al., 2012; Jang and Steinert, 2002; Phillips et al., 2004; Rorke et al., 2010; Welter et al., 1995; Welter and Eckert, 1995). Kruppel-like factor 4 (KLF4) was identified as the first essential transcription factor for epidermal barrier formation in mice. Ablation of Klf4 in mice leads to an upregulation of SPRR2A and repetin, and a downregulation of filaggrin and LCE proteins without affecting involucrin, loricrin, and KRT expression (Patel et al., 2006; Segre et al., 1999). Similarly, GATA3-deficient mouse epidermis display barrier impairments attributed to reduced expression of loricrin, KRT1, involucrin and LCE genes and concomitant increases in repetin expression (de Guzman Strong et al., 2006). Furthermore, loss of Grainyhead-like (GRHL) 3 in mice also leads to epidermal barrier impairments and upregulation of repetin, SPRR2, and S100A8 mRNA expression and downregulation of filaggrin, involucrin and loricrin mRNA expression (Klein et al., 2017; Yu et al., 2006). Milder epidermal barrier defects have been reported in MAFB-null mice (Miyai et al., 2016) and GRHL1-null mice (Mlacki et al., 2014) which possess thinner and thicker layers of terminally differentiating keratinocytes, respectively. Transcriptional profiling of MAFB-null mouse epidermis at embryonic day (E)18.5 reveals downregulation of filaggrin and repetin gene expression and upregulation of the lipid metabolism genes Alox12E and SMPD3. In contrast, loss of GRHL1, a direct transcriptional regulator of desmoglein 1 (DSG1), leads to fewer and structurally abnormal desmosomes in suprabasal mouse keratinocytes (Wilanowski et al., 2008).

Finally, there is accumulating evidence positing a role for p63 in epidermal barrier formation in opposition to earlier views of it as a master regulator of epidermal progenitor cell maintenance. One study demonstrates a direct positive regulatory interaction of ΔNp63 with Alox12 in differentiating keratinocytes (Kim et al., 2009). More recently, ΔNp63 was shown to promote the expression of ZNF185, a cytoskeleton- and membrane-associated protein critical for epidermal differentiation (Smirnov et al., 2019). Another zinc finger protein, 31

ZNF750, was also shown to be positively regulated by p63 for it to induce KLF4 expression in differentiating keratinocytes (Sen et al., 2012). Other researchers have shown that TAp63 β and γ isoforms of p63, which contain the N-terminal transactivation domain, function in activating late keratinocyte differentiation genes in concert with the Notch signalling pathway (Koh et al., 2015). However, the contribution of TAp63 isoforms to keratinocyte differentiation has been brought into question since they are expressed in the epidermis at a substantially lower level compared to ΔNp63 (Sethi et al., 2015). To this date, it is still unclear how ΔNp63 can act to promote stemness whilst also functioning as a pro- differentiation factor in keratinocytes.

Taken together, these studies support a model in which the EDC is subjected to targeted regulation, in part by transcription factors acting as transcriptional activators and/or repressors, to ensure the correct balance of components for assembly of the cornified envelope.

Figure 1.2 Key markers and molecular regulators of epidermal homeostasis. A schematic representation of human epidermis showing key molecular markers and regulators associated with basal epidermal cells (bottom row), keratinocytes committed to terminal differentiation (middle row), and cornification (top row). The epidermis is functionally separated from the dermis by connecting to the basement membrane via hemidesmosome junctions. Strong intercellular adhesion is mediated by desmosomes in basal, spinous and granular layers, and corneodesmosomes in the stratum corneum. The self-renewal capacity and the keratin composition (KRT5 and KRT14) of basal epidermal cells is in part promoted by the transcriptional regulator ΔNp63, canonical WNT signalling and several histone modifiers (e.g. PRC1 and KTM5A) that act to repress genes associated with keratinocyte differentiation. The basal to spinous cell switch is characterised by a change in keratin composition (KRT1 and KRT10) and low-level expression of involucrin which is promoted by several signalling pathways, including Notch and NF- κB, and the C/EBP family of transcription factors. As keratinocytes fully mature into anucleated corneocytes they begin to express many structural proteins (e.g. filaggrin and LCE proteins) encoded by the epidermal differentiation complex to form the cornified envelope. This process is governed by protein kinase C (PKC) signalling and the activities of several transcription factors, including KLF4 and GRHL1/3.

1.4 Chromatin: Modifiers, Modifications, and Gene Regulation

1.4.1 Nucleosome Structure and Function Long linear DNA constituting the human genome is packaged into a polymeric complex called chromatin for compaction, protection and as a means of regulating the accessibility and reading of the genetic code. The nucleosome is the basic unit of chromatin and is composed of a core heterotetramer of two copies of histones H3 and H4 flanked by two heterodimers of histone H2A and H2B which forms the spool to wrap 145-147 base pairs of DNA (Figure 1.3A) (Kornberg, 1974; Luger et al., 1997). Adjacent nucleosomes are attached via a short segment of linker DNA that typically associates with histone H1 or histone H5 which are thought to stabilise the nucleosomal arrays (Graziano et al., 1994; Robinson and Rhodes, 2006). 25-30% of the mass of each core histone protrudes away from the nucleosome unit in the form of unstructured N-terminal “tail” domains. H2A is distinct in that it also harbours a C-terminal tail domain (Vogler et al., 2010). Thus, eight tails in total exit from each nucleosome core. There is a preponderance of lysine and arginine residues in these tails that are readily accessible to enzymes that catalyse the addition or removal of methyl and acetyl groups on these basic amino acids. Being positively charged, H3 and H4 tails can by themselves organise higher-order chromatin structures by interacting with the negatively charged DNA backbone associated with its own or adjacent nucleosome(s) (Allan et al., 1982; Kan et al., 2009, 2007; Zheng et al., 2005). Furthermore, it has been shown that there is a portion of the H4 tail that has a propensity to interact with an acidic patch on the surface of the H2A/H2B dimer of an adjoining nucleosome to stabilise condensed chromatin (Dorigo et al., 2003; Wilkins et al., 2014). This interaction is abolished when K16 of the H4 tail is subjected to acetylation (H4K16ac), presumably by altering the tails electrostatic potential (Chang and Takada, 2016; Shogren-Knaak et al., 2006). Hence, some histone PTMs, particularly acetylation modifications, likely modulate gene expression by impairing the ability of histone tails to form inter- and intranucleosomal contacts (Figure 1.3B) (Tse et al., 1998). 34

Figure 1.3 DNA is packaged into nucleosomes - the fundamental repeating units of chromatin. (A) Three-dimensional computer-generated model of a nucleosome derived from x-ray diffraction measurements showing the architecture of the histone octamer and associated DNA. Adapted from: (Davey et al., 2002). (B) Nucleosomal arrays can adopt open conformations when subjected to acetylation (Ac) modifications by histone acetyltransferases (HATs) or closed conformations when these modifications are removed by histone deacetylases (HDACs). Gene expression can be regulated in this manner by modulating access of DNA templates to basal transcriptional machinery.

1.4.2 Histone Modifications Regulate Gene Expression Histone PTMs represent a mode of gene regulation that integrates extrinsic and intrinsic signals to affect cellular phenotype. Over 100 distinct histone PTMs have been identified since the discovery of histone acetylation (PHILLIPS, 1963) and histone methylation (Murray, 1964) in the early 1960s (Zhao and Garcia, 2015). They can be localised on histones proximal to target genes or in a global manner to transcriptionally regulate specific gene loci or large chromatin domains, respectively. There is still debate about how histone PTMs precisely regulate gene expression in vivo, but in general they are thought to do so by modulating the association of histones with DNA to render genes accessible or inaccessible to DNA binding transcription factors. A “direct” working hypothesis suggests that the intrinsic chemical properties of histone PTMs change the electrostatic potential of the local chromatin environment to alter DNA accessibility (Brower-Toland et al., 2005). This hypothesis was further elaborated into a concept termed the “histone code” which 35 acknowledges the combinatorial nature of these modifications and predicts that distinct patterns of histone PTMs represent epigenetic information that specify alternative chromatin states (Jenuwein and Allis, 2001). Underpinning this model is the idea that histone PTMs function indirectly by serving as marks to selectively recruit effector proteins that then elicit changes to local chromatin structure or further recruit other downstream regulatory proteins (Agalioti et al., 2002; Wang et al., 2004; Yoon et al., 2005). Testing of this hypothesis has since shown that particular marks can also block the recruitment of effector proteins and/or the establishment of other marks at proximal loci (Rea et al., 2000; Zegerman et al., 2002; Zhang and Reinberg, 2001). Furthermore, histone PTMs have a multitude of writers, readers, and erasers, and are responsible for their highly dynamic nature. Dynamics in the histone PTM landscape have been correlated with diverse cellular states and processes, including the DNA damage response (DDR; Clouaire et al., 2018), cellular differentiation (Verzi et al., 2010), and DNA replication (Han et al., 2013).

1.4.3 Histone Acetylation: A Mark of Transcriptional Activation Reversible acetylation of the epsilon amine group of lysine residues occurs on the N-terminal tails of all four core histones. It is the most extensively studied and well-characterised category of histone PTM. Studies over the past 56 years have consistently demonstrated a positive correlation between histone acetylation and transcriptional activity (Allfrey, Faulkner and Mirsky, 1964), whilst histone lysine methylation has been linked to either an active (Bernstein et al., 2002) or silent (Kuzmichev et al., 2002) gene state, depending upon the site that is modified (Pokholok et al., 2005; Z. Wang et al., 2008). Indeed, histone acetylation is largely found concentrated at gene promoters, although low levels are present throughout actively transcribed genes in a global fashion. Global increases in mRNA synthesis have been observed subsequent to the establishment of histone acetylation at gene promoters (Pogo et al., 1966). Moreover, genes subjected to differentiation-induction in a leukaemia cell line are associated with stable hyperacetylated histones prior to their expression (Clayton et al., 1993). A recent study suggests that the effects of histone acetylation on gene expression are primarily achieved through modulating transcriptional burst frequency (Nicolas et al., 2018).

Histone acetylation marks and histone methylation marks are present in a mutually exclusive manner, and so their establishment is a competitive one. For example, during early Drosophila development the polycomb repressive complex 2 is unable to catalyse the silencing mark H3K27me3 because of high levels of H3K27ac at target loci (Tie et al., 2009). Paradoxically, histone deacetylation has been found to be a prerequisite for transcriptional activation for a subset of genes (Kim et al., 2013; Wang et al., 2002, 2009). 36

This could reflect a mechanism of sequestration and release of transcriptional activators at sites of hyperacetylated histones in gene bodies and intergenic regions (Greer et al., 2015; Marié et al., 2018).

Despite being commonly referred to as an epigenetic mechanism, there is little evidence to support that these marks are heritable (Huang et al., 2013). In fact, acetyl-lysine is short- lived once established on human histone tails, with a half-life of between 30 minutes and 2 hours (Zheng et al., 2013). They must therefore be regularly replenished by HATs. Conversely, HDACs antagonise the effects of HATs by removing these acetyl groups from lysine residues. Hence, a relative balance of HATs and HDACs determines, to a large extent, the acetylation status of chromatin.

1.4.4 Histone Acetyltransferases: Classification, Structure and Function Seventeen distinct HATs have been identified in humans, nine of which are divided into three major families according to sequence conservation within their HAT domain where the structure has been defined and acetyl-coenzyme A (acetyl-CoA) binding has been confirmed. Although some HATs have been shown to act redundantly, many target specific chromatin domains and/or specific lysine residues to catalyse acetylation. This is mostly due to structural diversity in specialised domains flanking the catalytic core, which allow HATs to incorporate into different multisubunit complexes, recognise particular histone PTMs, and/or interact with different molecules (Figure 1.4) (Shahbazian and Grunstein, 2007). In turn, this permits the establishment of diverse and complex histone acetylomes appropriate for the functional outcome. Finally, it is noteworthy that in each family there is one or more HAT that has a paralogue of similar composition, indicative of compensatory or overlapping functions.

1.4.4.1 The MYST Family The largest family’s name was derived from abbreviating its founding members in yeast and mammals (MOZ, ybf2/Sas3, Sas2 and Tip60) – MYST. Defining this family is the presence of the highly conserved MYST domain composed of a common acetyl-CoA binding motif and an atypical zinc finger (Avvakumov and Côté, 2007). Tip60 (KAT5) and MOF (KAT8) are further defined structurally by an additional conserved chromodomain, which specifically recognises lysine-methylated histone tails (Eissenberg, 2012). Likewise, MOZ (KAT6A) and MORF (KAT6B) possess additional domains, including two small plant homeodomain-linked zinc finger (PHD) domains and a 200 amino acid N-terminus (H15 domain) with weak homology to linker histones (Thomas and Voss, 2007). The PHD domains are able to modify chromatin as well as recognise the methylation state of H3K4 37

(Sanchez and Zhou, 2011; Wen et al., 2010), whilst the H15 domain has been shown to influence nuclear localisation of KAT6A (Kitabayashi et al., 2001). HBO1 (KAT7) has an additional zinc finger domain and a serine-rich N-terminus domain not shared with any other member (Sharma et al., 2000). This unique region has been shown to repress androgen receptor- and NF-κβ mediated transcriptional activation (Contzler et al., 2006; Sharma et al., 2000).

MYST family members are conserved from yeast to human and are indispensable for mammalian development and cell growth (Yang, 2015). KAT8 plays an important global role in the formation and maintenance of euchromatin through specific acetylation of H4K16 to affect transcriptional activation, cell proliferation, and tumorigenesis (Akhtar and Becker, 2000; Gupta et al., 2008). KAT8-/- mouse embryos do not develop beyond the blastocyst stage (Thomas et al., 2008). Deletion of KAT5 in mouse embryos also leads to developmental arrest at the blastocyst stage (Hu et al., 2009). Interestingly, KAT5 and KAT8 are therefore functioning non-redundantly in these experiments, although this characterisation was limited to a small window of development. Rather, KAT5 has more pleiotropic functions, including co-regulation of gene promoters and participation in the DDR (Gorrini et al., 2007). Both KAT6A and KAT6B possess intrinsic transcriptional activation abilities independent of their HAT activity, and serve as coactivators for transcription factors such as runt-related gene 1/2 (RUNX1/2) (Collins et al., 2006; Pelletier et al., 2002). They have been shown to preferentially acetylate H3K9 and H3K14 amongst other sites (Ullah et al., 2008; Voss et al., 2009). Loss of KAT6A in mice leads to a switch from hyperacetylation to hypermethylation at H3K9 at Hox gene loci and consequent defects in segment identity during skeletogenesis (Voss et al., 2009). Furthermore, KAT6B- deficient mice exhibit facial and skeletal abnormalities that mirror the short stature and blepharoptosis seen in humans with haploinsufficiency of KAT6B (Kraft et al., 2011). Molecular analysis ascribed these phenotypes to disturbances in mitogen-activated protein kinase signal transduction because of global histone H3 hypoacetylation (global histone H4 acetylation was unaltered). Their importance in mammalian development is further underscored by studies implicating KAT6A/KAT6B activities in haematopoiesis, specifically with respect to stem cell self-renewal and maturation (Perez-Campo et al., 2013, 2009). KAT7 is the most unexplored member of the MYST family. In vitro analysis of human cells strongly suggest that KAT7 plays a direct role at replication origins to initiate DNA replication (Miotto and Struhl, 2008). In vivo, KAT7 has been characterised as an important transcriptional activator of multiple genes involved in postgastrulation mouse embryogenesis by promoting the acetylation of H3K14. Contradictory to in vitro findings, 38 embryonic lethality was linked to cell death and DNA fragmentation rather than changes to DNA replication or cell proliferation (Kueh et al., 2011).

Overall, both in vitro and in vivo genetic loss-of-function studies support a general view where the MYST family members act non-redundantly to maintain stem cell compartments during both early (KAT5, KAT7 and KAT8) and late (KAT6A and KAT6B) embryogenesis.

1.4.4.2 The p300/CBP Family The p300/CBP family include two distinct but related HATs derived from separate genes: KAT3A and KAT3B. Both proteins share several conserved protein-protein interacting motifs flanking their central HAT domain, including: 1) the bromodomain, which recognises acetylated lysines (Dhalluin et al., 1999); 2) three cysteine/histidine (CH)-rich domains, of which CH1 and CH3 contain transcriptional adaptor zinc fingers and CH2 contains a PHD finger; 3) a kinase-inducible domain interacting domain, which binds cAMP response element-binding protein (CREB) amongst other similar factors (Parker et al., 1996); and 4) a nuclear receptor interacting domain able to bind to proline-rich motifs. Amino acid sequence identity between KAT3A and KAT3B is 61% across the whole protein and 86% across the acetyltransferase domain and its two flanking domains (Chan and La Thangue, 2001). Intriguingly, KAT3A and KAT3B orthologs have not been identified in lower eukaryotes despite this being common for HATs of other families. Thus, some have argued that both HATs coevolved alongside metazoans and may therefore reflect their functional importance in more intricate processes, such as cell-cell communication and organ morphogenesis (Bordoli et al., 2001).

Given the extensive homology of KAT3A and KAT3B it is unsurprising that both share many overlapping and sometimes redundant functions. For example, although KAT3B and KAT3A were originally discovered as proteins that bind to adenovirus early region 1A (E1A) and CREB, respectively, it is now known that both proteins have the domains to bind both (Arany et al., 1995; Lundblad et al., 1995). In fact, KAT3A and KAT3B are known to physically and functionally interact with >400 transcriptional regulators and other proteins found in human cells (Messina et al., 2004). Further, most sequence-specific transcription factors can be coactivated by either KAT3A or KAT3B in transfection experiments. The high connectivity of the KAT3A and KAT3B interactome implies that both HATs are indispensable embryogenic factors. Indeed, deletion of KAT3B in mice causes defects in neurulation, cell proliferation, heart development, and death at E9-11.5 (Yao et al., 1998). KAT3A levels were unchanged in these embryos compared to controls and KAT3A-null mice also exhibited similar phenotypes, indicative of non-redundant but overlapping roles like the 39 behaviour of the MYST paralogue pairs. Interestingly, effects in neurulation and bone morphogenesis were also observed in some KAT3A/KAT3B heterozygous mice, suggesting that gene dosage is an important factor for the late stages of mouse embryogenesis to proceed correctly. KAT3A+/- mice showed multilineage defects in haematopoietic differentiation not detected in KAT3B +/- mice, supporting a model in which both paralogues have unique functions. In further support, immunolocalisation of KAT3A and KAT3B from the two-cell stage to the blastocyst stage shows that these proteins do not spatially overlap and, at some stages, reside in different cellular compartments in preimplantation mouse embryos (Kwok et al., 2006).

Conditional knockout alleles have been generated to understand the roles of KAT3B/KAT3B in adult cell lineages. KAT3A and KAT3B are known to regulate a large proportion of the same genes in many adult cell types and cellular processes, including proliferation, differentiation, apoptosis, and DNA repair (Goodman and Smolik, 2000). Chromatin immunoprecipitation sequencing (ChIP-seq) of quiescent cell cultures shows an extensive overlap in regions of DNA bound by KAT3A and KAT3B with most of these regions being located at transcription start and termination sites. However, analysis of transcription factor binding sites and functional classification of bound regions reveals that KAT3A and KAT3B preferentially associate with different transcription factors and KAT3A is more involved in regulating transcriptional inhibition (Ramos et al., 2010). A recent study using human primary myoblasts shows that KAT3A and KAT3B are important for activating the muscle- specific differentiation program by regulating distinct networks (Fauquier et al., 2018).

It is now widely accepted that KAT3A and KAT3B act as general transcriptional integrators by acting as a bridge to the basal transcriptional machinery or as a scaffold for the assembly of multicomponent coactivator complexes (Chan and La Thangue, 2001). In fact, it is unclear if and how the histone acetyltransferase activity of KAT3A/KAT3B is important for their action, even though it is known that they can acetylate all four core histone tails in vitro (Bannister and Kouzarides, 1996; Ogryzko et al., 1996). KAT3A and KAT3B are the main HATs responsible for maintaining global levels of H3K18ac and H3K27ac and promoter- associated histone H4 hyperacetylation in mouse fibroblasts (Jin et al., 2011; Kasper et al., 2010). Fibroblasts deleted for both KAT3A and KAT3B are viable but cannot proliferate. Curiously, although H3K27ac is a well characterised mark of active enhancers (Creyghton et al., 2010), deletion of KAT3A/KAT3B in fibroblasts leads to only a partial loss of target gene expression. 40

1.4.4.3 The GNAT Family The GCN5-related N-acetyltransferase (GNAT) family is comprised of two main members in humans: KAT2A (837 amino acids) and KAT2B (832 amino acids) encoded by separate genes located on chromosome 17q21.2 and 3p24.3, respectively. KAT2A duplicated and diverged to generate the KAT2B gene at some point during the evolutionary emergence of vertebrates (Spedale et al., 2012). KAT2A and KAT2B share ~75% amino acid sequence identity and closely resemble their yeast orthologs: General control non-repressed protein 5 (GCN5) and p300/CBP-associated factor (PCAF), respectively (Yang et al., 1996). They both have three conserved domains: The N-terminal extension region (containing the PCAF homology domain), the HAT domain, and the bromodomain. The HAT domain has a central globular core with an acetyl-CoA binding pocket and a conserved glutamate residue that functions to deprotonate lysine target residues to promote nucleophilic attack on the acetyl- CoA thioester (Clements et al., 1999; Tanner et al., 1999). The current consensus is that the GNAT family of HATs catalyse lysine acetylation through a compulsory-order ternary complex mechanism that requires binding of both acetyl-CoA and the histone substrate, with the former being the first to bind, for catalysis to take place (Tanner et al., 2000). The 439 amino acid yeast KAT2A (yKAT2A) possesses a HAT domain and a bromodomain homologous to the C-terminal halves of KAT2A and KAT2B but not the N-terminus domain which is unique to the metazoan orthologs (Xu et al., 1998). Notably, Drosophila KAT2A (dKAT2A) does possess a homologous N-terminal extension indicating that this was an important ancestral feature of metazoan KAT2A (Smith et al., 1998).

In vitro HAT assays show that both mouse KAT2A and KAT2B are effective in acetylating free and nucleosomal histones with a preference for histone H3 and histone H4 tails, respectively (Xu et al., 1998). By contrast, although yKAT2A can acetylate synthetic histone peptides with similar specificity to mouse KAT2A, it cannot do so when histones are assesmbled into nucleosomes suggesting that the N-terminal domain of KAT2A and KAT2B affords the enzymes the ability to recognise chromatin substrates. Furthermore, several studies have demonstrated physical and functional interactions between the N-termini of KAT2A and KAT2B and a range of different proteins, including KAT3A/KAT3B (Yang et al., 1996), nuclear transcription factor Y (Currie, 1998); Notch1 (Kurooka and Honjo, 2000); the transcriptional coactivator, p/CIP; (Brown et al., 2003), and the nuclear receptor, steroidogenic factor-1 (Jacob et al., 2001). Therefore, this domain could serve as a means of recruiting KAT2A and KAT2B to distinct genomic loci where they then act to restructure chromatin; but this has not been comprehensively investigated in recent years. 41

The ~110 amino acid bromodomain of KAT2A and KAT2B allows for direct interaction with amino acids flanking acetyl-lysine target residues and so places both HATs in the categories of readers and writers of PTMs (Zeng et al., 2008). Appropriately, yKAT2A has been shown to bind to specific lysine residues and to partake in local chromatin remodelling and/or processive acetylation of histone H3 lysine residues (Cieniewicz et al., 2014; Zeng and Zhou, 2002). The latter may be an important event for stabilising nucleosomal remodelling complexes, such as SWItch/Sucrose Non-Fermentable (SWI/SNF), at target promoters as it has been shown that this effect is compromised in the presence of a yKAT2A bromodomain mutant (Syntichaki et al., 2000). Furthermore, the bromodomain of yKAT2A has been shown to facilitate cooperative and cross-tail acetylation of nucleosomes (Li and Shogren-Knaak, 2009). In complex with synthetic histone tail peptides, the bromodomain of yKAT2A binds to H4K16 whilst the bromodomain of yKAT2B binds to H4K8 and H3K14 (Dhalluin et al., 1999; Hudson et al., 2000; Owen et al., 2000). Overall, the bromodomain of KAT2A/KAT2B may simply serve to retain these HATs and their interacting factors at target substrates long enough for them to act.

The histone substrate specificity of KAT2A and KAT2B has been the subject of much study. In vitro histone acetylation assays show that recombinant KAT2A preferentially acetylates H3K14 and, to a lesser degree, H4K8 and H4K16. KAT2B also favours H3K14 as a substrate and acetylates H4K8 albeit less efficiently. A mass spectrometry-based study showed that recombinant KAT2A acetylates six lysines on free recombinant histone H3 at the following efficiency: K14>K9 ≈ K23> K18> K27 ≈ K36 (Kuo and Andrews, 2013). Attempts to correlate these findings with those in mammalian cells depleted for KAT2A or KAT2B are confounded by redundancies in enzymatic activities between the two HATs. However, it is largely accepted that H3K9, H3K14, H3K18, and H3K36 are targets of KAT2A/KAT2B in mammalian cells. Of these substrates, H3K9ac has been the most well-studied in relation to the function of KAT2A. Global or locus-specific loss of H3K9ac is a consistent finding in cultured mammalian cells and animal tissues depleted for KAT2A (Domingues et al., 2018; Gatta and Mantovani, 2010; Jin et al., 2014; Sen et al., 2018). H3K9ac is a modification that associates with transcriptionally active genes. Studies have shown that H3K9ac loss upon KAT2A depletion in mammalian cells affects the expression of a subset of genes whilst it is apparently dispensable for others (Jin et al., 2011). Therefore, H3K9ac is instead considered a mark that fine tunes locus-specific transcriptional activity. Recently, it has been found that, rather than having a role in transcription initiation, H3K9ac is involved in recruiting the super elongation complex to chromatin to mediate the release of paused RNA polymerase II (RNAPII) (Gates et al., 2017a). 42

Figure 1.4: Sequence relationship tree and domain organisation of the human nuclear HAT enzymes. The amino acid sequence relationship between the nine HATs with structurally defined acetyltransferase domains are represented by the tree to the left. Domains 1-17 are colour coded and labelled in the table below the illustration. Protein length is denoted to the right of each HAT in terms of the number of amino acids (aa). Common amongst all the HATs is the conserved catalytic HAT domain (1), the active site where acetyl groups are transferred from acetyl-CoA to lysine residues in histone tails or non-histone proteins, such as transcription factors. Other domains typically confer binding to histones directly, for instance bromodomains (4), PHD domains (9), and chromodomains, or other proteins including DNA-binding factors. Note the homology between KAT2A and KAT2B and the unique ubiquitin ligase domain (3) of the latter at its N-terminal region. Adapted from: (Voss and Thomas, 2018). 43

1.4.5 STAGA and Related Complexes in Humans In vivo, human KAT2A and KAT2B each reside in large multiprotein complexes (~2 MDa, 18-20 subunits) as the catalytic subunit of a common HAT module. These complexes are recruited to target genes by transcription factors bound to activation sequences located upstream in order to facilitate the formation of the preinitiation complex. KAT2A incorporates into the SPT3-TAF9-GCN5 acetyltransferase (STAGA) complex (Brand et al., 1999; Martinez et al., 1998), whilst KAT2B assembles into a highly similar complex called the PCAF complex (Ogryzko et al., 1998). Biochemical and functional characterisation demonstrate STAGA and PCAF complexes to be almost identical despite some differences in subunit composition (Table 1.1) (Zhao et al., 2008). Both complexes are organised into several separate modules with distinct activities: the HAT module, which is comprised of KAT2A/KAT2B together with ADA proteins and SAGA-associated factor 29 (SGF29) (Kurabe et al., 2007); the TBP-associated factor (TAF) module, which consists of a group of TAF proteins; and the SPT module, which consists of SPT proteins and a 400 kilodalton (kDa) protein called transformation/transcription domain-associated protein (TRRAP) (Vassilev et al., 1998). The ADA proteins significantly enhance the catalytic activity of KAT2A/KAT2B without altering their histone substrate specificities (Riss et al., 2015; Sun et al., 2018). The subunit composition of these proteins differ between the HAT modules of the STAGA and PCAF complex. Whilst ADA2A is found in the PCAF complex, its homologous factor, ADA2B, is only present in the STAGA complex (Gamper et al., 2009). The SGF29 subunit is common between both the HAT modules of the STAGA and PCAF complex, and contains tandem Tudor domains that selectively recognise H3K4me2/3 that may be important for recruiting HAT activity to specific gene loci (Bian et al., 2011). The TAF and SPT modules are important for maintaining the architectural integrity of the STAGA and PCAF complexes and for mediating interactions with transcriptional machinery and transcription factors (Grant et al., 1998; McMahon et al., 2000). A deubiquitination module composed of ataxin-7, ataxin-7-like protein 3, ubiquitin carboxyl-terminal hydrolase 22, and transcription and export complex 2 subunits has been identified in the STAGA complex with activity for histone H2A and H2B substrates (Zhao et al., 2008). This module has yet to be reported as part of the PCAF complex. Some researchers also consider the spliceosome-associated proteins SF3B3 and SF3B5, categorised here as subunits of the SPT module, to be components of a distinct spliceosome module in STAGA (Martinez et al., 2001). However, the functions of these proteins as a part of STAGA have not been explored.

Table 1.1: Components of the human protein complexes containing KAT2A/KAT2B

Module STAGA and related complexes STAGA PCAF ATAC KAT2A KAT2A/KAT2B KAT2B ADA2A/B HAT ADA2B ADA2A ADA3 ADA3 ADA3 SGF29 SGF29 SGF29 ATAC1 HAT no. 2 ATAC2 USP22 ? ATXN7 ? Deubiquitination ATXN7L3 ? ENY2 ? TAF5L TAF5L WDR5 TAF6L TAF6L MAP3K7 TAF TAF9 TAF9 TAF10 TAF10 DR1 TAF12 TAF12 POLE3 TRRAP TRRAP POLE4 SPT20 MBIP SUPT7L YEATS2 SPT SUPT3H SUPT3H SF3B3 SF3B3 SF3B5 TADA1

A smaller 600-700kDa KAT2A/KAT2B-containing multiprotein complex called the ADA2A-containing (ATAC) complex has been purified from human cell lines and interacts with the TATA-binding protein to control transcription (Y.-L. Wang et al., 2008). The ATAC complex is less structurally defined compared to the STAGA and PCAF complexes. In addition to a HAT module that largely resembles that in STAGA/PCAF, ATAC has a unique unit of proteins, of which several serve as cofactors of chromatin assembly/remodelling and DNA replication machineries (Figure 1.5). ATAC is also distinguished by the presence of a second HAT centre containing ATAC2, a protein that shows weak HAT activity towards histone H4 and is also essential for the architectural integrity of the complex (Guelman et al., 2009). STAGA and ATAC orthologues in Drosophila exhibit different substrate specificities, with the former primarily targeting H3K9/14, and the latter favouring acetylation of H4K5/12 (Pankotai et al., 2005; Qi et al., 2004). However, in vitro HAT assays with recombinant histone octamers and endogenous human STAGA and ATAC containing KAT2A show that both complexes preferentially acetylate histone H3 over histone H4 to similar extents (Riss et al., 2015). Of note, these experiments also show that the histone substrate specificity of KAT2A is unchanged when it is incorporated into either complex. Whether the differences in subunit composition between STAGA, PCAF, and ATAC influences the substrate specificities of KAT2A/KAT2B for histone and non-histone substrates under physiological conditions warrants investigation.

Figure 1.5: Modules and subunit composition of STAGA and ATAC in human. KAT2A (dark blue, red outline) and KAT2B reside mutually exclusively in one of two large multisubunit complexes in human cells: STAGA (left) or ATAC (right). Subunits in both complexes are organised into modules that have distinct functions and activities. KAT2A/KAT2B associate with ADA proteins and SGF29 as part of a HAT module (dark blue) common between STAGA and ATAC. STAGA is further composed of three additional functional modules. The deubiquitination (DUB) module (purple) has activity towards histone substrates with USP22 being the main catalytic component. The TAF module (light blue) and SPT module (orange) consists of subunits important for maintaining the architectural integrity of STAGA in addition to mediating it interactions with transcriptional machinery and transcription factors. TRRAP is the largest and most functionally important subunit of these modules. SF3B3 and SF3B5 (highlighted with black outlines) could constitute a distinct splicing module. ATAC is a smaller complex that is composed of at least nine ATAC-specific subunits (green), one of which, ATAC2, possesses weak HAT activity towards histone H4. Adapted from: (Wang and Dent, 2014).

1.5 KAT2A and KAT2B in Stemness and Differentiation

1.5.1 KAT2A and KAT2B Developmental Expression Patterns During mouse embryogenesis KAT2A is abundantly and ubiquitously expressed throughout the embryo until E16.5 when expression is sharply downregulated. Curiously, expression of KAT2A is absent in the distal allantois and the developing heart. KAT2A is later upregulated and differentially expressed in adult mouse tissues. In contrast, KAT2B transcripts are detectable only in the maternal decidua prior to E12.5, henceforth expression is low but widespread with particularly high levels in the liver, heart, hind limb, and skeletal muscle (Yamauchi et al., 2000). KAT2B expression levels continue to increase in these tissues into adulthood. KAT2A and KAT2B transcripts are easily detectable by northern blot in whole tissue extracts from the brain, eye, heart, lung, liver, kidney, thymus, spleen, small intestine, skeletal muscle, ovary, and testis of adult mice. However, they are typically expressed in inverse and complementary amounts. For example, the ratio of KAT2A to KAT2B expression is highest in the brain, thymus, spleen, small intestine, ovary and testis. This pattern is the opposite in the eye, heart, liver, kidney, and skeletal muscle, whilst overall expression of KAT2A and KAT2B is equal in the lung (Xu et al., 2000; XuD, 1998). In fact, RNA- sequencing (RNA-seq) has identified KAT2A and KAT2B as the highest and lowest expressed in HAT in mouse hippocampal cells, respectively (Stilling et al., 2014). Taking these expression studies into account, one may postulate that KAT2A and KAT2B are regulated distinctly to give rise to differential expression patterns in a variety of tissues, particularly during mid-to late embryogenesis.

1.5.2 Developmental Roles of KAT2A and KAT2B KAT2A is an essential embryogenic factor. KAT2A nullzygous mice die at E10.5. Their growth is visibly retarded at E8.5 and they fail to form specific mesodermal-derived structures, such as somites, the notochord, and the neural tube (Xu et al., 2000; Yamauchi et al., 2000). Markers for the paraxial mesoderm and chordamesoderm are present in KAT2A mutant embryos but are subsequently lost, indicating correct specification of these structures. The authors attributed these defects to an increase in apoptotic cells in the ectoderm and mesoderm. Mice heterozygous for KAT2A and null for KAT2B do not exhibit any developmental abnormalities and live into adulthood, suggesting that KAT2B is dispensable for mouse embryogenesis or that KAT2A functionally compensates for the loss of KAT2B. In support of the former, Xu et al. reported no changes in KAT2A expression in the KAT2B- null mice, although in my opinion the published northern blot does show modest increases in KAT2A expression in the heart, lung, and liver of the KAT2B-/- mice. A similar study published at the same time reports a drastic overproduction of KAT2A in the lung and liver 48 of KAT2B-/- mice, indicative of a compensatory mechanism (Yamauchi et al., 2000). This phenomenon is not observed in similar experiments with KAT3A and KAT3B (Tanaka et al., 1997; Yao et al., 1998). Mice harbouring homozygous deletions for KAT2A and KAT2B die at E7.5 and exhibit severe growth retardation with highly disorganised embryonic ectoderm and visceral endoderm detectable at E6.5. Because the double-null mice die earlier than the KAT2A-/- mice, the authors reasoned that KAT2A and KAT2B must have overlapping roles prior to E6.5. Later, it was found that mice homozygous for alleles expressing catalytically inactive KAT2A typically live longer than KAT2A-/- embryos. However, these mice ultimately die by E16.5 with exencephaly, defects in neural tube closure, and perturbed craniofacial development due to abnormal retinoic acid signalling involving a nonhistone substrate of KAT2A (Bu et al., 2007; Sen et al., 2018; Wilde et al., 2017). This finding suggests that KAT2A functions in a HAT-independent and -dependent manner prior to and after E8.5, respectively. Phenotypic analysis has also extended to zebrafish and fruit fly models. Knockdown of KAT2A and KAT2B in zebrafish perturbs heart, limb and craniofacial development (Ghosh et al., 2018; Sen et al., 2018). Knockout of KAT2A in Drosophila leads to cell proliferation defects in the imaginal tissues and blocks oogenesis and metamorphosis (Carre et al., 2005). Unexpectedly, they found that the bromodomain of KAT2A was functionally dispensable for these developmental processes. Finally, separate studies have implicated KAT2A and KAT2B in memory formation in adult mice, showing that both HATs are also important in the lifelong functioning of mature tissues (Duclot et al., 2010; Maurice et al., 2008; Stilling et al., 2014). Specifically, KAT2A was shown to interact with NF-κB to activate genes linked to neuroactive receptor signalling by acetylating p65, H3K14/18, and H4K12 at promoter regions.

Given the severe developmental defects exhibited in the KAT2A-null animal models it was expected that KAT2A has critical functions in cellular processes related to cell growth, proliferation, and differentiation. On the other hand, the surprising dispensability of KAT2B for mammalian development suggested that its functions were more restricted to those of mature tissues consistent with expression data. KAT2A and KAT2B-containing complexes have been shown to function as transcriptional coactivators in a variety of cell types typically through their acetyltransferase activity. Researchers have employed in vitro techniques to understand what cellular process KAT2A and KAT2B are implicated in, how they function on a mechanistic level, and if their roles are distinct from each other or redundant.

1.5.3 KAT2A and KAT2B in the Regulation of the Cell Cycle Evidence consistently highlights KAT2A as an important pro-proliferative factor, whilst KAT2B seems to have more mixed effects depending on the cell line used in the study. 49

KAT2A expression is known to peak at early S-phase and decrease at mid S-phase of the cell cycle (Paolinelli et al., 2009). Whilst deletion of KAT2B had no phenotypic consequences in a chicken B-lymphocyte cell line, deletion of KAT2A affected the transcription of G1/S phase transition-related and apoptosis-related genes and delayed their growth rate (Kikuchi et al., 2005). Such contrasting effects are partly explained by the steady state levels of KAT2A and KAT2B in this cell line, which is substantially in favour of the former. It is also noteworthy that the authors for this study reported compensatory increases in KAT2B and HDAC4 levels upon knockout of KAT2A alongside global losses of H3K9ac and gains of H3K23ac and H4K8/12ac. Similar effects have been observed in other mammalian cell types upon KAT2A/KAT2B depletion, including: urothelial carcinoma cells (Koutsogiannouli et al., 2017), HeLa cells (Orpinell et al., 2010), human glioblastoma T98G cells (Paolinelli et al., 2009), T lymphocytes (Gao et al., 2017), neural precursor cells (Martínez-Cerdeño et al., 2012), glioma cells (Liu et al., 2015; Yugang Wang et al., 2017), and 3T3 fibroblasts (Orpinell et al., 2010).

KAT2A seems to mediate its pro-proliferative effects predominantly by acetylating non- histone proteins involved in cell cycle progression to regulate their stability, activity, and/or localisation. For example, acetylation of the cell division cycle 6 protein by KAT2A is necessary for its stability and relocalisation to the cytoplasm to permit proper S-phase progression (Paolinelli et al., 2009). Similarly, ATAC has been shown to directly acetylate Cyclin A to regulate its activity during mitosis (Orpinell et al., 2010). A minority of studies reveal unique roles for KAT2B in the cell cycle. One of which shows that KAT2A and KAT2B are important for G1/S phase transition and the G2/M phase of the cell cycle in mouse embryonic fibroblasts (MEFs), respectively (Gatta and Mantovani, 2010). Another study shows a pro-proliferative effect of KAT2B-mediated acetylation of protein-kinase B in a human glioblastoma cell line (Zhang et al., 2015). In contrast, KAT2B has been shown to inhibit the activity of the cyclin-dependent kinase complex to limit the proliferation of an immortalised mouse myoblast cell line (Mateo et al., 2009). Finally, comprehensive characterisation of the human KAT2A/KAT2B-dependent acetylome in HeLa cells reveals a large proportion of cellular targets involved in the mitotic cell cycle (Fournier et al., 2016). One target identified from this screen, polo-like kinase 4, is a regulator of centrosome duplication and is subjected to KAT2A/KAT2B-mediated acetylation to control its activity.

1.5.4 KAT2A as a Regulator of Stemness There are several in vitro studies in support of KAT2A as a regulator of stemness. Firstly, KAT2A-/- mouse embryonic stem cells (mESCs) show signs of loss of pluripotency when cultured. They form small misshapen embryoid bodies (EBs) with severely disorganised 50 epiblast morphologies during early stages of differentiation (Lin et al., 2007; Wang et al., 2018). Additionally, KAT2A-/- EBs have a greater proportion of cells in the G2/M phase and they prematurely curtail expression of epiblast markers by day 5-6 of differentiation. These observations are indicative of a premature loss of pluripotent cells in differentiating EBs in the absence of KAT2A. However, this idea is challenged in a more recent study by Wang et al. where comparable numbers of pluripotent cells between mutant EBs relative to control were measured at day 5. Lin et al. found that loss of KAT2A had no impact on the transcriptional profiles for endodermal and ectodermal markers over the course of differentiation. However, the levels and timings of expression for some mesodermal markers were altered in the KAT2A-/- EBs. In line with these findings, Wang et al. observed decreased expression of other mesoderm-specific genes in late stage KAT2A-/- EBs and differentiated KAT2A-/- embryonic stem cell monolayer cultures. Furthermore, they found significantly lower numbers of endodermal and mesodermal cells in KAT2A-/- EBs at day 5 compared to control numbers. Wang et al. further elucidated the molecular mechanisms at play and found abnormal activities of the fibroblast growth factor signalling pathway, defective extracellular signal-related kinase signalling, and altered levels/organisation of actin and vimentin cytoskeletal networks in day 5 KAT2A-/- EBs. Whilst Lin et al. observed global losses of H3K9ac/18ac in KAT2A-/- EBs using Western blot, Wang et al. could only detect localised losses of H3K9ac using ChIP-seq and most of these were direct target genes of cMYC. Indeed, KAT2A is an important cofactor for MYC-dependent transcription during the early stages of somatic cell reprogramming (Hirsch et al., 2015) and in maintaining the stem-like properties of neural stem cells (Martínez-Cerdeño et al., 2012). Unexpectedly, Lin et al. observed significant enhancements in the rate of skeletal and cardiac muscle differentiation in the KAT2A-/- EBs (Lin et al., 2007). Similar effects have been reported upon KAT2A depletion in neural stem cells and acute myeloid leukaemia cells, which have an increased propensity to differentiate towards the oligodendrocyte lineage and the myeloid lineage, respectively (Bararia et al., 2016; Domingues et al., 2017; Martínez-Cerdeño et al., 2012; Tzelepis et al., 2016). The Pina group proposes that KAT2A-dependent H3K9ac maintains stemness by buffering transcriptional heterogeneity. This model is supported by observations of increased transcriptional noise and probability of exit from stem cell self- renewal upon loss of KAT2A in human leukemic cells and mESCs (Domingues et al., 2018; Moris et al., 2018).

1.5.5 KAT2A as a Regulator of Cellular Differentiation KAT2A has also been shown to potentiate cellular differentiation in several cell types through HAT-dependent and -independent mechanisms involving histone and non-histone 51 proteins. Differentiation of preadipocytes stimulates KAT2A-mediated acetylation of C/EBPβ, which blocks its interaction with HDAC1 and promotes its transcriptional activity towards target genes of the adipogenic program (Wiper-Bergeron et al., 2007). KAT2A promotes osteogenic differentiation in periodontal ligament stem cells by upregulating a WNT inhibitor putatively through acetylation of H3K9ac (Li et al., 2016), and in mesenchymal stem cells through a HAT-independent mechanism that represses NF-κB- dependent transcription (Zhang, et al., 2016). KAT2A also drives cardiomyocyte differentiation of mesenchymal stem cells by binding to and installing H3K9ac at the GATA Binding Protein 4 and NK2 Homeobox 5 gene promoters to induce their expression during the early stages of differentiation (Li et al., 2010; Yi et al., 2017). Finally, several studies highlight KAT2A as an important regulator of T cell differentiation. In CD4+ helper T cells (Th), KAT2A forms a complex with the transcription factor PU.1 to induce expression of the interleukin-9 gene via histone acetylation to promote differentiation toward Th9 cells (Goswami and Kaplan, 2012). Similarly, upon T-cell activation, KAT2A is recruited by the nuclear factor of activated T-cells to the interleukin-2 gene promoter where it catalyses H3K9ac to induce transcription and Th1/Th17 differentiation (Gao et al., 2017). KAT2A also promotes natural killer T cell differentiation by acetylating and, in turn, positively regulating early growth responsive gene 2 transcriptional activity (Yajun Wang et al., 2017).

1.5.6 KAT2B as a Regulator of Cellular Differentiation Whereas KAT2A has been characterised as either a positive or negative regulator of cellular differentiation, substantial evidence supports KAT2B strictly as a positive and often critical regulator of differentiation in a variety of cell types. Depletion of KAT2B in mesenchymal cells significantly impairs osteogenic differentiation both in vivo and in vitro (Zhang et al., 2016). KAT2B functions in osteogenic differentiation by enriching H3K9ac at promoters of bone morphogenetic protein signalling genes. This differs from the role played by KAT2A in promoting osteogenic differentiation, which relies on a HAT-independent mechanism to repress NF-κβ signalling. Interestingly, the increase in KAT2B expression observed upon osteogenic induction of mesenchymal stem cells is dependent on SMAD signalling whilst KAT2A is upregulated via a distinct unknown mechanism. Furthermore, runt-related gene 2 (RUNX2), a master transcription factor for osteoblast differentiation, is a direct target of KAT2B which acts to acetylate RUNX2 to increase its transcriptional activity (Wang et al., 2013). KAT2B has been shown to act as a transcriptional coactivator for myoblast determination protein 1 (MyoD) to activate the myogenic program through a HAT- dependent mechanism (Puri et al., 1997). Inactivation of KAT2B in myoblasts renders the cells refractory to myogenic differentiation stimuli. Similarly, KAT2B acts as a 52 transcriptional coactivator for all-trans retinoic acid in leukaemia cells to promote granulocytic differentiation via acetylation of histone H3 (Sunami et al., 2017, 2014). Of particular relevance to the experiments described in this thesis, one study shown KAT2B to be a potent driver of primary keratinocyte differentiation in vitro (Pickard et al., 2010). KAT2B protein was significantly upregulated upon keratinocyte differentiation and was shown to acetylate retinoblastoma protein (Rb) to restrict its localisation to the nucleus. Depletion of KAT2B in these cells led to Rb mislocalization and significantly compromised expression of early and late differentiation markers. The precise mechanisms Rb employs to promote keratinocyte differentiation is unclear, however the authors suggest that it plays a role in limiting cell cycle re-entry during terminal differentiation.

It is interesting to note that many of the aforementioned studies find that the expression of KAT2A/KAT2B are regulated in accordance to their role in differentiation for the cell type in question. This suggests that KAT2A and KAT2B may be dynamically regulated as a means of controlling cell fate decisions and differentiation.

1.5.7 Concluding Remarks In summary, there is a large body of evidence that demonstrate divergent functions for KAT2A and KAT2B in variety of fundamental cellular processes despite their similarities in primary sequence, enzymatic activities, and the protein complexes in which they reside. The reasons for their differences in function remain elusive and highlight the need for studies that compare the differences in KAT2A and KAT2B function in parallel. Furthermore, although many studies support the significance of the HAT domain for KAT2A and KAT2B function, there are several others that show that they function in a HAT-independent manner. This suggests that the bromodomains and/or N-termini of KAT2A and KAT2B may play a significant role in how they function, yet the literature provides little insight into their value. There are many parallels between developmental processes and the processes involved in the homeostasis of highly regenerative adult tissues. Given that KAT2A and KAT2B are crucial embryogenic factors, it stands to reason that they could be similarly important for processes involved in adult tissue regeneration. The epidermis is a highly regenerative tissue. The roles that histone acetylation and HATs could play in epidermal homeostasis is significantly underexplored. Therefore, investigating the functional similarities and differences between KAT2A and KAT2B in this setting would be of value from an epigenetics and keratinocyte biology perspective. 53

1.6 Hypothesis and Aims

I hypothesise that KAT2A functions in human keratinocytes to maintain stemness and to limit the activation of gene expression programmes associated with differentiation in an opposite manner to what has been described for its paralogue, KAT2B.

Main aims include:

1. To identify HATs and histone modifications of functional importance for proliferative and differentiated keratinocyte populations. I will address this aim by characterising HAT expression profiles and histone acetylation dynamics across the course of differentiation in cultured human keratinocytes.

2. To characterise the functions of KAT2A and KAT2B in undifferentiated and differentiated keratinocytes. To address this aim I will characterise the molecular and cellular consequences of KAT2A and/or KAT2B depletion in proliferative and differentiated keratinocytes.

3. To elucidate the mechanisms by which KAT2A and KAT2B function in keratinocytes. Specifically, I will investigate where KAT2A and KAT2B are localised in the cell across the course of keratinocyte differentiation, what histone substrates they are active on, and what domains of KAT2A are important for its function.

CHAPTER 2 – MATERIALS AND METHODS

2.1 Cell Culture

2.1.1 Conditions for Maintaining Cell Cultures Cell culture work was performed using aseptic technique in the absence of antibiotics. Cell cultures were checked for mycoplasma contamination on a monthly basis using biochemical testing (Lonza™, Cat no 11650261) and/or staining with 4′,6-diamidino-2-phenylindole (DAPI). Experiments were performed with cells of healthy morphologies and proliferation rates. All cells were cultured in vessels of the Nunclon™ Delta surface treated brand supplied by Thermo Fisher Scientific. No feeder cells or supplemental surface coatings were utilised for cell culture. Cells were passaged using trypsin (Thermo Fisher Scientific, Cat no. 25200056) at 37°C until most cells had detached (<5 mins). Cells were then pelleted at 220xg for 5 mins, counted, seeded at the specified density, and incubated at 37°C with 5% carbon dioxide. Cell culture media was replenished every two days.

N/TERT-1 cells (Dickson et al., 2000) were maintained in Keratinocyte serum-free media supplemented with BPE, EGF, and calcium chloride (Sigma-Aldrich, Cat no. C7902) to a final concentration of 25 µg/ml, 0.2 ng/ml, and 0.4 mM, respectively (KSFM, Gibco™, Cat no. 10724-011). 70% confluent cells were passaged and seeded at a density of 1400 cells/cm2 in T25/75 tissue culture flasks (Thermo Fisher Scientific Cat no. 156340/156499). N/TERT- 1 cells were maintained within passages 50-80.

Primary Neonatal Normal Human Epidermal Keratinocytes (NHEK-Neo, Lonza™ Cat no. 00192907) were cultured in complete Keratinocyte Growth Medium Gold (KGM, Lonza™, Cat no.00192060). 70% confluent cells were passaged and seeded at a density of 3500 cells/cm2 in T25/T75 flasks. NHEKs were maintained below passage 8.

Human embryonic kidney 293T cells were cultured in high glucose DMEM (Thermo Fisher Scientific, Cat no. 11965-092) supplemented with 10% heat inactivated FBS (Hyclone™). 90% confluent cells were passaged and seeded at a density of 33 000 cells/cm2 in T75 flasks. 293T cells were maintained below passage 20.

2.1.2 Differentiation of Keratinocyte Cultures N/TERTs and NHEKs were cultured to 70% or 100% confluency, respectively, then media was switched to DFK1 (Table 2.1) for overnight incubation (Day 0 of differentiation). Differentiation was then induced by switching to DFK2 (Table 2.1) and replacing this media every two days. RNA and protein were harvested 48 hrs (day 2, D2), 72 hrs (day 4, D4), and 144 hrs (day 6, D6) following differentiation-induction.

Table 2.1: Media formulations for in vitro differentiation of N/TERT-1 and NHEK- Neo keratinocytes.

DFK0 (Intermediate media)

Medium/supplement Volume/final concentration DMEM (Thermo Fisher Scientific, Cat no. 11965-092) 250 ml Ham’s F12 + Glutamax (Gibco™, Cat no. 31765-035) 250 ml EGF 0.2 ng/ml BPE 25 µg/ml

DFK1 (Priming media)

Medium/supplement Volume DFK0 (see table above) 250 ml Complete KSFM 250 ml (without calcium chloride supplementation)

DFK2 (High calcium chloride media)

Medium/supplement Volume/final concentration DFK0 (see table above) 250 ml Complete KSFM 250 ml (without calcium chloride supplementation) Calcium chloride 1.23 mM

2.1.3 Short Hairpin RNA (shRNA) Expression Constructs Lentiviral shScrambled, shKAT2A, and shKAT2B were provided by Transomic Technologies™ in the Zip-mCMV (mouse cytomegalovirus) and Zip-hEF1-alpha (human elongation factor-1 alpha) vectors (Table 2.2). The Zip vectors constitutively expressed shScrambled/shKAT2A/shKAT2B, a ZsGreen fluorescent marker, and an antibiotic selection marker (puromycin, puro; or blasticidin, blst) from a single transcript driven under either a mCMV or hEF1-alpha promoter (Figure 2.1). N/TERT-1 cells were transduced with mCMV containing vectors, whilst hEF1-alpha containing vectors were used for transducing NHEK-Neo since transgene expression was highest with this promoter in primary cells.

Table 2.2: shScrambled, shKAT2A, and shKAT2B shRNA sequences.

shRNA shRNA sense sequence (5’-3’) shScrambled (ULTRA-NT#4, TLNSU4420) AAGGCAGAAGTATGCAAAGCAT shKAT2A#1 (ULTRA-3268840) ACGCCCTGGAGAAGTTCTTCTA shKAT2A#2 (ULTRA-3268839) ACCCAAATCAAGTCTCACCCC shKAT2B#1 (ULTRA-3409355) CACCAAACAAGTTTATTTCTA shKAT2B#2 (ULTRA- 3427172) CGCAGATGAATATGCAATTGG

Figure 2.1: Components of the pLenti-Zip lentiviral vector. mCMV (mouse cytomegalovirus) and hEF1-alpha (human elongation factor-1 alpha) promoters drive strong short hairpin RNA (shRNA) expression. ZsGreen reporter enables visual confirmation of transduction efficacy. IRES: internal ribosome entry site, allows for the expression of ZsGreen and antibiotic resistance genes (puromycin or blasticidin) on a single transcript. CMV-LTR and 3’LTR: long terminal repeats, enables integration of genetic material into the host genome. WPRE: Woodchuck hepatitis post-translational regulatory element, enhances transgene expression in target cells. 57

2.1.4 Generation of KAT2A Expression Constructs Kang Ting Lee, an undergraduate student currently studying at the National University of Singapore, kindly assisted in generating KAT2A expression constructs for this study.

Full-length wild-type KAT2A coding sequence (CDS) was polymerase chain reaction (PCR) purified from N/TERT-1 complementary DNA (cDNA) and cloned into the pCR™ BluntII- TOPO™ vector (Thermo Fisher Scientific). This clone was used as template to sequentially introduce silent mutations at the target regions of shKAT2A#1 using specifically designed primers (Table 2.3) by site-directed mutagenesis (SDM) with the Q5 Site-Directed Mutagenesis Kit (New England BioLabs, Cat No. E0554S) to generate shRNA-resistant full- length KAT2A CDS. Positive clones were sequenced by Sanger sequencing to verify the mutations. The resultant shRNA-resistant full-length KAT2A CDS was used as template for the generation of the various KAT2A “wild type” (WT) and mutant expression plasmids. The “WT” KAT2A construct was created by using FlagKAT2Acds F1, FlagKAT2Acds R1 forward and reverse primers (Table 2.3) to amplify the full-length shRNA-resistant KAT2A CDS and subcloned into the pLenti-P2A-Bsd vector (Figure 2.2). The KAT2A glutamic acid 575 arginine (E575R) mutant was generated by site-directed mutagenesis to change two bases at position 1723-1724 from guanine (G) adenine (A) to AG in the KAT2A CDS using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies, Cat no. 200521) with oligos hKAT2A-E575R SDM top/bot (Table 2.3). The resultant KAT2A E575R sequence was PCR amplified using FlagKAT2AcdsF1, FlagKAT2Acds R1 primers and subclones into the pLenti-P2A-Bsd expression vector. The bromodomain deleted ΔBr mutant was generated by PCR amplification using FlagKAT2Acds F1, FlagKAT2Acds R2 primers to amplify bases 1-2169 of KAT2A CDS (resulting in a 723 amino acid protein that lack the C-terminal bromodomain) and subcloned into the pLenti-P2A-Bsd vector. The ΔN- KAT2A construct was made by PCR amplification using FlagKAT2AcdsF3, FlagKAT2AcdsR1 primers to amplify bases 1084-2514 of KAT2A CDS (resulting in deletion of amino acids 1-361 of wildtype KAT2A) and subcloned into the pLenti-P2A-Bsd vector. In all KAT2A constructs, a FLAG tag sequence was introduced N-terminally of KAT2A by including the FLAG-HA sequences in the forward primers.

Table 2.3: Primers used for cloning KAT2A expression constructs

Primer name Sequence (5’-3’) F- AAAAATTTTTTTACTTCAAGCTCAAGGAGG hKAT2A-shRes#40 SDM R- CAAGAGCACTGGCACAGCGGCAGT top-CCCAGGGCTTCACGAGGATTGTCTTCTGTGC hKAT2A-E575R SDM bot-GCACAGAAGACAATCCTCGTGAAGCCCTGGG GAATTCGCCACCATGGATTACAAGGATGACGACG FlagKAT2AcdsF1 ATAAGATGGCGGAACCTTCCCAG GAATTCGCCACCATGGATTACAAGGATGACGACG FlagKAT2AcdsF3 ATAAGATGCTGGAGGAGGAGATC

FlagKAT2AcdsR1 TCTAGACTTGTCAATGAGGCCTCC

FlagKAT2AcdsR2 TCTAGACACAGGGATCTGCCTCAC

Figure 2.2: Circular map of plasmid vector pLenti-FLAG KAT2A-P2A-BSD used for cloning KAT2A expression constructs. Ori = Origin of replication, BSD = Blasticidin deaminase gene, WPRE = Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element, AmpR = Ampicillin Resistance gene, RRE = HIV-1 Rev Response Element. Restriction sites: KpnI, Xbal, EcoRI, claI, and NotI. 59

2.1.5 Lentiviral Production and Transduction Expression constructs were co-transfected with lentiviral packaging plasmids: A3 tTA, A5 Rev/Tat, A10 VprRTIN, A19 VSVG, and A23 GagPro (GE Dharmacon) into 50-60% confluent 293T cells with lipofectamine 2000 reagent (Invitrogen, Cat no. 11668030). One to two 10cm dishes were used to generate virus for a single expression construct. Lentiviral supernatant harvested at 48 hrs and 72 hrs post-transfection was pooled and filtered through a 0.45 μm filter. Virus was then pelleted at 19 600 rpm for 2 hrs at 22°C in a Beckman ultracentrifuge using a SW28 rotor (Beckman Coulter, Cat no. 342204). The resulting viral pellet was resuspended in 300 ul of KSFM or KGM-Gold and transferred to a microcentrifuge tube. Protein contaminants were removed by centrifuging the viral suspension at max speed in a microcentrifuge for 5 mins at 4°C. Viral suspensions containing constructs expressing the ZsGreen fluorescent marker were titrated in N/TERT-1 keratinocytes using serial dilutions of the viral stock. These cells were then analysed by flow cytometry to determine the proportion of ZsGreen-positive cells, which was then inputted into the following equation to calculate the number of transducing units/ml: (P x (C/V)) x DF. Where P = % of GFP-positive cells, C = total number of transduce cells, V = volume (ml) of virus added to the wells, and DF = dilution factor of the viral stock.

Transduction of N/TERT-1 and NHEK-Neo keratinocytes was achieved by seeding the cells with the viral stock at a multiplicity of infection of 3 or 15, respectively, in the presence of 8 μg/ml of polybrene (Sigma-Aldrich, Cat no. H9268). After 72 hrs, N/TERT-1 transductants were selected using 1 μg/ml of puromycin (Thermo Fisher Scientific, Cat no. A1113802) for one week. N/TERT-1-shKAT2A#1 cells were transduced with shKAT2B vectors expressing a blasticidin resistance gene and selected using 4 μg/ml blasticidin for one week to generate a stable double knock down cell line. NHEK-Neo transductants were selected by flow sorting cells strongly expressing the ZsGreen fluorescent marker. Following selection, transductants were allowed to recover for one passage before performing experiments.

2.2 Proliferation Assays

2.2.1 Trypan Blue Cell Counting Assay For cell counting experiments, N/TERT-1 cells were seeded in duplicate in a 24 well plate at a density of 20 000 cells/well and allowed to grow to confluency for five days. Every 24 hrs, cells were trypsinised, pelleted, resuspended in an appropriate volume of KSFM, and counted using a haemocytometer.

2.2.2 MTT Cell Proliferation Assay The MTT assay for cell proliferation was performed using the Cell Titer 96® Non- Radioactive Cell Proliferation Assay Kit (Promega, Cat no. G4000). N/TERT-1 keratinocytes were seeded in triplicate in 100 μl of KSFM at a density of 3000 cells/well in 96 well plates and cultured to confluency. Every 24 hrs, 15 μl of Dye Solution was added into each well and incubated at 37°C for 4 hrs. After incubation, 100 μl of Solubilisation Solution was added to stop the reaction before measuring the absorbance of the reaction at 570 nm using a SPECTRAmax™ 250 microplate reader (Molecular Devices, Cat no. 0112- 0024).

2.2.3 Cell Confluency Assay N/TERT-1 cell lines were seeded in triplicate at 8000 cells/well in 12 well plates. KSFM was replenished 24 hrs later and the plates were placed in the IncuCyte ZOOM® Live-Cell Imaging System (Essen Bioscience) to capture phase-contrast images every hour for four days. The IncuCyte software was used to calculate the percentage confluency of the cells during this period.

2.3 Gene Expression Analysis

2.3.1 RNA Extraction The bench and equipment were decontaminated with RNase AWAY™ (Thermo Fisher Scientific Cat no.10666421). Cells were cultured in 6 well plates for total RNA extraction. Cell culture media was completely aspirated away and 1 ml of TRIzol™ (Trizol, Invitrogen™, Cat no. 15596026) was added to each well and incubated at room temperature (RT) for 5 mins on a rocker at medium speed. The trizol lysate was then passed through a 1 ml pipette tip three times whilst scraping across the entirety of the well before transferring to a 1.5 ml Eppendorf tube. The trizol lysate was vigorously shaken with 200 μl of chloroform (Merck Millipore, Cat no. 102445) for 30 secs then allowed to incubate for 2 min at RT before centrifuging at 12 000 xg at 4°C for 15 mins. The aqueous layer was taken and mixed well with equal volumes of 70% ethanol (Merck Millipore, Cat no. 100983). This was then transferred to a RNeasy Mini Spin Column (Qiagen, Cat no. 74104) and centrifuged at 8000 xg for 30 secs. The flow-through was discarded and 700 μl of RW1 buffer was added to the column before centrifuging again at 8000 xg for 30 secs. The flow-through was discarded and 500μl of RPE was added to the column and centrifuged at 8000xg for 30 secs. The flow through was discarded and another 500 μl of RPE was added to the column and centrifuged for 8000xg for 2 mins. The column was then transferred to a fresh collection tube and centrifuged dry at 8000 xg for 1 min. Finally, purified RNA was eluted in 30-50 μl of water and the quality and concentration was determined using the Nanodrop ND-1000 (Thermo Fisher Scientific). 260/280 ratios for all RNA samples used in this study indicated high RNA purity (2-2.1).

2.3.2 cDNA Synthesis (Reverse Transcription) 1 μg of total RNA was converted to cDNA using the High-Capacity cDNA reverse transcription kit in a reaction volume of 20μl according to the manufacturer’s instructions (Thermo Fisher Scientific, Cat no. 4368814). A minus-reverse transcriptase controls was included in all conversions to detect for false positive readings from genomic DNA contamination. Synthesised cDNA was then diluted 1:5 with water for quantitative polymerase chain reaction (qPCR) analysis. Components and cycling conditions for cDNA synthesis are outlined in Tables 2.4 and 2.5, respectively.

Table 2.4: Reaction components for cDNA synthesis

Components Volume per reaction (μl) 1 μg RNA 10 10X Reverse transcriptase buffer 2 10X Reverse transcriptase random primers 2 25X 100mM dNTP mix 0.8 MultiScribe™ Reverse Transcriptase (50 units/μl) 1 RNaseOUT (ribonuclease inhibitor) (40 units/μl) 1 Nuclease-free water 3.2 Total 20

Table 2.5: Cycling conditions for cDNA synthesis

Temperature (°C) Duration (mins) 25 10 37 120 85 5 4 ∞

2.3.3 Quantitative-PCR qPCR reactions were set up using 2 μl of cDNA sample, PowerUp™ SYBR™ Green Master Mix (Applied Biosystems™, Cat no. A25742) and forward/reverse primers to a total volume of 10 μl (Table 2.6). All primers used in this study (Table 2.7) demonstrated high specificity (single melt curve peak and one product on an agarose gel) and efficiency (cDNA standard curve, R2 value >0.99). Samples were loaded into 384 well plates and qPCR was performed using the QuantStudio 7 Flex Real-time PCR System (Applied Biosystems™, Cat no.4485701) according to the thermal profile specified in Table 2.8. Target gene expression levels were normalised to the housekeeping genes: 60S ribosomal protein L13a ribosomal protein (RPL13A) and cyclophilin A (CYPA). Relative fold change was calculated using the 2-ΔΔCT method. All graphs represent the mean of three biological replicates with error bars denoting ±s.d. Statistically significant differences between the means of control and experimental groups were evaluated by log transforming fold changes and applying a one- way ANOVA with Tukey post-hoc test.

Table 2.6: Reaction mixture for qPCR

Components Volume per reaction (μl) 2X PowerUp SYBR Green Master Mix 5 Forward + Reverse gene specific primer mix, 10 μM 0.2 1:5 diluted cDNA 2 Nuclease-free water 2.8 Total 10

Table 2.7: Sequence of forward (F) and reverse (R) primers used for qPCR Gene Primer sequence (5’-3’) F-CCATTGTGGACGTGCTGACCAA ANXA9 R-GAGCCATCACAATCCTCTCCAG F-TTGACTCCTTGCTGAATCTG CLDN1 R-TTCTATTGCCATACCATGCT F-AGTGCAAGGTGTACGACTCGCT CLDN4 R-CGCTTTCATCCTCCAGGC AGTT F-ATGCTGGACCCAACACAAAT CYPA R-TCTTTCACTTTGCCAAACACC F-CCCACAGTGATGATGTCGAG Dap R-GCTGCTTCAGCTGCTTCTTC F-CACAACAAATTTTCATGGGTGA DSG3 R-TCATCTGCATCTGTGGCATT F-CGGGACATCTTGACCATTGA ECM1 R-GTGGATCAGCCCAGGAATATG F-TCATCATGAAGCTTCCTCTCAG FLG R-CCCTCACTGTCACTGTCCTG F-TGCCTCAGCCTTACTGTGAGT IVN R-TCATTTGCTCCTGATGGGTA F-GTGTACCCAGACAAAACCCG KAT1 R-CACAAGCACAAAGTCTCGTAAT F-TCCTCACTCACTTCCCCAAA KAT2A R-TTGGAGAGTTTGCCCCATAG F-CTGCGATCTCCCAATGATG KAT2B R-CTGTGGCACGTTGCAGTAA F-GCCAGAATCACCCTGAAGC KAT3A R-TTTCCCCAGAATCCACAAAC F-TCGAAATCATCTTGTTCACAAAC KAT3B R-AGGTTTTCCATCCGTCTGTCT F-CCTTCTTTGAGATTGATGGACGT KAT5 R-ACGATGTGGAAGCCCTTACA F-TGCTGAACCAATCCCCATCT KAT6A R-CGTAAGGCCTTCACTCGAAC

Table 2.7: Continued Gene Primer sequence (5’-3’) F-TGAAGAGCCAAACGATACTCC KAT7 R-CAGAGATTGAACCTTTGCGATA F-CCCGAAGACTATGGGAAACA KAT8 R-GAGATGTTGCTCTTGCGGTA F-CCCGAAGACTATGGGAAACA KAT8 R-GAGATGTTGCTCTTGCGGTA F-GAGGCAGAAGCGGAAAGGAGA KAT9 R-CCTGCTCGTGGGCTTCAATC F-CGACCTTCTGTTTCTGCCAA KRT10 R-TGAGACGTAATGTACAAGCTCTG F-GAGGAAGAAAGCACCATTGAGA KRTDAP R-TCAGGAACTCATCAGCCTTAAAC F-ACTCAACTCCTGCCAAGATG LCE3D R-ACACTGTACTGGGCTCTTTG F-CATCTCAACTCCTGCCAAGAT LCE3E R-CAGACACTGTACTGGGTTCTTT F-CGACAGAGATGAAGTCCGGT MMP1 R-TCTAGGGAAGCCAAAGGAGC F-ATGCCATCCCCGATAACCT MMP2 R-TGCTTCCAAACTTCACGCTC F-GACCTGGAAATGTTTTGGCCC MMP3 R-TGGCCAATTTCATGAGCAGC F-TGAAGTTAACAGCAGGGACACC MMP10 R-GGCTCAACTCCTGGAAAGTCA

F-TCACGATGGCATTGCTGAC MMP13 R-CTCATGCGCAGCAACAAGA F-ACAGACTACACAACTGGCGG OCLN R-TCCTGTAGGCCAGTGTCAAA F-CAAAGGTCCAGTCTCCACTAAG PI3 R-TGGAGCAGAAGGAACTCTTTATT F-GGGTCTCATGGGTCACTTCTA PPL R-TGCAGAATCTGGAGTTTGCTC F-TGACCAATAGGAAGAGCAACC RPL13A R-AGATGCCCCACTCACAAGAT F-AGACCGAGTGTCCTCAGTATATC S100A8 R-TGCCACGCCCATCTTTATC F-TCATCAGGACCAAGAAAGGATAAG SPRR2A R-GAGAAAGAAGCTCCCTGTGTATC F-GTGGAGACTGAGAAAGGAAGTC SPRR2E R-GGTGACAGACAGACACAGAAA F-CTCGCTCAAGCTGTCATGTAC Thr R-CGGTGATTTCTCACAGATGG F-AGCCATTCCCGAAGGAGTTG TJP1 R-ATCACAGTGTGGTAAGCGCA F-GGACCAGCTAACCAACGACA VIM R-AAGGTCAAGACGTGCCAGAG 65

Table 2.8: qPCR thermal profile Step Temperature (°C) Duration Cycle(s) 1 95 10 mins 1 95 15 secs 2 40 60 1 min

2.3.4 RNA-seq Library Preparation and Resulting Sequencing Data Analysis N/TERT-1 keratinocytes expressing either shScr, shKAT2A, shKAT2B, or both shKAT2A and shKAT2B were cultured in parallel and seeded for three timepoints: subconfluency, which represents a proliferative state; confluency (D0), this timepoint represents the start of differentiation when cells are contact inhibited; and day 4 of differentiation, a time point that represents mid-late keratinocyte differentiation. RNA was harvested using the method described in Chapter 2.3.1 for all timepoints. This experiment was performed on two passages for all cell lines so that a total of 24 samples were harvested for RNA. RNA was extracted and purified from these samples in parallel using the method described in Chapter 2.3.1. The yield and quality of each RNA sample was determined using the nanodrop ND- 1000. Total RNA samples were submitted to collaborators in Doctor Wan Yue’s laboratory at the Genome Institute of Singapore for subsequent processing and sequencing. Total RNA was subjected to polyadenylation (polyA) selection using the Poly(A) Purist MAG kit (Life Technologies, Cat no. AM1922). 100ng of the polyA selected RNA was then used for library preparation using the NEBNext® Ultra™ II Directional RNA Library Prep kit (New England Biolabs, Cat no. E7760L). All 24 cDNA libraries were multiplexed and sequenced on the Next-seq Hi illumine platform, single end reads. Subsequent analysis was performed by bioinformatics collaborators. Refer to the figure legends and main text for cut-off thresholds for fold changes and statistical significance and for software programs used to analyse the RNA-seq data.

2.3.5 Polysome Profiling 8 million N/TERT-1-shScrambled or N/TERT-shKAT2A#1 keratinocytes at subconfluency were treated with 100 μg/ml cycloheximide (Sigma-Aldrich, Cat no. C4859) for 10 mins. Cells were trypsinised, pelleted, washed with phosphate buffered saline (PBS), and resuspended in 140 μl of 2XRSB buffer containing 20 mM Tris-HCl, pH 7.4, 300 mM NaCl,

30 mM MgCl2, 200 μg/ml cycloheximide and 1000 units/ml RNasin (Promega, Cat no. N2111). Shatarupa Das from Doctor Leah Vardy’s lab at the Skin Research Institute of Singapore performed the remainder of the procedure from this point onwards. An equal volume of lysis buffer containing RSB buffer, 1% Triton X-100, 2% Tween-20, and 1% sodium deoxycholate was added and incubated on ice for 10 mins. Extracts were 66 subsequently centrifuged at max speed for 3 mins at 4°C to pellet nuclei. The cell supernatant was taken and spun for an additional 10 mins at 4°C to further clarify. The optical density (OD) units for both subconfluent cell lysates were measured and equal OD units (350 µl of extract) were loaded onto 10-50% linear sucrose gradients (prepared in 10 mM Tris-HCl pH

7.4, 75 mM KCl and 1.5 mM MgCl2) and centrifuged at 36 000rpm for 2 hrs at 8°C in a SW41 rotor (Beckman Coulter, Cat no. 331336). Eleven fractions were collected from the top of the gradient using a Piston Gradient Fractionator™ (BioComp Instruments, B152- 002) which were then stored at -80°C. 6 µl of 20 mg/ml proteinase K (Invitrogen, Cat no. AM2546) and 110 µl of sodium dodecyl sulphate (SDS) was added to each fraction and incubated at 42°C for 30 mins with agitation. Fractions 1-4, 5-7, and 8-11 were pooled corresponding to non-, low- and high-translated fractions, respectively. 10 µl of bacterial spike-in RNAs, Dap and Thr, were added to equal volumes of these fractions. RNA was subsequently purified from these fractions using phenol:chloroform:isoamyl (Invitrogen, Cat no. 15593031) extraction and the quality and concentration was assessed using a Nanodrop ND-1000. Equal volumes of RNA were used to synthesise cDNA as described in Chapter 2.3.2 and qPCR was performed for KAT2A, KAT2B, TBP, Dap, and Thr as described in Chapter 2.3.3. KAT2A, KAT2B, and TBP cycle threshold (Ct) values were normalised to those of Dap and Thr. Relative RNA levels were expressed as a percentage of the total RNA in each pool, with all three pooled fractions representing 100% RNA. To account for variation in polysome extraction, two cultures from control and N/TERT-shKAT2A#1 keratinocytes were processed and analysed in parallel corresponding to two technical replicates.

2.3.6 RNAscope® In Situ Hybridization The cryostat and blade were sprayed with 100% ethanol prior to sectioning human skin biopsies embedded in Tissue-Tek® Optimal Cutting Temperature compound (OCT; Sakura®, Cat no. 27050) at 15 μm onto Superfrost® Plus microscopic slides (Thermo Fisher Scientific, Cat no. J1800AMNT). Freshly cut sections were allowed to fully adhere onto the slide for 1 hour inside the cryostat. Sections were fixed in 4% paraformaldehyde at 4°C for 15 mins before being dehydrated through an increasing ethanol gradient: 50%, 70%, 100%. Sections were then dried and demarcated using an ImmEdge™ hydrophobic barrier pen (Vector Labs, Cat no. H4000). Hydrogen peroxide was applied to each section for 10 mins at RT before incubation with protease IV for 30 mins at RT. Sections were then processed according to the RNAscope® 2.5 HD RED chromogenic assay protocol provided by the manufacture. Briefly, sections were incubated for 2 hrs at 40°C with the appropriate probe: KAT2A, KAT2B, PPIB (positive control) or dapB (negative control). Slides were then washed twice 67 for 2 mins each at RT with RNAscope® Wash Buffer. This was then followed by sequential hybridizations with six amplification probes, alternating between 30 mins and 15 mins incubation at 40°C. After washing in RNAscope® Wash Buffer, sections were incubated for 10 mins at RT with RNAscope® RED Working solution. This was then washed off with tap water and the sections were counterstained with 50% Gill’s Haematoxylin I staining solution (Sigma-Aldrich, Cat no. GHS132) for 3 mins at RT. Nuclei were then blued using 0.02% ammonia water before drying at 60°C for 15 mins. Finally, slides were mounted with DPX (Sigma-Aldrich, Cat no. 06522) and visualised using a Zeiss AxioImager GU brightfield microscope with a 40X objective.

2.4 Analysis of Relative Levels and Subcellular Localisation of Proteins

2.4.1 Whole Cell Protein Extraction Keratinocyte cultures were rinsed twice with ice-cold PBS then lysed with ice-cold radioimmunoprecipitation assay buffer (RIPA, Thermo Fisher Scientific, Cat no. 89901) containing freshly added protease inhibitors: 1 mM DTT, 1X cOmpleteTM Protease Inhibitor Cocktail (Roche, Cat no. 11697498001), and 1 mM PSFM. RIPA was also supplemented with 1 mM sodium butyrate, to inhibit HDAC activity, and 0.9% SDS. Cells were gently scrapped into the appropriate volume of RIPA buffer (Table 2.9), passed ten times through a 1 ml pipette tip, then transferred to a 1.5ml Eppendorf on ice to incubate for 15 mins. Lysates were finally passed through a 27-gauge needle ten times and then snap frozen prior to storage in a -80 freezer.

Table 2.9: RIPA buffer volumes used for protein extraction of cultured keratinocytes

Timepoint Vessel Volume of RIPA (μl) Subconfluence 6 cm 100 Confluence (D0) 6 well 250 D2 6 well 425 D4 6 well 500 D6 6 well 500

2.4.2 Subcellular Fractionation for Protein Analysis Nuclear and cytoplasmic fractions were generated according to the protocol described by Gagnon et al. (2014). Briefly, confluent cells cultured in two 10 cm dishes were trypsinised and pelleted before rinsing in ice-cold PBS. The pellet was then gently resuspended in hypotonic lysis buffer (HLB, 10 mM Tris (pH 7.5), 10 mM NaCl, 3 mM MgCl2, 0.3% (vol/vol) NP-40 and 10% (vol/vol) glycerol) and incubated on ice for 5 mins before centrifuging at 800 xg for 8 mins. The supernatant (the cytosolic fraction) was transferred to a new tube containing 140 mM NaCl and gently inverted. The nuclear pellet was gently washed four times with HLB before being resuspended in nuclear lysis buffer (20 mM Tris (pH 7.5), 150 mM KCl, 3 mM MgCl2, 0.3% (vol/vol) NP-40 and 10% (vol/vol) glycerol). This was then sonicated at low power thrice using a Diagenode Bioruptor® standard sonicator for 15 secs with 2 min cooling intervals in a cold room. Finally, the nuclear extract was clarified and transferred to a fresh tube.

2.4.3 SDS PAGE and Western Blotting 10-20 μg of protein extract was mixed with Laemmli sample buffer (Bio Rad, Cat no. 161- 0747) and heated at 95°C for 5 mins. Denatured samples were then loaded onto mini handcasted SDS polyacrylamide gels and separated using Mini-PROTEAN® Tetra Vertical Electrophoresis Cell equipment (Bio Rad, Cat no.1658004) at 200 V for 1 hour in tris/glycine/SDS buffer (25 mM Tris, 192 mM glycine, 0.1% SDS). Proteins were transferred onto nitrocellulose membranes (GE Healthcare, Cat no. GE10600002) using the Mini Trans- Blot® Cell (Bio Rad, Cat no. 1703930) in cold Towbin transfer buffer (25mM Tris, 190mM glycine, 20% methanol) at 0.25Amps (constant current) for 1 hour with an ice pack. Non- specific binding was blocked by incubating transferred membranes in tris-buffered saline with 0.1% Tween-20 (TBST, Sigma-Aldrich, Cat no. P9416) containing 5% nonfat dried milk power (Marvel, UK) for 30 mins with gentle agitation. Membranes were then incubated overnight at 4°C in primary antibody (Table 2.10) diluted in blocking buffer. Membranes were then washed thrice in TBST for 15 mins before being incubated with horseradish peroxidase (HRP)-conjugated secondary antibody diluted 1:10 000-1:20 000 in blocking buffer for 1 hour at RT (Table 2.11). Membranes were then washed thrice in TBST for 15 minutes before applying Clarity Western ECL substrate (Bio Rad, Cat no. 1705061) for 5 mins at RT. Membranes were then visualised using CL-XPosure Film (Thermo Fisher Scientific, Cat no. 340900).

Table 2.10: Primary antibodies used for Western blotting

Antibody (clone) Host Manufacturer Cat no. Dilution Mouse Beta-actin (AC-15) Sigma-Aldrich A5441 1:50 000 monoclonal Mouse Beta-tubulin (AA2) Sigma-Aldrich T8328 1:40 000 monoclonal Mouse BD Transduction E-cadherin (36) 610181 1:5000 monoclonal Laboratories Mouse Filaggrin (FLG01) Invitrogen MA5-13440 1:500 monoclonal Mouse FLAG (M2) Merck Millipore F3165 1:5000 monoclonal Rabbit Cell Signaling GCN5L2 (C26A10) 3305 1:4000 monoclonal Technology Rabbit H3K14ac (EP964Y) Abcam ab52946 1:4000 monoclonal Rabbit H3K18ac Abcam ab1191 1:5000 polyclonal Rabbit H3K27ac Diagenode C15410196 1:4000 polyclonal Rabbit H3K27me3 Merck Millipore 07-449 1:3000 polyclonal Rabbit H3K4me1 Abcam ab8895 1:6000 polyclonal Rabbit H3K4me3 Merck Millipore 07-473 1:2000 polyclonal Rabbit H3K79suc PTM Biolabs PTM-412 1:2000 polyclonal Rabbit H3K9ac Abcam ab 4441 1:5000 polyclonal Rabbit Histone H3ac Merck Millipore 06-599 1:10 000 polyclonal Rabbit Involucrin Covance PRB-140C-200 1:1000 polyclonal

Table 2.10: continued from previous page

Antibody (clone) Host Manufacturer Cat no. Dilution Rabbit KAT2A (S.775.4) Invitrogen MA514884 1:4000 monoclonal Mouse KAT2B (E-8) Santa Cruz SC-13124 1:1000 monoclonal Keratin 10 Rabbit Abcam ab76318 1:20 000 (EP1607IHCY) monoclonal Mouse Lamin A+C (Jol2) Abcam ab40567 1:1000 monoclonal Loricrin Rabbit Abcam ab176322 1:3000 [EPR7148(2)(B)] monoclonal Rabbit PanH3 Abcam ab1791 1:40 000 polyclonal Rabbit Novus TGM1 NB-100184 1:2000 polyclonal Biologicals Goat Vimentin (C-20) Santa Cruz SC-7557 1:3000 polyclonal

Table 2.11: Horseradish peroxidase-conjugated antibodies used for Western blotting

Antibody (clone) Host Brand Cat no. Dilution anti-Mouse IgG-heavy and light Donkey Bethyl A90-337P 1:20 000 chain cross-adsorbed polyclonal Laboratories anti-Rabbit IgG-heavy and light Donkey Bethyl A120-208P 1:20 000 chain cross-adsorbed polyclonal Laboratories anti-Goat IgG-heavy and light Donkey Bethyl A50-101P 1:20 000 chain polyclonal Laboratories

2.4.4 Immunofluorescence-labelling in Cultured Cells and Tissues N/TERT-1 and NHEK-Neo cells were cultured in Nunc™ Lab-Tek™ II Chamber Slide™ (Thermo Fisher Scientific, Cat no. 155382) and fixed with 4% paraformaldehyde (Sigma- Aldrich, Cat no. P6148-500G) in PBS, pH7.4 at RT for 10 mins. Cells were then washed thrice in PBS before being permeabilised with 0.2% Triton X-100/0.5% SDS/PBS for 10 mins at RT. Cells were then washed thrice in PBS and incubated in blocking buffer (1% BSA/5% normal goat serum/PBS containing 0.1% Tween-20) for 1 hour at RT. Cells were then incubated overnight at 4°C with primary antibody (Table 2.12) diluted in blocking buffer. Following three washes in PBS, the cells were then incubated for 1 hour in the dark with fluorophore-conjugated secondary antibodies diluted 1:200 in blocking buffer (Table 2.13). Finally, cells were washed thrice in PBS, stained with DAPI (Sigma-Aldrich, Cat no. D9542) for 10 mins, and imaged using Olympus FV1000 confocal microscope. Human skin fresh frozen in OCT was cryosectioned at 7 μm and immunolabelled in the same manner as above. These skin biopsies were sourced from the National University Hospital and Singapore General Hospital. Patients’ written consent was obtained in all cases.

Table 2.12: Primary antibodies used for immunofluorescence staining

Antibody (clone) Host Brand Cat no. Dilution Claudin 1 (2H10D10) Mouse Thermo Fisher 374900 1:100 monoclonal Scientific E-Cadherin (36) Mouse BD Transduction 610181 1:200 monoclonal Laboratories Filaggrin Rabbit Abcam Ab81468 1:100 polyclonal H3K9ac Rabbit Abcam Ab4441 1:200 polyclonal Histone H3 (PanH3) Rabbit Abcam Ab1791 1:300 polyclonal KAT2A (S.775.4) Rabbit Thermo Fisher MA5-14884 1:100 monoclonal Scientific Keratin 10 (DE-K10) Mouse Thermo Fisher MA5-13705 1:100 monoclonal Scientific

Table 2.13: Alexa Fluor®-conjugated antibodies used for immunofluorescence

Antibody (clone) Host Brand Cat no. Dilution anti-Rabbit IgG (H+L) Cross- Goat Adsorbed Secondary Antibody, Invitrogen A-11011 1:200 polyclonal Alexa Fluor 568 anti-Mouse IgG (H+L) Highly Mouse Cross-Adsorbed Secondary Invitrogen A-11031 1:200 polyclonal Antibody, Alexa Fluor 568

CHAPTER 3 DYNAMICS IN GLOBAL HISTONE H3 MODIFICATIONS AND A SWITCH IN KAT2A AND KAT2B EXPRESSION ARE HALLMARKS OF DIFFERENTIATING KERATINOCYTES

3.1 Introduction

The epigenomic landscape differs between pluripotent and lineage-restricted human embryonic cells, suggesting that chromatin states are linked to cell fate (Ahmed et al., 2010; Fisher and Fisher, 2011; Hawkins et al., 2010a). Despite having more restricted differentiation capacities compared to embryonic stem cells, adult tissue stem cells in haematopoietic, nervous, and intestinal tissues also have distinct chromatin signatures that change as the cells transition from uncommitted to differentiated states (Cui et al., 2009; Marshall and Brand, 2017; Raab et al., 2019). This also seems to be true for epidermal cells, although evidence is incomplete and conflicting, likely because of interspecies differences (mouse vs human), variations in culture systems, poorly validated reagents (non-specific histone antibodies), and technical pitfalls. In basal keratinocytes, the chromatin landscape must be appropriate to permit the expression of stemness-associated genes but limiting for the expression of differentiation genes. Upon commitment to differentiate, the chromatin landscape undergoes dramatic changes so that it is appropriate for the differentiation gene expression program to proceed. Dynamics in histone PTMs are integral to this process but are substantially underexplored in adult human epidermal homeostasis. Studies have demonstrated the importance of HDAC1/2 in maintaining the proliferative and stratification capacities of epidermal cells during mouse development (LeBoeuf et al., 2010). Thus, global changes in histone acetylation may influence epidermal stem cell self-renewal and terminal differentiation. Indeed, one study found higher levels of global histone H4 acetylation in differentiating epidermal cells compared to the β1-integrin expressing interfollicular epidermal stem cells by means of IF labelling of wholemount adult human skin (Frye et al., 2007). However, four years later, the same group reported a global decrease in histone H3 and H4 acetylation levels upon shape-induced terminal differentiation of human primary keratinocytes in vitro and suggested that histone deacetylation is essential for keratinocyte differentiation (Connelly et al., 2011). The apparent contradiction in these studies reveal significant gaps in our understanding of how chromatin acetylation dynamics impacts epidermal cell fate decisions. This led us to seek a more robust characterisation of the histone acetylome profiles in stem versus differentiated epidermal cells and clarify the roles of HATs 74 in regulating the delicate balance between self-renewal and terminal differentiation in epidermal homeostasis.

3.1 Calcium-induced differentiation of keratinocyte monolayers mirrors in vivo epidermal homeostasis

A controlled in vitro human keratinocyte culture system was used in this study. Before conducting experiments, this system was validated to ensure that it properly and reliably recapitulated in vivo human epidermal homeostasis in terms of the morphological and gene/protein expression changes that occur with differentiation.

Immortalised human keratinocytes, N/TERT-1 (Dickson et al., 2000), or primary keratinocytes isolated from human foreskin, NHEK-Neo, were cultured in the self-renewing stem cell-like state under conditions of subconfluent growth in low calcium-containing media (0.3 mM) in the absence of a feeder-layer and serum (see Chapter 2.1.1). These cells can be induced to progressively terminally differentiate by culturing to high confluency in high-nutrient medium containing 1.8 mM calcium chloride for up to six days (DFK2, Figure 3.1). Culturing N/TERT-1 or NHEK-Neo cells in this manner for up to six days recapitulated the morphologies typically observed in stratified human skin (Figure 3.2). Subconfluent N/TERT-1 cells were small, polygonal in shape, and highly proliferative as indicated by a large proportion cells with mitotic figures. These cells also adopted scattered arrangements at this timepoint with infrequent cell-cell contact. When cultured to confluency the number of mitotic figures was greatly reduced due to contact inhibition. By day 2 of differentiation N/TERT-1 cells adopted cobblestone morphologies. At day 4 of differentiation a large proportion of cells had nuclear membranes that were faded or indistinct, characteristic of terminal differentiation. Additionally, there was evidence of stratification in discrete areas of the culture. These areas were populated superficially by large flattened cells. By day 6 of differentiation there were large areas of the culture showing multiple layers of stratified cells (Figure 3.3). The morphologies of NHEK-Neo cells closely resembled that of NTERT-1 cells except they were slightly larger at subconfluency and across the course of differentiation (Figure 3.2). This seems to be a consequence of differences in media formulation between KSFM and KGM-Gold as NHEK-Neo cells were morphologically indistinguishable from N/TERT-1 cells when cultured in KSFM. 75

Figure 3.1: A schematic representation of the keratinocyte differentiation culture system workflow timeline. Immortalised (N/TERT-1, above) and primary (NHEK-Neo, below) human keratinocytes are seeded at the indicated cell densities to achieve a confluency of 70% at day 3 of culture and 100% at day 4 of culture, respectively. At this timepoint, media is switched from a low nutrient, serum-free media containing 0.4 mM of calcium chloride (KSFM) to DFK1, a high nutrient media that primes keratinocytes for differentiation. Following overnight culture in DFK1, media is switched with fresh DFK1 containing 1.8 mM calcium chloride (DFK2) to progressively induce terminal differentiation over a period of 6 days. Protein and RNA are harvested at the indicated timepoints in addition to a proliferative, subconfluent timepoint.

Figure 3.2: Calcium-induced differentiation of keratinocyte monolayers recapitulates cellular morphologies observed in vivo. Phase contrast micrographs of immortalised (left) and primary (right) keratinocyte monolayers prior to- (sub, day 0) and post-differentiation (days 2, 4, and 6). 20x objective. Scale bar = 200μm. 77

Figure 3.3: Keratinocyte monolayers stratify in medium containing 1.8mM calcium ions. A photograph depicting NHEK-Neo cells differentiated for six days in a 6cm dish. Arrow points to a mound of differentiated keratinocytes projecting away from the vessel surface.

To assess if N/TERT-1 cells appropriately transit through early and late differentiation events in this culture system, IF labelling for KRT10 (early marker) and filaggrin (late marker) was performed on these cells at subconfluency and day 6 of differentiation. IF signal for KRT10 and filaggrin was only detectable in differentiated N/TERT-1 cells and not in subconfluent, undifferentiated cultures. Moreover, high levels of signal for KRT10 and filaggrin localised to stratified cells whilst cells situated below, in contact with the vessel surface, exhibited negative or weak signal (Figure 3.4).

Western blotting was used to further assess the expression patterns of differentiation markers in a more quantitative manner across more timepoints of the culture system (Figure 3.5). KRT10 was expressed at increasingly high levels soon after induction of differentiation in both N/TERT-1 and NHEK-Neo keratinocytes. In proliferative (subconfluent) and confluent N/TERT-1 and NHEK-Neo protein lysates, KRT10 levels were only detectable at exposures exceeding 30 minutes. Loricrin, a structural protein of the late cornified envelope, was only detectable at day 4 and day 6 of differentiation and could not be detected at longer exposures in both subconfluent N/TERT-1 and NHEK-Neo lysates.

Following transfer of the separated proteins to a nitrocellulose membrane, Ponceau S was used to stain for total protein to assess broad changes in the proteome with differentiation (Figure 3.5). The N/TERT-1 total protein profile changed dramatically soon after differentiation-induction. Notably, there was a greater abundance of 37-50kDa proteins and proteins <30kDa upon differentiation compared to undifferentiated timepoints. Furthermore, there was a depletion of some proteins of 50-75kDa. These differences were more apparent 78 in the N/TERT-1 protein lysates compared to the NHEK-Neo protein lysates. Nonetheless, the total protein profiles of NHEK-Neo protein lysates were similar to those observed in the NHEK-1 protein lysates at the same timepoints. Therefore, the differentiation stimuli employed (elevated concentration of calcium chloride, high-nutrient media, and confluency) was sufficient to lead to extensive changes to the keratinocyte proteome in vitro.

Figure 3.4: Keratinocyte monolayers treated with 1.8mM calcium ion levels express keratin 10 and filaggrin. Keratin 10 (green) and filaggrin (red) were immunolabelled and visualised with an immunofluorescence dye. Z-stack images were captured using confocal microscopy and then maximally projected. Nuclei were labelled using DAPI (Blue). Keratin 10 and filaggrin signal is undetectable in undifferentiated cells but is intense in differentiated, stratified cell populations. 79

Figure 3.5: Keratinocyte monolayers treated with 1.8mM calcium ion levels express keratin 10 and loricrin. Western blotting was performed for an early (keratin10) and late (loricrin) differentiation marker in undifferentiated (subconfluent, day 0) and differentiated (days 2-6) N/TERT-1 and NHEK-Neo keratinocytes. High levels of both markers are only detectable upon differentiation. Ponceau S staining revealed changes to the total protein profiles upon differentiation in both keratinocyte cell lines. kDa = kilodalton. 80

The kinetics and patterns of differentiation gene expression were assessed in N/TERT-1 and NHEK-Neo keratinocytes to determine if the differentiation system recapitulates the transcriptional changes that occur during human epidermal homeostasis in vivo. Using qPCR, large increases in transcript abundance were measured for KRT10, involucrin (IVL), and filaggrin (FLG) following differentiation-induction (Figure 3.6). KRT10 was upregulated modestly at confluency (25-fold increase) and dramatically upon differentiation-induction. KRT10 mRNA levels peaked at day 4 of differentiation for N/TERT-1 cells (7255-fold increase) and NHEK-Neo cells (3583-fold increase). Similarly, IVL was modestly upregulated at confluency in N/TERT-1cells (3-fold increase). IVL expression peaked at day 6 for N/TERT-1 (513-fold increase) and NHEK-Neo cells (109- fold increase). FLG was modestly upregulated at confluency in N/TERT-1 cells (4-fold increase). FLG expression peaked at day 6 in N/TERT-1 cells (6865-fold increase) and NHEK-Neo cells (854-fold increase).

Overall, I found that this differentiation system appropriately recapitulated the key morphological, biochemical, and behavioural changes that occur during human epidermal homeostasis in vivo in a manner that was predictable and easily controlled. Keratinocytes maintained at subconfluency in KSFM containing 0.4 mM calcium chloride were considered akin to stem/progenitor cells of the basal epidermis due to their high proliferation rate and undifferentiated state. Keratinocytes cultured to confluency in the absence of high calcium chloride levels were considered to be in an undifferentiated but primed state, whereby cell proliferation is contact inhibited. Keratinocytes cultured for 2 days in high nutrient media containing 1.8mM calcium chloride have morphologies and differentiation marker expression profiles (high early marker expression but low late marker expression) similar to that of committed cells situated in the spinous layers of the human epidermis. Finally, keratinocytes cultured for 4 to 6 days in the same media have morphologies and differentiation marker expression profiles (high expression of early and late differentiation markers) similar to that of terminally differentiating cells transiting into the cornified layers of the human epidermis. Importantly, these characteristics were common between N/TERT- 1 cells and NHEK-Neo cells, indicating that these immortalised cells are suitable surrogates for primary keratinocyte cultures. Thus, this culture system was utilised for subsequent experiments described in this dissertation that required the analysis of keratinocytes in undifferentiated and differentiated cellular states. 81

Figure 3.6: Keratinocyte monolayers treated with 1.8mM calcium ion levels display gene expression profiles akin to in vivo epidermal homeostasis. qPCR was performed on differentiating N/TERT-1 (left) and NHEK-Neo (right) keratinocytes for early and late differentiation markers, keratin 10 (KRT10), involucrin (IVL), and filaggrin (FLG). Gene expression was normalised to the housekeeping gene, RPL13A, and displayed as log2 transformed fold changes calculated relative to subconfluent expression. Error bars = ±s.d. n = 3 biological replicates. 82

3.2 Global levels of key histone acetylation modifications are reduced upon differentiation of immortalised keratinocytes.

In order to identify histone PTMs that are stable, enriched, or depleted at a global level across the course of keratinocyte differentiation, Western blotting was performed on whole cell protein lysates from N/TERT-1 keratinocytes at confluency (day 0) and day 2 and day 4 of differentiation.

A sharp decrease in total histone H3 levels was measured in protein lysates harvested at day 6 of differentiation compared to earlier timepoints. Therefore, since this precluded accurate quantitative assessment of histone H3 modifications, this timepoint was omitted from analysis. This may reflect the onset of nuclear degradation, which is a key event in terminal differentiation. Alternatively, it may be an additional means by which gene expression is regulated besides histone modifications, as is observed in differentiating embryonic stem cells where histone content increases (Karnavas et al., 2014). Similarly, total histone H4 levels were only stable from confluency to day 2 of differentiation and fell dramatically at day 4 of differentiation. Therefore, for this study, only well characterised histone H3 modifications were immunoblotted, including: H3K9ac, a mark of transcriptional elongation (Gates et al., 2017b); H3K18ac, found at the transcription start site of active and poised genes (Z. Wang et al., 2008); H3K27ac, typically found at active enhancers (Creyghton et al., 2010); H3K4me3, a mark enriched at active promoters and may place a role in the formation of the preinitiation complex (Zhao et al., 2007); H3K27me3, a mark typically found at promoters and gene bodies and is often associated with transcriptional repression (Young et al., 2011); and histone H3ac, a measure of global acetylation levels on histone H3. I probed for total histone H3 on fresh membranes to serve as a loading control.

The quality of commercially available histone antibodies is inconsistent. One study assessed the quality of over 200 histone antibodies and shown that 25% failed due to issues with cross-reactivity with other modifications (Egelhofer et al., 2011). Our lab routinely tests commercial histone antibodies using dot blot arrays and experience similar proportions of failure. Therefore, all histone antibodies used for the experiments in this study were subjected to rigorous quality assessment to ensure that only antibodies with a high specificity and affinity for their cognate peptide modification are used (Supplementary Figure S.1). Furthermore, I performed all immunoblots on fresh membranes to circumvent issues associated with inadequate stripping.

Global levels of H3K9ac was decreased by 10% between confluency and day 2 of differentiation (Figure 3.7). After four days of differentiation, total H3K9ac was only 50% 83 of its level at confluency (day 0). A progressive decrease in total H3K18ac, H3K27ac and H3K4me3 levels was also measured starting from day 2 of differentiation. The decrease in H3K9ac levels measured between subconfluent and differentiated N/TERT-1 cell protein lysates was verified by IF. Consistent with the immunoblotting results, lower signal intensity of IF-labelled H3K9ac was observed in differentiated N/TERT-1 cells compared to that in undifferentiated cells (Figure 3.8). In contrast to the changes measured for total H3K9ac, H3K18ac, H3K27ac, and H3K4me3, global levels of H3K27me3 were stable at day 2 of differentiation but increased modestly by 40% at day 4 of differentiation relative to levels prior to differentiation-induction. Of note, despite global levels of H3K9ac, H3K18ac, and H3K27ac decreasing with differentiation, total histone H3ac remained largely unchanged. Therefore, H3K9ac, H3K27ac, and H3K18ac could constitute a small proportion of the keratinocyte histone acetylome and/or global levels of other histone acetylation modifications could be increasing upon differentiation.

These findings reveal histone H3 modifications to be highly dynamic at a global level across the course of keratinocyte differentiation in vitro. Intriguingly, several key histone acetylation modifications linked to gene activation were diminished at a global level with keratinocyte differentiation, whilst H3K27me3, a mark associated with transcriptional repression, increased with differentiation. This could represent a way in which keratinocytes restrict and refine their gene expression programs during the onset of differentiation. Specifically, high levels of H3K9ac, H3K18ac, and H3K27ac may be functionally important in maintaining keratinocyte stemness, whilst a progressive loss of these modifications with differentiation and an increase in silencing marks may allow for proper expression of the differentiation gene network. Taken together, these results suggest that HATs and their activities towards histone tails could constitute a mechanism that balances keratinocyte stemness and differentiation in vitro. This stimulated my interest to identify HATs that are functionally important to this end.

Figure 3.7: Global levels of histone modifications associated with gene activation are reduced upon differentiation of immortalised keratinocytes. (A) Representative Western blots for the indicated histone modification on whole cell lysates harvested from confluent (D0) and differentiated (D2 and D4) N/TERT-1 cells. (B) Densitometric analysis was performed on three biological replicates for each histone modification under study. The band intensity for each histone modification was normalised to histone H3 and expressed as a ratio relative to D0. kDa = kilodalton. Error bars = ±s.d.; p values ≤0.05* and ≤0.01**.

Figure 3.8: Global H3K9ac levels are depleted upon differentiation of immortalised keratinocytes. Representative Z-stack confocal sum-projections of N/TERT-1 cells immunolabelled for H3K9ac or histone H3 (red) at confluency (D0) and day 4 of differentiation (D4). Staining for histone H3, a protein not expected to vary significantly between samples, is stable across both timepoints relative to H3K9ac indicating that antibody penetration is mostly comparable between undifferentiated and differentiated cultures. DAPI (blue) stains nuclei. The mean fluorescence intensity for histone H3 and H3K9ac staining in nuclei was quantified at both timepoints (right). This data was graphed using box and whisker plots whereby the box represents the median, lower quartile, and upper quartile values, and the whiskers represent the upper and lower extremes. Scale bar = 50 μm. 86

3.3 KAT2A and KAT2B are Inversely Expressed in Differentiating Keratinocytes In Vitro

The selective reduction in histone acetylation marks with differentiation in keratinocytes could reflect concomitant changes to the activities of HATs and HDACs in these cells. Whilst there is evidence implicating HDACs in keratinocyte proliferation and differentiation, there is a paucity of information regarding the expression patterns and functions of HATs in keratinocyte differentiation. HATs enriched prior to or following keratinocyte differentiation could be indicative of their functional significance at that timepoint. With the aim to identify candidate HATs of functional importance for the self- renewing and differentiated state of keratinocytes, gene expression profiles of nine well- characterised HATs (KAT1-9) from the three major HAT families (GNAT, p300/CBP, and MYST family) were measured across the course of differentiation in N/TERT-1 cells. qPCR analysis revealed very minor downregulations for all HATs in the p300/CBP and MYST families upon differentiation, with the exception for KAT5, which was transcriptionally stable (Figure 3.9A). These HATs displayed similar expression patterns across the course of differentiation with the greatest downregulation occurring at day 2 or day 4 of differentiation. However, these reductions in transcript levels were modest, ranging between 26%-55% relative to levels at subconfluency. At day 6 of differentiation, expression levels for these HATs returned to those measured in proliferative keratinocytes, except for KAT7, which remained slightly downregulated at this timepoint. By contrast, the GNAT family of HATs exhibited substantial and progressive changes in expression across the course of differentiation. KAT1 and KAT9 showed a similar progressive downregulation in expression that was sustained at day 6 of differentiation. The most significant downregulation was measured for KAT2A expression at day 4 (88% decrease of subconfluent levels) and day 6 of differentiation (90% decrease of subconfluent levels). KAT2B was the only HAT that displayed a significant and progressive upregulation with differentiation, peaking at day 6 with an average fold change of 22.3. It is also noteworthy that no significant changes in KAT2A or KAT2B expression were measured between proliferative cells and cells cultured to confluency. To ensure that this gene expression pattern for KAT2A and KAT2B was not specific to immortalised keratinocytes, the same analysis was performed on NHEK- Neo cells across the course of differentiation and yielded similar findings (Figure 3.9B). The delta Ct values of KAT2A and KAT2B were compared to approximately determine the mRNA levels of each paralogue relative to each other at undifferentiated and differentiated timepoints. KAT2A mRNA appears to be significantly more abundant in proliferative 87 keratinocytes compared to KAT2B mRNA, whilst the opposite pattern is observed at day 6 of differentiation (Figure 3.9C).

In summary, these findings show that the KAT2A and KAT2B genes are significantly inversely expressed upon keratinocyte differentiation in vitro. The distinction of this observation is underscored by the relatively stable expression patterns of the two closely related HAT paralogues, KAT3A and KAT3B, and of HATs belonging to the MYST family. KAT2A and KAT2B have been shown to reside in similar multi-subunit protein complexes to function redundantly and/or have overlapping roles in many cellular processes. Therefore, it is surprising that gene expression of KAT2A and KAT2B diverges in differentiating keratinocytes. This suggests that the functions of KAT2A and KAT2B may differ in keratinocytes and be specific for processes related to self-renewal or differentiation, respectively. Indeed, a previous study implicates KAT2B as a driver of in vitro keratinocyte differentiation (Pickard et al., 2010). Therefore, KAT2A could have a similar importance in epidermal homeostasis, particularly in undifferentiated keratinocyte populations in which it is most abundant. For these reasons, KAT2A and KAT2B were chosen as candidate HATs of functional significance for epidermal homeostasis, and their roles in this process were further dissected in this study.

Figure 3.9: KAT2A and KAT2B are inversely expressed in cultured keratinocytes induced to differentiate. (A) Gene expression for mammalian HATs from the three major families (GNAT, p300/CBP, and MYST) in differentiating N/TERT-1 cells and presented as fold change (log2) relative to subconfluent levels normalised to RPL13A. (B) qPCR for KAT2A and KAT2B in differentiating NHEK-Neo cultures. (C) Comparison of -delta Ct values for KAT2A and KAT2B at subconfluency and day 6 post-differentiation. n = 3, error bars = ±s.d.; p values ≤0.05*, ≤0.01**, ≤0.001***, and ≤0.0001****. 89

3.4 KAT2A and KAT2B are Inversely Expressed in Differentiating Keratinocytes In Vitro

The inverse expression patterns of KAT2A and KAT2B measured in differentiating keratinocytes may not necessarily correlate at the protein level. To assess if the protein levels of KAT2A and KAT2B are indeed expressed inversely upon keratinocyte differentiation, whole cell protein lysates from N/TERT-1 and NHEK-Neo cells were immunoblotted for KAT2A or KAT2B across the course of differentiation.

Commercial monoclonal antibodies for KAT2A (Thermo Fisher Scientific, Cat no. MA5- 14884) and KAT2B (Santa Cruz, Cat no. 13124) were quality assessed prior to their use in these experiments to assess their specificity and affinity for their cognate peptide. Validation was performed using protein lysates harvested from N/TERT-1 and NHEK-Neo cells depleted for KAT2A and/or KAT2B. A single band just below 100KDa was detected in control lysates but not in KAT2A-depleted lysates when immunoblotting was performed with the KAT2A antibody (Supplementary Figure S.2). A band of identical size was also obtained in control lysates but not in KAT2B-depleted lysates when immunoblotting was performed with the KAT2B antibody. Several additional bands were also present between 37-50KDa in all protein lysates, but this did not affect the interpretation of KAT2B protein levels. The KAT2A antibody is raised against the N-terminus of the protein. In further support of the specificity of this antibody, no band was detected when this antibody was immunoblotted with protein lysates harvested from KAT2A-depleted N/TERT-1 cells expressing a KAT2A construct missing its N-terminus domain (See Chapter 6.1, Figure 6.1B). No cross-reactivity was obtained with the KAT2A or KAT2B antibodies and their respective paralogue. Thus, these antibodies were suitably specific towards their cognate protein and so were used for the analysis of KAT2A and KAT2B protein expression.

KAT2A protein levels were stable between subconfluency and day 2 of differentiation in both N/TERT-1 and NHEK-Neo lysates (Figure 3.10). At day 4 of differentiation KAT2A levels sharply decreased by similar magnitudes in both keratinocyte cell lines. At day 6 of differentiation, KAT2A was undetectable even at long exposures in N/TERT-1 cells. In NHEK-Neo cells KAT2A levels decreased further at day 6 of differentiation, but a faint band was still visible at this timepoint. KAT2B protein was weakly detectable in proliferative N/TERT-1 and NHEK-Neo cells and was expressed at similar levels at confluency. Increased KAT2B protein levels were measured at day 2 of differentiation and peaked at day 4 of differentiation in both keratinocyte cell lines. KAT2B protein levels did not increase further at day 6 of differentiation. 90

In summary, the inverse gene expression patterns of KAT2A and KAT2B observed in differentiating cultured keratinocytes is also present at the protein level. KAT2A is most abundant in undifferentiated and early differentiated keratinocyte populations. KAT2B levels are low in undifferentiated keratinocytes but become progressively higher upon differentiation. These findings further support the notion of KAT2A and KAT2B having distinct functions in undifferentiated and differentiated keratinocyte populations, respectively.

Figure 3.10: Inverse protein expression of KAT2A and KAT2B upon differentiation of keratinocyte cultures. Representative Western blots for KAT2A and KAT2B in undifferentiated (sub and 0 days post-diff) and differentiated N/TERT-1 and NHEK-Neo whole cell protein lysates (2-6 days post-diff). β-tubulin was used as a loading control. Ponceau S was used as a transfer control and as an additional loading control. kDa = kilodalton. 91

3.5 KAT2A and KAT2B are Inversely Expressed in the Adult Human Epidermis

So far, expression analysis for KAT2A and KAT2B in differentiating keratinocytes has been limited to cultured cells. RNAscope® in situ hybridisation and immunofluorescence techniques were used to explore if the in vivo expression patterns of KAT2A and KAT2B are consistent with those characterised in differentiating cultured keratinocytes.

RNAscope® in situ hybridisation was used to visualise KAT2A and KAT2B mRNA in formalin fixed paraffin embedded tissue sections of adult human abdominal skin. DapB and PPIB probes served as negative and positive controls, respectively. As expected, DapB hybridised sections showed no chromogenic signal, whilst PPIB hybridised sections exhibited uniform signal throughout the epidermis, thus no positive or negative bias in the assay towards any epidermal layer was present (Figure 3.11). KAT2A mRNA foci was present in the basal layer and spinous layers at approximately equal numbers and intensities but absent in the granular layers and the stratum corneum. By contrast, KAT2B mRNA foci were most intense and frequent in the granular layers and the stratum corneum, while weaker and less frequent KAT2B foci were detected in the spinous layers and occasionally in the basal layer.

KAT2A was IF-labelled in adult human abdominal skin. KAT2A staining was restricted to the basal layer and spinous layers of the epidermis (Figure 3.12). Granular cells and the stratum corneum were devoid of KAT2A staining in keeping with the in-situ hybridisation data. Unfortunately, similar validation of KAT2B levels in human epidermal tissues was not achievable as labelling KAT2B, using the same antibody as used for Western blotting, yielded non-specific signals in the epidermis of human skin tissue sections. In the future, further optimisation of the immunostaining protocol with this antibody or the development of more sensitive and specific KAT2B antibodies will be necessary.

Figure 3.11: Differential expression of KAT2A and KAT2B in basal vs suprabasal cells of adult human epidermis. Representative brightfield micrographs of formalin fixed paraffin embedded adult human abdominal skin sections subjected to RNAscope® in situ hybridization for DapB (negative control), PPIB (positive control), KAT2A, and KAT2B mRNA. Individual transcripts are indicated by red foci. Nuclei are stained blue with haematoxylin. Yellow dotted lines demarcate the dermis-epidermis boundaries. 63x objective. Scale bar = 50μm. 93

Figure 3.12: Protein expression of KAT2A is limited to the basal and spinous cells of adult human epidermis. Representative confocal micrograph showing an adult human skin cryosection immunofluorescently labelled for KAT2A (red). Yellow dotted line demarcates the dermis-epidermis boundary. DAPI (blue) stains nuclei. White arrowheads indicate granular cells expressing KAT2A at low levels. The mean fluorescence intensity for KAT2A staining was quantified in nuclei belonging to the basal, spinous, and granular layers (right). This data was graphed using box and whisker plots whereby the box represents the median, lower quartile, and upper quartile values, and the whiskers represent the upper and lower extremes. Scale bar = 50 μm. 94

3.6 KAT2A and KAT2B are Inversely Expressed in the Developing Mouse Epidermis

To further correlate KAT2A and KAT2B expression patterns with the degree of keratinocyte differentiation, I asked how early in skin development does KAT2A and KAT2B expression segregate between basal/spinous and terminally differentiating layers of the epidermis? To this end, I performed RNAscope® in situ hybridisation for KAT2A and KAT2B transcripts on mouse dorsal skin dissected at E15.5, a timepoint when the first morphological signs of stratification and differentiation are evident.

Empirical observations and counting of the number of mRNA foci per cell confirmed that a bias in KAT2A and KAT2B expression patterns between basal and suprabasal epidermal compartments exists as early as E15.5 in mouse embryos (Figure 3.13). KAT2A expression was detectable throughout all epidermal layers but was higher in basal cells vs suprabasal cells. KAT2B expression was also detectable throughout all epidermal layers, but many basal cells demonstrated low or absent staining whilst suprabasal cells were comparatively more enriched with mRNA foci.

Overall, these findings show that KAT2A and KAT2B are inversely expressed at the mRNA and protein level with differentiation in immortalised and primary keratinocytes. KAT2A is most abundant in proliferative keratinocytes relative to KAT2B, while KAT2B is the predominant paralogue in differentiated keratinocytes. More importantly, these expression patterns are also observed in human epidermis in vivo, where KAT2A mRNA and protein are localised to undifferentiated and early differentiated keratinocyte populations, while KAT2B mRNA is most abundant in cells undergoing terminal differentiation. These KAT2A/KAT2B expression patterns are conserved in mouse skin and are apparent during development as early as basal and suprabasal epidermal compartments are firmly established.

These findings support the hypothesis of divergent functions for KAT2A and KAT2B in keratinocyte biology. Specifically, KAT2A may function to establish and maintain characteristics of proliferative or early differentiated keratinocytes, while KAT2B may have the opposite effect by promoting late keratinocyte differentiation. Thus, a switch in expression from KAT2A to KAT2B may serve as a means of maintaining normal epidermal homeostasis.

Figure 3.13: Differential expression of KAT2A and KAT2B in basal vs suprabasal cells of developing mouse epidermis. Representative brightfield micrographs of mouse dorsal skin cryosections at E15.5 subjected to RNAscope® in situ hybridisation for KAT2A and KAT2B (left). Individual transcripts are indicated by brown foci. Nuclei are stained blue with haematoxylin. Yellow dotted lines demarcate the dermis-epidermis boundaries. The number of foci per basal and suprabasal cell was quantified from five fields of view from three biological replicates using RNAscope® SpotStudio image analysis software (right). 63x objective. Scale bar = 20μm.

CHAPTER 4 KAT2A FUNCTIONS IN UNDIFFERENTIATED KERATINOCYTES TO MAINTAIN STEMNESS FEATURES WHILST KAT2B PRIMARILY FUNCTIONS IN CALCIUM TREATED CELLS TO DRIVE DIFFERENTIATION

4.1 Introduction

In the previous chapter, evidence was presented showing inverse expression patterns for KAT2A and KAT2B upon keratinocyte differentiation that suggested predominant functions for each HAT in undifferentiated and differentiated cell populations, respectively. Undifferentiated basal keratinocytes are distinguished from their differentiated progeny at many levels. They exhibit cubic to columnar morphologies in vivo and are smaller in vitro compared to differentiated keratinocytes. Deletion of KAT2A leads to disorganisation and morphological abnormalities of the epiblast in EBs because of defects in cytoskeletal networks (Wang et al., 2018). Given that the epiblast is also a columnar epithelial tissue, it begs the question: does KAT2A also regulate the morphology and organisation of epidermal cells through similar mechanisms? Proliferation rates of basal keratinocytes are also significantly higher compared to differentiated cells, which are rarely mitotically active. This proliferative capacity of basal keratinocytes is key for proper replenishment of suprabasal layers. Histone acetylation has been implicated in regulating keratinocyte proliferation. Double knockout of HDAC1 and HDAC2 in mouse epidermis arrests basal keratinocyte proliferation and their capacity to differentiate (LeBoeuf et al., 2010). HDAC1 and HDAC2 function with ΔNp63 in undifferentiated keratinocytes to transcriptionally repress cell cycle- related genes, such as p16/INK4a and p21, which in part accounts for the phenotype described. These findings highlight the importance of targeted histone deacetylation as a means of repressing genes not permissive for the stem cell state. It stands to reason that activating genes permissive for the stem cell state through targeted histone acetylation could represent an additional means by which the proliferative capacities of basal keratinocytes are maintained. This could be facilitated by KAT2A, which is enriched in proliferative keratinocytes but depleted as keratinocytes differentiate and exit the cell cycle. Indeed, there is considerable evidence in support of KAT2A as a pro-proliferative factor in a range of adult mammalian cell lines, but no studies have been conducted to this end in any normal epithelial cells, including keratinocytes. Beyond proliferation, basal keratinocytes are also characterised by distinct gene and protein expression profiles to suit their functions. The literature supports the view of KAT2A as an important regulator of cell type-specific gene expression networks. Furthermore, emerging evidence points to KAT2A as a stabiliser of 97 pluripotency, and it is possible that this function extends to multipotent cells, such as basal keratinocytes (Moris et al., 2018).

In this chapter, experiments are described that aimed to characterise the functions of KAT2A and KAT2B in keratinocytes, and to specifically assess whether the stem cell-like properties of basal keratinocytes or the course of differentiation is affected upon the loss of KAT2A and/or KAT2B.

4.2 shRNA-mediated Knockdown Effectively Depletes KAT2A and KAT2B in Keratinocytes

In order to determine the functions of KAT2A and KAT2B in keratinocytes, N/TERT-1 stable cell lines constitutively expressing shRNAs against KAT2A or KAT2B transcripts were generated in parallel alongside control cells expressing a non-targeting hairpin (shScr). Two different shRNA sequences (shRNA#1 and shRNA#2) targeting KAT2A or KAT2B were used individually to exclude any off-target effects of the shRNAs. N/TERT-1 cells were also stably knocked down for both KAT2A and KAT2B to circumvent functional compensation between the paralogues and to permit analysis of functional redundancies. The shRNA constructs contained a ZsGreen fluorescent marker that allows for evaluation of transduction efficacy. All cell lines generated exhibited strong and stable ZsGreen fluorescent marker signal indicating successful transduction and efficient expression of the shRNA construct (Figure 4.1A).

Validation of knock down efficacy was first assessed using qPCR. On average, KAT2A mRNA levels were depleted 87% or 72% of control levels in subconfluent N/TERT-1 cells expressing shKAT2A#1 (Figure 4.1B) or shKAT2A#2 (Figure 4.2A), respectively. Depletion of KAT2A mRNA using shKAT2A#1 was similar on average in the double knockdown N/TERT-1 cell line (84% of control levels). N/TERT-1-shKAT2A#1 cells exhibited sustained knockdown for KAT2A mRNA throughout the course of differentiation. shKAT2B#1 and shKAT2B#2 achieved 81% and 74% of KAT2B mRNA knockdown at day 6 of differentiation in N/TERT-1 cells when the expression of KAT2B is highest. KAT2B expression was equally depleted in the double knockdown N/TERT-1 cells upon differentiation. KAT2B expression in KAT2A-depleted N/TERT-1 cells was modestly upregulated by 55% (shKAT2A#1) and 66% (shKAT2A#2) at subconfluency relative to control levels. Similarly, KAT2A expression in KAT2B-depleted N/TERT1 cells was upregulated by 69% (shKAT2B#1) and 130% (shKAT2B#2) at day 4 of differentiation, indicative of compensatory gene expression mechanisms at play. These suspected 98 compensatory responses were eliminated in the double knockdown N/TERT-1 cells at the mRNA level.

Further assessment of knockdown efficacy was performed by Western blotting for KAT2A and KAT2B in the N/TERT-1 knockdown cell lines at confluency and day 4 of differentiation, timepoints at which KAT2A and KAT2B are respectively most abundant. KAT2A protein was largely depleted in N/TERT-1 cells expressing shKAT2A#1 or shKAT2A#2 at confluency (Figure 4.1C), although residual protein was still detectable in N/TERT-1-shKAT2A#2 cells (Figure 4.2B), consistent with a lesser degree of transcript depletion. KAT2B protein was significantly depleted in N/TERT1 cells expressing shKAT2B#1 or shKAT2B#2 at undifferentiated and differentiated timepoints, but again residual protein was detectable in differentiated shKAT2B#2-N/TERT-1 lysates. Consistent with the detected increase in KAT2B transcripts, KAT2B protein levels were abnormally elevated in undifferentiated N/TERT-1 cells expressing shKAT2A#1 or shKAT2A#2. Likewise, KAT2A levels were also higher at day 4 of differentiation in the KAT2B-depleted N/TERT-1 cells compared to shScr controls. Western blotting N/TERT-1 cells depleted for both KAT2A and KAT2B yielded no detectable signal for either HAT.

To allow for characterization of KAT2A and KAT2B function in primary keratinocytes, I further generated KAT2A- or KAT2B- depleted primary NHEK-Neo cells by transducing low passage cells with lentiviruses carrying shKAT2A, shKAT2B or shScr, and flow-sorted for the ZsGreen-positive transductants. The transduced cells were analysed for knockdown efficacy 2-3 passages after sorting. KAT2A mRNA levels were depleted 87% on average in subconfluent NHEK-Neo cells expressing shKAT2A#1 relative to control cultures (Figure 4.3A). Furthermore, like shKAT2A-N/TERT-1 cultures, KAT2B was modestly upregulated by 1.76-fold in shKAT2A#1-NHEK-Neo cells at subconfluency. Expression of shKAT2B#1 in differentiated NHEK-Neo led to an 84% reduction in KAT2B mRNA levels on average (Figure 4.3B). While no change in KAT2A expression was measured in subconfluent NHEK-Neo cells expressing shKAT2B relative to shScr control cultures, these cells exhibited a modest increase in KAT2A expression at day 4 post differentiation. (Figure 4.3B). NHEK-Neo cells expressing shKAT2A or shKAT2B were significantly depleted for KAT2A and KAT2B at the protein level, respectively (Figure 4.3C). Consistent with gene expression data, KAT2B levels were significantly increased upon knockdown of KAT2A in subconfluent NHEK-Neo cultures. In contrast to shKAT2B#1-N/TERT-1 cultures, there was only a marginal difference in KAT2A levels between control cells and shKAT2B#1-NHEK- Neo cells at day 4 of differentiation. 99

The significant increase in KAT2B protein levels upon depletion of KAT2A in subconfluent keratinocytes could be explained by the corresponding upregulation of KAT2B. However, the changes in KAT2B mRNA expression was small and may not represent the main mechanism by which KAT2B protein levels are regulated in these cells. Instead, KAT2B mRNA may become more translated due to an increased abundance of ribosomes on existing transcripts. Alternatively, the KAT2B protein may have accumulated because of escaping degradation pathways upon knock down of KAT2A. To investigate the former, polysome fractions containing the non-translated, low translated, and highly translated pools of total RNA were harvested from subconfluent N/TERT-1 cells expressing shScr or shKAT2A#1. qPCR was then performed to assess the levels of KAT2A and KAT2B transcripts in the different fractions. In N/TERT-1 keratinocytes, both KAT2A and KAT2B mRNAs are enriched in the high translated fraction of total RNA (Figure 4.4A). The extent of this enrichment for KAT2B mRNA was not altered upon depletion of KAT2A. To assess if KAT2B protein is readily subjected to ubiquitin-mediated degradation, N/TERT-1 cells expressing shScr or shKAT2A#1 were treated with a proteasome inhibitor (MG132) and immunoblotted for KAT2B. KAT2B protein levels were not altered in the presence of MG132, indicating that KAT2B is a stable protein not readily subjected to proteasome degradation (Figure 4.4B). Taken together, these results indicate that the compensatory increase in KAT2B levels detected in keratinocyte cultures depleted for KAT2A is most likely due to a modest increase in KAT2B transcripts that are highly translated rather than changes to the degradation rate of the KAT2B protein.

I have thus generated N/TERT-1 keratinocyte cell lines and primary epidermal keratinocytes that are effectively depleted of KAT2A, KAT2B, or both, which facilitated subsequent studies to characterise the functions of these HATs in relation to keratinocyte growth, self- renewal, and differentiation.

100

Figure 4.1: shKAT2A#1/shKAT2B#1 depletes KAT2A/KAT2B in immortalised keratinocytes. (A) ZsGreen fluorescent signal exhibited by N/TERT-1 cells successfully transduced with shScr, shKAT2A#1, or shKAT2B#1 constructs. (B) qPCR for KAT2A or KAT2B was performed across the course of keratinocyte differentiation in N/TERT-1 cells expressing shScr, shKAT2A#1, shKAT2B#1, or shKAT2A#1 and shKAT2B#1. Fold change was calculated relative to shScr at subconfluency. n = 3, error bars = ±s.d.; p values ≤0.05*, ≤0.01** and ≤0.001***. (C) Representative Western blot showing the knockdown efficacy of shKAT2A#1 and/or shKAT2B#1 at the protein level in undifferentiated and differentiated N/TERT-1 cells. 101

Figure 4.2: shKAT2A#2/shKAT2B#2 depletes KAT2A/KAT2B in immortalised keratinocytes. (A) qPCR analysis for KAT2A and KAT2B expression in N/TERT-1 cells expressing shScr, shKAT2A#2, or shKAT2B#2 at subconfluency and day 4 of differentiation. Fold change in gene expression was calculated relative to shScr-N/TERT-1 levels at the same timepoint. n=3, error bars = ±s.d.; p values ≤0.05*, ≤0.01**, and ≤0.001***. (B) Representative Western blot for KAT2A and KAT2B in subconfluent N/TERT-1 cells expressing shScr, shKAT2A#2, or shKAT2B#2. (C) Representative Western blot for KAT2B in differentiating N/TERT-1 cells expressing shScr, shKAT2B#1, or shKAT2B#2. kDa = kilodalton. 102

Figure 4.3: shKAT2A#1/shKAT2B#1 depletes KAT2A/KAT2B in primary keratinocytes. (A) qPCR for KAT2A and KAT2B in undifferentiated NHEK-Neo cells expressing shKAT2A#1 (blue, n = 4) or shKAT2B#1 (red, n = 3). (B) qPCR for KAT2A and KAT2B in NHEK-Neo cells expressing shKAT2B#1 four days post-differentiation (n =2). Fold change in gene expression was calculated relative to levels in shScr control cells at subconfluency or day 4 post differentiation. error bars = ±s.d.; p values ≤0.01** and ≤0.001***. (C) Representative immunoblot for KAT2A and KAT2B showing the knockdown efficacy of shKAT2A#1/shKAT2B#1 at the protein level in NHEK-Neo cells prior to – (sub) and four days post-differentiation (D4). kDa = kilodalton. 103

Figure 4.4: KAT2B transcripts are highly translated and the protein is not readily subjected to proteasome degradation in immortalised keratinocytes. (A) Polysome profiling was performed to examine ribosomal loading and translation rate of KAT2B mRNA in subconfluent N/TERT-1 cells expressing shScr or shKAT2A#1. Three polysome fractions were harvested from each cell line corresponding to non-translated, low translated, and high translated pools of RNA. qPCR was performed to measure the KAT2B expression in each fraction and results were represented as fold change relative to N/TERT-1-shScr normalised to the THR DNA spike-in control. Errors bars= s.d. of two technical replicates. (B) Representative immunoblot for KAT2B in subconfluent N/TERT-1 cells expressing shScr or shKAT2A#1 treated with two concentrations of the proteasome inhibitor, MG132. Total ubiquitinated proteins were immunoblotted to assess the efficacy of the treatment. Tubulin was immunoblotted to serve as a loading control. 104

4.3 KAT2A Depletion Negatively Impacts Proliferation of Primary Keratinocytes

Keratinocytes that comprise the basal layer have a high proliferative capacity which is tightly regulated by various signalling molecules, particularly EGFs (Miettinen et al., 1995), and cell adhesion molecules, of which several integrins have been implicated (Turner et al., 2006). As basal keratinocytes commit to differentiate their capacity to proliferate becomes restricted. HDAC1 and HDAC2 activities are critical for the proliferation of skin stem cells during mouse development, highlighting histone acetylation as a potential regulatory mechanism for keratinocyte proliferation (LeBoeuf et al., 2010). To my knowledge, the influence of HATs on keratinocyte proliferation have not been explored. KAT2A and KAT2B have been shown to promote or limit proliferation of numerous normal and cancer mammalian cell lines by acetylating histone and non-histone substrates. Since KAT2A is enriched in largely undifferentiated keratinocyte populations, it stands to reason that it could have a role in regulating the proliferative capacity of these cells, whilst KAT2B, which is enriched in differentiated keratinocytes, could have a role in limiting keratinocyte proliferation in keeping with the terminal differentiation program. Following transduction, selection, and recovery, N/TERT-1 stable cell lines were subjected to a series of assays to assess if knockdown of KAT2A and/or KAT2B impacted cell proliferation.

For cell counting experiments, cells were seeded at low densities and counted every day for five days until they reached confluency at day 5. No significant differences in cell numbers were measured between N/TERT-1 cells expressing shScr and those expressing shKAT2A or shKAT2B or both (Figure 4.5A). A more sensitive colourimetric assay (MTT assay) that measures metabolic activity as a function of viable cell proliferation was also employed. No significant differences were measured between control cells and those expressing shKAT2A or shKAT2B or both (Figure 4.5B). Finally, I utilised the IncuCyteTM Live-Cell Imaging System to measure confluency of the N/TERT-1 cell lines in real-time. No significant differences in cell confluency were measured between shScr control cells and those expressing shKAT2A#1 or shKAT2B#1 over a period of 96 hours (Figure 4.5C). Hence, loss of KAT2A or KAT2B or both did not appear to significantly affect cellular proliferation rates in actively dividing N/TERT-1 keratinocytes.

105

Figure 4.5: Proliferation rates of immortalised keratinocytes are unaffected by KAT2A or KAT2B depletion. (A) Daily cell counting of N/TERT-1 cells expressing shScr, shKAT2A#1/#2 and/or shKAT2AB#1/#2 cultured from clonal density (D0) to confluency (D5). (B) Metabolic activity of viable cells were measured by the colourimetric MTT assay to assess the growth rates of N/TERT-1 cells expressing shScr, shKAT2A#1, or shKAT2#2 over five days in culture. (C) Cell growth and real-time confluency was measured for N/TERT-1 cells expressing shScr, shKAT2A#1, or shKAT2B#1 from 6% confluency to 95% confluency using the IncuCyteTM Live-Cell Imaging System. Error bars = ±s.d.

106

In contrast to the absence of proliferative phenotypes in N/TERT-1 cells, noticeably slower growth was observed in KAT2A-depleted, but not KAT2B-depleted, primary NHEK-Neo keratinocytes. The proliferative delay was most evident one passage following flow sorting of the transductants. When seeded at the same cell density, shKAT2A#1-NHEK-Neo cells took a further four to six days of culture compared to control cells to reach 70% confluency (Figure 4.6). Furthermore, more senescent cells were observed in the shKAT2A#1-NHEK- Neo cultures at every passage compared to shScr control cultures. Unfortunately, due to time constraints, I was unable to further quantify and explore this phenotype. Nonetheless, these results suggest KAT2A may play a role in regulating cellular proliferation in primary keratinocytes, a function which is masked in the immortalised N/TERT-1 cells.

Figure 4.6: KAT2A depletion triggers premature senescence and delayed proliferation in primary keratinocytes. Phase contrast micrographs of NHEK-Neo cells expressing shScr, shKAT2A#1, or shKAT2B#1 at day 4 of culture following seeding at the same cell density. shKAT2A#1-NHEK-Neo cultures grew significantly slower and display a higher proportion of senescent cells (red arrowheads) compared to shScr/shKAT2B#1-NHEK-Neo cultures. 10x objective.

107

4.4 Immortalised Keratinocytes Cluster Upon Knockdown of KAT2A

4.4.1 Characterisation of Morphological Changes in Keratinocytes Depleted for KAT2A and/or KAT2B Although loss of KAT2A or KAT2B did not significantly alter the cellular proliferation rates of the N/TERT-1 keratinocytes, I found the cell morphology adopted by the KAT2A- depleted, but not KAT2B-depleted, N/TERT-1 cells to be distinctively altered. In subconfluent cultures (20-70% confluency), both untreated and shScr control N/TERT-1 cells adopt scattered arrangements with areas of loose cell clusters. Most cells in these cultures formed loose contact with a few neighbouring cells, but there were also many isolated single cells (Figure 4.7A and Figure 4.8A). Live cell imaging showed that these cells are highly motile and make only transient contacts with other cells in their path. N/TERT-1 cells depleted for KAT2A grew very differently in tight cell clusters at subconfluency (Figure 4.7A and Figure 4.8A). These cells formed much more cell-cell contacts with neighbouring cells, giving rise to islands, or colonies, of cells with highly regular borders in culture. This cell clustering phenotype was more pronounced in cells stained with phalloidin to demarcate the actin cytoskeleton and cell boundaries (Figure 4.7B and Figure 4.8B). Furthermore, isolated single cells were much less frequently seen compared to the shScr cultures. Live cell imaging showed that the KAT2A-depleted cells formed longer-lasting cell-cell contacts and were less motile. The shKAT2B-N/TERT-1 cultures were, on the other hand, visually indistinguishable from shScr control cells. However, double knock down of KAT2A and KAT2B in shKAT2A#1+shKAT2B#1- N/TERT-1 keratinocytes appeared to exacerbate the clustering phenotype, which is consistent with a partial compensatory effect by upregulated KAT2B.

A similar analysis of the culture morphology of KAT2A-depleted primary NHEK-Neo keratinocytes was confounded by the proliferation/senescent defect described in Chapter 4.2 and Figure 4.6. As observed for N/TERT-1 cells, knock-down of KAT2B in NHEK-Neo keratinocytes did not result in any obvious morphological differences compared to control.

Overall, these findings show that loss of KAT2A, but not KAT2B, in N/TERT-1 keratinocytes leads to marked changes in culture morphology, adopting a more clustered colony-like growth at subconfluency instead of the scattered, loose cell-cell interactions observed in both untransduced and shScr control N/TERT-1 cultures.

108

Figure 4.7: Clustering of proliferative immortalised keratinocytes expressing shKAT2A#1. Phase contrast micrographs (A) and confocal micrographs (B) of subconfluent N/TERT-1 cells expressing shScr, shKAT2A#1, and/or shKAT2B#1. Red arrowheads highlight examples of isolated cells without any cell-cell contacts. DAPI (blue) stains nuclei, F-actin = green. 10x objective. 109

Figure 4.8: Clustering of proliferative immortalised keratinocytes expressing shKAT2A#2. Phase contrast micrographs (A) and confocal micrographs (B) of subconfluent N/TERT-1 cells expressing shScr, shKAT2A#2, or shKAT2B#2. Red arrowheads highlight examples of isolated cells without any cell-cell contacts. DAPI = blue, F-actin = green. 10x objective. 110

4.4.2 Characterisation of Cell Adhesion Upon Loss of KAT2 and/or KAT2B The clustering phenotype observed upon loss of KAT2A in N/TERT-1 keratinocytes may reflect changes to cell adhesion. Specifically, shKAT2A#1- N/TERT-1 cells could form cell- cell contacts more readily compared to control cells. Therefore, I aimed to evaluate if KAT2A knockdown in N/TERT-1 keratinocytes led to changes in the expression and/or localisation of intercellular adhesion molecules.

E-cadherin (CDH1) is a calcium-dependent cell-cell adhesion molecule important for promoting tissue organisation and integrity (van Roy and Berx, 2008). E-cadherin is strongly expressed at the plasma membrane of keratinocytes throughout the epidermis. Intercellular connections mediated by E-cadherin regulate proliferation, stratification, and the induction of differentiation genes in cultured keratinocytes (Owens et al., 2000). However, subconfluent keratinocytes cultured under low calcium concentrations do not express E- cadherin strongly at the cell periphery. This only occurs when cell density and extracellular concentrations of calcium ions are sufficiently high. The clustering phenotype observed upon loss of KAT2A in N/TERT-1 keratinocytes could be due to a premature acquisition of E-cadherin connections between cells as a result of deregulated E-cadherin expression. However, no difference in E-cadherin expression was measured at the transcript or protein level in subconfluent N/TERT-1 cells expressing shKAT2A and/or KAT2B relative to control cultures (Figure 4.9A). Furthermore, IF staining revealed no substantial differences in the localisation of E-cadherin between control cells and those depleted for KAT2A and/or KAT2B (Figure 4.9A). This evidence suggests that E-cadherin is not implicated in the functions of KAT2A and KAT2B in proliferative keratinocytes.

The analysis was extended beyond that of the cadherin family of cell adhesion molecules to investigate the relative expression of desmosomal components, desmoglein-3 (DSG3) and periplakin (PPL); and tight junction proteins, claudin 1 (CLDN1), tight junction protein 1 (TJP1), and occludin (OCLN) in N/TERT-1 keratinocytes depleted for KAT2A and/or KAT2B. Similar to E-cadherin, these types of junctions are critical for cell-cell adhesion and are translocated to the plasma membrane with increasing cell density and extracellular calcium concentrations in vitro. The expression of CLDN1, OCLN, and PPL was significantly upregulated in N/TERT-1 cells expressing shKAT2A by 3-7-fold relative to control cultures (Figure 4.9B). These differences were amplified in N/TERT-1 cells depleted for both KAT2A and KAT2B. Notably, in contrast to the increased expression observed in KAT2A-depleted cells, the levels of CLDN1 and OCLN were decreased by 30%- 40% in the shKAT2B#1- N/TERT-1 keratinocytes. TJP1 and DSG3 transcript levels were found to be largely unchanged in all cell lines. 111

IF staining for claudin 1 was performed to determine if tight junctions were being formed prematurely upon KAT2A loss. Claudin 1 was negative at the cell membrane of all cells in shScr and shKAT2B samples whilst discrete areas of weak positive staining at cell-cell junctions was detected in the shKAT2A#1-N/TERT-1 and shKAT2A#1+shKAT2B#1- N/TERT-1 cultures (Figure 4.9B).

Overall, it was found that clustering of N/TERT-1 cells upon depletion of KAT2A associates with a selective upregulation of key adhesion molecules comprising tight junctions (CLDN1 and OCLN) and desmosomes (PPL), suggesting that these adhesion junctions could be forming prematurely in the undifferentiated state. However, since membranous signal for claudin 1 was not detected for most shKAT2A-depleted N/TERT-1 cells, it is unlikely that the clustering phenotype is due to an enhancement of tight junction function. It remains to be determined if an enhancement of desmosome function is instead contributing to the clustering of shKAT2A-N/TERT-1 cells.

112

Figure 4.9: KAT2A depletion in proliferative immortalised keratinocytes selectively upregulates cell-cell adhesion molecules. (A) Expression and localisation of E-cadherin (CDH1) in subconfluent N/TERT-1 cells expressing shScr, shKAT2A and/or shKAT2B using qPCR, Western blotting and immunofluorescence. (B) left- qPCR for CLDN1 (claudin 1), TJP1 (tight junction protein 1), OCLN (occludin), DSG3 (desmoglein 3), and PPL (periplakin) in subconfluent N/TERT-1 cells depleted for KAT2A and/or KAT2B. Fold change was calculated relative to shScr-N/TERT-1 cells. Right- immunofluorescence microscopy for claudin 1 in subconfluent N/TERT-1 cells depleted for KAT2A and/or KAT2B. Yellow arrowheads highlight regions of positive membranous signal. n = 3, error bars = ±s.d.; p values ≤0.05*, ≤0.01**, and ≤0.001***, ≤0.0001****. 113

4.4.3 KAT2A and KAT2B Knockdown Differentially Affects Vimentin Expression in Keratinocytes Vimentin is a class III intermediate filament protein that coexists with the keratin cytoskeleton (Richard et al., 1990a), and has been shown to coordinate migration and colony growth in cultured keratinocytes (Castro-Muñozledo et al., 2015; Velez-delValle et al., 2016). Since KAT2A depletion has previously been associated with perturbed vimentin networks in mouse EBs (Wang et al., 2018), I asked whether vimentin expression is changed upon KAT2A loss in keratinocytes and whether this could contribute to the clustering phenotype observed in N/TERT-1-shKAT2A#1 cultures. qPCR for VIM revealed a significant downregulation of 60% in N/TERT-1 cells expressing shKAT2A relative to control (Figure 4.10A). This difference was further enhanced to more than 80% in N/TERT-1 cells expressing both KAT2A and KAT2B, suggesting that KAT2B induced upon deletion of KAT2A can replace KAT2A activity and limit the effect on vimentin organisation in KAT2A-depleted keratinocytes. Conversely, knockdown of KAT2B in cells with normal KAT2A levels led to a small 2.7-fold upregulation of VIM expression relative to control. Vimentin expression at the protein level corresponded with these transcriptional changes (Figure 4.10A). Additional analyses were carried out to examine whether the changes in vimentin expression were similarly induced by KAT2A loss in primary NHEK-Neo keratinocytes. Depletion of KAT2A in these primary cells was found to result in decreased levels of vimentin of 50% at both the mRNA and protein level relative to control (Figure 4.10B). In contrast to NTERT-1-shKAT2B cells, depletion of KAT2B in NHEK-Neo cells led to a small decrease in vimentin expression at the transcript and protein level, although this difference was not as significant as that measured upon KAT2A depletion (Figure 4.10B).

Overall, these finding reveal KAT2A as a positive regulator of vimentin expression in cultured keratinocytes. Further, I find that KAT2B has differential effects on vimentin expression in immortalised and primary keratinocytes. Further work is necessary to investigate the relevance of these changes in vimentin expression with the clustering phenotype observed in N/TERT-1-shKAT2A keratinocytes.

114

Figure 4.10: KAT2A and KAT2B knockdown differentially affects vimentin expression in keratinocytes. Expression analysis for vimentin (VIM) in subconfluent N/TERT-1 (A) and NHEK-Neo keratinocytes (B) expressing shScr, shKAT2A, and/or shKAT2B using qPCR (left) and Western blotting (right). Error bars = ±s.d. n = 3, p values <0.05*, <0.01**, and <0.001***.

4.4.4 KAT2A Regulates Matrix Metalloproteinase Expression in Proliferative Keratinocytes In addition to changes in cytoskeletal organisation, decreased cell motility and cell clustering phenotypes observed in N/TERT-1-shKAT2A keratinocytes may also result from changes in how the cells interact with the ECM. Matrix metalloproteinases (MMPs) are a family of secreted zinc-dependent endopeptidases that are implicated in the degradation and remodelling of ECM components. Upon wounding, the activities of nascent MMPs disassociate cell-matrix interactions to facilitate keratinocyte migration across the wound bed (Pilcher et al., 1997a). These MMPs are also important for keratinocyte motility in vitro (Xue and Jackson, 2008). Several MMPs have also been shown to act on non-ECM substrates including cytokines, cell surface receptors, growth factors, that affect other bioprocesses such as epidermal cell adhesion, proliferation and differentiation (Egeblad and Werb, 2002; McCawley et al., 2008; Rodríguez et al., 2010; Schlage and auf dem Keller, 2015). To further explore the roles of KAT2A and KAT2B in regulating how epidermal 115 keratinocytes interact with the extracellular matrix, I examined whether the expression of these secreted proteases is altered in KAT2A-depleted keratinocytes in a manner that correlate with their changes in culture morphology. qPCR was performed on five MMPs representing the three major groups of MMPs: MMP1 and MMP13 (collagenases), MMP2 (gelatinases), and MMP3 and MMP10 (stromelysins). With the exception of MMP2, the other MMP genes were significantly upregulated by 7-10- fold upon depletion of KAT2A in N/TERT-1 keratinocytes (Figure 4.11A). Cells depleted of both KAT2A and KAT2B exhibited even greater increases of >15-25 fold in MMP1, MMP3, MMP10 and MMP13 mRNAs compared to shScr control cells. By contrast, knockdown of KAT2B did not affect expression of any of the MMP genes analysed. Specific upregulation of MMP1 upon loss of KAT2A but not KAT2B was also observed in primary NHEK-Neo keratinocytes (Figure 4.11B).

This evidence demonstrates KAT2A, but not KAT2B, as the predominant paralogue that negatively regulates MMP expression in proliferative keratinocytes before the onset of differentiation. The observation that MMP expression is further upregulated in shKAT2A- N/TERT-1 cells upon depletion of KAT2B indicates that both paralogues may act redundantly to regulate these genes. This redundancy was not detectable using qPCR in keratinocytes expressing shKAT2B alone, which is likely because basal expression of KAT2B is already low at undifferentiated timepoints. Since KAT2B levels are increased in proliferate keratinocytes expressing shKAT2A, the redundancy of both HATs in regulating MMP expression is only detectable when this compensation in KAT2B expression is curtailed in the double knockdown cell lines.

116

Figure 4.11: Matrix metalloproteinase expression is deregulated upon knockdown of KAT2A in proliferative immortalised keratinocytes. qPCR in subconfluent N/TERT-1 (A) or NHEK-Neo keratinocytes (B) expressing shKAT2A and/or shKAT2B for genes encoding matrix metalloproteinases belonging to the three major groups: MMP1 and MMP13 (collagenases), MMP2 (gelatinases), and MMP3 and MMP10 (stromelysins). Fold change in gene expression was calculated relative to scrambled control cells. n = 3, error bars = s.d. p values <0.05*, <0.01**, <0.001***, and <0.0001****.

117

4.5 KAT2A Knockdown Triggers Premature Expression of Differentiation Markers in Proliferative Keratinocytes

KAT2A is abundant in proliferative keratinocytes but is significantly downregulated upon differentiation. This could reflect a functional significance for KAT2A specifically in proliferative keratinocyte populations. Numerous lines of evidence show KAT2A as a pluripotency stabiliser and, in some cases, a negative regulator of differentiation in adult stem cells. KAT2A may be functioning in a similar capacity to maintain basal keratinocyte stemness by repressing transcription of differentiation-associated genes and promoting the expression of stemness-associated genes. Furthermore, KAT2B, which has previously been shown by Pickard and colleagues (2010) to drive primary keratinocyte differentiation, may function in an antagonistic manner to KAT2A in proliferative cells to prime differentiation genes for activation. I aimed to assess if loss of KAT2A and/or KAT2B alters the expression of differentiation genes in proliferative keratinocytes.

The expression levels of three markers of differentiation: keratin 10 (KRT10, early marker), involucrin (IVL, mid-late marker) and filaggrin (FLG, late marker) were analysed in proliferative N/TERTs-1 and NHEK-Neo keratinocytes expressing shKAT2A and/or shKAT2B. The transcript levels of KRT10, IVL, and FLG in normal proliferative keratinocytes at subconfluency are typically low or undetectable. By contrast, in both N/TERT-1 and primary NHEK-Neo keratinocytes depleted for KAT2A, KRT10, IVL, and FLG were upregulated 3-15-fold relative to shScr control cells (Figure 4.12 and Figure 4.13). The increase in these differentiation marker gene expression were further enhanced in the double KAT2A and KAT2B depleted N/TERT-1 cells, while knockdown of only KAT2B did not result in major changes in the expression of KRT10 and FLG, and instead led to downregulation of IVL by 64-67% relative to shScr control cells (Figure 4.12 and Figure 4.13). More importantly, the increases in KRT10 and IVL transcripts corresponded to similar changes in protein levels. While keratin 10 and involucrin are barely detectable in control cell lysates, these proteins were distinctly present in shKAT2A#1-N/TERT-1 keratinocytes and were approximately doubled in shKAT2A#1+shKAT2B#1-N/TERT-1 cells (Figure 4.14). KAT2A depletion in NHEK-Neo keratinocytes led to a small increase in keratin 10 and ~ 5-fold increase in involucrin protein levels, which corresponded well with the ~2-fold and >10-fold increases in KRT10 and IVL transcripts respectively measured in this cell line (Figure 4.14). Keratin 10 and involucrin protein levels in KAT2B-depleted NHEK-Neo keratinocytes were similar to that of shScr cells. Despite the ~ 4-fold increase in FLG mRNA measured in the KAT2A-depleted cells, the protein levels of filaggrin were undetectable in these proliferative keratinocytes and shScr controls using Western blot. 118

In summary, these findings show that KAT2A loss in cultured proliferative keratinocytes shifts expression profiles towards that characteristic of differentiation. This supports the hypothesis that KAT2A is functioning to limit differentiation and to maintain stemness in undifferentiated keratinocytes. Furthermore, I also show that KAT2B loss has minimal impact on the expression of these differentiation markers, in keeping with the view of this paralogue predominantly functioning in differentiated keratinocyte populations.

Figure 4.12: shKAT2A#1 expression in subconfluent immortalised and primary keratinocytes upregulates differentiation genes. qPCR was performed for early (KRT10, keratin10), mid-late (INV, involucrin), and late (FLG, filaggrin) keratinocyte differentiation markers in subconfluent N/TERT-1 and NHEK-Neo cells expressing shScr, shKAT2A#1 and/or shKAT2B#1. Fold change in gene expression was calculated relative to scrambled control cells. n = 3, error bars = ±s.d. p values <0.05*, <0.01**, <0.001***, and <0.0001****.

119

Figure 4.13: shKAT2A#2 expression in proliferative immortalised keratinocytes upregulates differentiation genes. qPCR was performed for early (KRT10, keratin10), mid- late (INV, involucrin), and late (FLG, filaggrin) keratinocyte differentiation markers in subconfluent N/TERT-1 and NHEK-Neo cells expressing shScr, shKAT2A#2 and/or shKAT2B#2. Fold change in gene expression was calculated relative to scrambled control cells. n = 3, error bars = ±s.d. p values <0.05*, <0.01**, and <0.001***. 120

Figure 4.14: KAT2A depletion triggers premature expression of differentiation markers at the protein level in proliferative keratinocytes. Western blotting was performed for an early (keratin 10) and mid-late (involucrin) differentiation markers in subconfluent N/TERT-1 and NHEK-Neo keratinocytes expressing shScr, shKAT2A, and/or shKAT2B. β-actin serves as a loading control. kDa = kilodalton.

121

4.6 KAT2A and KAT2B Depletion Oppositely Impacts Keratinocyte Differentiation In Vitro

Optimal epidermal keratinocyte differentiation relies on the coordinated expression of structural, adhesion, and metabolic genes amongst others. Their expression must be both induced at the correct time and be at sufficient levels according to the degree of keratinocyte differentiation. When either of these criteria are not fulfilled, as is typically observed in human skin disorders, the epidermal barrier is compromised. Whilst a strong body of evidence describes a combinatory role for various transcription factors in driving keratinocyte differentiation, research into the roles chromatin modifiers could play in this process are more limited. HATs are known to serve as coactivators to selectively modulate gene transcription and to in turn yield major changes to cell phenotype during cellular differentiation of non-keratinocytes. KAT2A and KAT2B have recurrently been identified as either positive or negative regulators of cellular differentiation depending upon tissue- and cell-type. In Chapter 4.5, I showed that KAT2A loss leads to a small yet significant upregulation of differentiation markers in keratinocyte cultures in the absence of initiating signals, suggesting that KAT2A functions to some degree in limiting keratinocyte differentiation in vitro. I have also shown that KAT2B loss has minimal impact on the expression of differentiation markers in proliferative keratinocytes except for IVL, which was downregulated. I predict that KAT2B loss will negatively affect the expression of differentiation genes when keratinocytes are induced to differentiate as it is in these population of cells where KAT2B is most abundant. This hypothesis suggests that KAT2A and KAT2B are not functionally redundant for keratinocyte differentiation and may instead have opposing effects on this process. Such functional divergences between KAT2A and KAT2B in cellular differentiation have been previously described. Myogenic differentiation of KAT2A-/- EBs is substantially enhanced (Lin et al., 2007), whilst loss of KAT2B activity in an immortalised myoblast cell line has an inhibitory effect on differentiation (Puri et al., 1997). Similarly, loss of KAT2A in primary haematopoietic cells enhances myeloid differentiation (Bararia et al., 2016), whilst KAT2B depletion inhibits granulocytic differentiation in acute promyelocytic leukaemia cells (Sunami et al., 2017). Based on these studies, I further envisaged that KAT2A loss would enhance keratinocyte differentiation since KAT2A is not present to restrict this process.

Experiments described in the following section aimed to ascertain if KAT2A and/or KAT2B loss affects the differentiation process in cultured keratinocytes when initiating signals are present. 122

4.6.1 Morphologies of Differentiated Keratinocytes Depleted for KAT2A and/or KAT2B Cultured keratinocytes undergo dramatic changes in morphology when grown to confluency and induced to differentiate with 1.8mM calcium treatment. Phase contrast microscopy was used to determine if KAT2A and/or KAT2B loss delayed or enhanced the acquisition of these morphologies relative to keratinocytes expressing shScr. This would reveal if KAT2A and/or KAT2B are important for N/TERT-1 cells to transition from undifferentiated to differentiated keratinocytes at the cellular level.

N/TERT-1 cells expressing shScr, shKAT2A, and/or shKAT2B were morphologically identical at confluency. All cell lines were responsive to differentiation stimuli and adopted morphologies appropriate for early keratinocyte differentiation (Figure 4.15). At day 4 of differentiation overall cell morphology was similar between control cells and N/TERT-1 cells depleted for KAT2A#1 and/or KAT2B#1. However, the number of cornified cell stacks formed was higher in shKAT2A#1-N/TERT-1 keratinocytes compared to control cells, whilst these were almost completely absent in shKAT2B#1-N/TERT-1 cultures. The cell morphology of double knockdown N/TERT-1 keratinocytes at day 4 of differentiation more closely resembled that of N/TERT-1 cells expressing shKAT2A rather than shKAT2B. NHEK-Neo cultures expressing shKAT2B#1 were morphologically identical to control cells at confluency, but nuclear degradation was noticeably delayed at day 4 of differentiation (Figure 4.16). The proliferative defect caused by KAT2A knockdown in NHEK-Neo keratinocytes precluded similar assessments of differentiated cell morphologies.

These findings show that KAT2A and/or KAT2B loss does not largely affect the transition from undifferentiated to differentiated keratinocytes at a cellular level. Rather, KAT2A loss may enhance the commitment of differentiated keratinocytes to stratify and terminally differentiate, whilst KAT2B loss may delay these events.

123

Figure 4.15: Immortalised keratinocytes depleted for KAT2A display more stacks of cornified cells when induced to differentiate. Phase contrast micrographs captured for N/TERT-1 cells expressing shScr, shKAT2A#1, and/or shKAT2B#1 at confluency and day 4 of differentiation. 20x objective. Red arrowhead highlights a stack of cornified cells.

124

Figure 4.16: KAT2B depletion in primary keratinocytes delays the onset of morphological changes characteristic of differentiation. Phase contrast micrographs of NHEK-Neo keratinocytes expressing shScr or shKAT2B#1 at confluency and day 4 of differentiation. Prior to differentiation, both cell lines are morphologically similar with polyhedral cells and distinct nuclear membranes. Upon induction of differentiation, control cells display faint fragmented nuclear membranes whilst a greater population of KAT2B depleted cells retain more distinct nuclear membranes. 20x objective. 125

4.6.2 Knockdown of KAT2A and/or KAT2B Alters the Kinetics of Differentiation Gene Expression upon Induction The kinetics and patterns of KRT10, IVL, and FLG gene expression in differentiating keratinocytes are predictable in the in vitro system used in this study (see Chapter 3.1 and Figure 3.6). A change in these properties as a result of KAT2A and/or KAT2B loss would indicate broad defects in keratinocyte differentiation. Furthermore, marker-specific changes in expression would reveal if KAT2A and/or KAT2B loss specifically impacts early or late keratinocyte differentiation events. To assess these possibilities, qPCR for KRT10, IVL, and FLG was performed on N/TERT-1 keratinocytes expressing shScr, shKAT2A#1, and/or shKAT2B#1 prior to differentiation and over six days of calcium-induced differentiation.

Expression of shKAT2B#1 or shKAT2B#2 in N/TERT-1 keratinocytes did not alter the kinetics and patterns of KRT10 gene expression relative to control cells (Figure 4.17 and Figure 4.18A). KRT10 expression in shKAT2A#1-N/TERT-1 cells was also similar to control cells from confluency onwards. KRT10 mRNA levels remained significantly high in the transition from subconfluency to confluency in N/TERT-1 cells depleted for both KAT2A and KAT2B compared to control cells, but these differences were normalised upon differentiation-induction. Interestingly, at day 6 of differentiation, KRT10 mRNA levels were significantly higher in the double knockdown cells compared to control cells, possibly because expression is not effectively curtailed. IVL gene expression in shKAT2A#1- N/TERT-1 cells, which was prematurely induced prior to differentiation, remained significantly high at confluency relative to control cells, but these differences normalised upon induction of differentiation. IVL gene expression was also higher in double knockdown N/TERT-1 keratinocytes at confluency relative to control cells. However, these difference in IVL expression did not normalise to control levels until day 6 of differentiation unlike shKAT2A#1-N/TERT-1 keratinocytes. FLG gene expression remained significantly upregulated in both shKAT2A#1-N/TERT-1 cells and double knockdown cells at confluency relative to control levels. This upregulation is limited to undifferentiated timepoints, as FLG mRNA levels in both cell lines normalised to those measured in control cells upon differentiation induction.

In Chapter 4.5, I described a significant decrease in IVL expression upon loss of KAT2B in subconfluent N/TERT-1 keratinocytes. This defect is present and more prominent when these cells are cultured to confluency and induced to differentiate. In fact, mRNA levels of IVL in shKAT2B#1-N/TERT-1 cells do not attain those measured in control cells at subconfluency until after day 2 of differentiation. Nonetheless, IVL mRNA levels in shKAT2B#1-N/TERT-1 cells did eventually peak at day 6 of differentiation at the same 126 levels as control cells. As described in Chapter 4.5, KAT2B loss in N/TERT-1 keratinocytes does not impact FLG expression at subconfluency. In these experiments, FLG mRNA levels are significantly reduced in shKAT2B-N/TERT-1 cells relative to control levels only at day 2 and day 4 of differentiation. Again, similar to the expression pattern for IVL expression, mRNA levels of FLG normalised to control levels at day 6 of differentiation. In contrast to measurements in shKAT2B-N/TERT-1 keratinocytes, KAT2B depletion in NHEK-Neo cells did not impact IVL expression but did lead to a significant decrease in FLG mRNA levels at day 4 of differentiation (Figure 4.18B).

In summary, these findings show that KAT2A and KAT2B are dispensable for the induction of KRT10, IVL, and FLG gene expression in differentiating keratinocytes in vitro. KAT2A loss did not enhance their rate of induction with differentiation. Rather, KAT2A loss only affected the expression of these genes at undifferentiated timepoints, in keeping with the view of KAT2A as a factor that maintains keratinocyte stemness. Although IVL and FLG mRNA levels in N/TERT-1 cells expressing shKAT2B#1 did peak at the same levels as control cells, the rate at which they were induced was significantly slower. These delays in gene expression were specific for both late differentiation markers and not for KRT10, suggesting that KAT2B functions to promote the late stages of keratinocyte differentiation in vitro.

127

Figure 4.17: KAT2A and/or KAT2B-depletion alters differentiation gene kinetics in immortalised keratinocytes. qPCR was performed for early (KRT10) and late (IVL and FLG) differentiation markers in N/TERT-1 cells expressing shScr, shKAT2A, and/or shKAT2B prior to- and over six days of calcium-induced differentiation. Changes in gene expression are represented as mean fold changes (log2) relative to shScr-N/TERT-1 levels at subconfluency. n = 3, error bars = ±s.d. p values ≤0.05*, ≤0.01**, ≤0.001***, and ≤ 0.0001 ****. 128

Figure 4.18: The induction of FLG expression is compromised by shKAT2B#2 in N/TERT-1 cells and shKAT2B#1 in NHEK-Neo cells. (A) Gene expression levels for KRT10 and FLG in shKAT2A#1/shKAT2B#2-N/TERT-1 cells at day 4 post-differentiation relative to shScr-N/TERT-1 cells. n = 3 (B) Gene expression levels for IVL and FLG in shKAT2B#1-NHEK-Neo cells at day 4 post-differentiation relative to shScr-NHEK-Neo cells. n = 2, error bars = ±s.d. p value ≤0.01**.

4.6.3 Knockdown of KAT2A and/or KAT2B Alters Protein Expression of Differentiation Markers Upon Induction

The transcriptional changes measured for KRT10, IVL, and FLG upon knockdown of KAT2A and/or KAT2B in differentiated N/TERT-1 cells may not correlate with their corresponding protein levels. Furthermore, KAT2A and KAT2B may affect the protein levels of keratin 10, involucrin and filaggrin independent of their effects on gene expression. To assess these possibilities, Western blot was performed for keratin 10, involucrin, and filaggrin on whole cell protein extracts from N/TERT-1 keratinocytes expressing shScr, shKAT2A, and/or shKAT2B at confluency and day 2 and day 4 of differentiation. 129

Keratin 10 protein levels were slightly decreased by equal amounts in shKAT2A#1- N/TERT-1 cells and shKAT2B#1/#2-N/TERT-1 cells at day 2 and day 4 of differentiation relative to control levels (Figure 4.19 and Figure 4.20). These decreases in keratin 10 protein expression were even more pronounced in the double knockdown cell line. Involucrin protein levels were significantly higher in shKAT2A#1-N/TERT-1 cells relative to those in control cells at day 4 of differentiation, whilst shKAT2B#1/#2-N/TERT-1 levels were significantly decreased. Low levels of involucrin were detectable prematurely in double knockdown N/TERT-1 keratinocytes at day 2 of differentiation which increased further at day 4 of differentiation to equal the protein levels measured for shKAT2A#1- N/TERT-1 keratinocytes. Filaggrin protein levels were prematurely expressed at low levels at day 2 of differentiation in shKAT2A#1-N/TERT-1 cells relative to control cells. However, filaggrin protein levels were equal between control cells and shKAT2A#1-N/TERT-1 keratinocytes at day 4 of differentiation. KAT2B loss led to a substantial decrease in filaggrin expression at day 4 of differentiation (Figure 4.19 and Figure 4.20). Loricrin protein levels were similarly affected by KAT2B loss (Figure 4.20). Double knockdown for KAT2A and KAT2B in N/TERT-1 cells significantly decreased the protein levels of filaggrin at day 4 post-differentiation to a similar extent measured in shKAT2B-N/TERT-1 lysates.

To summarise, KAT2A and/or KAT2B significantly affects the normal protein expression patterns of several differentiation markers in N/TERT-1 keratinocytes over the course of differentiation. KAT2A depletion seemed to accelerate keratinocyte differentiation upon calcium treatment as indicated by the enhanced protein expression of late differentiation markers and is consistent with the morphologies described in section 4.6.1. It is plausible that the depletion of KAT2A allows differentiation gene expression programs to more readily become active when inductive signals are present. This data further supports the idea of KAT2A functioning as a repressor of the differentiation gene expression program in keratinocytes and mirrors previous reports of enhanced skeletal muscle differentiation in the absence of KAT2A (Lin et al., 2007). Furthermore, consistent with observations by Pickard et al., (2010), KAT2B depletion significantly delayed the protein expression of late differentiation markers, supporting the idea of this paralogue functioning to drive the keratinocyte differentiation program upon calcium-induction. Interestingly, the protein expression of filaggrin in differentiated double knockdown cells was affected to a similar degree as in KAT2B depleted cells despite FLG gene expression being comparable to control cell (see section 4.6.2). This could indicate that KAT2B is regulating the stability of the filaggrin protein during keratinocyte differentiation.

. 130

Figure 4.19: shKAT2A#1 and shKAT2B#1 differentially affects protein expression of early and late differentiation markers in differentiating immortalised keratinocytes. Confluent (day 0) and differentiating (day 2 and day4) N/TERT-1 keratinocytes expressing shScr, shKAT2A#1, and/or shKAT2B#1 were subjected to Western blotting for keratin 10, involucrin, and filaggrin. A short and a 30 fold longer exposure (exp.) for the filaggrin immunoblot is shown. Equal loading was confirmed by immunoblotting β-actin. Even protein transfer to the membrane was confirmed using Ponceau S. kDa = kilodalton. 131

Figure 4.20: Protein expression of late differentiation markers is negatively affected by shKAT2B#2 in immortalised keratinocytes. Representative immunoblots for early (keratin 10) and late (involucrin, loricrin, and profilaggrin) differentiation markers in shKAT2B#1/#2-N/TERT-1 cells prior to- (day 0) and post-induction of differentiation (day 2 and day 4). β-actin served as a loading control. Ponceau S served as a loading and transfer control.

In this chapter, evidence was presented showing differential effects of KAT2A and KAT2B loss in proliferative and differentiated keratinocytes. In keeping with their expression patterns during epidermal homeostasis, the effects of KAT2A and KAT2B loss were most pronounced in keratinocytes prior to and following differentiation, respectively. The premature expression of early and late differentiation markers in proliferative shKAT2A- keratinocytes suggests that KAT2A functions broadly to maintain the undifferentiated cellular state, whilst the delays in the expression of late differentiation markers observed in differentiated shKAT2B-keratinocytes suggests that KAT2B functions to promote terminal differentiation. The atypical morphologies and the changes in MMP, vimentin, and adhesion molecule expression detected upon loss of KAT2A in proliferative keratinocytes could also reflect a shift to a more differentiated state. So far, the effects of KAT2A and/or KAT2B loss on gene expression in cultured keratinocytes have been evaluated based on a focused panel of genes. In the next chapter, I sought to more comprehensively investigate the gene expression changes in these cells using RNA-sequencing (RNA-seq) to provide a more global picture of KAT2A and KAT2B function in undifferentiated and differentiated keratinocytes. 132

CHAPTER 5 TRANSCRIPTOME PROFILING REVEALS DISTINCT REGULATORY ROLES FOR KAT2A AND KAT2B IN KERATINOCYTE DIFFERENTIATION

5.1 Introduction

The roles of KAT2A in transcriptional regulation have long been appreciated since its discovery in yeast when it was found that yKAT2A was required to transcriptionally coactivate amino acid biosynthetic genes (Georgakopoulos and Thireos, 1992). Similarly, soon after its discovery, KAT2B was found to be required for the activity of multiple transcription factors that are involved in executing cell-type-specific gene expression programs (Sartorelli et al., 1999), including MyoD (Puri et al., 1997), the retinoic acid receptor, and CREB (Korzus et al., 1998). Since these early descriptions, KAT2A and KAT2B have proven to be important transcriptional regulators for a wide spectrum of biological processes in various cell types, owing to their range of substrate specificities and ubiquitous expression. This is particularly highlighted in recent years by a handful of studies that have employed transcriptomic technologies to understand the genes and cellular processes regulated by KAT2A and/or KAT2B in cultured cells and mouse tissues. A commonality amongst these studies is the observation that KAT2A and/or KAT2B loss deregulates only a small proportion of expressed genes, suggesting that both HATs act in a gene-specific manner, rather than as general transcriptional co-activators. These analyses also show that a significant proportion of genes deregulated upon KAT2A and/or KAT2B loss are upregulated, suggesting that these HATs can function to directly or indirectly repress a subset of genes. For example, RNA-seq analysis of mouse embryonic fibroblasts deleted for KAT2A and KAT2B revealed a downregulation of 844 genes, which constituted 6.4% of the total number of expressed genes, and an upregulation of 224 genes (Jin et al., 2014). The downregulated genes of this dataset were related to multiple developmental processes, including epithelium development, and cell adhesion, whilst upregulated genes were linked to immune response or response to virus. Another study performed RNA-seq analysis on hippocampal cells derived from KAT2A knockout mice to reveal an even more narrow set of differentially expressed genes, of which many were linked to neuroactive ligand–receptor signalling (Stilling et al., 2014). The transcriptome has also been analysed in KAT2A knockout neurospheres. Genes associated with neuronal differentiation were upregulated in these cultures, whilst those related to WNT-Ras signalling were downregulated (Martínez- Cerdeño et al., 2012). The labs of Sharon Dent and Cristina Pina have explored KAT2A- dependent gene expression in mESCs using RNA-seq. Using lax cut-off thresholds, Hirsch 133 and Dent identified 2239 genes downregulated in KAT2A-/- mESCs and only 92 genes that were upregulated compared to control data sets (Hirsch et al., 2015). They found that 474 of these genes were direct targets of KAT2A, most of which being involved in cell cycle regulation. By contrast, Moris and Pina identified 599 genes that were mildly differentially expressed in mESCs treated with a chemical inhibitor for KAT2A, with only three genes showing a fold change >2 (Moris et al., 2018). In 2018, Dent et al. extended their transcriptomic analysis to differentiated KAT2A-/- EBs. Using gene set enrichment analysis, they found that these cultures were deficient for several biological processes and signalling pathways, including multicellular organismal development, cell surface receptor linked signal transduction, and fibroblast growth factor signalling (Wang et al., 2018).

Taken together, these studies demonstrate KAT2A and KAT2B as key orchestrators of gene expression programs associated with general and cell-type-specific cellular processes, including differentiation, the cell cycle, metabolism, and cell adhesion. However, it is important to acknowledge that most of these studies do not take into account the possibility of KAT2B sharing redundant gene regulatory roles with KAT2A. It is also possible that cells compensate for KAT2A loss by redirecting the functions of KAT2B to mirror that of KAT2A. As such, these redundancies and/or compensatory mechanisms may mask the full extent of KAT2A’s influence on gene expression. Furthermore, whilst the analysis performed by Jin et al. does circumvent these issues by transcriptionally profiling cells deleted for both KAT2A and KAT2B, it is not permissive for distinguishing between genes regulated distinctly or redundantly by either HAT. Therefore, a side-by-side comparison between the transcriptional profiles of KAT2A-depleted cells and KAT2B-depleted cells is warranted to fill this gap in knowledge.

In this chapter, experiments are described that broadly aimed to identify genes and cellular processes regulated by KAT2A and/or KAT2B in undifferentiated and differentiated keratinocytes at the genome-wide level using RNA-seq analysis. N/TERT-1 cells expressing shScr, shKAT2A, shKAT2B, or both shKAT2A and shKAT2B were subjected to RNA-seq at three timepoints chosen based on initial characterisation experiments: subconfluent, which is when the clustering phenotype and gene expression changes are most apparent for KAT2A loss; confluent, which represents the starting point of differentiation when cell proliferation is cell contact inhibited; and day 4 of differentiation, which is when the effects of KAT2B loss on gene expression are most profound. Two biological replicates were analysed for each experimental group per timepoint. 134

5.2 Quantitative Expression Analysis of HATs in Undifferentiated and Differentiated Keratinocytes qPCR analysis described in Chapter 3.3 aimed to determine the relative abundance between KAT2A and KAT2B mRNA in keratinocytes at undifferentiated and differentiated timepoints by comparing their corresponding ΔCt values (Figure 3.9C). This analysis suggested that KAT2A expression was significantly higher in proliferative keratinocytes compared to KAT2B, whilst the reverse was true in differentiated keratinocytes. However, this method of analysis is semi-quantitative due in part to sequence-specific signal generation and differences in primer efficiencies. RNA-seq analysis can circumvent these issues when read counts for a given gene are converted to RPKM (reads per kilobase of exon model per million mapped reads), a measure that more reliably allows for proportional quantification of the transcriptome. From the RNA-seq data, I was able to determine and compare the transcript levels of all major HATs, including KAT2A and KAT2B, in shScr-N/TERT-1 cells at subconfluent, confluent, and day 4 of differentiation timepoints. This analysis would more conclusively determine if KAT2A expression is favoured over KAT2B expression in undifferentiated keratinocytes and if the opposite is true in differentiated keratinocytes, which would further support a functional importance of each HAT paralogue for that timepoint.

KAT1, an enzyme primarily responsible for acetylating newly synthesised histones, was found to be the most highly expressed HAT in shScr-N/TERT-1 cells at all timepoints analysed (Figure 5.1). KAT2A was the second highest expressed HAT at subconfluent and confluent timepoints but was sharply downregulated to become one of the lowest expressed HATs at day 4 of differentiation, consistent with its expression profile characterised by qPCR. Conversely, KAT2B was the second lowest expressed HAT prior to differentiation but was significantly upregulated to become one of the highest expressed HATs at day 4 of differentiation. Consistent with the qPCR analysis of HAT expression profiles described in Chapter 3.3 (Figure 3.9A), the gene expression of KAT3A, KAT3B, KAT5, KAT6A, KAT6B, KAT7, or KAT8 was either largely unchanged or marginally decreased between undifferentiated and differentiated cell states, whilst KAT1 and KAT9 mRNA levels were significantly decreased with differentiation. Nonetheless, the largest changes in transcript abundance amongst these HATs were observed with KAT2A and KAT2B as their expression is inversely regulated upon differentiation. 135

This analysis shows that KAT2A and KAT2B are preferentially expressed relative to each other in undifferentiated and differentiated keratinocytes, respectively, further supporting the idea of each paralogue functioning distinctly in these two cellular states.

Figure 5.1: KAT2A is preferentially expressed over KAT2B in undifferentiated keratinocytes. The mean expression levels of the indicated HAT genes in shScr-N/TERT-1 cells at subconfluent, confluent, and day 4 post-differentiation timepoints in terms of RPKM (reads per kilobase of exon model per million mapped reads). Bars denoting KAT2A and KAT2B expression levels are highlighted respectively in blue and red. Error bars = ± s.d., n = 2. 136

5.3 Establishing Sample Variance and Relatedness

A principal component analysis (PCA) plot was generated to visually evaluate the degree of variance between biological replicates as a quality control measure, and the relatedness between experimental cells and control cells with respect to their transcriptional profiles. The PCA plot showed tight clustering among biological replicates, indicating that variation in their gene expression profiles was minimal (Figure 5.2). As expected, the largest variances in gene expression were associated with cell state changes as the keratinocytes transition from highly proliferative progenitors at subconfluence to a cell-contact inhibited, ‘primed’ state of initial differentiation at confluency, to finally a mid-late differentiated state after 4 days of induction. shKAT2A#1- and shKAT2A#1+shKAT2B#1-N/TERT-1 cells, but not shKAT2B#1-N/TERT-1 cells, diverged away from shScr control cells at subconfluency towards confluent clusters. At the confluent timepoint, shKAT2B#1-N/TERT-1 cells were generally well-related to shScr control cells, whilst shKAT2A- and shKAT2A#1+shKAT2B-N/TERT-1 cells diverged away from these cells. shKAT2A#1- N/TERT-1 cells closely clustered with shScr-N/TERT-1 cells at day 4 of differentiation, whilst shKAT2B#1- and shKAT2A#1+shKAT2B#1-N/TERT-1 cells were pronouncedly separate from these cells and with respect to each other.

To compare similarities and differences in differentiation gene expression amongst the samples, the RNA-seq data was subjected to unsupervised hierarchical clustering of the top 10% most significantly differentially expressed genes between shScr-N/TERT-1 cells at subconfluency and day 4 of differentiation. Data from this analysis indicated that the expression profiles of these 258 genes in shKAT2A#1- and shKAT2A#1+shKAT2B#1- N/TERT-1 samples at subconfluency cluster with that of shScr-N/TERT-1 samples at confluency rather than at the subconfluent timepoint (Figure 5.3). Furthermore, the upregulation of differentiation-associated genes was found to be markedly reduced in shKAT2B-N/TERT-1 cells to such a degree that it clustered apart from the other cell lines at day 4 of differentiation.

Overall, these analyses indicate that shKAT2A#1 or shKAT2B#1 more profoundly impacts the transcriptome of N/TERT-1 cells at subconfluency and day 4 of differentiation, respectively. The loss of both KAT2A and KAT2B in N/TERT-1 cells appears to significantly affect the transcriptome at all timepoints, with expression profiles at subconfluency more related to that of shKAT2A#1-N/TERT-1 cells, and expression profiles at day 4 of differentiation being surprisingly distinct to that of shKAT2B#1-N/TERT-1 cells. Finally, clustering analysis suggests that KAT2A loss in subconfluent N/TERT-1 cells 137 allows for the acquisition of a differentiation-associated gene expression profile in line with a ‘primed’ state, and that KAT2B loss compromises proper expression of a broad range of differentiation-associated genes when induced.

Figure 5.2: Global transcriptional variance between biological replicates subjected to RNA-seq analysis is minimal. A principal component (PC) analysis plot generated from RNA-sequencing data of shScr (grey), shKAT2A#1 (blue), shKAT2B#1 (orange), and shKAT2A#1+shKAT2B#1-N/TERT-1 cells (light blue) at subconfluent (circles) confluent (triangles) and day 4 post-differentiation (square) timepoints. Samples associated with the same timepoint are demarcated with red ovals. n = 2.

138

Figure 5.3: Gene expression heatmap showing clustering of differentiation-associated genes in immortalised keratinocytes depleted for KAT2A and/or KAT2B at subconfluency, confluency, and day 4 of differentiation. Comparative gene expression and unsupervised hierarchical clustering analysis of 258 genes identified as the top 10% of differentially expressed genes between shScr-N/TERT-1 cells at subconfluency and day 4 of differentiation. Fold change > 2, false discovery rate < 0.05, colour scale = row Z-score.

139

5.4 Differential Gene Expression Analysis of KAT2A and/or KAT2B Depleted Keratinocytes

The similarities in sequence and enzymatic activities between KAT2A and KAT2B, and the observation that mice null for both HATs die earlier than KAT2A-/- mice (Xu et al., 2000), suggests that KAT2A and KAT2B are functionally redundant at least for certain development processes. Giving credence to this notion, the cardiogenic transcription factor, T-box transcription factor 5 (TBX5), was recently found to be acetylated by KAT2A and KAT2B to redundantly regulate its activity during zebrafish embryogenesis (Ghosh et al., 2018). There is also evidence that demonstrates non-redundant functions of KAT2A and KAT2B in cultured cells and in vivo. For instance, KAT2A and KAT2B have been shown to have opposite effects on telomere maintenance in cell lines that utilise the alternative lengthening of telomeres pathway (Jeitany et al., 2017). Additionally, loss of KAT2A or KAT2B perturbs craniofacial development in zebrafish, indicating that these HATs are unable to compensate for each other and thus function distinctly in this process (Sen et al., 2018). Although evidence clearly supports the potential of KAT2A and KAT2B to function redundantly and non-redundantly in various cellular processes, there is a lack of insight into this behaviour at the level of gene regulation, despite both HATs being well established transcriptional regulators. For this reason, I aimed to identify and compare genes that were differentially expressed between shKAT2A#1-, shKAT2B#1-, and shKAT2A#1+shKAT2B#1-N/TERT-1 cells in order to understand which genes/cellular processes are regulated distinctly or redundantly by KAT2A and KAT2B in keratinocytes at subconfluent, confluent, and day 4 of differentiation timepoints.

Differentially expressed genes (DEGs) were identified in each experimental group relative to shScr-N/TERT-1 cells at the corresponding timepoint using strict filter criteria based on fold change (> ±2) and statistical significance (false discovery rate, FDR < 0.05). The total number of DEGs for any cell line at a given timepoint ranged between 48 and 653 (Figure 5.4). At subconfluency, over threefold more DEGs were identified in shKAT2A#1-N/TERT- 1 cells compared to shKAT2B#1-N/TERT-1-cells, indicating that KAT2A has a greater influence on the transcriptome than KAT2B at this timepoint. However, at day 4 post- differentiation the total number of DEGs identified in shKAT2B-N/TERT-1 cells was almost 2.5-fold higher than that identified in shKAT2A#1-N/TERT-1 cells, indicating that KAT2B has a greater influence on the transcriptome than KAT2A at this timepoint. The total number of DEGs identified for shKAT2B-N/TERT-1 cells increased from 48 at subconfluency to 653 at day 4 post-differentiation (13.6-fold increase), whilst the change in the total number of DEGs with differentiation for shKAT2A#1-N/TERT-1 cells was less dramatic, with 115 140 identified at subconfluency and 267 at day 4 post-differentiation (2.3-fold increase). Thus, implying that KAT2B, but not KAT2A, has a more significant influence on gene expression following the induction of differentiation rather than at undifferentiated cell states. Between 259 and 356 unique DEGs were identified in shKAT2A#1+shKAT2B#1-N/TERT-1 cells, suggesting that KAT2A and KAT2B can redundantly regulate a large subset of genes in keratinocytes. Across all timepoints, 20-49% of DEGs were downregulated in shKAT2A#1- and shKAT2A#1+shKAT2B#1-N/TERT-1 cells compared to 65-80% of DEGs in shKAT2B#1-N/TERT-1 cells, suggesting that, in general, KAT2B favours gene activation whilst KAT2A favours gene repression in keratinocytes. Therefore, KAT2A and KAT2B may be functioning through different mechanisms to affect gene expression.

As expected, 86-91% of DEGs in shKAT2A#1-N/TERT-1 and 50-62% of DEGs in shKAT2B#1-N/TERT-1 cells were also identified for shKAT2A#1-shKAT2B#1-N/TERT- 1 cells at undifferentiated timepoints. This high overlap of DEGs across groups decreases significantly at day 4 post-differentiation, when only 40% of DEGs in shKAT2A#1- N/TERT-1 cells and 13% of DEGs in shKAT2B#1-N/TERT-1 cells are also identified in the double knockdown cell line. This is consistent with the divergence in relatedness observed between shKAT2A#1/shKAT2B#1- and shKAT2A#1+shKAT2B#1-N/TERT-1 cells in the PCA plot (Figure 5.2) and the hierarchical analysis (Figure 5.3). There was partial overlap in DEGs identified in shKAT2A#1- and shKAT2B#1-N/TERT-1 cells, indicating that the deregulation of these genes is not fully stabilised by KAT2A or KAT2B compensation. However, most DEGs identified in shKAT2A#1- and shKAT2B#1-N/TERT-1 cells did not overlap.

In summary, this analysis shows that the loss of KAT2A and/or KAT2B in N/TERT-1 cells leads to select changes to the transcriptome involving gene upregulation and downregulation. Consistent with the hypothesis of KAT2B having functional significance for keratinocyte differentiation, the degree of change to the transcriptome due to KAT2B loss was greatest at differentiated timepoints, whereas this effect was considerably weaker in shKAT2A#1-N/TERT-1 cells. Furthermore, the unique DEGs identified in shKAT2A#1+shKAT2B#1-N/TERT-1 cells suggests that KAT2B, which is upregulated upon KAT2A loss, plays a compensatory role in limiting the transcriptional effects of KAT2A depletion in N/TERT-1 cells. Finally, the minor overlaps in DEGs found between shKAT2A#1- and shKAT2B#1-N/TERT-1 cells suggests that the two paralogues may share some functional redundancies. Nonetheless, the majority of DEGs were non-overlapping between these cell lines, indicative of distinct functions for these pair of paralogues in keratinocytes. 141

Figure 5.4: The number and commonality of differentially expressed genes in undifferentiated and differentiated N/TERT-1 cells depleted for KAT2A and/or KAT2B. Venn diagrams showing intersections of differentially expressed genes in shKAT2A#1-, shKAT2B#1-, and shKAT2A#1+shKAT2B#1-N/TERT-1 cells compared to shScr control cells at subconfluent, confluent, and day 4 post-differentiation timepoints. Differential expression in pair-wise comparisons at fold change > 2, FDR < 0.05. The table shows the number of significantly up- and downregulated genes in each dataset.

142

5.5 Gene Ontology Analysis

Next, I sought to classify the gene ontology (GO) of DEGs identified in shKAT2A#1-, shKAT2B#1-, shKAT2A#1+shKAT2B#1-N/TERTs at all timepoints analysed in order to identify overrepresented groups of genes related in biological function. GO analysis was performed separately for upregulated and downregulated DEGs using the clusterProfiler package (Yu et al., 2012) and The GO database build: 2019 April 26th (Ashburner et al., 2000; The Gene Ontology Consortium, 2019) to obtain GO terms at FDR < 0.05.

The top five GO terms are presented for each dataset in Figure 5.5. At subconfluency the majority of upregulated DEGs identified in shKAT2A#1- and shKAT2A#1+shKAT2B#1- N/TERT-1 cells were highly related to epidermal cell development and keratinocyte differentiation, particularly with respect to the cornification process. This is consistent with the qPCR analysis presented in Chapter 4.5 that revealed significant upregulation of the late differentiation markers IVL and FLG in KAT2A-depleted keratinocytes in the absence of differentiation signals (Figure 4.12). GO terms related to keratinocyte differentiation remained significantly enriched in upregulated DEGs identified in shKAT2A#1+shKAT2B#1-N/TERT-1, but not shKAT2A#1-N/TERT-1 cells, at confluent and day 4 post-differentiation timepoints, suggesting that double knockdown confers an enhancement to differentiation gene expression upon induction. These findings are consistent with qPCR (Figure 4.17) and Western blot (Figure 4.19) experiments presented in Chapter 4.6 that showed the double knockdown cell line to have higher levels of involucrin expression at differentiated timepoints relative to control cells. By contrast, GO terms linked to keratinocyte differentiation and skin development were significantly enriched in downregulated DEGs in shKAT2B#1-N/TERT-1 cells exclusively at day 4 of differentiation, consistent with findings presented in Chapter 4.6.2 that revealed an overall delay in the expression of late differentiation markers upon KAT2B loss (Figure 4.17-4.20). Furthermore, GO terms associated with nuclear division and chromosome segregation during mitosis were significantly and uniquely enriched in upregulated DEGs in shKAT2B#1-N/TERT-1 cells at day 4 post-differentiation, a timepoint when the cell cycle should be arrested to permit terminal differentiation.

Besides GO terms associated with keratinocyte differentiation, other terms such as “extracellular matrix” and “hormone metabolic processes” were enriched in upregulated DEGs in confluent shKAT2A#1-N/TERT-1 cells. Consistent with qPCR data presented in Chapter 4.4.4, several of these upregulated DEGs were members of the MMP family. I did not find any enrichment for GO terms associated with cell adhesion in DEGs identified in 143 subconfluent shKAT2A#1-N/TERT-1 samples despite these cells adopting tight clustered morphologies in culture (see Chapter 4.4). However, consistent with qPCR analysis described in Chapter 4.4.2, several claudin genes and desmosomal genes, including CLDN4, CLDN7, DSG1, DES, and PPL, were upregulated in KAT2A-depleted cells. Furthermore, the VIM gene, another candidate linked to the clustering phenotype that was found to be downregulated by KAT2A loss in experiments described in Chapter 4.4.3, was identified by RNA-seq as a DEG with one of the greatest fold changes in shKAT2A-expressing cells. Interestingly, downregulated DEGs identified in all three cell lines at confluency were enriched for GO terms associated with innate immune responses to viruses, suggesting that both KAT2A and KAT2B are involved in positively regulating the interferon (IFN) pathway prior to the induction of differentiation in keratinocytes. These GO terms were significantly enriched for upregulated DEGs in shKAT2A#1-N/TERT-1 cells at day 4 post- differentiation, indicating that KAT2A switches to become a negative regulator of the IFN pathway upon the induction of differentiation. Finally, a small proportion of downregulated DEGs identified in shKAT2A#1+shKAT2B#1-N/TERT-1 cells at day 4 post-differentiation were functionally linked to metabolite processing, suggesting that both HATs also partake in more general cellular processes.

Overall, this analysis suggests that KAT2A and KAT2B may have several common and distinct functions in keratinocytes in a cell state/stimulus-dependent manner. The most striking disturbance to the transcriptome upon KAT2A or KAT2B loss appears to be related to the expression of genes associated with keratinocyte differentiation. In accordance with preliminary qPCR findings, this analysis supports divergent functions for KAT2A and KAT2B in regulating the differentiation gene expression program in keratinocytes, with the former functioning to limit and the latter functioning to promote this program in proliferative and differentiation-induced N/TERT-1 cells, respectively. Interestingly, the loss of both KAT2A and KAT2B appears to enhance the expression of keratinocyte differentiation genes in the absence and presence of induction signals. Functional classification of DEGs also indicates possible functional redundancies for KAT2A and KAT2B in promoting inflammatory responses to viral infections in undifferentiated keratinocytes putatively through the interferon signalling pathway. Finally, the enrichment of cell cycle GO terms for upregulated DEGs in differentiated shKAT2B-N/TERT-1 keratinocytes suggests that these cells are still proliferative, which could be a further indication of compromised differentiation. Alternatively, KAT2B could have a distinct role in negatively regulating the segregation of mitotic chromosomes in differentiated keratinocytes.

144

Figure 5.5: Functional classification of differentially expressed genes in undifferentiated and differentiated N/TERT-1 cells depleted for KAT2A and/or KAT2B relative to shScr control cells. Graphs showing the top five gene ontology terms for upregulated (left) and downregulated (right) differentially expressed genes identified in shKAT2A#1-, shKAT2B#1-, shKAT2A#1+shKAT2B#1-N/TERT-1 cells at subconfluency, confluency and day 4 post-differentiation relative to shScr-N/TERT-1 cells. Only gene ontology terms with more than five hits and FDR < 0.05 are shown.

145

5.6 Gene Set Enrichment Analysis

Whilst gene ontology analysis is a simple means of determining enriched biological functions and/or cellular pathways from RNA-seq data, it does not evaluate this data as a whole and instead analysis is limited to DEGs identified with pre-set cut-off thresholds. Gene set enrichment analysis (GSEA) is a more robust methodology, first described by Subramanian et al. in 2005, that circumvents the need of arbitrary cut-off values to calculate a score for the enrichment of an entire set of genes rather than single genes (Subramanian et al., 2005). Therefore, this method of analysis can detect modest yet coordinated changes in prespecified sets of related genes, such as those associated with a specific cellular pathway or biological function, that would otherwise be overlooked by single-gene analysis methods. The end-product of GSEA is a normalised enrichment score (NES), a metric which reflects the degree to which the genes in a gene set are overrepresented at the top or bottom of a list of genes ranked according to their differential expression. Specifically, this value is computed beginning from the top of the ranked list as a running-sum statistic and is increased when a gene belongs to the predefined gene set and is decreased when the gene does not. The maximum value that deviates from zero provides the enrichment score which is then normalised to account for the size of each gene set.

GSEA was applied to the RNA-seq data using the Molecular Signatures Database (Subramanian et al., 2005) to obtain a list of enriched gene sets at a p value cut-off of < 0.25. Six of the top ten enriched gene sets in the expression profiles of shKAT2A#1- and shKAT2A#1+shKAT2B#1-N/TERT-1 at subconfluency and shKAT2B#1-N/TERT-1 at day 4 post-differentiation were related to epidermal development and keratinocyte differentiation. The NES plots for ‘epidermis development’ and ‘keratinocyte differentiation’ gene sets are shown in Figure 5.6. These plots show a statistically significant enrichment of epidermis development genes and keratinocyte differentiation genes nonrandomly distributed at the top of the ranked gene list for shKAT2A#1- and shKAT2A#1+shKAT2B#1-N/TERT-1 samples at subconfluence and at the bottom of the ranked gene list for shKAT2B#1-N/TERT-1 samples at day 4 post-differentiation. Genes ranked at or prior to the peak enrichment score (leading edge genes) in the ‘epidermis development’ gene set that are common to all three gene expression profiles are listed in Table 5.1. Almost all these genes have been functionally linked to terminal differentiation, including FLG and IVL, which were previously identified as DEGs in Chapter 4.5 using qPCR analysis. Amongst this list includes many genes of the EDC, including ten members of the LCE family, six members of the SPRR family, and HRNR (hornerin). Other than structural proteins, genes coding for enzymes important for epidermal barrier formation are 146 also listed, including TGM3 (transglutaminase 3), ACER1 (alkaline ceramidase 1), and four members of the kallikrein related peptidase family. Interestingly, the transcription factor genes: GRHL1 and POU2F3 (POU class 2 homeobox 3) are also listed. Surprisingly, GAL (galanin and GMAP prepropeptide), a gene encoding a neuroendocrine peptide that acts as a ligand for three classes of G-protein-coupled receptors (GPCRs), is also a common leading edge gene between the three data sets. In fact, GSEA analysis revealed a significant enrichment for GPCR signalling genes distributed at the top of the ranked gene list for shKAT2A#1- (NES = 1.504) and shKAT2A#1+shKAT2B#1-N/TERT-1 (NES = 1.526) samples at subconfluency but not shKAT2B#1-N/TERT-1 samples at day 4 post- differentiation (NES = -1.285, FDR = 0.363).

Overall, GSEA demonstrates positive correlations with KAT2A loss and epidermis development gene sets in subconfluent N/TERT-1 cells, whilst showing negative correlations with KAT2B loss and this gene set in N/TERT-1 cells at day 4 post- differentiation. Many genes related to terminal differentiation contributed the most to these enrichments and were common between the three data sets, thus indicating that KAT2A and KAT2B differentially affect the expression of these genes at undifferentiated and differentiated timepoints in keratinocytes, respectively. The identification of GRHL1, and POU2F3 as leading edge genes common amongst these data sets raises the possibility of these transcription factors underpinning the transcriptional control of the differentiation genes affected by KAT2A and/or KAT2B loss. Finally, enrichment for GPCR signalling gene sets in shKAT2A#-1 and shKAT2A#1+shKAT2B#1-N/TERT-1 expression profiles suggests that this pathway could be implicated in KAT2A and KAT2B function in undifferentiated keratinocytes.

147

Figure 5.6: GSEA in proliferative and/or differentiated N/TERT-1 cells depleted for KAT2A and/or KAT2B. Pre-ranked gene set enrichment analysis showing correlation of gene expression changes in shKAT2A and shKAT2A/B cells at subconfluence, and in shKAT2B keratinocytes at day 4 post- differentiation compared to shScr control cells at the respective timepoints with the indicated gene sets. Green lines show the running enrichment scores. Black vertical lines represent correlating ‘hits’. The normalized enrichment score (NES) and false discovery rate (FDR) are stated for each plot. Red dotted lines demarcate the leading edge of the enrichment plots. 148

Table 5.1: GSEA leading edge genes in the “Epidermis development” gene set identified in all three of the shKAT2A (subconfluent), shKAT2A/B (subconfluent) and shKAT2B (D4 differentiated) gene expression profiles.

Log2 Fold Change Gene Symbol Name KAT2A (S) KAT2AB (S) KAT2B (D4) ABCA12 ATP binding cassette subfamily A member 12(ABCA12) 0.722 1.508 -1.370 ACER1 alkaline ceramidase 1 1.439 3.897 -1.790 C1orf68 chromosome 1 open reading frame 68 3.029 0.903 -0.849 CALML5 calmodulin like 5 5.519 5.316 -1.549 CST6 cystatin E/M 0.870 1.165 -3.037 DNASE1L2 deoxyribonuclease 1 like 2 1.430 3.312 -2.276 DSG1 desmoglein 1 1.252 2.301 -0.728 FA2H fatty acid 2-hydroxylase 1.625 1.524 -3.156 FLG filaggrin 0.959 1.478 -3.029 GAL galanin and GMAP prepropeptide 1.125 0.578 -1.878 GRHL1 grainyhead like transcription factor 1 1.250 1.481 -0.854 HPSE heparanase 0.649 0.913 -0.790 HRNR hornerin 1.289 3.175 -1.469 IVL involucrin 1.150 1.571 -1.653 KLK12 kallikrein related peptidase 12 5.152 6.181 -2.257 KLK13 kallikrein related peptidase 13 3.031 5.046 -2.160 KLK14 kallikrein related peptidase 14 4.965 5.913 -3.311 KLK7 kallikrein related peptidase 7 1.257 0.761 -2.865 KRT37 keratin 37 2.572 3.890 -1.403 KRT38 keratin 38 1.312 2.337 -1.037 KRTAP5-10 keratin associated protein 5-10 1.386 2.280 -4.379 KRTAP5-6 keratin associated protein 5-6 3.821 2.280 -1.584 LCE1A late cornified envelope 1A 1.462 1.165 -1.978 LCE1C late cornified envelope 1C 2.115 2.065 -2.646 LCE1D late cornified envelope 1D 1.360 0.910 -2.283 LCE1E late cornified envelope 1E 1.269 0.697 -2.399 LCE1F late cornified envelope 1F 4.858 4.321 -3.272 LCE3A late cornified envelope 3A 3.460 5.025 -5.062 LCE3B late cornified envelope 3B 1.000 2.211 -4.455 LCE3C late cornified envelope 3C 0.607 1.709 -4.207 LCE3D late cornified envelope 3D 6.602 7.231 -4.621 LCE3E late cornified envelope 3E 6.089 7.102 -4.601 PCSK6 proprotein convertase subtilisin/kexin type 6 1.295 2.107 -1.418 PDZD7 PDZ domain containing 7 0.699 0.839 -0.852 PI3 peptidase inhibitor 3 2.992 4.006 -0.953 POU2F3 POU class 2 homeobox 3 1.378 1.304 -1.098 PPL periplakin 1.245 2.008 -0.896 S100A7 S100 calcium binding protein A7 3.998 5.140 -1.309 SCEL sciellin 0.931 1.222 -0.818 SPINK5 serine peptidase inhibitor, Kazal type 5 2.259 2.063 -1.558 SPRR2A small proline rich protein 2A 3.339 3.564 -0.880 SPRR2B small proline rich protein 2B 3.125 3.576 -0.950 SPRR2D small proline rich protein 2D 3.797 4.064 -0.922 SPRR2E small proline rich protein 2E 2.926 3.679 -0.982 SPRR2F small proline rich protein 2F 3.241 3.536 -1.066 SPRR2G small proline rich protein 2G 1.714 1.493 -1.454 SULT2B1 sulfotransferase family 2B member 1 3.183 3.871 -1.007 TGM3 transglutaminase 3 2.391 2.771 -0.782 TGM5 transglutaminase 5 5.536 5.409 -1.679

149

5.7 qPCR Validation of Gene Candidates Detected in the RNA-seq Analysis

A selection of the most differentially expressed genes associated with keratinocyte differentiation was validated by qPCR using the same RNA-seq samples. These DEGs were selected to represent the functional diversity of the differentiation-associated genes affected by KAT2A and/or KAT2B loss, and includes genes mapped to the EDC (ANXA9, LCE1A, LCE3D, S100A8, SPRR2A, SPRR2E) and outside of the EDC (ECM1, KRTDAP, PI3, TGM1). The magnitude and patterns of expression for this panel of genes matched those identified by the RNA-seq analysis (Figure 5.7). Notably, LCE1A and LCE3D, which were identified as leading edge genes in Chapter 5.6, were prominently upregulated in KAT2A- depleted cells, particularly prior to differentiation, but substantially downregulated in shKAT2B-N/TERT-1 cells at day 4 of differentiation. To reduce the possibility of these transcriptional changes being due to off-target effects of the shKAT2A#1 and shKAT2B#1 sequences, I performed qPCR analysis for KRTDAP, LCE3D, SPRR2A and TGM1 in N/TERT-1 cells expressing shKAT2A#2 or shKAT2B#2. The same patterns of expression for this panel of genes were observed in shKAT2A#2- and shKAT2B#2-N/TERT-1 cells at subconfluency, although the fold changes in the former were smaller in comparison to that observed in shKAT2A#1-N/TERT-1 cells, likely due to it being a less complete knockdown (Figure 5.8). At day 4 of differentiation, mRNA levels of LCE1A and LCE3D in shKAT2B#2-N/TERT-1 cells were 72% and 90% of shScr control levels, similar to that obtained in shKAT2B#1-N/TERT-1 cells. qPCR analysis was also performed for TGM1, LCE3E, LCE3D, and LCE1A in shScr-, shKAT2A#1-, and shKAT2B#1-NHEK-Neo keratinocytes to assess if KAT2A or KAT2B loss affects the expression of these genes in primary cultures similar to that in immortalised cells. Consistent with mRNA levels in shKAT2A-N/TERT-1 cells, the expression of this panel of genes was increased at subconfluency in shKAT2A#1-NHEK-Neo cells but largely unchanged in shKAT2B#1-NHEK-Neo cells relative to shScr control cells (Figure 5.9). However, the fold-changes for the expression of these genes in shKAT2A#1-NHEK-Neo cells were significantly lower than those measured in shKAT2A#1-N/TERT-1 cells. For instance, LCE3D expression was 13.8-fold higher in shKAT2A#1-N/TERT-1 cells but only 4.4-fold higher in shKAT2A#1-NHEK-Neo cells at subconfluency relative to shScr control cells on average. Consistent with expression levels in shKAT2B#1-N/TERT-1 cells, mRNA levels for TGM1, LCE3E, LCE3D, and LCE1A were all significantly lower in shKAT2B#1- NHEK-Neo cells at day 4 post-differentiation relative to shScr control cells albeit not to the degree observed in immortalised cells. 150

Figure 5.7: qPCR analysis confirms deregulation of genes associated with cornification in immortalised keratinocytes depleted for KAT2A and/or KAT2B. qPCR analysis in shScr-, shKAT2A#1-, shKAT2B#1-, and shKAT2A#1+shKAT2B#1-N/TERT-1 cells at the indicated timepoints for DEGs related to keratinocyte differentiation identified by RNA-seq. Expression changes for the indicated genes are displayed as mean fold changes ± s.d. relative to levels in shScr-N/TERT-1 cells at the corresponding timepoint n = 3. 151

Figure 5.8: Genes associated with cornification are deregulated in immortalised keratinocytes expressing shKAT2A#2 or shKAT2B#2. qPCR analysis in shScr, shKAT2A#1-, and shKAT2B#1-N/TERT-1 cells at the indicated timepoints for DEGs related to keratinocyte differentiation identified by RNA-seq. Expression changes for the indicated genes are displayed as mean fold changes ± s.d. relative to levels in shScr- N/TERT-1 cells at the corresponding timepoint n = 3.

Figure 5.9: Genes associated with cornification are deregulated in primary keratinocytes depleted for KAT2A or KAT2B. qPCR analysis in shScr-, shKAT2A#1-, and shKAT2B#1-NHEK-Neo keratinocytes at subconfluent and day 4 post-differentiation timepoints for DEGs related to keratinocyte differentiation identified by RNA-seq in N/TERT-1 cells depleted for KAT2A and/or KAT2B. Expression changes for the indicated genes are displayed as mean fold changes ±s.d. relative to levels in shScr-N/TERT-1 cells at the corresponding timepoint. n = 2.

152

Overall, these qPCR analyses validate the expression profiles of various late keratinocyte differentiation genes in KAT2A and/or KAT2B-depleted N/TERT-1 samples at subconfluent, confluent, and day 4 post-differentiation timepoints initially identified by RNA-seq.

Expression analysis described in chapter 4 revealed that KAT2A-depletion causes premature upregulation of several markers of keratinocyte differentiation in the absence of initiating signals, whilst KAT2B-depletion compromises the expression of the same markers upon induction. This chapter further enhances our insight into the extent by which KAT2A and/or KAT2B regulates the expression of differentiation-associated genes by presenting a genome wide transcriptome analysis of N/TERT-1 cells depleted for KAT2A and/or KAT2B. This RNA-seq analysis showed that loss of KAT2A and/or KAT2B deregulates a broad set of differentiation-associated genes in addition to those characterised in chapter 4, of which many were linked to the formation of the cornified envelope, the end-product of terminal differentiation. Interestingly, KAT2A and KAT2B seemed to differentially regulate many of the same differentiation-associated genes albeit at different timepoints, with the former acting as a negative regulator prior to differentiation and the latter acting as a positive regulator post-differentiation. Importantly, these regulatory effects on gene expression appear to be predominantly limited to these distinct timepoints, consistent with the expression profiles of KAT2A and KAT2B during normal epidermal homeostasis. Independent to their effects on cellular differentiation, this RNA-seq analysis also points to overlapping roles for KAT2A and KAT2B in potentiating the viral innate immune response in keratinocytes. Taken together, this analysis further supports my hypothesis of KAT2A and KAT2B having distinct and divergent functions in keratinocyte differentiation and suggests that these functions are mediated, in part, by selectively regulating gene expression. The following chapter presents evidence that aimed to provide a mechanistic insight into how KAT2A/KAT2B function in keratinocytes particularly as regulators of the differentiation gene expression program.

153

CHAPTER 6 KAT2A FUNCTIONS PRIMARILY THROUGH ITS HAT ACTIVITY AND N- TERMINUS DOMAIN IN PROLIFERATIVE KERATINOCYTES TO REPRESS THE TERMINAL DIFFERENTIATION PROGRAM

6.1 Introduction

So far, I have shown that KAT2A-depletion in N/TERT-1 cells leads to premature expression of a broad range of differentiation genes in the absence of initiating signals in addition to the acquisition of abnormal, clustered morphologies that associate with changes in the expression of cell-cell adhesion molecules, vimentin, and genes involved in ECM degradation and remodelling. From these findings, it clear that KAT2A functions in undifferentiated keratinocytes primarily through regulating gene expression. This begs the question: How does KAT2A act as both a transcriptional activator and repressor in proliferative keratinocytes at the mechanistic level?

Mammalian KAT2A is a multidomain protein comprised of a HAT domain and a bromodomain at the C-terminal part of the full-length protein, and an N-terminal extension region. The HAT activity of KAT2A and its link to transcriptional activation was first established by Brownell and Allis in 1996 (Brownell et al., 1996). Since this discovery, numerous cellular processes that are regulated by the HAT activity of KAT2A have been described. The neural tube closure defects and exencephaly exhibited in mutant mice expressing catalytically inactive KAT2A is a particularly striking example of the importance of the HAT domain in KAT2A function (Bu et al., 2007). On a mechanistic level, the link between the HAT activity of KAT2A and gene activation is unclear, although several studies have demonstrated a positive correlation between gene activation and H3K9ac deposited by KAT2A at promoter regions (Bidon et al., 2018; Jin et al., 2011; Nagy and Tora, 2007; Sandoz et al., 2019). KAT2A HAT activity is not limited to histone substrates. KAT2A has also been shown to acetylate and regulate the activity and/or localisation of numerous non- histone proteins involved in diverse cellular processes, further expanding the influence KAT2A has on cellular function (Fournier et al., 2016). The functional significance of the bromodomain possessed by KAT2A has received relatively less attention in vivo. The bromodomain of yKAT2A is known to modulate the specificity and HAT activity of yKAT2A by recognising specific acetyl-lysine residues within histone H3 and H4 tails (Cieniewicz et al., 2014; Li and Shogren-Knaak, 2009). To my knowledge, the contribution of the mammalian KAT2A bromodomain to the regulation of KAT2A target genes is unexplored. The N-terminus domain of KAT2A is putatively involved in recognising 154 nucleosomal substrates and non-histone proteins, but evidence for this is limited to in vitro assays. This domain is unique to the mammalian KAT2A orthologue, and so may be important in orchestrating KAT2A functions in complex cellular processes. Indeed, mice null for KAT2A die earlier than mutant mice expressing a catalytically inactive form of KAT2A, suggesting that HAT-independent functions that involve the N-terminus domain of KAT2A may be at play during early mammalian embryogenesis (Bu et al., 2007).

In addition, several reports have shown that the subcellular distribution of KAT2A and KAT2B can change in response to cellular or extracellular signals (Blanco-García et al., 2009; Gregoire et al., 2007; Wong et al., 2004). Interestingly, KAT2B has been previously reported to translocate from the cytosol to the nucleus upon induced differentiation of human primary keratinocytes (Pickard et al., 2010). While KAT2A has been shown to predominantly localise to the nucleus of mouse hippocampal cells (Stilling et al., 2014) and mouse primary T-cells (Gao et al., 2017), it has also be shown to be present in the cytosol and nucleus of normal human colonic cells at equal proportions, suggesting that KAT2A could potentially shuttle between cellular compartments (Yin et al., 2015). This raises the possibility of KAT2A translocating between cytoplasmic and nuclear compartments under different cellular conditions, potentially acting on and regulating both histone and cytosolic substrates in a tissue- and cell state-specific manner.

From all these studies, it is evident that KAT2A is a multi-faceted enzyme which can selectively interact and acetylate with various proteins and substrates to directly or indirectly effect gene expression changes and modulate different cellular processes in different cell types and lineages.

In this chapter, I sought to determine the specific mechanisms by which KAT2A function to maintain the stemness state of basal keratinocytes. To address this, I performed studies to characterize the requirement of different functional domains of KAT2A in rescuing the KAT2A-depletion phenotypes, establish the subcellular compartment of the enzyme as well as identity the major substrates of KAT2A in the proliferative and differentiating keratinocytes.

155

6.1 Validation of Recombinant KAT2A Proteins for Functional Domain Analysis

KAT2A is a 837 amino acid polypeptide containing a catalytic acetyltransferase domain and a bromodomain at the C-terminal end of the protein. It also has a long N-terminal region making up 40% of the full-length protein, which has no overt functional structures and has been postulated to mediate protein-protein interactions. Understanding which domain, or combination of domains, is important in mediating a particular function of KAT2A in proliferative keratinocytes will be useful to understand how KAT2A acts in these cells. To this end, a series of KAT2A full-length (FL) or mutant constructs resistant to KAT2A- shRNAs were generated and cloned into lentiviral expression vectors to allow the assessment of their capacities to reverse the phenotypic changes associated with KAT2A depletion in keratinocytes. The mHAT mutant was generated by introducing a single E575R point mutation that inactivated the catalytic domain; the ΔBro mutant was made as a 705 amino acid truncated protein that lacked the C-terminally located bromodomain; and the ΔN-term mutant was generated whereby the first 361 amino acids of the full-length KAT2A were deleted (Figure 6.1). Silent mutations at the target sequences of shKAT2A#1 and shKAT2B#2 were introduced into all KAT2A constructs to confer resistance to shRNA- mediated degradation. The constructs were also FLAG epitope tagged at the N-terminus to facilitate detection of the recombinant proteins.

Figure 6.1: Schematic depicting the mutant KAT2A constructs generated for functional domain analysis experiments. hKAT2A – full-length 837 amino acid KAT2A protein possessing an N-terminus domain (white), a HAT domain (yellow), and a bromodomain (blue) located at the C-terminus. hKAT2AmHATE575R – catalytically dead KAT2A harbouring a mutation in the HAT domain (red arrowhead denotes the position of E>R point mutation). hKAT2AΔNter – KAT2A with the first 361 amino acids deleted to yield a truncated protein possessing amino acids 362-837. hKAT2AΔBro – a 705 amino acid KAT2A protein lacking the C-terminally located bromodomain. 156

To ascertain that the different mutant constructs can be expressed and localised properly in the cells, I first transduced HEK293T cells with each construct and visualised the presence and subcellular localisation of the recombinant proteins by IF-labelling of the FLAG epitope. IF signal was strongly detected and localised to the nucleus for all FLAG-tagged proteins (Figure 6.2A). I also checked the expression of these recombinant KAT2A proteins in shKAT2A#1-N/TERT-1 cells by immunoblotting with anti-KAT2A and anti-FLAG antibodies (Figure 6.2B). Overall expression levels between the recombinant KAT2A proteins were similar and, as expected, FL-hKAT2A and mHAT-hKAT2B had a similar molecular weight to endogenous KAT2A (~94kDa), while ΔBro-hKAT2A and ΔN-term- hKAT2A were detected respectively at ~80kDa and ~60kDa, which corresponded to the predicted sizes of the truncated proteins. The ΔN-term-hKAT2A was not detected by the anti-KAT2A antibody, which recognises an epitope in the deleted N-terminal region. Taken together, these results show that the deletions/mutations did not induce nonsense-mediated decay of the transcripts and the mutant polypeptides can be produced in the cells at similar amounts.

Overall, these quality control assessments show that the KAT2A constructs generated proteins detectable with anti-KAT2A antibodies and with molecular weights that correspond to their respective deletions or mutations. Thus, these expression constructs were deemed suitable for use in subsequent experiments aiming to determine the functional contributions of each KAT2A domain in regulating the phenotypes and differentially expressed genes and proteins identified in KAT2A-depleted N/TERT-1 keratinocytes. To assess these activities, I established shKAT2A#1-N/TERT-1 cell lines that stably express either the full-length or mutant KAT2A proteins and characterised their effects on three major phenotypes induced by KAT2A-depletion: 1) altered cell clustering morphology and structural components, 2) aberrant differentiation gene expression and dynamics, and 3) compensatory upregulation of KAT2B.

157

Figure 6.2: Mutant KAT2A constructs express stable nuclear proteins at the correct molecular weights. (A) Representative confocal images of HEK293T cells transduced with the indicated expression construct and IF stained using a mouse anti-FLAG M1 antibody (red). DAPI (blue) stains nuclei. Scale bar = 10µm. (B) Representative immunoblots of lysates from shKAT2A#1-N/TERT-1 cells transduced with the indicated expression construct. Recombinant FLAG-tagged KAT2A proteins were detected with anti-KAT2A (N- terminus epitope) and anti-FLAG antibodies. β-actin serves as a loading control. Ponceau S serves as a loading and transfer control. kDa = kilodalton. 158

6.2 KAT2A Promotes Normal Growth Morphology of Proliferative Keratinocytes via its HAT and N-terminus Domain.

As described in Chapter 4.4, subconfluent N/TERT-1 cells adopt tight clustered colony morphologies when depleted of KAT2A. I aimed to validate this phenotype as a direct consequence of KAT2A loss by reintroducing FL-hKAT2A into these cells. I also assessed the functional contribution of the HAT activity, bromodomain, and N-terminal domain of KAT2A towards the maintenance of normal growth morphology of the proliferative N/TERT-1 cells.

Compared to control cells transduced with an empty vector, the clustered morphologies characteristic of shKAT2A#1-N/TERT-1 keratinocytes were fully reversed upon expression with FL-hKAT2A (Figure 6.3). shKAT2A#1-N/TERT-1 keratinocytes expressing FL- hKAT2A were visibly indistinguishable from shScr-N/TERT-1+empty vector control cells, which adopted scattered arrangements. By contrast, expression of the catalytically inactive mHAT-hKAT2A in the shKAT2A#2-N/TERT-1 keratinocytes did not alter the abnormal clustered morphology. Expression of ΔBro-hKAT2A in shKAT2A#1-N/TERT-1 cells led to a partial reversal of the clustering phenotype, with looser clusters and increased presence of isolated cells. Surprisingly, expression of ΔN-term-hKAT2A in shKAT2A#1-N/TERT-1 cells exacerbated the clustering phenotype to such an extent that the presence of isolated cells in these cultures was almost absent.

159

Figure 6.3: The HAT activity and N-terminus of KAT2A are indispensable for reversing the clustering phenotype associated with KAT2A depletion in proliferative immortalised keratinocytes. Phalloidin staining labels F-actin filaments (green) in subconfluent shScr-N/TERT-1 cells and shKAT2A#1-N/TERT-1 cells expressing the indicated recombinant KAT2A protein or empty vector. DAPI (blue) stains nuclei.

160

As described in Chapter 4.4.2 and Chapter 5, the clustering of N/TERT-1 cells as a result of KAT2A loss was associated with upregulation of several genes involved in the formation of desmosomes and tight junctions, such as OCLN, CLDN4, and PPL, which are key structures that promote cell-cell adhesion. I investigated if the HAT activity, bromodomain, or N- terminus of KAT2A is important for regulating these genes in proliferative keratinocytes. To address this, qPCR was performed for OCLN, CLDN4, and PPL on samples from subconfluent shScr-N/TERT-1 cells transduced with an empty vector and shKAT2A#1- N/TERT-1 cells transduced with either: an empty vector, FL-hKAT2A, mHAT-hKAT2A, ΔBro-hKAT2A, or ΔN-term-hKAT2A. The functional contribution of each domain for the regulation of OCLN, CLDN4, and PPL were determined by comparing the relative mRNA levels of these genes in each experimental group.

The expression of FL-hKAT2A in shKAT2A#1-N/TERT-1 cells led to a 58-64% reduction in the expression of OCLN, CLDN4, and PPL, compared to cells transduced with the empty vector (Figure 6.4). A more modest 25-45% rescue in the expression of these genes was measured in shKAT2A#1-N/TERT-1 cells expressing ΔBro-hKAT2A. By contrast, the expression of mHAT-hKAT2A or ΔN-term-hKAT2A in this cell line did not block the increases in mRNA levels of these genes resulting from the loss of KAT2A. In fact, the expression of ΔN-term-hKAT2A led to an approximate 2 fold enhancement of CLDN4 and OCLN upregulation in shKAT2A#1-N/TERT-1 cells.

161

Figure 6.4: The HAT activity of KAT2A is important for regulating the expression of several cell-cell adhesion genes in proliferative immortalised keratinocytes. qPCR for OCLN (occludin), CLDN4 (claudin 4), and PPL (periplakin) performed on subconfluent shKAT2A#1-N/TERT-1 cells expressing either: empty vector, FL-hKAT2A, mHAT- hKAT2A, ΔBro-hKAT2A, or ΔN-term-hKAT2A. Data represents the mean fold changes relative to shScr + empty vector of three independent transductions. Error bars = ±s.d. p values <0.05* and <0.001***.

162

In addition to the cell adhesion molecules, I also examined the importance of the HAT activity, bromodomain, or N-terminus of KAT2A in mediating its effects on vimentin expression, which was significantly reduced upon the loss of KAT2A in proliferative keratinocytes. Vimentin expression was analysed using qPCR and Western blotting in samples derived from shKAT2A#1-N/TERT-1 cells expressing empty vector, FL-hKAT2A, mHAT-hKAT2A, ΔBro-hKAT2A, or ΔN-term-hKAT2A. The effects of these recombinant KAT2A proteins on the transcript and protein levels of vimentin were compared with levels measured in shScr-N/TERT-1 cells expressing empty vector.

The expression of FL-hKAT2A or ΔBro-hKAT2A in shKAT2A#1-N/TERT-1 cells restored both the mRNA (Figure 6.5A) and protein levels (Figure 6.5B) of vimentin to that in shScr control cells. Conversely, mHAT-hKAT2A or ΔN-term-hKAT2A expression resulted in a small increase in vimentin mRNA levels in shKAT2A#1-N/TERT-1 cells to approximately 50% of shScr control levels, and a corresponding change in vimentin protein levels in shKAT2A#1-N/TERT-1 cells expressing mHAT-hKAT2A but not in those expressing ΔN- term-hKAT2A.

163

Figure 6.5: The HAT activity and N-terminus of KAT2A are indispensable for regulating vimentin expression in proliferative immortalised keratinocytes. qPCR (A) and a representative Western blot (B) for vimentin performed on subconfluent shKAT2A#1- N/TERT-1 cells expressing either: empty vector, FL-hKAT2A, mHAT-hKAT2A, ΔBro- hKAT2A, or ΔN-term-hKAT2A. β-actin serves as a loading control. Ponceau S serves as a loading and transfer control. kDa = kilodalton. qPCR data represents the mean fold changes relative to shScr + empty vector of three independent transductions. Error bars = ±s.d.; p values <0.05*, <0.01**, <0.001***, and <0.0001****.

164

KAT2A loss in proliferative keratinocytes was also associated with upregulation of various ECM-related proteins, particularly those of the MMP family, including MMP1, MMP10, MMP13, ECM1, S100A8, ANXA9, and PI3. I examined the expression of these genes and found that they were respectively rescued by 78%, 86%, 82%, 79%, 54%, 96%, and 81% upon transduction of shKAT2A#1-N/TERT-1 cells with FL-hKAT2A, whilst transduction with ΔBro-hKAT2A led to a more modest rescue in the expression of these genes (Figure 6.6). By contrast, mHAT-hKAT2A in shKAT2A#1-N/TERT-1 cells did not alter the expression of any of the genes analysed. Furthermore, ΔN-term-hKAT2A in shKAT2A#1- N/TERT-1 cells failed to restore the expression of MMP1, MMP10, and MMP13 to control levels, and only marginally reduced the aberrant expression levels of S100A8, ECM1, ANXA9, and PI3. Interestingly, the relative fold-change for MMP13 significantly increased from 6.5 to 22.2 when shKAT2A-N/TERT-1 cells were transduced with ΔN-term-hKAT2A, similar to its effects on OCLN expression.

All together, these results suggest that KAT2A functions in proliferative N/TERT-1 monolayers to promote cell motility possibly by regulating the expression of ECM-related proteins, cell adhesion proteins and/or vimentin through a HAT- and N-terminus-dependent mechanism that could be enhanced by means of its bromodomain.

165

Figure 6.6: The HAT activity of KAT2A is indispensable for it to repress ECM-related genes in proliferative immortalised keratinocytes whilst the bromodomain and N- terminus enhance this function. qPCR for the indicated genes performed on subconfluent shKAT2A#1-N/TERT-1 cells expressing either: empty vector, FL-hKAT2A, mHAT- hKAT2A, ΔBro-hKAT2A, or ΔN-term-hKAT2A. Data represents the mean fold changes relative to shScr + empty vector of three independent transductions. Error bars = ±s.d.; p values <0.05*, <0.01**, <0.001*** and <0.0001****. 166

6.3 KAT2A Represses the Keratinocyte Differentiation Gene Expression Program Primarily via a HAT-mediated Mechanism

As described in Chapter 4.5 and Chapter 5, KAT2A depletion in proliferative keratinocytes triggers premature expression of early and late differentiation markers in the absence of initiating signals. Amongst the genes of the keratinocyte differentiation category, KRT10, IVL, FLG, TGM1, LCE3E, LCE3D, KRTDAP, SPRR2A, and SPRR2E were some of the most differentially expressed in shKAT2A#1-N/TERT-1 cells relative to shScr control cells. I aimed to gain insight into the functional contributions of the KAT2A domains in limiting the expression of this panel of genes in proliferative keratinocytes. To address this aim, the expression of the aforementioned panel of differentiation genes was assessed by qPCR and Western blotting in samples from shKAT2A#1-N/TERT-1 cells expressing either: empty vector, FL-hKAT2A, mHAT-hKAT2A, ΔBro-hKAT2A, or ΔN-term-hKAT2A. These transcript and protein levels were compared relative to those in shScr-N/TERT-1 cells transduced with empty vector.

The perturbed gene expression of KRT10, IVL, FLG, TGM1, LCE3E, LCE3D, KRTDAP, SPRR2A, and SPRR2E found in shKAT2A#1-N/TERT-1 cells was greatly reduced upon re- expression of FL-hKAT2A by 85%, 69%, 53%, 66%, 71%, 76%, 76%, 60%, and 74%, respectively (Figure 6.7), whilst the expression of ΔBro-hKAT2A led to a slightly less, but still statistically significant, restoration in the expression of this panel of genes to control levels. By contrast, transcript levels of these differentiation-associated genes upon expression of mHAT-hKAT2A remained elevated, comparable to that observed in the parental shKAT2A#1-N/TERT-1 cells. The expression of ΔN-term-hKAT2A led to significant downregulation of KRTDAP and KRT10 compared to the parental shKAT2A#1- N/TERT-1 cells. However, ΔN-term-hKAT2A did not convincingly normalise the aberrant expression of late differentiation markers FLG, IVL, LCE3E, LCE3D, SPRR2A, or SPRR2E in shKAT2A#1-N/TERT-1 cells. The transcriptional changes induced by expressing FL- hKAT2A, mHAT-hKAT2A, ΔBro-hKAT2A, or ΔN-term-hKAT2A translated to corresponding changes at the protein level, as shown by Western blot analyses of KRT10, IVL, and TGM1 (Figure 6.8).

167

Figure 6.7: The HAT activity of KAT2A is indispensable for it to repress differentiation gene expression in proliferative immortalised keratinocytes whilst the bromodomain and N-terminus enhance this function. qPCR for the indicated genes performed on subconfluent shKAT2A#1-N/TERT-1 cells expressing either: empty vector, FL-hKAT2A, mHAT-hKAT2A, ΔBro-hKAT2A, or ΔN-term-hKAT2A. Data represents the mean fold changes relative to shScr + empty vector of three independent transductions. Error bars = ±s.d.; p values <0.05*, <0.01**, <0.001*** and <0.0001****.

168

Figure 6.8: The HAT activity of KAT2A is indispensable for it to repress the protein expression of differentiation markers in proliferative immortalised keratinocytes. A representative Western blot analysis for the protein expression of keratin10, involucrin, and TGM1 in subconfluent shKAT2A#1-N/TERT-1 cells expressing either: empty vector, FL- hKAT2A, mHAT-hKAT2A, ΔBro-hKAT2A, or ΔN-term-hKAT2A. β-actin serves as a loading control. Ponceau S serves as a loading and transfer control. kDa = kilodalton.

169

The upregulation of genes associated with keratinization and cornification, such as the transglutaminases (TGM1,3 and 5), the LCE and SPRR genes, was concomitant with increased number of cornified cell stacks observed after 4 days of induced differentiation, as described in Chapter 4.6. I found that re-expression of FL-hKAT2A, but not mHAT- hKAT2A, visibly decreased the frequency and cell density of cornified cell stacks in shKAT2A#1-N/TERT-1 cultures differentiated for 4 days (Figure 6.9). Thus, these cultures, which were morphologically indistinguishable from shScr + empty vector control cells at day 4 post-differentiation, provide further evidence that expression of FL-hKAT2A, but not the catalytically inactive mutant, was able to revert the differentiation dynamics in shKAT2A#1-N/TERT-1 cells. These findings confirmed that KAT2A loss was the primary cause for the enhanced differentiation morphology observed in shKAT2A#1-N/TERT-1 cells. Due to time constraints, similar analyses were not performed on shKAT2A#1- N/TERT-1 cells expressing ΔBro-hKAT2A or ΔN-term-hKAT2A.

These findings confirm that KAT2A loss caused the morphological changes that are associated with enhanced differentiation in shKAT2A#1-N/TERT-1 cells. This further supports the idea of KAT2A as a negative regulator of keratinocyte differentiation and suggests that KAT2A achieves this function through its HAT activity.

In total, these findings show that normally KAT2A blocks the expression of early and late keratinocyte differentiation markers in basal keratinocytes, thereby preventing premature differentiation in the absence of inductive signals. In the absence of functional KAT2A, these differentiation-associated genes become de-repressed and aberrantly expressed, thereby priming the cells for differentiation. The results also clearly demonstrate that this KAT2A- mediated regulation of differentiation genes hinges on its HAT activity and is further modulated by interactions with its N-terminus region, and to a lesser extent, the bromodomain.

170

Figure 6.9: Expression of FL-KAT2A in KAT2A-depleted cells restores the frequency of cornified cell stacks to that in control cells. Representative low (left) and high (right) objective phase contrast micrographs depicting shScr-N/TERT-1 cells expressing empty vector and shKAT2A#1-N/TERT-1 expressing empty vector, FL-hKAT2A, or mHAT- hKAT2A at four days post-differentiation. Red arrowheads highlight stacks of cornified cells. 171

6.4 The Functional Contributions of KAT2A Domains for the Expression of KAT2B

As described in Chapter 4.2, depletion of KAT2A in immortalised or primary keratinocytes triggers a significant increase in the protein levels of KAT2B, suggesting that KAT2A limits the expression of its paralogue in proliferative keratinocytes through mechanisms that are yet to be defined. I aimed to further understand this mechanism by evaluating the functional importance of each KAT2A domain in rescuing KAT2B protein levels in shKAT2A- N/TERT-1 cells. To address this aim, protein lysates were prepared from shKAT2A#1- N/TERT-1 cells stably expressing either: empty vector, FL-hKAT2A, mHAT-hKAT2A, ΔBro-hKAT2A, or ΔN-term-hKAT2A and analysed for KAT2B by Western blot analysis. Cell lysates from shScr-N/TERT-1 cells transduced with empty vector were used as a reference for KAT2B protein levels in normal unperturbed cells.

KAT2B levels in KAT2A-depleted keratinocytes transduced with the control empty vector was more than 2 fold higher than that in shScr-N/TERT-1 cells. By contrast, KAT2B protein was very low or undetectable in shKAT2A#1-N/TERT-1 cells stably expressing FL- hKAT2A or ΔN-term-hKAT2A, but not mHAT-hKAT2A, while the expression of ΔBro- hKAT2A normalised the KAT2B protein levels to approximately that of shScr control cells (Figure 6.10). The reduction of KAT2B protein level to below that of shScr control cells likely resulted from the over-expression of the recombinant KAT2A proteins at a higher than endogenous level.

Overall, this experiment shows that KAT2A limits KAT2B expression in proliferative keratinocytes through a HAT-dependent mechanism without the involvement of its N- terminus region. The differences in KAT2B protein levels between cells expressing FL- hKAT2A and ΔBro-hKAT2A suggests that the bromodomain also plays a minor role in enhancing the function of KAT2A in limiting KAT2B expression.

172

Figure 6.10: The HAT activity of KAT2A is indispensable for limiting KAT2B expression in proliferative immortalised keratinocytes. A representative immunoblot of KAT2B expression in subconfluent shScr-N/TERT-1 cells expressing empty vector and shKAT2A#1-N/TERT-1 cells expressing either: empty vector, FL-hKAT2A, mHAT- hKAT2A, ΔBro-hKAT2A, or ΔN-term-hKAT2A. β-actin serves as a loading control. Ponceau S serves as a loading and transfer control. kDa = kilodalton.

173

6.5 KAT2A Functions to Maintain High Levels of H3K9ac in Undifferentiated Keratinocytes

6.5.1 KAT2A and KAT2B are Predominantly Nuclear in Keratinocytes To further our understanding of how mechanistically KAT2A acts to keep basal keratinocytes in a stem-like state and effects the repression of the differentiation-associated genes, I first sought to determine its subcellular localisation, whether KAT2A exhibits compartment shuttling activity during epidermal cell differentiation as was reported for KAT2B to gain insight into whether nuclear or cytosolic proteins are the primary substrates of KAT2A in proliferative keratinocytes and how that might change upon cellular differentiation.

Nuclear and cytoplasmic protein fractions were harvested from undifferentiated (day 0) N/TERT-1 cells and N/TERT-1 cells differentiated for 2 and 4 days. High subcellular purity of these fractions was confirmed by Western analysis of nuclear- (lamin A/C) and cytoplasmic- (β-tubulin) specific markers. Western blot analysis for KAT2A showed that KAT2B was predominantly present in the nuclear fraction prior to- and over the course of differentiation (Figure 6.11A). In fact, KAT2A was never detectable in cytoplasmic fractions at any timepoint even after long exposure times. Of not, I did not observe the previously reported cytosol to nuclear movement of KAT2B, which was detected only in the nuclear fractions after two days of keratinocyte differentiation.

To further validate these results, I performed immunostaining for KAT2A and KAT2B in N/TERT-1 cells prior to- and 2 days post-differentiation. KAT2A staining was exclusively limited to the nuclei of undifferentiated keratinocyte (Figure 6.11B), consistent with its localisation in vivo (see Chapter 3.5, Figure 3.11). KAT2B staining was predominantly localised to differentiated keratinocyte nuclei, although very weak staining was detectable in the cytoplasm. However, this cytoplasmic staining is most likely non-specific, as this KAT2B antibody also gave a non-specific band of <100kDa in the cytoplasmic fractions in the Western blot analysis.

Overall, the subcellular distribution of KAT2A and KAT2B in N/TERT-1 keratinocytes was robustly characterised using two complementary techniques. These findings show that KAT2A and KAT2B are strictly localised to the keratinocyte nucleus prior to- and post- differentiation, implying that both HATs acetylate primarily histones and other nuclear proteins in keratinocytes.

174

Figure 6.11: KAT2A and KAT2B are localised in the nucleus prior to- and over the course of differentiation in immortalised keratinocytes. (A) A representative Western blot analysis for KAT2A and KAT2B expression in nuclear and cytoplasmic protein fractions harvested from undifferentiated (day 0) and differentiated (days 2 and 4) N/TERT- 1 cells. Lamin A/C, a nuclear protein; and β-tubulin, a cytoplasmic protein, were immunoblotted to confirm the subcellular purity of the fractions. β-actin served as a loading control. Ponceau S served as a loading and transfer control. kDa = kilodalton. (B) Representative confocal images of undifferentiated and differentiated N/TERT-1 cells IF- labelled for KAT2A or KAT2B (red). DAPI (blue) stains the nuclei. Scale bar = 10µm. 175

6.5.2 KAT2A, but not KAT2B, Specifically Acetylates H3K9 in Immortalised Keratinocytes While KAT2A, and KAT2B, can acetylate both histone and non-histone substrates (Fournier et al., 2016), the nuclear localisation and the necessity of the HAT domain of KAT2A to rescue the phenotypes of shKAT2A#1-N/TERT-1 cells led me to postulate that KAT2A likely regulates the balance between stemness and differentiation in keratinocytes by modulating gene expression through the acetylation of chromatin at target gene loci. To begin to address this hypothesis, I first asked the question of which histone substrates are acetylated by KAT2A in keratinocytes. To identify histone substrates of KAT2A in proliferative keratinocytes, the global levels of a panel of histone acetylation modifications previously linked to KAT2A and KAT2B activity were assessed in immortalised and primary keratinocytes expressing shKAT2A and/or shKAT2B. I further examined if the ability of KAT2A to acetylate histone lysine residues is regulated by its bromodomain or N- terminus domain.

Using Western bot analysis on whole cell lysates, I found that the total level of H3K9ac was substantially reduced in proliferative N/TERT-1 cells depleted for KAT2A, whilst levels of H3K14ac, H3K18ac, H4K16ac, and H4K5ac were largely unchanged (Figure 6.12). The global levels of H3K9ac were further reduced in shKAT2A#1-shKAT2B#1-N/TERT-1 cells. The depletion of KAT2B alone did not impact the acetylation states of any of these histone residues tested, which is consistent with KAT2B playing a negligible or minor role in basal keratinocytes. Of note, total histone H3ac was also significantly reduced by the loss of KAT2A, suggesting that H3K9ac constitutes a large proportion of the keratinocyte histone acetylome or that other histone PTMs not included in this panel were also affected (Figure 6.12). The effect of KAT2A loss on global levels of H3K9ac was confirmed using IF staining, where a 48.9% decrease in staining intensity per nuclei was measured on average relative to shScr control levels (Figure 6.13). H3K9ac and histone H3ac levels in shKAT2A#1-N/TERT-1 cells were fully restored to those in control cells upon re-expression of FL-hKAT2A, ΔBro-hKAT2A, or ΔN-term-hKAT2A, but not mHAT-hKAT2A (Figure 6.14).

176

Figure 6.12: KAT2A specifically acetylates H3K9 in proliferative immortalised keratinocytes. Representative Western blot analysis of subconfluent N/TERT-1 cells depleted for KAT2A and/or KAT2B. Samples were analysed for six histone acetylation modifications previously identified as KAT2A substrates. Histone H3 served as a loading control. Global levels of H3K9ac, a modification linked to the release of paused Pol II, and total histone H3ac were reduced in samples depleted for KAT2A. No changes in H3K9ac levels were detected in samples depleted for KAT2B. kDa = kilodalton. 177

Figure 6.13: Immunofluorescence staining of H3K9ac is reduced in proliferative immortalised keratinocytes depleted for KAT2A. Representative confocal images depicting IF staining for histone H3 and H3K9ac in subconfluent N/TERT-1 cells expressing shScr, shKAT2A#1, or shKATB#1 (left). The integrated density of IF staining for histone H3 and H3K9ac was quantified for each nuclei from three fields of view from each experimental group (right). This data was graphed using box and whisker plots whereby the box represents the median, lower quartile, and upper quartile values, and the whiskers represent the upper and lower extremes. DAPI (blue) stains nuclei. Scale bar = 10µm. 178

Figure 6.14: The bromodomain and N-terminus of KAT2A is dispensable for acetylating H3K9 in keratinocytes. A representative Western blot analysis of global H3K9ac and H3ac levels in shScr-N/TERT-1 cells expressing empty vector and shKAT2A#1-N/TERT-1 cells expressing empty vector, FL-hKAT2A, mHAT-hKAT2A, ΔBro-hKAT2A, or ΔN-term-hKAT2A. Histone H3 served as a loading control, Ponceau S served as a loading and transfer control. kDa = kilodalton.

I also assessed changes in acetylation of these histone substrates in primary keratinocytes upon depletion of KAT2A. Surprisingly, the global levels of H3K9ac, H3K14ac, H3K18ac, H4K5ac, and histone H3ac were all profoundly decreased in shKAT2A#1-NHEK-Neo cells (Figure 6.15). These changes were not observed in shKAT2B#1-NHEK-Neo cells except for a modest decrease in H3K18ac. In addition, a small decrease in histone H3 was also observed compared to shScr control. The levels of specific histone acetylation modifications and even total histone H3 are known to be dynamically altered during the cell cycle. For example, in human dermal fibroblasts, whilst the global levels of H3K9ac are stable throughout the cell cycle, the levels of H4K5ac are more abundant in S-phase (O’Sullivan et al., 2010). Given the proliferative defect conferred by KAT2A loss specifically in primary keratinocytes, I cannot exclude the possibility that reduced histone acetylation in these cells is consequent of an altered cell cycle profile rather than as a direct loss of KAT2A HAT activity.

These results, coupled with observations of proliferative delay and increased senescence in KAT2A-depleted primary keratinocytes described in Chapter 4.3, further points to KAT2A 179 playing a critical role in regulating the stemness and self-renewing properties of these basal keratinocytes.

These findings show that KAT2A specifically maintains high global levels of H3K9ac in proliferative N/TERT-1 keratinocytes. This regulation is likely a direct effect since high H3K9ac level was dependent on the catalytic activity, but not the bromo- or N-terminal domains of KAT2A.

In summary, results presented here supports the proposition that KAT2A plays a vital role in maintaining the stem-like cell state of basal keratinocytes via a direct gene regulatory mechanism. 180

Figure 6.15: Assessment of the global levels of histone acetylation modifications in proliferative primary keratinocytes depleted for KAT2A or KAT2B. Representative Western blot analysis for the global levels of the indicated histone modification in subconfluent NHEK-Neo keratinocytes depleted for KAT2A or KAT2B. Histone H3 served as a loading control. kDa = kilodalton.

181

CHAPTER 7 – DISCUSSION

7.1 Summary of Key Results

In this dissertation, I have shown that KAT2A and KAT2B are inversely expressed with keratinocyte differentiation, with expression of the former highest in undifferentiated cell populations and the latter in differentiated cell populations. These significant changes in HAT expression during keratinocyte differentiation were found to be mostly limited to these two paralogues in vitro. Notably, KAT3A and KAT3B, another pair of nuclear HAT paralogues also known to exhibit partial functional redundancy, were transcriptionally stable during keratinocyte differentiation, substantiating a functional importance for the switch in KAT2A and KAT2B expression to the change in cellular states. I also showed that several histone substrates of KAT2A associated with transcriptional regulation, including H3K9, are hypoacetylated in differentiated vs undifferentiated keratinocytes, suggesting that KAT2A is functioning in undifferentiated populations to maintain these histone modifications. shRNA-mediated knockdown of KAT2A in proliferative immortalised keratinocytes resulted in cell clustering morphology that resembled cells in a primed differentiation state at confluency, whilst knockdown in primary cells led to a dominant proliferative defect, which precluded analysis of cell morphology. These phenotypes were accompanied by upregulation of numerous genes associated with keratinocyte differentiation in the absence of initiating signals, including those encoding structural elements of the cornified envelope, tight junction adhesion molecules, and proteins involved in ECM remodelling. KAT2A- depleted keratinocytes at subconfluency also aberrantly expressed KAT2B at levels that are normally detected only in well differentiated cells. When the elevated KAT2B levels were normalised by concurrent knockdown of KAT2B, the morphological and transcriptional changes induced by KAT2A loss were exacerbated and a greater number of genes associated with late keratinocyte differentiation were deregulated as a result. Importantly, expression of the shKAT2B alone did not result in similar changes in either immortalised or primary keratinocytes in the undifferentiated state, consistent with KAT2B having predominant functions at differentiated timepoints. Indeed, I showed that loss of KAT2B profoundly compromised the course of keratinocyte differentiation, as indicated by a diminished upregulation in a broad range of late differentiation markers and higher expression of cell cycle genes upon induction. By contrast, KAT2A loss had the opposite effect, in that the expression of late keratinocyte differentiation markers were enhanced at the protein level. Loss of both KAT2A and KAT2B led to an effect on differentiation that was more similar overall to keratinocytes depleted for KAT2A rather than KAT2B. Analysis of global 182 transcriptomic changes by RNA-seq identified altered expression of several transcription factors in undifferentiated KAT2A-depleted cells and differentiated KAT2B depleted cells that have previously been shown to modulate the differentiation gene expression program in keratinocytes, providing insight into how KAT2A and KAT2B could transcriptionally regulate the differentiation genes and the EDC gene loci in particular. In addition, I showed that KAT2A regulates cellular morphology and differentiation gene expression in proliferative keratinocytes predominantly through HAT-dependent mechanisms that are enhanced by its bromodomain and N-terminus domain. Finally, I showed that these mechanisms employed by KAT2A are mostly limited to the keratinocyte nucleus, where they are necessary, at least in part, to maintain high levels of H3K9ac, which may contribute to the function of KAT2A to restrict precocious initiation of the keratinocyte differentiation program.

In this chapter, I will interpret the results described in this dissertation and discuss how they build upon knowledge gained from previous studies in addition to addressing their significance and limitations.

7.2 Global Histone H3 Modification Dynamics during Keratinocyte Differentiation

Gene expression programs are in part regulated by histone acetylation at a local and global level, with much evidence supporting this gleaned from profiling histone PTMs in ESCs. The early transition of mouse ESCs from pluripotent to committed states and the transcriptional changes that this entails is regulated by global increases in both histone H3 and H4 acetylation across specific gene regulatory regions of chromatin (McCool et al., 2007), whilst later timepoints of differentiation are characterised by global histone deacetylation (Gonzales-Cope et al., 2016; Lee et al., 2004). Mass spectrometric profiling of histone PTMs in human ESCs associated pluripotency with hyperacetylation of histone H3 at K4, K9, K14, K18, K56 and K122 as well as histone H4 at K5, K8, K12 and K16, and differentiated states with global losses of histone acetylation and enrichment for histone methylations especially of histone H3 at K9, K20, K27 and K36 (Azuara et al., 2006; Bhanu et al., 2016). At a local level, studies using chromatin immunoprecipitation (ChIP) assays found the promoter/enhancer of the pluripotency gene, Oct-4, to be hyperacetylated in mESCs (Hattori et al., 2004). Accordingly, researchers have found that self-renewing ESCs generally display more decondensed transcriptionally permissive chromatin, whilst differentiated ESCs are characterised by expanded transcriptionally inactive heterochromatin regions imprinted with H3K9 and H3K27 methylation (Hawkins et al., 2010b). In light of these studies, it is tempting to speculate that a shift from self-renewing to 183 differentiated cellular states may be granted by global hypoacetylation and hypermethylation of the histone landscape to limit the expression of stemness genes and specify differentiation gene expression programs.

My findings described in Chapter 3.2 show that keratinocyte differentiation is associated with a decrease in the global levels of histone PTMs linked to gene activation, namely H3K9ac, H3K18ac, H3K27ac, and H3K4me3, and an increase in total H3K27me3, a gene silencing mark. These results show some consistency with observations reported in ESCs, raising the possibility that these dynamics in global histone marks could be hallmarks of a transition from undifferentiated to differentiated cellular states in general. The loss of these active gene marks and gain in repressive marks likely negatively regulates the expression of a broad subset of genes, presumably those related to keratinocyte stemness. Consistent with this finding, it is known that the majority of gene transcription is downregulated during keratinocyte differentiation, and it stands to reason that changes in the levels of these histone PTMs could contribute to this observation. Indeed, Cavazza et al. have shown that in differentiated epidermal cells H3K27me3 transcriptionally silences genes encoding transcriptional regulators, chromatin remodelers and cell cycle regulators, amongst others, that are otherwise highly expressed in undifferentiated keratinocytes (Cavazza et al., 2016). Therefore, the increase in global levels of H3K27me3 I observed during keratinocyte differentiation may reflect silencing of stem/progenitor cell-related genes in differentiated progeny. It follows that the decrease in global levels of active histone marks likely correspond to a selective loss of these marks from the promoters of stem/progenitor cell- related genes to also downregulate their expression. Furthermore, the decrease in H3K27ac levels observed with keratinocyte differentiation may reflect a reduction in the activity of enhancers that support the undifferentiated state.

In line with my findings, it has been shown that inhibition of HDACs can block terminal differentiation of primary human keratinocytes and that shape-induced differentiation is associated with global hypoacetylation of histone H3 and histone H4 (Connelly et al., 2011). Furthermore, deletion of ectodermal HDAC1/2 in mice, which are most highly expressed in the suprabasal layers of the epidermis, causes aberrant epidermal differentiation and the manifestation of a single layered epidermis throughout embryogenesis that is enriched for H3K9ac and absent for KRT10 and loricrin (LeBoeuf et al., 2010). These studies indicate that an appropriate histone acetylation status achieved by the activities of HDACs is important for the commitment or progression of terminal differentiation. My data, showing a loss of several histone acetylation PTMs with differentiation, supports this notion and 184 further suggests that a concomitant loss of HAT activities (see following section) may contribute to the establishment of histone acetylation states appropriate for keratinocyte differentiation. Further work should seek to affirm if global histone acetylation states do indeed differ between basal cells and suprabasal cells of the adult human epidermis under physiological conditions using IF staining techniques with highly-specific histone antibodies.

7.3 KAT2A and KAT2B Expression Patterns during Keratinocyte Differentiation

In Chapter 3.3 and Chapter 5.2, I presented data showing that significant gene expression changes in HATs during keratinocyte differentiation are limited to the GNAT family. The high expression of KAT1 in undifferentiated N/TERT-1 cells and its downregulation upon differentiation could indicate a functional significance for this HAT in basal keratinocytes. Currently, the roles of KAT1 in the epidermis have not been thoroughly explored, although this HAT, which was once thought to have functions confined to the cytosol, has been shown to primarily localise to the nucleus of NHEK cells where levels are highest during mitosis (Lebel et al., 2010). There is some evidence to suggest a protective role for KAT1 against DNA damaging agents in MEFs (Nagarajan et al., 2013) and NHEKs in vitro (Lebel et al., 2010). Given the vulnerability of skin to ultraviolet radiation (UVR), it would be interesting to explore if KAT1 partakes in protecting against genome instability induced by this insult, and if impairments to KAT1 function or expression contribute to the progression of skin cancers. Keratinocyte culture systems utilising controlled exposures to UVR have been used extensively since the early 1980s (De Leo et al., 1984) and have proved to be good models for the study of photobiologic phenomena in skin. Using similar in vitro systems to investigate the roles of KAT1 in UVR-induced cellular responses in keratinocytes would be a suitable starting point.

KAT9, the catalytic subunit of the elongator complex, was another HAT from the GNAT family found to be downregulated in N/TERT-1 cells upon differentiation. To my knowledge, the functions of KAT9 in keratinocytes have not been explored. Recombinant yeast KAT9 can acetylate all four core histones in vitro, but preferentially targets H3K14 and H4K8 when a part of its native complex (Winkler et al., 2002). Similar activities have been observed for the human orthologue (Hawkes et al., 2002), whilst KAT9 has been shown to preferentially target H3K9 over H3K14 in Drosophila (Karam et al., 2010). It is possible that the HAT activity of KAT9 similarly contributes to the levels of H3K9ac in N/TERT-1 cells and hence the decrease in global levels of this mark with differentiation may be in part due to concomitant downregulation of KAT9. 185

The most striking differences in HAT expression observed with keratinocyte differentiation, and the basis for the present study, was the inverse expression patterns of KAT2A and KAT2B. Initial developmental characterisation studies of KAT2A and KAT2B revealed that the two paralogues exhibit complementary expression patterns in a variety of adult mouse tissues (XuD, 1998). In addition, KAT2A and KAT2B have been shown to be the highest and lowest expressed HATs in adult mouse hippocampal cells, respectively (Stilling et al., 2014). My findings extended these observations by showing that differential expression of KAT2A and KAT2B at a cellular level is similarly conserved in human keratinocytes. My studies showed that keratinocyte differentiation can reliably induce a switch in KAT2A and KAT2B expression that correspond to the different cellular states. Consistent with my findings, Hirsch et al. have shown that KAT2A and KAT2B are respectively upregulated and downregulated during early somatic cell reprogramming (Hirsch et al., 2015). However, they also show that both KAT2A and KAT2B are downregulated upon differentiation of mouse ESCs. This could suggest that KAT2A and KAT2B are only differentially regulated during cellular differentiation of adult stem cells. To investigate this possibility, the expression patterns for KAT2A and KAT2B could be profiled during differentiation of intestinal epithelial stem cells or haematopoietic stem cells.

Consistent with expression profiles measured in vitro, KAT2A expression in the adult human epidermis, as shown in Chapter 3.5, is limited to the basal and spinous layers but absent in cells undergoing terminal differentiation. Therefore, I speculate that a reduction in the levels of KAT2A may be a prerequisite for the expression of genes associated with terminal differentiation. This is consistent with the gene expression profiles of proliferative N/TERT- 1 cells and NHEK-Neo cells which exhibited an upregulation of a broad set of late differentiation genes, particularly those related to cornification, upon depletion of KAT2A (see Chapter 4.5 and Chapter 5.5). I also showed that KAT2B mRNA levels were higher in cells undergoing terminal differentiation in the adult human epidermis, consistent with expression profiles measured in vitro. Accordingly, Pickard et al. have demonstrated higher protein levels for KAT2B in suprabasal layers of human epidermis using immunohistochemistry. This expression pattern suggests that KAT2B levels are purposefully elevated in order to drive the expression of late differentiation genes. This is consistent with the gene expression profiles of differentiated shKAT2B-N/TERT-1/NHEK- Neo cells, which show reduced mRNA levels for a broad set of late differentiation genes (see Chapter 4.5 and Chapter 5.5).

These observations led to my speculation that KAT2A and KAT2B may regulate different sets of genes and targets to impact specific pathways, and that a tightly maintained balance 186 in the levels of KAT2A and KAT2B is an important mechanism by which cells control specific cellular process, such as differentiation. While the mechanisms and/or regulators involved in modulating the differential expression of KAT2A and KAT2B during keratinocyte differentiation is beyond the scope of the present study, my experiments, showing increased KAT2B protein expression in proliferative shKAT2A-N/TERT- 1/NHEK-Neo cells (see Chapter 4.2), suggest that KAT2A may act as a negative regulator of KAT2B expression. Indeed, elevated levels of KAT2B have been reported in many other cell lines and mouse tissues depleted for KAT2A (Koutsogiannouli et al., 2017). This may explain why KAT2A and KAT2B are expressed at drastically different levels relative to each other in various tissues and cells. It follows that the increased expression of KAT2B upon keratinocyte differentiation could reflect a release from the repressive effects of KAT2A as it is downregulated. Although I did not fully investigate the mechanism by which KAT2A loss leads to an increase in KAT2B protein expression, I showed in Chapter 4.2 that this effect is likely due to upregulation in KAT2B gene expression and not due to changes in the stability of the KAT2B protein. I also showed in Chapter 6.2 that the HAT activity of KAT2A functions to limit this effect in proliferative N/TERT-1 cells. Further work is necessary to investigate if KAT2A indirectly or directly negatively regulates the KAT2B gene in keratinocytes.

7.4 KAT2A as a Negative Regulator of Terminal Keratinocyte Differentiation

In this section, I will discuss how results described in Chapter 4 and Chapter 5 support a model in which KAT2A functions as a negative regulator of keratinocyte differentiation to promote the undifferentiated state.

7.4.1 KAT2A may Function to Sustain Self-Renewal of Primary Keratinocytes In Chapter 4.3, I showed that KAT2A knockdown profoundly reduces the proliferative capacity of primary human keratinocytes but not immortalised keratinocytes harbouring deletions for the p16INK4a locus. Importantly, KAT2B does not functionally compensate to rescue this phenotype in shKAT2A-NHEK-Neo cells, and knockdown of KAT2B was dispensable for normal proliferation in both cell lines. This led me to postulate that KAT2A is functioning non-redundantly with KAT2B to sustain self-renewal of keratinocyte stem cells, potentially through the p16INK4a pathway, rather than promoting their commitment to differentiate. Although my investigation into this phenotype did not proceed further than empirical observations, I will speculate on how KAT2A loss could have caused such effects.

The self-renewing property of keratinocyte stem cells is governed by the p16INK4a pathway. Following activation by several differentiation stimuli, p16INK4a directly inhibits the activity 187 of cyclin-dependent kinase 4/6 (CDK4/6) towards Rb to favour its association with E2F transcription factors in the cytoplasm, thus preventing them from inducing transcription of their target genes to promote the G1- to S-phase transition (Sharpless, 2005). In this manner, p16INK4a functions as a potent inhibitor of cell cycle progression. If activation of the p16INK4a pathway is sustained, cellular senescence may be initiated, characterised by stable cell cycle arrest. Appropriately, expression of the p16INK4a gene is tightly controlled by the activities of several HATs to ensure that cell cycle withdrawal of stem cells only occurs under the appropriate conditions (Li et al., 2011). For example, KAT3A/B is recruited to the promoter of p16INK4a by HMG-box transcription factor 1 or transcription factor SP1 to facilitate chromatin relaxation and subsequent gene transactivation (Wang et al., 2012; X Wang et al., 2008; Xue et al., 2004). KAT3B also interacts with and acts as a coactivator for Myb-related protein B (Johnson et al., 2002), a repressor of p16INK4a that has been shown to play an important role in maintaining the undifferentiated state of basal epidermal cells (Maruyama et al., 2014). Furthermore, KAT6A has been shown to bind to the promoter of p16INK4a to transcriptionally repress this locus through a HAT-dependent mechanism to promote self- renewal in both haematopoietic and neural stem cells (Perez-Campo et al., 2014). Therefore, HAT activities can positively and negatively regulate the expression and function of p16INK4a to in turn impact self-renewal potential.

As for KAT2A and KAT2B, numerous studies support roles for both paralogues in the p16INK4a pathway. KAT2B has been shown to acetylate Rb to retain it in the nucleus of NHEK-Neo cells during the late stages of differentiation in order to maintain stable cell cycle arrest (Chan et al., 2001; Nguyen et al., 2004; Pickard et al., 2010). Since Rb was found to be acetylated only during late differentiation, it is unlikely that KAT2A has similar activity towards this protein in proliferative keratinocytes, despite studies showing that some non-histone proteins of both paralogues are targeted redundantly. However, KAT2A could regulate the expression of Rb in proliferative keratinocytes to regulate cell cycle progression. It is possible that the proliferative defects I observed in shKAT2A-NHEK-Neo cells is a consequence of deregulation to Rb expression that causes an increase in Rb levels. However, inconsistent with this hypothesis, it has been shown that knockdown of KAT2A in A549 and RPE1 cells reduces Rb levels (Chen et al., 2013; Qiao et al., 2018) despite also inhibiting cell cycle progression. Therefore, the proliferative phenotype I observed in shKAT2A- NHEK-Neo cells is likely due to perturbations in the p16INK4A pathway outside of Rb function.

The proliferative defects and premature senescence I observed upon KAT2A loss in NHEK- Neo cells could be due to upregulation or enhanced activities of p16INK4a. Although no such 188 links have been made with KAT2A in other cell types, KAT2B has been shown to upregulate p16 INK4a when overexpressed in two gastric cancer cell lines with aberrantly low levels of KAT2B. Additionally, overexpressed KAT2B can interact with p16 in these cells to promote its nuclear translocation where it competes with cyclin D1 for binding to CDK4/6 (Fei et al., 2016). Although this supports a role for KAT2B in limiting cell cycle progression by modulating p16 INK4a expression/function, KAT2A may balance these effects in proliferative keratinocytes by also interacting with p16 INK4a and/or negatively regulating its expression. To consider this as a possibility, the mRNA and protein expression of p16 INK4a could be measured in shKAT2A-NHEK-Neo cells to ascertain if levels are aberrantly elevated. If expression is found to be deregulated, then further investigation is warranted to understand if KAT2A directly regulates p16INK4a in keratinocytes or if KAT2A loss leads to the manifestation of stress stimuli known to activate this pathway, such as DNA damage.

There is strong evidence supporting a link between the pro-proliferative effects of KAT2A and the activities of E2F transcription factors. Firstly, KAT2A has been shown to acetylate histones at the promoter regions of E2F1 to upregulate its expression in A549, RPE1, and human breast cancer cells to potentiate their growth (Chen et al., 2013; Qiao et al., 2018; Zhao et al., 2018). Secondly, KAT2A binds to E2F transcription factors in mammalian cell cultures and its HAT activity towards H3K9/14 is essential to stimulate E2F-mediated transactivation in pluripotent cells (Hirsch et al., 2015; Lang et al., 2001). KAT2B-, and, to a lesser extent, KAT2A-mediated acetylation of E2F transcription factors has also been shown to stabilise these proteins and enhance their transactivation potential (Martínez- Balbás et al., 2000). Finally, there is also evidence suggesting that the E2F1 transcription factor can itself induce the expression of the KAT2A gene in human colon cancer cells (Yin et al., 2015). Taken together, these studies suggest that KAT2A plays a profound role in the E2F1 pathway and, given its importance in maintaining the proliferative capacity of keratinocytes (Dicker et al., 2000; Jones et al., 1997), it is possible that perturbations in this pathway underlie the proliferative defects I observed in shKAT2A-NHEK-Neo cells. To investigate this possibility, mRNA and protein levels of E2F transcription factors could be analysed in shKAT2A-NHEK-Neo cultures to determine if their expression is negatively affected by KAT2A loss.

7.4.2 Clustering of shKAT2A-N/TERT-1 cells may Reflect a Transition to a Primed State In Chapter 4.4, I described the propensity of N/TERT-1 cells expressing shKAT2A to cluster at subconfluent cell densities, giving rise to cellular morphologies that closely resemble those at confluency, a timepoint when proliferation rates decrease, cell-cell adhesion junctions mature, and interactions with ECM components change in preparation to initiate 189 the terminal differentiation program. In accordance with these characteristics, the clustering phenotype observed was associated with changes in the expression of several cell adhesion molecules, vimentin, and proteins involved in ECM remodelling, in addition to upregulation in a wide range of genes belonging to the EDC at levels that were intermediate between that exhibited in confluent and differentiated keratinocyte cultures. Therefore, I propose that this phenotype reflects premature acquisition of a primed state of differentiation under conditions that typically favour self-renewal.

7.4.2.1 KAT2A may Modulate the Development of Adhesion Junctions Strong cell-cell contacts that develop over the course of keratinocyte differentiation are mediated by the formation of specialised adhesion junctions that are typically not detectable in cultures maintained at subconfluency in media containing low calcium ion concentrations. However, expression analysis of proliferative shKAT2A-N/TERT-1 cells revealed a selective upregulation for cell-adhesion genes, particularly those associated with tight junctions and desmosomes (see Chapter 4.4.2 and Chapter 5.6), suggesting that these adhesion junctions may be forming prematurely in absence of initiating signals to cause the cells to cluster together. However, I did not detect significant tight junction formation by staining for claudin 1 in undifferentiated shKAT2A-N/TERT-1 cultures. It is possible, however, that the clustering phenotype results predominantly from enhanced formation of desmosomes typically associated with late keratinocyte differentiation. To explore such a possibility, IF staining for desmocollin-1, desmoglein-1, or plakophilin-1 could be performed using methanol/acetone fixation techniques.

7.4.2.2 KAT2A may Modulate Keratinocyte Migration by Regulating Vimentin Expression The functions of vimentin in keratinocyte biology is relatively understudied relative to other intermediate filament proteins. In fact, vimentin expression in the epidermis has only been detected in melanocytes and Langerhans cells under steady-state conditions (Bongiovanni et al., 2013; Mahrle et al., 1989, 1983), and in some basal cells of the regenerated epidermis (Moll et al., 1998). However, vimentin fibrils are readily detectable in keratinocytes grown in culture (Franke et al., 1979a, 1979b; Richard et al., 1990b). Recently, vimentin was shown to cooperate with keratin filaments to promote keratinocyte migration in vitro and to function in vivo to promote burn wound healing in a mouse model (Cheng et al., 2016; Velez- delValle et al., 2016). The decrease in vimentin expression I observed in immortalised and primary keratinocytes (see Chapter 4.4.3) may have negatively affected vimentin-mediated migration to give rise to the clustering phenotype. Consistent with this explanation, shScr- N/TERT-1 cells appeared significantly more motile and followed more complex migratory paths compared to shKAT2A-N/TERT-1 cells in live cell imaging experiments. Vimentin 190 expression is reduced and mislocalised in mouse ESCs and EBs depleted for KAT2A, with the latter displaying disorganised epiblast morphologies (Moris et al., 2018; Wang et al., 2018). Therefore, in addition to migratory deficits, altered vimentin expression in the shKAT2A-N/TERT-1 cells could have also perturbed cell-cell adhesion and/or cell polarisation to contribute to the clustering phenotype. Interestingly, Castro-Muñozledo et al. have shown that the presence of vimentin filament networks is limited to a subpopulation of primary keratinocytes coexpressing the putative stem cell markers p63 and integrin α5β1. Thus, in line with the gene expression profiles of shKAT2A-N/TERT-1 cells, the decrease in vimentin expression I observed upon KAT2A loss may be a consequence of a transition from a stem-like state to a primed state in keratinocytes. This notion is further supported by a study that demonstrates dramatic reductions in vimentin expression in cultured keratinocytes soon after differentiation induction (Biddle and Spandau, 1996).

7.4.2.3 KAT2A may Modulate Keratinocyte-ECM Interactions by Upregulating MMPs MMPs are secreted by keratinocytes to facilitate their migratory and terminal differentiation processes in both in vitro and in vivo systems. Most of these studies show that MMPs promote keratinocyte migration in the context of wound healing, but there is little insight into how these enzymes could affect the motility and migratory paths of individual keratinocytes cultured at subconfluent cell densities. It is expected that these parameters would be affected by changes in the levels of MMPs. In Chapter 4.4.4 and 5.5, I showed that MMP1, MMP3, MMP10, and MMP13 were upregulated in shKAT2A-N/TERT-1 cells at subconfluency. MMP1, MMP10, and MMP13 have all been demonstrated to promote keratinocyte migration in wound healing models (Hattori et al., 2009; Pilcher et al., 1997b; Schlage et al., 2015). Therefore, it is unlikely that changes in the levels of these MMPs contributes to the clustering phenotype observed in shKAT2A-N/TERT-1 cells, which were visibly less motile and followed more simple migratory paths compared to control cells. However, elevated activities of these MMPs may in combination degrade the surrounding ECM components produced and secreted by shKAT2A#1-N/TERT-1 cells to impede cell migration. Indeed, one study demonstrated defects in keratinocyte spreading and migration when cultured on collagen lattices pre-treated with MMP1 (Varani et al., 2009). Further work should explore if the upregulation of MMP1, MMP10, and MMP13 equates to an overall increase in their activities in shKAT2A-N/TERT-1 cultures, as these enzymes must first be activated to degrade ECM components.

Alternatively, MMPs regulated by KAT2A may play roles in the terminal differentiation process. Overexpression of MMP3 in cultured keratinocytes has been shown to enhance terminal differentiation (McCawley et al., 2008). Perhaps the upregulation of MMP3 I 191 detected in subconfluent shKAT2A-N/TERT-1 cells contributes to the ectopic expression of late differentiation markers in these cells? It follows that MMP1, MMP10, and MMP13 may also function in a similar manner in keratinocytes.

7.4.3 KAT2A Functions to Restrain the Differentiation Gene Expression Program In this study, KAT2A loss in N/TERT-1 cells did not downregulate any putative stem cell markers described in the literature, such as ITGB1, DLL1, or TP63. KAT2A appears to be similarly dispensable for maintaining pluripotency, as deletion of this HAT in mESCs has been shown to have no effect on the expression of pluripotency markers (Lin et al., 2007). Therefore, KAT2A may not be functioning to maintain the “stemness” gene expression program in keratinocytes. Rather, KAT2A may play a role in establishing this program in the first place. In support of this proposition, KAT2A has been shown to activate an alternative splicing program that is essential for the acquisition of pluripotency during the early events of somatic cell reprogramming (Hirsch et al., 2015). Although my study does not explore if KAT2A functions in establishing keratinocyte stemness, it does clearly demonstrate KAT2A as an important factor for maintaining the undifferentiated cellular state. This is demonstrated in evidence presented in Chapters 4.5 and 5.5 showing upregulation of differentiation-associated genes in proliferative keratinocytes upon depletion of KAT2A in the absence of initiating signals. Premature expression of differentiation markers has been described in other cell types depleted for KAT2A. Notably, KAT2A-/- mouse bone marrow-derived progenitor cells exhibit differentiated morphologies and express CD11b, a differentiation marker for the myeloid-monocytic lineage (Domingues et al., 2018). Chemical inhibition of KAT2A in human acute myeloid leukaemia cell lines has also been shown to trigger the expression of myeloid differentiation marker genes (Tzelepis et al., 2016). Several studies have even shown an enhancement of embryonic myogenesis and mesendodermal differentiation in the absence of KAT2A (Lin et al., 2007; Moris et al., 2018). I also observed a similar effect upon differentiation of shKAT2A-N/TERT-1 cells. In these cultures, the expression of certain late differentiation markers was slightly higher than control levels and the number of cornified cells was greater. This suggests that KAT2A may be functioning to limit the expression of differentiation markers at early-mid differentiation timepoints before its expression is dramatically downregulated. In support of this notion, KAT2A levels only fall between days 2 and 4 of in vitro keratinocyte differentiation and at the transition from spinous to granular cell layers in vivo. Nonetheless, the expression of differentiation markers in KAT2A depleted keratinocytes was always markedly higher at the undifferentiated timepoints, and this appears to be when the levels and repressive effects of KAT2A are greatest. 192

7.4.3.1 KAT2A may Regulate Differentiation Gene Expression via Histone PTMs In Chapter 6, I showed that KAT2A was predominantly localised to the nucleus of keratinocytes and that its HAT activity was essential for its function, suggesting that KAT2A is functioning as a histone acetyltransferase in keratinocytes. How could KAT2A mediate its repressive effects on keratinocyte differentiation by acetylating chromatin? Prior to differentiation-induction, KAT2A loss may have endowed a permissive chromatin state at differentiation-associated genes so that transcription by basal transcription factors takes place. Further work is necessary to understand if KAT2A directly promotes a condensed chromatin state at these genes to repress their expression in undifferentiated keratinocytes. Although a direct mechanism is inconsistent with the long-standing view of KAT2A as an acetyltransferase that promotes transcription, there may be an undefined chromatin- associated mechanism employed by KAT2A that serves to negatively regulate expression. This would explain why the DEGs identified in shKAT2A-N/TERT-1 cells were biased towards upregulation. In fact, most studies find that a large proportion of DEGs are upregulated as a result of KAT2A loss in various cell types. Notably, 31% of DEGs identified in yKAT2A deletion mutants in yeast are upregulated (Holstege et al., 1998), including ARG1, a gene that is transcriptionally repressed specifically by the HAT activity of yKAT2A at the ARG1 promoter (Ricci et al., 2002). Moreover, ChIP analysis demonstrated a decrease in histone H3 acetylation and an increase in TBP binding at the ARG1 promoter in the absence of yKAT2A (Ricci et al., 2002), showing that nucleosomal acetylation can be transcriptionally repressive. Ablack et al. observed the same phenomenon with the negative regulation of the viral E4 gene by the HAT activity of KAT2A in infected MEFs. The recruitment of KAT2A to the E4 promoter correlated with hyperacetylation of H3K9/14. H3K9/14ac levels typically correlate positively with gene activity, and so it is surprising to find that both marks may contribute to the repressive effects of KAT2A. KAT2A may similarly deposit H3K9ac at differentiation gene loci to serve as a repressive mark in undifferentiated keratinocytes. Indeed, I showed that KAT2A specifically maintains H3K9ac in undifferentiated N/TERT-1 cells (see Chapter 6.5.2) and that keratinocyte differentiation correlates with decreased global levels of this mark (see Chapter 3.2), suggesting that this loss of KAT2A-mediated H3K9ac may derepress differentiation- associated genes during normal epidermal homeostasis.

There is also strong, emerging evidence from the lab of Doctor Cristina Pina demonstrating KAT2A as a transcriptional noise modulator to control stem cell fate decisions through acetylation of H3K9 (Domingues et al., 2017; Moris et al., 2018). Underpinning this proposition is the idea that loss of H3K9ac destabilises transcription to cause stochastic gene 193 expression and increased transcriptional heterogeneity. In turn, this increases the probability of differentiation networks replacing self-renewal programs. The Pina lab have demonstrated associations between the loss of KAT2A-depedent H3K9ac and the destabilisation of pluripotency/self-renewal networks in mESCs and leukemic stem cells (Domingues et al., 2018, 2017; Moris et al., 2018). This may represent a general mechanism by which stem cell fate transitions are promoted through changes in the histone landscape. The specific and extensive loss of H3K9ac in KAT2A-depleted N/TERT-1 cells coupled with their apparent shift from an undifferentiated to a differentiated state, both in terms of morphology and expression profile, suggests that KAT2A could be acting as a transcriptional noise modulator via H3K9ac in keratinocytes. Further work should be performed to determine if increased transcriptional noise contributes to the premature differentiation phenotype characterised in subconfluent shKAT2A-N/TERT-1 cells. This would require transcriptionally profiling these cultures at single-cell resolution and performing ChIP-seq analysis for H3K9ac.

7.4.3.2 KAT2A may Regulate Differentiation Gene Expression via Non-histone Substrates The chromatin-associated activities of KAT2A are supported by its bromodomain, which allows for the cooperative acetylation of nucleosomes (Li and Shogren-Knaak, 2009) and stabilisation of the SWI/SNF complex at gene promoters (Hassan et al., 2001). Inactivating the yKAT2A bromodomain leads to a decrease in KAT2A-dependent transcription and histone acetylation at gene promoters in vivo (Syntichaki et al., 2000). In the present study, I have shown that the HAT activity, but not the bromodomain, of KAT2A is essential for the regulation of differentiation genes in N/TERT-1 cells, suggesting that KAT2A may function to this end by acetylating non-histone substrates similar to how KAT2B acetylates Rb to promote keratinocyte differentiation.

KAT2A-dependent acetylation has been shown to modulate the activities, subcellular localisation, and/or stability of several non-histone proteins in cells, including, but not limited to, polo-like kinase 4 (Fournier et al., 2016), C/EBPα (Bararia et al., 2016), and TBX5 (Ghosh et al., 2018). C/EBPα is a notable example of a non-histone substrate acetylated by KAT2A that is associated with cellular differentiation (Bararia et al., 2016). In this case, C/EBPα is acetylated by KAT2A in haematopoietic cells to downregulate its activity in promoting granulocytic differentiation. KAT2A has also been shown to acetylate C/EBPβ to potentiate preadipocyte differentiation (Wiper-Bergeron et al., 2007). Therefore, it is apparent that the C/EBP family of transcription factors are important targets for KAT2A in regulating cellular differentiation. Could KAT2A negatively regulate keratinocyte differentiation by acetylating C/EBP proteins? C/EBPα/β are strongly coexpressed in suprabasal keratinocyte nuclei, although lower levels are detectable in basal keratinocyte 194 nuclei (Di-Poï et al., 2005; Lopez et al., 2009; Oh and Smart, 1998; Swart et al., 1997). Accordingly, calcium-induced differentiation of primary mouse keratinocytes leads to a modest increase in C/EBPα and a more substantial increase in C/EBPβ (Maytin and Habener, 1998). Epidermal ablation of both C/EBPα and C/EBPβ yields barrier defects and reduced or absent expression of early and late differentiation markers (Lopez et al., 2009). The subcellular localisation, expression profiles, and functions of C/EBPα/β during keratinocyte differentiation make these transcription factors promising non-histone protein candidates for KAT2A to target in keratinocytes. Thus, it would be interesting to explore if KAT2A acetylates C/EBP transcription factors in basal keratinocyte nuclei to attenuate their activity in promoting the onset of differentiation.

Three non-histone, nuclear-localised proteins that are dynamically acetylated upon calcium- induced differentiation have been detected in HaCaT keratinocytes with molecular weights of 70KDa, 78KDa, and 97KDa (Kawabata et al., 2002). The 97KDa protein was hyperacetylated soon after the induction of differentiation through the PKC signalling pathway. Ectopic expression of catalytically dead mutant KAT2B blocked the acetylation of this protein. Although the identity of this protein was never identified, it may be Rb, which was later found to be acetylated by KAT2B in differentiating primary human keratinocytes (Pickard et al., 2010). The acetylation levels of the 70KDa protein prior to differentiation was the highest amongst the three proteins under study. Upon differentiation, the 70KDa protein was significantly hypoacetylated independent of the PKC signalling pathway. It is tempting to speculate that this protein is acetylated by KAT2A in undifferentiated keratinocytes, and that this activity is important to limit the onset of differentiation. Hence, hypoacetylation of the 70KDa protein may be consequent to the downregulation of KAT2A following differentiation-induction, an event that may be permissive to the proliferation- differentiation switch.

KAT2A has also been shown to regulate the activity of several transcriptional regulators, including the CDK9/pTEFb complex. Ablack et al. found that the HAT activity of KAT2A at the E4 promoter correlated with a reduced occupancy by phosphorylated RNAPII. KAT2A and KAT2B have both been shown to acetylate the CDK9/pTEFb complex to inhibit its ability to phosphorylate the C-terminal domain of RNAPII (Sabo et al., 2008). Taking this into consideration, mechanistic insight may be gained by assessing if the occupancy and phosphorylation states of RNAPII are increased at the promoters of upregulated DEGs identified in shKAT2A-N/TERT-1 cells. 195

A mass spectrometry-based study identified over 300 non-histone candidates acetylated by KAT2A/KAT2B in HeLa cells, many of which associated with the mitotic cell cycle and histone lysine methylation, which may be relevant to the proliferative and differentiation phenotypes I described in KAT2A-depleted keratinocytes, respectively (Fournier et al., 2016). A similar proteomic study applied to the shScr/shKAT2A-N/TERT-1 cell lines before and after differentiation would be valuable in identifying non-histone substrates of KAT2A that function in regulating the keratinocyte differentiation process.

7.5 KAT2B Promotes Late Keratinocyte Differentiation

KAT2B has previously been demonstrated by Pickard et al. to promote calcium-induced differentiation of primary human keratinocytes (Pickard et al., 2010). Consistent with this study, I found that KAT2B loss significantly attenuated the induction of late differentiation gene expression in both immortalised and primary human keratinocytes (see Chapters 4.6 and 5.5). Pickard et al. demonstrated the effects of KAT2B loss on keratinocyte differentiation by assessing the protein levels of involucrin and TGM1. My RNA-seq analysis shows that KAT2B loss also affects the expression of genes encoding these proteins in addition to a broad range of late differentiation markers, particularly those associated with the cornified envelope. At the protein level, I found that KAT2B loss more profoundly affected the expression of late differentiation markers compared to early-mid differentiation markers, which were only slightly reduced relative to control levels. These findings underscore the importance of KAT2B as a positive regulator of keratinocyte differentiation in vitro, specifically during the later stages as keratinocytes transition into corneocytes. Furthermore, the progressive upregulation of KAT2B expression I observed during in vitro and in vivo keratinocyte differentiation may serve as means of driving the differentiation program (see Chapters 3.4 and 3.5).

The mechanisms by which KAT2B promotes keratinocyte differentiation was not explored in the current study. However, Pickard et al. have shown that KAT2B acetylates Rb to limit its localisation to the nucleus so that it can enforce permanent cell cycle arrest to allow for terminal keratinocyte differentiation. In addition, Rb has been proposed to function as a complex with E2F1 to repress genes that inhibit keratinocyte differentiation (Paramio et al., 2000). In both cases, Rb functions in the nucleus to mediate its effects on differentiation. In Chapter 6.5.1, I showed that KAT2B was strictly localised to the keratinocyte nucleus throughout differentiation. Therefore, KAT2B is in the correct subcellular compartment to acetylate Rb to promote its functions in differentiation like that proposed by Pickard et al. KAT2B is known to target other non-histone substrates for the induction of cellular 196 differentiation. For example, KAT2B acetylates RUNX2 to enhance its transcriptional activity towards genes related to osteogenic differentiation (Wang et al., 2013). Similarly, KAT2B promotes muscle differentiation by acetylating MyoD to enhance transcription initiation of its target genes (Dilworth et al., 2004; Puri et al., 1997; Sartorelli et al., 1999). Taking this into consideration, KAT2B could serve as a coactivator for transcription factors associated with late keratinocyte differentiation (e.g. Fre-2/AP1, Klf4, and GRHL1-3) and/or may modulate their activities through acetylation. Alternatively, KAT2B may promote keratinocyte differentiation through histone acetylation. This has been demonstrated to occur for granulocytic differentiation in leukaemia cells, whereby KAT2B acetylates histone H3 at the promoters of genes targeted by all-trans-retinoic acid (Sunami et al., 2017). However, I did not detect any increases in the global levels of H3K9ac, H3K18ac, H3K27ac upon differentiation of N/TERT-1 cells to suggest that KAT2B is establishing these modifications in abundance as it is upregulated. Nor did I detect any changes in the global levels of H3K9ac, H3K14ac, H3K18ac, H4K16ac, or H4K5ac in shKAT2B-N/TERT-1 cells to indicate that KAT2B is functioning as a histone acetyltransferase in subconfluent keratinocytes, at least with respect to these histone PTMs (see Chapter 6.5.2). However, these experiments were performed at undifferentiated timepoints when levels of KAT2B are low and its functions in keratinocyte differentiation are not in full effect. To assess if KAT2B is acetylating histones to promote keratinocyte differentiation, western blot analyses could be performed using differentiated lysates of shKAT2B-N/TERT-1 cells for histone PTMs known to be catalysed by KAT2B, including H4K5ac, H4K8ac, and H3K18ac. KAT2B may acetylate histones at promoters of differentiation genes in a more local manner that may not be detectable using western blot analysis. Therefore, ChIP-qPCR would be a more suitable approach to investigate this possibility.

KAT2B may also positively regulate the production and/or stability of differentiation proteins. In support of this idea, I found that the protein levels for filaggrin were substantially lower in the double knockdown cells relative to control levels, despite no changes in FLG gene expression (see Chapter 4.6.3). Interestingly, KAT2B may regulate only some differentiation proteins in this manner, as I found that protein levels for involucrin were unaffected. Taken together, KAT2B may function to promote differentiation through several mechanisms. Further work should seek to uncover the mechanisms KAT2B employs to promote keratinocyte differentiation. A similar approach to that described in Chapter 6 could be used to investigate this, whereby a series of deletion/mutant KAT2B constructs are generated and expressed in the shKAT2B-N/TERT-1 cell lines to determine if the HAT 197 domain, bromodomain, and/or N-terminus domain play roles in mediating the functions of KAT2B.

7.6 GRHL1 and POU2F3 as Master Regulators of Late Keratinocyte Differentiation

Alongside changes in expression of late differentiation genes, two transcription factor genes, GRHL1 and POU2F3, were upregulated in shKAT2A- and shKAT2A+shKAT2B-N/TERT- 1 cells at subconfluency and downregulated in shKAT2B-N/TERT-1 cells at day 4 post- differentiation. The importance of GRHL1 in regulating differentiation gene expression during terminal differentiation has been well documented. GRHL1 directly targets the promoter of DSG1, a desmosomal cadherin gene, to upregulate its expression during epidermal differentiation (Wilanowski et al., 2008). The back skin of GRHL1-null mice display a thicker epidermis, fewer desmosomes, and dysregulated terminal differentiation, culminating in mild chronic epidermal barrier defects (Mlacki et al., 2014). Ablation of both GRHL1 and GRHL3 in the epidermis of adult mice induces loss of TGM1 and TGM5 expression, perturbation of cornification, and lethal epidermal barrier defects (Cangkrama et al., 2016). GRHL1 is also essential for epidermal differentiation in Xenopus via its binding and upregulation of XK81A1, a gene encoding keratin type 1 (Tao et al., 2005). TGM1, TGM5, DSG1, and GRHL1 were significantly upregulated in subconfluent shKAT2A- and shKAT2A+shKAT2B-N/TERT-1 cells but downregulated in shKAT2B-N/TERT-1 cells at day 4 post-differentiation. Thus, it is likely that GRHL1 acts as a master regulator for the expression of these differentiation genes and perhaps other TGM family members and desmosomal genes identified as DEGs upon KAT2A/KAT2B loss. Similarly, POU2F3 has been demonstrated to be an important regulator of epidermal differentiation. POU2F3 is prominently expressed in the suprabasal keratinocytes of adult murine epidermis (Andersen et al.). In vitro studies have shown that POU2F3 binds to and transactivates the promoter regions of KRT10, SPRR2A, and IVL in keratinocytes upon differentiation (Andersen et al., 1997; Cabral et al., 2003; Lena et al., 2010; Welter et al., 1996). POU2F3-null mice do not exhibit any epidermal defects apart from a reduction in staining intensity for loricrin, although potential phenotypes may be masked by other members of the POU family suspected of being functionally redundant with POU2F3. POU2F3, SPRR2A, KRT10, and IVL were upregulated in subconfluent shKAT2A- and shKAT2A+shKAT2B-N/TERT-1 cells but downregulated in shKAT2B-N/TERT-1 cells at day 4 post-differentiation. Thus, POU2F3 may serve as master regulator for these differentiation genes and perhaps other SPRR family members identified as DEGs upon KAT2A/KAT2B loss. Furthermore, POU2F3 has also been shown to regulate the expression and activation of MMPs in HaCaT 198 keratinocytes (Beck et al., 2007). Therefore, the changes in expression of various MMP family members in KAT2A-depleted N/TERT-1 cells could be coordinated by POU2F3.

Further work is necessary to understand if KAT2A and KAT2B differentially regulate the expression of GRHL1 and/or POU2F3 in N/TERT-1 cells through direct mechanisms or by functioning upstream in relevant signalling pathways.

7.7 KAT2A-depleted Phenotypes Dominate over KAT2B-depleted Phenotypes

To eliminate potential functional redundancies between KAT2A and KAT2B, N/TERT-1 cells were depleted for both HATs. Consistent with this assumption, unique DEGs were identified in the double knockdown cell line following RNA-seq analysis, suggesting that these genes are either being redundantly regulated by both KAT2A and KAT2B or that the functions of KAT2B are being redirected to mirror that of KAT2A. Given that KAT2A- depletion led to premature differentiation in proliferative N/TERT-1 cells and that KAT2B- depletion delayed the progression of differentiation, I reasoned that knockdown for both HATs would yield a combination of these phenotypes. As expected, hierarchical clustering showed that the expression profiles for shKAT2A+shKAT2B-N/TERT-1 cells and shKAT2A-N/TERT-1 cells were similar at subconfluency. Surprisingly, the expression profiles for shKAT2A+shKAT2B-N/TERT-1 cells and shKAT2B-N/TERT-1 cells were highly dissimilar at day 4 post-differentiation and was more related to that of shKAT2A- N/TERT-1 cells. Specifically, at this timepoint, a large subset of genes related to keratinocyte differentiation that was downregulated in shKAT2B-N/TERT-1 cells were upregulated in shKAT2A+shKAT2B-N/TERT-1 cells. Therefore, rather than delaying differentiation, depletion of KAT2B in shKAT2A-N/TERT-1 cells instead enhanced keratinocyte differentiation to a certain extent. The reason for this counterintuitive result is not clear. One explanation is that KAT2A may serve to repress differentiation genes through histone PTMs prior to differentiation, but KAT2B may promote the removal of these marks upon differentiation to execute the differentiation gene expression program. If this model is indeed true, then that would mean that the premature expression of differentiation genes in subconfluent shKAT2A-N/TERT-1 reflects a loss of repressive marks at corresponding regulatory elements, whilst the delay in differentiation gene expression in shKAT2B- N/TERT-1 cells reflects an inability to remove these marks effectively. Therefore, for the double knockdown cell line, because repressive marks have already been lost upon depletion of KAT2A, the effects of KAT2B loss on differentiation do not manifest, at least on the level of transcription. 199

7.7 KAT2A and KAT2B Redundantly Regulate Innate Antiviral immunity

The skin and its interactions with the commensal microbiome serve as an initial barrier to entry by viruses that are involved in the pathogenesis of diseases, such as shingles and chicken pox. Keratinocytes primarily contribute to this defence system by expressing various antiviral proteins as part of the innate immune response, which is regulated by several signalling pathways, of which the IFN pathway has proven to be crucial (Reviewed by: Dainichi, Hanakawa and Kabashima, 2014; Handfield, Kwock and MacLeod, 2018). In Chapter 5.5, I described RNA-seq data that revealed a dysregulation of gene sets related to viral responses and the type I IFN signalling pathway upon KAT2A or KAT2B loss that was distinct from their effects on the differentiation process, indicating that both HATs may play a role in viral defence in keratinocytes through the IFN pathway. Interestingly, whilst my data suggests that KAT2A and KAT2B function non-redundantly and differentially to regulate keratinocyte differentiation, it appears that in the context of the innate immune response both HATs have similar overlapping and perhaps redundant roles in undifferentiated keratinocytes. Complex and opposing roles for KAT2A and KAT2B in the regulation of the innate immune response have been previously described. KAT2A and KAT2B were shown to be present, with correspondingly high H3K9ac levels, at the promoter of IFNB to facilitate gene activation in vitro (Agalioti et al., 2002). A study has also shown that double knockout of KAT2A and KAT2B in MEFs and preadipocytes leads to enhanced activation of IFNβ production, rendering the cells resistant to viral infection (Jin et al., 2014). However, the impact of KAT2A and KAT2B on IFNB gene expression in these cells were found to be an indirect one. Jin et al. showed that KAT2A and KAT2B act to inhibit phosphorylation of the TANK-binding kinase 1 (TBK1) in the cytoplasm in a HAT- and transcriptionally- independent manner, leading to limited activation of the IFNB promoter by TBK1-mediated pathways. A similar non-histone substrate may be activated by KAT2A/KAT2B to promote the IFN signalling pathway in keratinocytes. qPCR analysis for key IFN-stimulated genes could be performed in shKAT2A-N/TERT-1 cells expression FL- hKAT2A or mHAT-hKAT2A to determine if KAT2A regulates IFN signalling through a HAT-independent mechanism like that described by Jin et al. Alternatively, KAT2A/KAT2B may directly regulate IFN genes in keratinocytes via histone acetylation. This has been demonstrated to occur in human cell cultures upon viral infection during which KAT2A/KAT2B acetylate H3K9 and H3K14 at the promoters of IFNα and IFNβ to recruit basal transcription factors (Agalioti et al., 2002; Ford and Thanos, 2010; Génin et al., 2012) 200

My findings substantiate KAT2A and KAT2B as key regulators of the innate immune response to viral infection in cultured cells. Further work should explore if KAT2A and KAT2B modulate similar responses against viral infections in vivo.

201

CHAPTER 8 - CONCLUSIONS & FUTURE DIRECTIONS

An effective skin barrier is important for mammals to thrive and, in some cases, to survive. Formation of the skin barrier is dependent upon the ability of interfollicular progenitor keratinocytes to exit the cell cycle and progressively differentiate to form a stratified epidermis. The maintenance of the stem cell-like state of progenitor keratinocytes and their commitment to terminally differentiate involves the coordinated repression and expression of select genes spatiotemporally regulated by the interplay of cell signalling pathways (McMullan et al., 2003; Meng et al., 2018; Palazzo et al., 2017; Xin et al., 2011), fibroblast- derived soluble factors (Schumacher et al., 2014), transcription factors (Reviewed by Nagarajan, Romano and Sinha, 2008), ionic gradients (Reviewed by: Bikle, Xie and Tu, 2012; Lee and Lee, 2018), and thermal gradients (Borowiec et al., 2013; Ponec et al., 1997). The importance of this process is underscored by the high prevalence of cutaneous disorders where dysregulation in terminal differentiation is commonly featured. Therefore, identifying key regulators of epidermal homeostasis is of importance not only from a basic science perspective but also a clinical one.

Over the past 15 years, the importance of epigenetic mechanisms in governing keratinocyte differentiation programs has been demonstrated, and it is now widely accepted that this mode of gene regulation works in concert with transcription factors, such as p63 (Fessing et al., 2011), to control epidermal homeostasis (Reviewed by Botchkarev, 2015). DNA methylation and histone deacetylation have been the most well-studied epigenetic mechanisms linked to limiting or driving keratinocyte differentiation, whilst the roles of HATs and histone acetylation in these processes have received considerably less attention despite extensive evidence supporting their importance for balancing stemness and differentiation in other cells types, including ESCs and mesenchymal stem cells (Reviewed by Trisciuoglio, Di Martile and Del Bufalo, 2018). A study by Pickard et al., one of few that have investigated the roles of HATs in keratinocyte differentiation in vitro, showed that KAT2B-mediated acetylation of Rb was required for the proper expression of involucrin and TGM1 during calcium-induced keratinocyte differentiation (Pickard et al., 2010), suggesting that KAT2B could be integral for skin barrier formation in vivo. KAT2A, a closely related paralogue of KAT2B, has not been studied in keratinocytes. Given the large body of evidence demonstrating overlapping roles for both HATs in various cellular processes during mammalian development, it stands to reason that KAT2A could be similarly important for keratinocyte differentiation like KAT2B. On the other hand, KAT2A 202 has also been linked to preventing cellular differentiation in the absence of appropriate signals, functioning instead to stabilise stemness in other cell types, including ESCs (Moris et al., 2018), neural stem cells (Martínez-Cerdeño et al., 2012), and haematopoietic stem cells (Domingues et al., 2018). With evidence indicating divergent functions for KAT2A and KAT2B in cellular differentiation, it stimulated my interest to explore the roles of KAT2A during normal epidermal homeostasis, to understand if KAT2A is functionally redundant with KAT2B to drive keratinocyte differentiation or distinct to maintain undifferentiated cellular states.

This research aimed to explore the functions of KAT2A and KAT2B in keratinocyte differentiation. Based on thorough characterisation of cultured human keratinocytes depleted for KAT2A and/or KAT2B, it can be concluded that the two HATs have distinct roles in keratinocyte differentiation, with KAT2A functioning in undifferentiated cells to sustain the self-renewing potential and to limit the execution of the terminal differentiation program, which is instead promoted by KAT2B upon the induction of differentiation. Although KAT2A and KAT2B have previously been shown to individually regulate differentiation in other cell types, this dissertation is the first to describe how they function oppositely to impact cellular differentiation in the same cell type, and further supports the emerging view of KAT2A as a stabiliser of the self-renewing state in adult stem cells. Future work should seek to reaffirm these functions by overexpressing KAT2A or KAT2B in cultured keratinocytes to determine if cells are rendered refractory to differentiation stimuli or have an enhanced ability to differentiate, respectively. Furthermore, clonogenicity assays should be performed on primary human keratinocytes depleted for KAT2A to quantify the proposed loss of stem cell activity.

The experimental design of this study, which comprised analysis of single and double knockdown cell lines, afforded insight into the functional redundancies that could exist between KAT2A and KAT2B in keratinocytes, a property that few studies consider. This was particularly relevant for this study, as it was shown that KAT2A loss led to a marked increase in KAT2B levels in undifferentiated keratinocytes. Based on the RNA-seq data at subconfluent timepoints, it can be concluded that this likely represents a compensatory mechanism, whereby nascent KAT2B rescues, to a large degree, the effects of KAT2A loss. Future work should seek to clarify if nascent KAT2B is functionally redundant with KAT2A or whether its functions are being redirected to mirror its paralogue prior to differentiation. Taking this into account, it is recommended that future studies investigating the functions of KAT2A using knockdown or knockout approaches ensure that compensatory increases in KAT2B levels are not masking the effects of KAT2A loss. Nevertheless, the expression 203 analysis data prior to differentiation conclusively demonstrates KAT2A as the predominant paralogue at this timepoint and that it functions mainly to prevent premature expression of differentiation genes. By contrast, the expression analysis data post-differentiation conclusively shows that KAT2B is the predominant paralogue at this timepoint and that it functions to promote the differentiation program. Gene set enrichment analysis posits GPCR signalling as a novel pathway through which KAT2A could function to limit the differentiation program. Since GPCR signalling has not been previously implicated in keratinocyte differentiation, it would be interesting to explore what role this pathway plays in driving the differentiation program and how it is regulated by KAT2A. DEG candidates associated with this pathway should first be validated using qPCR analysis. Moreover, future work should employ ChIP techniques to determine which DEGs identified from the RNA- seq analysis in this study are directly regulated via binding of KAT2A/KAT2B to corresponding promoter regions. This data would reveal if KAT2A and KAT2B regulate the expression of keratinocyte differentiation genes through direct or indirect mechanisms. Future work should also explore what allows KAT2A and KAT2B to have such different effects on keratinocyte differentiation given their similarities in structure and the multiprotein complexes in which they reside. I speculate that, despite these broad similarities, small differences in the protein sequence and structure of KAT2A and KAT2B outside of their HAT domain exist that allows them to recognise and/or be recruited to differential substrates and interacting proteins.

Using a series of deletion/mutant expression constructs for KAT2A, it can be concluded that KAT2A functions to repress differentiation-associated genes in keratinocytes primarily through its HAT activity, which is often enhanced by its bromodomain and N-terminus region. Based on western blot analyses for a broad panel of histone PTMs, it was determined that this HAT activity primarily targets H3K9 in keratinocytes. This analysis was limited to assessing changes in global levels of histone PTMs upon KAT2A loss. Therefore, my research does not provide information about where KAT2A-dependent H3K9ac is localised on chromatin and whether it serves a purpose in regulating the DEGs identified upon KAT2A loss. However, there is emerging evidence pointing to a role for KAT2A-dependent H3K9ac in buffering transcriptional noise as means of limiting cell fate transitions (Moris et al., 2018). This model is compatible with observations described in this study for KAT2A- depleted keratinocytes and should be considered as a potential mechanism by which KAT2A restricts the induction of the differentiation program.

Although in vitro assays suggest a role for the N-terminus domain of KAT2A in recognising nucleosomal substrates (Xu et al., 1998), the contribution of this domain to gene expression 204 was previously unexplored in mammalian cells. Here, I have shown that the N-terminus domain is essential for KAT2A to regulate some but not all its target genes, particularly the vimentin gene. Interestingly, the N-terminus domain also appears to direct proper activity of KAT2A, as it was shown that some genes, including those from the MMP family, were further dysregulated upon expression of ΔN-term-hKAT2A in KAT2A-depleted keratinocytes. Thus, this research highlights previously unexplored functions for the N- terminus domain in permitting KAT2A to properly regulate a distinct subset of genes in keratinocytes. Further work should seek to understand how the N-terminus domain of KAT2A contributes to its gene regulatory activity.

I propose that the activities of KAT2A and KAT2B are, in part, controlled by a balance in their expression levels during keratinocyte differentiation. This is inferred from experiments presented at the beginning of this dissertation that shows inverse expression patterns for KAT2A and KAT2B in immortalised and primary keratinocyte cultures upon calcium- induced differentiation and in human epidermis. Future work should aim to identify the molecular regulators and mechanisms orchestrating the switch in KAT2A and KAT2B expression upon keratinocyte differentiation. The consistency between in vitro and in vivo expression patterns for KAT2A and KAT2B emphasises the suitability of the culture system used in this study for recapitulating epidermal homeostasis. It is therefore recommended that this simple and controlled culture system be used in future studies aiming to understand keratinocyte biology at the molecular level prior to translating to more sophisticated systems (see Chapter 2.1).

In conclusion, this dissertation provides a range of experimental evidence demonstrating KAT2A and KAT2B as key regulators of keratinocyte differentiation, with the former functioning to support the undifferentiated state and the latter functioning to promote terminal differentiation (Figure 7.1). These findings reveal a distinctive gene regulatory mechanism in which keratinocytes utilise a pair of highly homologous HATs to support divergent functions in stem cell self-renewal and differentiation. Epidermal ablation of KAT2A and KAT2B should now be pursued in mice to explore the importance of these HATs in keratinocyte self-renewal and differentiation under physiological conditions.

205

Figure 7.1: Proposed model for the roles of KAT2A and KAT2B in keratinocyte differentiation. KAT2A is expressed at high levels in the basal keratinocyte nucleus (below) where its HAT activity is necessary to repress the epidermal differentiation complex (EDC) and several members of the MMP family, and to positively regulate type I interferon (IFN) signalling, vimentin, and self-renewal pathways. KAT2A may mediate these effects by acetylating H3K9 or a nuclear non-histone protein that has yet to be identified. KAT2B is expressed at low levels and has overlapping roles with KAT2A in regulating type I IFN signalling. In the nuclei of terminally differentiating keratinocytes, KAT2B is expressed at high levels and functions to promote the expression of the EDC and to repress components of the mitotic cell cycle through mechanisms that may involve acetylation of the retinoblastoma protein (Rb) and histone post-translational modifications (PTMs). KAT2A is expressed at low levels and functions to repress type I IFN signalling.

206

SUPPLEMENTARY MATERIAL

Supplementary Figure S.1: Antibody ab4441 is highly specific against histone H3 (acetyl K9). A dot blot arrayed with a panel of peptides corresponding to various histone H3 (top) and histone H4 (bottom) modifications. This dot blot shows strong specific signal for 100ng and 10ng of H3K9ac following incubation for 1 hour with anti-H3K9ac (ab4441, Rabbit polyclonal) diluted 1:5000 in 5% non-fat milk/TBST. Following incubation with a horseradish peroxidase secondary antibody, the array was finally exposed to X-ray film for 1 minute. Rabbit IgG serves as a positive control. No cross-reactivity with modifications other than the cognate peptide of the antibody is evident. 207

Supplementary Figure S.2: anti-KAT2A and anti-KAT2B do not cross react with KAT2B or KAT2A, respectively. Total protein harvested from undifferentiated (D0) and differentiated (D4) N/TERT-1 cells expressing shScr, shKAT2A#1, or shKAT2B#1 were immunoblotted with monoclonal antibodies for KAT2A (S.775.4, MA5-14884) and KAT2B (E8, sc-13124) to assess their specificity as determined by the presence of a single band and the absence of that band in the relevant knockdown cell line. Non-specific low molecular weight bands are obtained when immunoblotting with anti-KAT2B but not with anti- KAT2A. β-actin served as a loading control. kDa = kilodalton. 208

REFERENCES

Adams, J.C., Watt, F.M., 1990. “Changes in keratinocyte adhesion during terminal differentiation: reduction in fibronectin binding precedes alpha 5 beta 1 integrin loss from the cell surface.” Cell (63), 425–435. Agalioti, T., Chen, G., Thanos, D., 2002. “Deciphering the transcriptional histone acetylation code for a human gene.” Cell (111), 381–392. Ahmed, A.S.I., Sheng, M.H., Wasnik, S., Baylink, D.J., Lau, K.-H.W., 2017. “Effect of aging on stem cells.” World J Exp Med (7), 1. Ahmed, K., Dehghani, H., Rugg-Gunn, P., Fussner, E., Rossant, J., Bazett-Jones, D.P., 2010. “Global chromatin architecture reflects pluripotency and lineage commitment in the early mouse embryo.” PLoS One (5), 10531. Akhtar, A., Becker, P.B., 2000. “Activation of transcription through histone H4 acetylation by MOF, an acetyltransferase essential for dosage compensation in Drosophila.” Mol Cell (5), 367–375. Allan, J., Harborne, N., Rau, D.C., Gould, H., 1982. “Participation of core histone ‘tails’ in the stabilization of the chromatin solenoid.” J Cell Biol (93), 285–297. Allfrey, V.G., Faulkner, R., Mirsky, A.E., 1964. “Acetylation and methylation of histones and their possible roles in the regulation of RNA synthesis.” Proc Natl Acad Sci U S A (51), 786–794. Andersen, B., Schonemann, M.D., Flynn, S.E., Pearse, R. V., Singh, H., Rosenfeld, M.G.,. “Skn-1a and Skn-1i: Two functionally distinct Oct-2-related factors expressed in epidermis.” Science (260), 78–82. Andersen, B., Weinberg, W.C., Rennekampff, O., McEvilly, R.J., Bermingham, J.R., Hooshmand, F., Vasilyev, V., Hansbrough, J.F., Pittelkow, M.R., Yuspa, S.H., Rosenfeld, M.G., 1997. “Functions of the POU domain genes Skn-1a/i and Tst-1/Oct- 6/SCIP in epidermal differentiation.” Genes Dev (11), 1873–1884. Antonini, D., Sirico, A., Aberdam, E., Ambrosio, R., Campanile, C., Fagoonee, S., Altruda, F., Aberdam, D., Brissette, J.L., Missero, C., 2015. “A composite enhancer regulates p63 gene expression in epidermal morphogenesis and in keratinocyte differentiation by multiple mechanisms.” Nucleic Acids Res (43), 862–874. Arany, Z., Newsome, D., Oldread, E., Livingston, D.M., Eckner, R., 1995. “A family of transcriptional adaptor proteins targeted by the E1A oncoprotein.” Nature (374), 81– 84. Ashburner, M., Ball, C.A., Blake, J.A., Botstein, D., Butler, H., Cherry, J.M., Davis, A.P., Dolinski, K., Dwight, S.S., Eppig, J.T., Harris, M.A., Hill, D.P., Issel-Tarver, L., Kasarskis, A., Lewis, S., Matese, J.C., Richardson, J.E., Ringwald, M., Rubin, G.M., Sherlock, G., 2000. “Gene ontology: Tool for the unification of biology.” Nat Genet. (25), 25-29. Avgustinova, A., Benitah, S.A., 2016. “Epigenetic control of adult stem cell function.” Nat Rev Mol Cell Biol (17), 643–658. Avvakumov, N., Côté, J., 2007. “The MYST family of histone acetyltransferases and their intimate links to cancer.” Oncogene (26), 5395–5407.

209

Azuara, V., Perry, P., Sauer, S., Spivakov, M., Jørgensen, H.F., John, R.M., Gouti, M., Casanova, M., Warnes, G., Merkenschlager, M., Fisher, A.G., 2006. “Chromatin signatures of pluripotent cell lines.” Nat Cell Biol (8), 532–538. Bannister, A.J., Kouzarides, T., 1996. “The CBP co-activator is a histone acetyltransferase.” Nature (384), 641–643. Bararia, D., Kwok, H.S., Welner, R.S., Numata, A., Sárosi, M.B., Yang, H., Wee, S., Tschuri, S., Ray, D., Weigert, O., Levantini, E., Ebralidze, A.K., Gunaratne, J., Tenen, D.G., 2016. “Acetylation of C/EBPα inhibits its granulopoietic function.” Nat Commun (7), 10968. Barrandon, Y., Green, H., 1987. “Three clonal types of keratinocyte with different capacities for multiplication.” Proc Natl Acad Sci U S A (84), 2302–2306. Beck, I.M., Müller, M., Mentlein, R., Sadowski, T., Mueller, M.S., Paus, R., Sedlacek, R., 2007. “Matrix metalloproteinase-19 expression in keratinocytes is repressed by transcription factors Tst-1 and Skn-1a: implications for keratinocyte differentiation.” J Invest Dermatol (127), 1107–1114. Behrens, D.T., Villone, D., Koch, M., Brunner, G., Sorokin, L., Robenek, H., Bruckner- Tuderman, L., Bruckner, P., Hansen, U., 2012. “The Epidermal Basement Membrane Is a Composite of Separate Laminin- or Collagen IV-containing Networks Connected by Aggregated Perlecan, but Not by Nidogens.” J Biol Chem (287), 18700–18709. Bernstein, B.E., Humphrey, E.L., Erlich, R.L., Schneider, R., Bouman, P., Liu, J.S., Kouzarides, T., Schreiber, S.L., 2002. “Methylation of histone H3 Lys 4 in coding regions of active genes.” Proc Natl Acad Sci (99), 8695–8700. Bhanu, N. V., Sidoli, S., Garcia, B.A., 2016. “Histone modification profiling reveals differential signatures associated with human embryonic stem cell self-renewal and differentiation.” Proteomics (16), 448–458. Bian, C., Xu, C., Ruan, J., Lee, K.K., Burke, T.L., Tempel, W., Barsyte, D., Li, J., Wu, M., Zhou, B.O., Fleharty, B.E., Paulson, A., Allali-Hassani, A., Zhou, J.-Q., Mer, G., Grant, P.A., Workman, J.L., Zang, J., Min, J., 2011. “Sgf29 binds histone H3K4me2/3 and is required for SAGA complex recruitment and histone H3 acetylation.” EMBO J (30), 2829–2842. Bickenbach, J.R., 1981. “Identification and Behavior of Label-retaining Cells in Oral Mucosa and Skin.” J Dent Res (60), 1611–1620. Biddle, D., Spandau, D.F., 1996. “Expression of vimentin in cultured human keratinocytes is associated with cell - extracellular matrix junctions.” Arch Dermatol Res (288), 621– 624. Bidon, B., Iltis, I., Semer, M., Nagy, Z., Larnicol, A., Cribier, A., Benkirane, M., Coin, F., Egly, J.-M., Le May, N., 2018. “XPC is an RNA polymerase II cofactor recruiting ATAC to promoters by interacting with E2F1.” Nat Commun (9), 2610. Bikle, D.D., Xie, Z., Tu, C.L., 2012. “Calcium regulation of keratinocyte differentiation.” Expert Rev Endocrinol Metab (7), 461-472. Biteau, B., Hochmuth, C.E., Jasper, H., 2011. “Maintaining tissue homeostasis: Dynamic control of somatic stem cell activity.” Cell Stem Cell (9), 402-411. Blanco-García, N., Asensio-Juan, E., de la Cruz, X., Martínez-Balbás, M.A., 2009. “Autoacetylation regulates P/CAF nuclear localization.” J Biol Chem (284), 1343– 1352. 210

Blanpain, C., Fuchs, E., 2009. “Epidermal homeostasis: a balancing act of stem cells in the skin.” Nat Rev Mol Cell Biol (10), 207–217. Blanpain, C., Lowry, W.E., Pasolli, H.A., Fuchs, E., 2006. “Canonical notch signaling functions as a commitment switch in the epidermal lineage.” Genes Dev (20), 3022– 3035. Bongiovanni, L., D’Andrea, A., Romanucci, M., Malatesta, D., Candolini, M., Salda, L.D., Mechelli, L., Sforna, M., Brachelente, C., 2013. “Epithelial-to-mesenchymal transition: immunohistochemical investigation of related molecules in canine cutaneous epithelial tumours.” Vet Dermatol (24), 195-203. Bordoli, L., Netsch, M., Lüthi, U., Lutz, W., Eckner, R., 2001. “Plant orthologs of p300/CBP: conservation of a core domain in metazoan p300/CBP acetyltransferase- related proteins.” Nucleic Acids Res (29), 589–597. Borowiec, A.-S., Delcourt, P., Dewailly, E., Bidaux, G., 2013. “Optimal Differentiation of In Vitro Keratinocytes Requires Multifactorial External Control.” PLoS One (8), 77507. Botchkarev, V.A., 2015. “Epigenetic Regulation of Epidermal Development and Keratinocyte Differentiation.” J Invest Dermatol (17), 18–19. Boyce, S.T., Ham, R.G., 1983. “Calcium-Regulated Differentiation of Normal Human Epidermal Keratinocytes in Chemically Defined Clonal Culture and Serum-Free Serial Culture.” J Invest Dermatol (81), 33–40. Boyce, S.T., Ham, R.G., 1985. “Cultivation, frozen storage, and clonal growth of normal human epidermal keratinocytes in serum-free media.” J Tissue Cult Methods (9), 83– 93. Brand, M., Yamamoto, K., Staub, A., Tora, L., 1999. “Identification of TATA-binding protein-free TAFII-containing complex subunits suggests a role in nucleosome acetylation and signal transduction.” J Biol Chem (274), 18285–18289. Brower-Toland, B., Wacker, D.A., Fulbright, R.M., Lis, J.T., Kraus, W.L., Wang, M.D., 2005. “Specific Contributions of Histone Tails and their Acetylation to the Mechanical Stability of Nucleosomes.” J Mol Biol (346), 135–146. Brown, K., Chen, Y., Underhill, T.M., Mymryk, J.S., Torchia, J., 2003. “The coactivator p/CIP/SRC-3 facilitates retinoic acid receptor signaling via recruitment of GCN5.” J Biol Chem (278), 39402–39412. Brownell, J.E., Zhou, J., Ranalli, T., Kobayashi, R., Edmondson, D.G., Roth, S.Y., Allis, C.D., 1996. “Tetrahymena histone acetyltransferase A: A homolog to yeast Gcn5p linking histone acetylation to gene activation.” Cell (84), 843–851. Bu, P., Evrard, Y.A., Lozano, G., Dent, S.Y.R., 2007. “Loss of Gcn5 Acetyltransferase Activity Leads to Neural Tube Closure Defects and Exencephaly in Mouse Embryos.” Mol Cell Biol (27), 3405–3416. Budel, L., Djabali, K., 2017. “Rapid isolation and expansion of skin-derived precursor cells from human primary fibroblast cultures.” Biol Open (6), 1745–1755. Cabral, A., Fischer, D.F., Vermeij, W.P., Backendorf, C., 2003. “Distinct Functional Interactions of Human Skn-1 Isoforms with Ese-1 during Keratinocyte Terminal Differentiation.” J Biol Chem (278), 17792–17799.

211

Candi, E., Schmidt, R., Melino, G., 2005. “The cornified envelope: a model of cell death in the skin.” Nat Rev Mol Cell Biol (6), 328–340. Cangkrama, M., Darido, C., Georgy, S.R., Partridge, D., Auden, A., Srivastava, S., Wilanowski, T., Jane, S.M., 2016. “Two Ancient Gene Families Are Critical for Maintenance of the Mammalian Skin Barrier in Postnatal Life.” J Invest Dermatol (136), 1438–1448. Carre, C., Szymczak, D., Pidoux, J., Antoniewski, C., 2005. “The Histone H3 Acetylase dGcn5 Is a Key Player in Drosophila melanogaster Metamorphosis.” Mol Cell Biol (25), 8228–8238. Carroll, D.K., Carroll, J.S., Leong, C.-O., Cheng, F., Brown, M., Mills, A.A., Brugge, J.S., Ellisen, L.W., 2006. “p63 regulates an adhesion programme and cell survival in epithelial cells.” Nat Cell Biol (8), 551–561. Castro-Muñozledo, F., Velez-DelValle, C., Marsch-Moreno, M., Hernández-Quintero, M., Kuri-Harcuch, W., 2015. “Vimentin is necessary for colony growth of human diploid keratinocytes.” Histochem Cell Biol (143), 45–57. Cavazza, A., Miccio, A., Romano, O., Petiti, L., Malagoli Tagliazucchi, G., Peano, C., Severgnini, M., Rizzi, E., De Bellis, G., Bicciato, S., Mavilio, F., 2016. “Dynamic Transcriptional and Epigenetic Regulation of Human Epidermal Keratinocyte Differentiation.” Stem cell reports (6), 618–632. Chakrabarti, R., Wei, Y., Hwang, J., Hang, X., Andres Blanco, M., Choudhury, A., Tiede, B., Romano, R.-A., DeCoste, C., Mercatali, L., Ibrahim, T., Amadori, D., Kannan, N., Eaves, C.J., Sinha, S., Kang, Y., 2014. “ΔNp63 promotes stem cell activity in mammary gland development and basal-like breast cancer by enhancing Fzd7 expression and Wnt signalling.” Nat Cell Biol (16), 1004–1015. Chan, H.M., Krstic-Demonacos, M., Smith, L., Demonacos, C., Thangue, N.B. La, 2001. “Acetylation control of the retinoblastoma tumour-suppressor protein.” Nat Cell Biol (3), 667–674. Chan, H.M., La Thangue, N.B., 2001. “p300/CBP proteins: HATs for transcriptional bridges and scaffolds.” J Cell Sci (114), 2363–2373. Chang, L., Takada, S., 2016. “Histone acetylation dependent energy landscapes in tri- nucleosome revealed by residue-resolved molecular simulations.” Sci Rep (6), 34441. Chen, L., Wei, T., Si, X., Wang, Q., Li, Y., Leng, Y., Deng, A., Chen, J., Wang, G., Zhu, S., Kang, J., 2013. “Lysine Acetyltransferase GCN5 Potentiates the Growth of Non-small Cell Lung Cancer via Promotion of E2F1, Cyclin D1, and Cyclin E1 Expression.” J Biol Chem (288), 14510–14521. Chen, Y.-G., Ezhkova, E., Ostankovitch, M., 2016. “Molecular Mechanisms Regulating Stem Cells Fate.” J Mol Biol (428), 1407–1408. Cheng, F., Shen, Y., Mohanasundaram, P., Lindström, M., Ivaska, J., Ny, T., Eriksson, J.E., 2016. “Vimentin coordinates fibroblast proliferation and keratinocyte differentiation in wound healing via TGF-β-Slug signaling.” Proc Natl Acad Sci U S A (113), 4320-4327. Chikh, A., Matin, R.N.H., Senatore, V., Hufbauer, M., Lavery, D., Raimondi, C., Ostano, P., Mello-Grand, M., Ghimenti, C., Bahta, A., Khalaf, S., Akgül, B., Braun, K.M., Chiorino, G., Philpott, M.P., Harwood, C.A., Bergamaschi, D., 2011. “iASPP/p63 autoregulatory feedback loop is required for the homeostasis of stratified epithelia.” EMBO J (30), 4261–4273. 212

Cieniewicz, A.M., Moreland, L., Ringel, A.E., Mackintosh, S.G., Raman, A., Gilbert, T.M., Wolberger, C., Tackett, A.J., Taverna, S.D., 2014. “The Bromodomain of Gcn5 Regulates Site Specificity of Lysine Acetylation on Histone H3.” Mol Cell Proteomics (13), 2896–2910. Clayton, A.L., Hebbes, T.R., Thorne, A.W., Crane-Robinson, C., 1993. “Histone acetylation and gene induction in human cells.” FEBS Lett (336), 23–26. Clayton, E., Doupé, D.P., Klein, A.M., Winton, D.J., Simons, B.D., Jones, P.H., 2007. “A single type of progenitor cell maintains normal epidermis.” Nature (446), 185–189. Clements, A., Rojas, J.R., Trievel, R.C., Wang, L., Berger, S.L., Marmorstein, R., 1999. “Crystal structure of the histone acetyltransferase domain of the human PCAF transcriptional regulator bound to coenzyme A.” EMBO J (18), 3521–3532. Clouaire, T., Rocher, V., Lashgari, A., Arnould, C., Aguirrebengoa, M., Biernacka, A., Skrzypczak, M., Aymard, F., Fongang, B., Dojer, N., Iacovoni, J.S., Rowicka, M., Ginalski, K., Côté, J., Legube, G., 2018. “Comprehensive Mapping of Histone Modifications at DNA Double-Strand Breaks Deciphers Repair Pathway Chromatin Signatures.” Mol Cell (72), 250-262. Collins, H.M., Kindle, K.B., Matsuda, S., Ryan, C., Troke, P.J.F., Kalkhoven, E., Heery, D.M., 2006. “MOZ-TIF2 Alters Cofactor Recruitment and Histone Modification at the RARβ2 Promoter.” J Biol Chem (281), 17124–17133. Connelly, J.T., Mishra, A., Gautrot, J.E., Watt, F.M., 2011. “Shape-induced terminal differentiation of human epidermal stem cells requires p38 and is regulated by histone acetylation.” PLoS One (6), 27259. Contzler, R., Regamey, A., Favre, B., Roger, T., Hohl, D., Huber, M., 2006. “Histone acetyltransferase HBO1 inhibits NF-κB activity by coactivator sequestration.” Biochem Biophys Res Commun (350), 208–213. Creyghton, M.P., Cheng, A.W., Welstead, G.G., Kooistra, T., Carey, B.W., Steine, E.J., Hanna, J., Lodato, M.A., Frampton, G.M., Sharp, P.A., Boyer, L.A., Young, R.A., Jaenisch, R., 2010. “Histone H3K27ac separates active from poised enhancers and predicts developmental state.” Proc Natl Acad Sci (107), 21931–21936. Cui, K., Zang, C., Roh, T.-Y., Schones, D.E., Childs, R.W., Peng, W., Zhao, K., 2009. “Chromatin Signatures in Multipotent Human Hematopoietic Stem Cells Indicate the Fate of Bivalent Genes during Differentiation.” Cell Stem Cell (4), 80–93. Currie, R.A., 1998. “NF-Y is associated with the histone acetyltransferases GCN5 and P/CAF.” J Biol Chem (273), 1430–1434. Dainichi, T., Hanakawa, S., Kabashima, K., 2014. “Classification of inflammatory skin diseases: A proposal based on the disorders of the three-layered defense systems, barrier, innate immunity and acquired immunity.” J Dermatol Sci (76), 81–89. Davey, C.A., Sargent, D.F., Luger, K., Maeder, A.W., Richmond, T.J., 2002. “Solvent mediated interactions in the structure of the nucleosome core particle at 1.9 a resolution.” J Mol Biol (319), 1097–1113. de Guzman Strong, C., Wertz, P.W., Wang, C., Yang, F., Meltzer, P.S., Andl, T., Millar, S.E., Ho, I.-C., Pai, S.-Y., Segre, J.A., 2006. “Lipid defect underlies selective skin barrier impairment of an epidermal-specific deletion of Gata-3.” J Cell Biol (175), 661– 670.

213

De Leo, V.A., Horlick, H., Hanson, D., Eisinger, M., Harber, L.C., 1984. “Ultraviolet Radiation Induces Changes in Membrane Metabolism of Human Keratinocytes in Culture.” J Invest Dermatol (83), 323–326. Dhalluin, C., Carlson, J.E., Zeng, L., He, C., Aggarwal, A.K., Zhou, M.-M., Zhou, M.-M., 1999. “Structure and ligand of a histone acetyltransferase bromodomain.” Nature (399), 491–496. Dhawan, J., Laxman, S., 2015. “Decoding the stem cell quiescence cycle - lessons from yeast for regenerative biology.” J Cell Sci (128), 4467–4474. Di-Poï, N., Desvergne, B., Michalik, L., Wahli, W., 2005. “Transcriptional Repression of Peroxisome Proliferator-activated Receptor β/δ in Murine Keratinocytes by CCAAT/Enhancer-binding Proteins.” J Biol Chem (280), 38700–38710. Dicker, A.J., Popa, C., Dahler, A.L., Serewko, M.M., Hilditch-Maguire, P.A., Frazer, I.H., Saunders, N.A., 2000. “E2F-1 induces proliferation-specific genes and suppresses squamous differentiation-specific genes in human epidermal keratinocytes.” Oncogene (19), 2887–2894. Dickson, M.A., Hahn, W.C., Ino, Y., Ronfard, V., Wu, J.Y., Weinberg, R.A., Louis, D.N., Li, F.P., Rheinwald, J.G., 2000. “Human keratinocytes that express hTERT and also bypass a p16(INK4a)-enforced mechanism that limits life span become immortal yet retain normal growth and differentiation characteristics.” Mol Cell Biol (20), 1436– 1447. Dilworth, F.J., Seaver, K.J., Fishburn, A.L., Htet, S.L., Tapscott, S.J., 2004. “In vitro transcription system delineates the distinct roles of the coactivators pCAF and p300 during MyoD/E47-dependent transactivation.” Proc Natl Acad Sci (101), 11593– 11598. Dlugosz, A.A., Yuspa, S.H., 1993. “Coordinate changes in gene expression which mark the spinous to granular cell transition in epidermis are regulated by protein kinase C.” J Cell Biol (120), 217–225. Domingues, A.F., Kulkarni, R., Giotopoulos, G., Gupta, S., Tan, S., Foerner, E., Adao, R.R., Zeka, K., Huntly, B.J., Prabakaran, S., Pina, C., 2018. “Loss of Kat2A Enhances Transcriptional Noise and Depletes Acute Myeloid Leukemia Stem-Like Cells.” bioRxiv 446096. Domingues, A.F., Kulkarni, R., Giotopoulos, G., Huntly, B.J.., Prabakaran, S., Pina, C., 2017. “Histone Acetyl-Transferase Kat2a Regulates Transcriptional Heterogeneity and Impacts Self-Renewal of Acute Myeloid Leukemia Cells in a Disease-Specific Manner.” Blood (130), 2486. Dorigo, B., Schalch, T., Bystricky, K., Richmond, T.J., 2003. “Chromatin fiber folding: requirement for the histone H4 N-terminal tail.” J Mol Biol (327), 85–96. Driskell, I., Oda, H., Blanco, S., Nascimento, E., Humphreys, P., Frye, M., 2012. “The histone methyltransferase Setd8 acts in concert with c-Myc and is required to maintain skin.” EMBO J (31), 616–629. Duclot, F., Jacquet, C., Gongora, C., Maurice, T., 2010. “Alteration of working memory but not in anxiety or stress response in p300/CBP associated factor (PCAF) histone acetylase knockout mice bred on a C57BL/6 background.” Neurosci Lett (475), 179– 183.

214

Eckhart, L., Lippens, S., Tschachler, E., Declercq, W., 2013. “Cell death by cornification.” Biochim Biophys Acta - Mol Cell Res (1833), 3471–3480. Egeblad, M., Werb, Z., 2002. “New functions for the matrix metalloproteinases in cancer progression.” Nat Rev Cancer (2), 161–174. Egelhofer, T.A., Minoda, A., Klugman, S., Lee, K., Kolasinska-Zwierz, P., Alekseyenko, A.A., Cheung, M.-S., Day, D.S., Gadel, S., Gorchakov, A.A., Gu, T., Kharchenko, P. V, Kuan, S., Latorre, I., Linder-Basso, D., Luu, Y., Ngo, Q., Perry, M., Rechtsteiner, A., Riddle, N.C., Schwartz, Y.B., Shanower, G.A., Vielle, A., Ahringer, J., Elgin, S.C.R., Kuroda, M.I., Pirrotta, V., Ren, B., Strome, S., Park, P.J., Karpen, G.H., Hawkins, R.D., Lieb, J.D., 2011. “An assessment of histone-modification antibody quality.” Nat Struct Mol Biol (18), 91–93. Eissenberg, J.C., 2012. “Structural biology of the chromodomain: Form and function.” Gene (496), 69–78. Elias, P.M., Brown, B.E., Crumrine, D., Feingold, K.R., Ahn, S.K., 2002. “Origin of the Epidermal Calcium Gradient: Regulation by Barrier Status and Role of Active vs Passive Mechanisms.” J Invest Dermatol (119), 1269–1274. Fauquier, L., Azzag, K., Parra, M.A.M., Quillien, A., Boulet, M., Diouf, S., Carnac, G., Waltzer, L., Gronemeyer, H., Vandel, L., 2018. “CBP and P300 regulate distinct gene networks required for human primary myoblast differentiation and muscle integrity.” Sci Rep (8), 12629. Favier, B., Fliniaux, I., Thélu, J., Viallet, J.P., Demarchez, M., Jahoda, C.A.B., Dhouailly, D., 2000. “Localisation of members of the notch system and the differentiation of vibrissa hair follicles: Receptors, ligands, and fringe modulators.” Dev Dyn (218), 426– 437. Fei, H.-J., Zu, L.-D., Wu, J., Jiang, X.-S., Wang, J.-L., Chin, Y.E., Fu, G.-H., 2016. “PCAF acts as a gastric cancer suppressor through a novel PCAF-p16-CDK4 axis.” Am J Cancer Res (6), 2772–2786. Fessing, M.Y., Mardaryev, A.N., Gdula, M.R., Sharov, A.A., Sharova, T.Y., Rapisarda, V., Gordon, K.B., Smorodchenko, A.D., Poterlowicz, K., Ferone, G., Kohwi, Y., Missero, C., Kohwi-Shigematsu, T., Botchkarev, V.A., 2011. “p63 regulates Satb1 to control tissue-specific chromatin remodeling during development of the epidermis.” J Cell Biol (194), 825–839. Fisher, C.L., Fisher, A.G., 2011. “Chromatin states in pluripotent, differentiated, and reprogrammed cells.” Curr Opin Genet Dev (21), 140–146. Ford, E., Thanos, D., 2010. “The transcriptional code of human IFN-β gene expression.” Biochim Biophys Acta - Gene Regul Mech (1799), 328–336. Fournier, M., Orpinell, M., Grauffel, C., Scheer, E., Garnier, J.-M., Ye, T., Chavant, V., Joint, M., Esashi, F., Dejaegere, A., Gönczy, P., Tora, L., 2016. “KAT2A/KAT2B- targeted acetylome reveals a role for PLK4 acetylation in preventing centrosome amplification.” Nat Commun (7), 13227. Franke, W.W., Schmid, E., Breitkreutz, D., Lüder, M., Boukamp, P., Fusenig, N.E., Osborn, M., Weber, K., 1979a. “Simultaneous expression of two different types of intermediate sized filaments in mouse keratinocytes proliferating in vitro.” Differentiation (14), 35– 50.

215

Franke, W.W., Schmid, E., Winter, S., Osborn, M., Weber, K., 1979b. “Widespread occurrence of intermediate-sized filaments of the vimentin-type in cultured cells from diverse vertebrates.” Exp Cell Res (123), 25–46. Frye, M., Fisher, A.G., Watt, F.M., 2007. “Epidermal Stem Cells Are Defined by Global Histone Modifications that Are Altered by Myc-Induced Differentiation.” PLoS One (2), 763. Fuchs, E., Green, H., 1980. “Changes in keratin gene expression during terminal differentiation of the keratinocyte.” Cell (19), 1033–1042. Gagnon, K.T., Li, L., Janowski, B.A., Corey, D.R., 2014. “Analysis of nuclear RNA interference in human cells by subcellular fractionation and Argonaute loading.” Nat Protoc (9), 2045–2060. Gamper, A.M., Kim, J., Roeder, R.G., 2009. “The STAGA Subunit ADA2b Is an Important Regulator of Human GCN5 Catalysis.” Mol Cell Biol (29), 266–280. Gao, B., Kong, Q., Zhang, Y., Yun, C., Dent, S.Y.R., Song, J., Zhang, D.D., Wang, Y., Li, X., Fang, D., 2017a. “The Histone Acetyltransferase Gcn5 Positively Regulates T Cell Activation.” J Immunol (198), 3927–3938. Gates, L.A., Shi, J., Rohira, A.D., Feng, Q., Zhu, B., Bedford, M.T., Sagum, C.A., Jung, S.Y., Qin, J., Tsai, M.-J., Tsai, S.Y., Li, W., Foulds, C.E., O’Malley, B.W., 2017. “Acetylation on histone H3 lysine 9 mediates a switch from transcription initiation to elongation.” J Biol Chem (292), 14456–14472. Gatta, R., Mantovani, R., 2010. “Single nucleosome ChIPs identify an extensive switch of acetyl marks on cell cycle promoters.” Cell Cycle (9), 2149–2159. Génin, P., Lin, R., Hiscott, J., Civas, A., 2012. “Recruitment of Histone Deacetylase 3 to the Interferon-A Gene Promoters Attenuates Interferon Expression.” PLoS One (7), 38336. Georgakopoulos, T., Thireos, G., 1992. “Two distinct yeast transcriptional activators require the function of the GCN5 protein to promote normal levels of transcription.” EMBO J (11), 4145–4152. Ghosh, T.K., Aparicio-Sánchez, J.J., Buxton, S., Ketley, A., Mohamed, T., Rutland, C.S., Loughna, S., Brook, J.D., 2018. “Acetylation of TBX5 by KAT2B and KAT2A regulates heart and limb development.” J Mol Cell Cardiol (114), 185–198. Gonzales-Cope, M., Sidoli, S., Bhanu, N. V., Won, K.J., Garcia, B.A., 2016. “Histone H4 acetylation and the epigenetic reader Brd4 are critical regulators of pluripotency in embryonic stem cells.” BMC Genomics (17), 95. Goodman, R.H., Smolik, S., 2000. “CBP/p300 in cell growth, transformation, and development.” Genes Dev (14), 1553–77. Gorrini, C., Squatrito, M., Luise, C., Syed, N., Perna, D., Wark, L., Martinato, F., Sardella, D., Verrecchia, A., Bennett, S., Confalonieri, S., Cesaroni, M., Marchesi, F., Gasco, M., Scanziani, E., Capra, M., Mai, S., Nuciforo, P., Crook, T., Lough, J., Amati, B., 2007. “Tip60 is a haplo-insufficient tumour suppressor required for an oncogene- induced DNA damage response.” Nature (448), 1063–1067. Goswami, R., Kaplan, M.H., 2012. “Gcn5 Is Required for PU.1-Dependent IL-9 Induction in Th9 Cells.” J Immunol (189), 3026–3033.

216

Grant, P.A., Schieltz, D., Pray-Grant, M.G., Steger, D.J., Reese, J.C., Yates, J.R., Workman, J.L., 1998. “A subset of TAF(II)s are integral components of the SAGA complex required for nucleosome acetylation and transcriptional stimulation.” Cell (94), 45–53. Graziano, V., Gerchman, S.E., Schneider, D.K., Ramakrishnan, V., 1994. “Histone H1 is located in the interior of the chromatin 30-nm filament.” Nature (368), 351–354. Green, H., 1978. “Cyclic AMP in relation to proliferation of the Epidermal cell: a new view.” Cell (15), 801–811. Green, H., Kehinde, O., Thomas, J., 1979. “Growth of cultured human epidermal cells into multiple epithelia suitable for grafting.” Proc Natl Acad Sci U S A (76), 5665–5668. Greer, C.B., Tanaka, Y., Kim, Y.J., Xie, P., Zhang, M.Q., Park, I.-H., Kim, T.H., 2015. “Histone Deacetylases Positively Regulate Transcription through the Elongation Machinery.” Cell Rep (13), 1444–1455. Gregoire, S., Xiao, L., Nie, J., Zhang, X., Xu, M., Li, J., Wong, J., Seto, E., Yang, X.-J., 2007. “Histone Deacetylase 3 Interacts with and Deacetylates Myocyte Enhancer Factor 2.” Mol Cell Biol (27), 1280–1295. Guelman, S., Kozuka, K., Mao, Y., Pham, V., Solloway, M.J., Wang, J., Wu, J., Lill, J.R., Zha, J., 2009. “The double-histone-acetyltransferase complex ATAC is essential for mammalian development.” Mol Cell Biol (29), 1176–88. Gupta, A., Guerin-Peyrou, T.G., Sharma, G.G., Park, C., Agarwal, M., Ganju, R.K., Pandita, S., Choi, K., Sukumar, S., Pandita, R.K., Ludwig, T., Pandita, T.K., 2008. “The Mammalian Ortholog of Drosophila MOF That Acetylates Histone H4 Lysine 16 Is Essential for Embryogenesis and Oncogenesis.” Mol Cell Biol (28), 397–409. Haftek, M., 2015. “Epidermal barrier disorders and corneodesmosome defects.” Cell Tissue Res (360), 483–490. Han, B., Rorke, E.A., Adhikary, G., Chew, Y.C., Xu, W., Eckert, R.L., 2012. “Suppression of AP1 transcription factor function in keratinocyte suppresses differentiation.” PLoS One (7), 36941. Han, J., Li, Q., Zhou, H., Zhang, Z., 2013. “Histone modifications regulate DNA replication coupled nucleosome assembly.” Epigenetics Chromatin (6), O3. Handfield, C., Kwock, J., MacLeod, A.S., 2018. “Innate Antiviral Immunity in the Skin.” Trends Immunol (39), 328–340. Hasebe, Y., Hasegawa, S., Date, Y., Ogata, Y., Nakata, S., Iwata, Y., Yagami, A., Sugiura, K., Akamatsu, H., 2017. “The role of collagen type 5 in the dermal stem cell niche.” J Dermatol Sci (86), 58. Hassan, A.H., Neely, K.E., Workman, J.L., 2001. “Histone Acetyltransferase Complexes Stabilize SWI/SNF Binding to Promoter Nucleosomes tion of SWI/SNF in the remodeling of the chromatin” Cell (104), 817-827. Hattori, N., Mochizuki, S., Kishi, K., Nakajima, T., Takaishi, H., D’Armiento, J., Okada, Y., 2009. “MMP-13 Plays a Role in Keratinocyte Migration, Angiogenesis, and Contraction in Mouse Skin Wound Healing.” Am J Pathol (175), 533–546. Hattori, N, Nishino, K., Ko, Y.G., Hattori, Naka, Ohgane, J., Tanaka, S., Shiota, K., 2004. “Epigenetic Control of Mouse Oct-4 Gene Expression in Embryonic Stem Cells and Trophoblast Stem Cells.” J Biol Chem (279), 17063–17069.

217

Hawkes, N.A., Otero, G., Winkler, G.S., Marshall, N., Dahmus, M.E., Krappmann, D., Scheidereit, C., Thomas, C.L., Schiavo, G., Erdjument-Bromage, H., Tempst, P., Svejstrup, J.Q., 2002. “Purification and characterization of the human elongator complex.” J Biol Chem (277), 3047–3052. Hawkins, R.D., Hon, G.C., Lee, L.K., Ngo, Q., Lister, R., Pelizzola, M., Edsall, L.E., Kuan, S., Luu, Y., Klugman, S., Antosiewicz-Bourget, J., Ye, Z., Espinoza, C., Agarwahl, S., Shen, L., Ruotti, V., Wang, W., Stewart, R., Thomson, J.A., Ecker, J.R., Ren, B., 2010. “Distinct Epigenomic Landscapes of Pluripotent and Lineage-Committed Human Cells.” Cell Stem Cell (6), 479–491. Hirsch, C.L., Coban Akdemir, Z., Wang, L., Jayakumaran, G., Trcka, D., Weiss, A., Hernandez, J.J., Pan, Q., Han, H., Xu, X., Xia, Z., Salinger, A.P., Wilson, M., Vizeacoumar, F., Datti, A., Li, W., Cooney, A.J., Barton, M.C., Blencowe, B.J., Wrana, J.L., Dent, S.Y.R., 2015. “Myc and SAGA rewire an alternative splicing network during early somatic cell reprogramming.” Genes Dev (29), 803–816. Holstege, F.C., Jennings, E.G., Wyrick, J.J., Lee, T.I., Hengartner, C.J., Green, M.R., Golub, T.R., Lander, E.S., Young, R.A., 1998. “Dissecting the regulatory circuitry of a eukaryotic genome.” Cell (95), 717–728. Hoot, K.E., Lighthall, J., Han, G., Lu, S.-L., Li, A., Ju, W., Kulesz-Martin, M., Bottinger, E., Wang, X.-J., 2008. “Keratinocyte-specific Smad2 ablation results in increased epithelial-mesenchymal transition during skin cancer formation and progression.” J Clin Invest (118), 2722–2732. Hotchin, N.A., Watt, F.M., 1992. “Transcriptional and post-translational regulation of beta 1 integrin expression during keratinocyte terminal differentiation.” J Biol Chem (267), 14852–14858. Hu, Y., Fisher, J.B., Koprowski, S., McAllister, D., Kim, M.-S., Lough, J., 2009. “Homozygous disruption of the Tip60 gene causes early embryonic lethality.” Dev Dyn (238), 2912–2921. Huang, C., Xu, M., Zhu, B., 2013. “Epigenetic inheritance mediated by histone lysine methylation: maintaining transcriptional states without the precise restoration of marks?” Philos Trans R Soc Lond B Biol Sci (368), 20110332. Hudson, B.P., Martinez-Yamout, M.A., Dyson, H.J., Wright, P.E., 2000. “Solution structure and acetyl-lysine binding activity of the GCN5 bromodomain.” J Mol Biol (304), 355– 370. Jacob, A.L., Lund, J., Martinez, P., Hedin, L., 2001. “Acetylation of steroidogenic factor 1 protein regulates its transcriptional activity and recruits the coactivator GCN5.” J Biol Chem (276), 37659–37664. Jang, S.-I., Steinert, P.M., 2002. “Loricrin Expression in Cultured Human Keratinocytes Is Controlled by a Complex Interplay between Transcription Factors of the Sp1, CREB, AP1, and AP2 Families.” J Biol Chem (277), 42268–42279. Jeitany, M., Bakhos-Douaihy, D., Silvestre, D.C., Pineda, J.R., Ugolin, N., Moussa, A., Gauthier, L.R., Busso, D., Junier, M.-P., Chneiweiss, H., Chevillard, S., Desmaze, C., Boussin, F.D., 2017. “Opposite effects of GCN5 and PCAF knockdowns on the alternative mechanism of telomere maintenance.” Oncotarget (8), 26269-26280.

218

Jenuwein, T., Allis, C.D., 2001. “Translating the Histone Code.” Science (293), 1074–1080. Jin, Q., Yu, L.-R., Wang, L., Zhang, Z., Kasper, L.H., Lee, J.-E., Wang, C., Brindle, P.K., Dent, S.Y.R., Ge, K., 2011. “Distinct roles of GCN5/PCAF-mediated H3K9ac and CBP/p300-mediated H3K18/27ac in nuclear receptor transactivation.” EMBO J (30), 249–262. Jin, Q., Zhuang, L., Lai, B., Wang, C., Li, W., Dolan, B., Lu, Y., Wang, Z., Zhao, K., Peng, W., Dent, S.Y., Ge, K., 2014. “Gcn5 and PCAF negatively regulate interferon- production through HAT-independent inhibition of TBK1.” EMBO Rep (15), 1192–1201. Johnson, L.R., Johnson, T.K., Desler, M., Luster, T.A., Nowling, T., Lewis, R.E., Rizzino, A., 2002. “Effects of B-Myb on Gene Transcription.” J Biol Chem (277), 4088–4097. Jones, S.J., Dicker, A.J., Dahler, A.L., Saunders, N.A., 1997. “E2F as a Regulator of Keratinocyte Proliferation: Implications for Skin Tumor Development.” J Invest Dermatol (109), 187–193. Kan, P.-Y., Caterino, T.L., Hayes, J.J., 2009. “The H4 tail domain participates in intra- and internucleosome interactions with protein and DNA during folding and oligomerization of nucleosome arrays.” Mol Cell Biol (29), 538–546. Kan, P.-Y., Lu, X., Hansen, J.C., Hayes, J.J., 2007. “The H3 tail domain participates in multiple interactions during folding and self-association of nucleosome arrays.” Mol Cell Biol (27), 2084–2091. Karam, C.S., Kellner, W.A., Takenaka, N., Clemmons, A.W., Corces, V.G., 2010. “14-3-3 Mediates Histone Cross-Talk during Transcription Elongation in Drosophila.” PLoS Genet (6), 1000975. Karnavas, T., Pintonello, L., Agresti, A., Bianchi, M.E., 2014. “Histone content increases in differentiating embryonic stem cells.” Front Physiol (5), 330. Kasper, L.H., Lerach, S., Wang, J., Wu, S., Jeevan, T., Brindle, P.K., 2010. “CBP/p300 double null cells reveal effect of coactivator level and diversity on CREB transactivation.” EMBO J (29), 3660–3672. Kaur, P., 2006. “Interfollicular Epidermal Stem Cells: Identification, Challenges, Potential.” J Invest Dermatol (126), 1450–1458. Kawabata, H., Kawahara, K., Kanekura, T., Araya, N., Daitoku, H., Hatta, M., Miura, N., Fukamizu, A., Kanzaki, T., Maruyama, I., Nakajima, T., 2002. “Possible role of transcriptional coactivator P/CAF and nuclear acetylation in calcium-induced keratinocyte differentiation.” J Biol Chem (277), 8099–8105. Kershaw, E.E., Flier, J.S., 2004. “Adipose tissue as an endocrine organ.” J Clin Endocrinol Metab (89), 2548–2556. Kikuchi, H., Takami, Y., Nakayama, T., 2005. “GCN5: a supervisor in all-inclusive control of vertebrate cell cycle progression through transcription regulation of various cell cycle-related genes.” Gene (347), 83–97. Kim, S., Choi, I.F., Quante, J.R., Zhang, L., Roop, D.R., Koster, M.I., 2009. “p63 directly induces expression of Alox12, a regulator of epidermal barrier formation.” Exp Dermatol (18), 1016–1021.

219

Kim, Y.J., Greer, C.B., Cecchini, K.R., Harris, L.N., Tuck, D.P., Kim, T.H., 2013. “HDAC inhibitors induce transcriptional repression of high copy number genes in breast cancer through elongation blockade.” Oncogene (32), 2828–2835. Kitabayashi, I., Aikawa, Y., Nguyen, L.A., Yokoyama, A., Ohki, M., 2001. “Activation of AML1-mediated transcription by MOZ and inhibition by the MOZ-CBP fusion protein.” EMBO J (20), 7184–7196. Kitajima, Y., 2015. “Implications of normal and disordered remodeling dynamics of corneodesmosomes in stratum corneum.” Dermatologica Sin (33), 58–63. Klein, R.H., Lin, Z., Hopkin, A.S., Gordon, W., Tsoi, L.C., Liang, Y., Gudjonsson, J.E., Andersen, B., 2017. “GRHL3 binding and enhancers rearrange as epidermal keratinocytes transition between functional states.” PLOS Genet (13), 1006745. Koh, L.F., Ng, B.K., Bertrand, J., Thierry, F., 2015. “Transcriptional control of late differentiation in human keratinocytes by TAp63 and Notch.” Exp Dermatol (24), 754– 760. Kolarsick, P.A.J., Kolarsick, M.A., Goodwin, C., 2011. “Anatomy and Physiology of the Skin.” J Dermatol Nurses Assoc (3), 366. Kornberg, R.D., 1974. “Chromatin Structure: A Repeating Unit of Histones and DNA.” Science (184), 868–871. Korzus, E., Torchia, J., Rose, D.W., Xu, L., Kurokawa, R., McInerney, E.M., Mullen, T.M., Glass, C.K., Rosenfeld, M.G., 1998. “Transcription factor-specific requirements for coactivators and their acetyltransferase functions.” Science (279), 703–707. Koutsogiannouli, E.A., Wagner, N., Hader, C., Pinkerneil, M., Hoffmann, M.J., Schulz, W.A., 2017. “Differential Effects of Histone Acetyltransferase GCN5 or PCAF Knockdown on Urothelial Carcinoma Cells.” Int J Mol Sci (18), 1449. Kraft, M., Cirstea, I.C., Voss, A.K., Thomas, T., Goehring, I., Sheikh, B.N., Gordon, L., Scott, H., Smyth, G.K., Ahmadian, M.R., Trautmann, U., Zenker, M., Tartaglia, M., Ekici, A., Reis, A., Dörr, H.-G., Rauch, A., Thiel, C.T., 2011. “Disruption of the histone acetyltransferase MYST4 leads to a Noonan syndrome–like phenotype and hyperactivated MAPK signaling in humans and mice.” J Clin Invest (121), 3479. Kueh, A.J., Dixon, M.P., Voss, A.K., Thomas, T., 2011. “HBO1 is required for H3K14 acetylation and normal transcriptional activity during embryonic development.” Mol Cell Biol (31), 845–60. Kuo, Y.-M., Andrews, A.J., 2013. “Quantitating the Specificity and Selectivity of Gcn5- Mediated Acetylation of Histone H3.” PLoS One (8), 54896. Kurabe, N., Katagiri, K., Komiya, Y., Ito, R., Sugiyama, A., Kawasaki, Y., Tashiro, F., 2007. “Deregulated expression of a novel component of TFTC/STAGA histone acetyltransferase complexes, rat SGF29, in hepatocellular carcinoma: possible implication for the oncogenic potential of c-Myc.” Oncogene (26), 5626–5634. Kurooka, H., Honjo, T., 2000. “Functional Interaction between the Mouse Notch1 Intracellular Region and Histone Acetyltransferases PCAF and GCN5.” J Biol Chem (275), 17211–17220. Kuzmichev, A., Nishioka, K., Erdjument-Bromage, H., Tempst, P., Reinberg, D., 2002. “Histone methyltransferase activity associated with a human multiprotein complex containing the Enhancer of Zeste protein.” Genes Dev (16), 2893–2905. 220

Kwok, R.P.S., Liu, X.-T., Smith, G.D., 2006. “Distribution of co-activators CBP and p300 during mouse oocyte and embryo development.” Mol Reprod Dev (73), 885–894. Kypriotou, M., Huber, M., Hohl, D., 2012. “The human epidermal differentiation complex: cornified envelope precursors, S100 proteins and the ‘fused genes’ family.” Exp Dermatol (21), 643–649. Lang, S.E., McMahon, S.B., Cole, M.D., Hearing, P., 2001. “E2F Transcriptional Activation Requires TRRAP and GCN5 Cofactors.” J Biol Chem (276), 32627–32634. Langerhans, P., 1868. “Ueber die Nerven der menschlichen Haut.” Arch für Pathol Anat und Physiol und für Klin Med (44), 325–337. Lebel, E.A., Boukamp, P., Tafrov, S.T., 2010. “Irradiation with heavy-ion particles changes the cellular distribution of human histone acetyltransferase HAT1.” Mol Cell Biochem (339), 271–284. LeBoeuf, M., Terrell, A., Trivedi, S., Sinha, S., Epstein, J.A., Olson, E.N., Morrisey, E.E., Millar, S.E., 2010. “Hdac1 and Hdac2 Act Redundantly to Control p63 and p53 Functions in Epidermal Progenitor Cells.” Dev Cell (19), 807–818. Lee, J.-H., Hart, S.R.L., Skalnik, D.G., 2004. “Histone deacetylase activity is required for embryonic stem cell differentiation.” genesis (38), 32–38. Lee, J.L., Streuli, C.H., 2014. “Integrins and epithelial cell polarity.” J Cell Sci (127), 3217– 3225. Lee, S.E., Lee, S.H., 2018. “Skin Barrier and Calcium.” Ann Dermatol (30), 265–275. Lena, A.M., Cipollone, R., Amelio, I., Catani, M.V., Ramadan, S., Browne, G., Melino, G., Candi, E., 2010. “Skn-1a/Oct-11 and ΔNp63α exert antagonizing effects on human keratin expression.” Biochem Biophys Res Commun (401), 568–573. Lersch, R., Fuchs, E., 1988. “Sequence and expression of a type II keratin, K5, in human epidermal cells.” Mol Cell Biol (8), 486–493. Li, B., Sun, J., Dong, Z., Xue, P., He, X., Liao, L., Yuan, L., Jin, Y., 2016. “GCN5 modulates osteogenic differentiation of periodontal ligament stem cells through DKK1 acetylation in inflammatory microenvironment.” Sci Rep (6), 26542. Li, H., Cui, D., Wu, S., Xu, X., Ye, L., Zhou, X., Wan, M., Zheng, L., 2017. “Epigenetic Regulation of Gene Expression in Epithelial Stem Cells Fate.” Curr Stem Cell Res Ther (13), 46-51. Li, J., Poi, M.J., Tsai, M.D., 2011. “Regulatory mechanisms of tumor suppressor P16INK4A and their relevance to cancer.” Biochemistry (50), 5566–5582. Li, L., Fukunaga-Kalabis, M., Herlyn, M., 2012. “Isolation and Cultivation of Dermal Stem Cells that Differentiate into Functional Epidermal Melanocytes.” Methods Mol Biol (806), 15–29. Li, L., Zhu, J., Tian, J., Liu, X., Feng, C., 2010. “A role for Gcn5 in cardiomyocyte differentiation of rat mesenchymal stem cells.” Mol Cell Biochem (345), 309–316. Li, S., Shogren-Knaak, M.A., 2009. “The Gcn5 Bromodomain of the SAGA Complex Facilitates Cooperative and Cross-tail Acetylation of Nucleosomes.” J Biol Chem (284), 9411–9417.

221

Lim, X., Tan, S.H., Koh, W.L.C., Chau, R.M.W., Yan, K.S., Kuo, C.J., van Amerongen, R., Klein, A.M., Nusse, R., 2013. “Interfollicular Epidermal Stem Cells Self-Renew via Autocrine Wnt Signaling.” Science (342), 1226–1230. Lin, W., Srajer, G., Evrard, Y.A., Phan, H.M., Furuta, Y., Dent, S.Y.R., 2007. “Developmental potential ofGcn5−/− embryonic stem cells in vivo and in vitro.” Dev Dyn (236), 1547–1557. Liu, K., Zhang, Q., Lan, H., Wang, L., Mou, P., Shao, W., Liu, D., Yang, W., Lin, Z., Lin, Q., Ji, T., 2015. “GCN5 Potentiates Glioma Proliferation and Invasion via STAT3 and AKT Signaling Pathways.” Int J Mol Sci (16), 21897–21910. Lo Celso, C., Prowse, D.M., Watt, F.M., 2004. “Transient activation of beta-catenin signalling in adult mouse epidermis is sufficient to induce new hair follicles but continuous activation is required to maintain hair follicle tumours.” Development (131), 1787–1799. Lopez, R.G., Garcia-Silva, S., Moore, S.J., Bereshchenko, O., Martinez-Cruz, A.B., Ermakova, O., Kurz, E., Paramio, J.M., Nerlov, C., 2009. “C/EBPα and β couple interfollicular keratinocyte proliferation arrest to commitment and terminal differentiation.” Nat Cell Biol (11), 1181–1190. Lowell, S., Jones, P., Le Roux, I., Dunne, J., Watt, F.M., 2000. “Stimulation of human epidermal differentiation by delta-notch signalling at the boundaries of stem-cell clusters.” Curr Biol (10), 491–500. Luger, K., Mäder, A.W., Richmond, R.K., Sargent, D.F., Richmond, T.J., 1997. “Crystal structure of the nucleosome core particle at 2.8 Å resolution.” Nature (389), 251–260. Luis, N.M., Morey, L., Mejetta, S., Pascual, G., Janich, P., Kuebler, B., Roma, G., Nascimento, E., Frye, M., Di Croce, L., Benitah, S.A., 2011. “Regulation of human epidermal stem cell proliferation and senescence requires polycomb-dependent and independent functions of cbx4.” Cell Stem Cell (9), 233–246. Lundblad, J.R., Kwok, R.P.S., Laurance, M.E., Harter, M.L., Goodman, R.H., 1995. “Adenoviral ElA-associated protein p300 as a functional homologue of the transcriptional co-activator CBP.” Nature (374), 85–88. Mackenzie, I.C., 1970. “Relationship between Mitosis and the Ordered Structure of the Stratum Corneum in Mouse Epidermis.” Nature (226), 653–655. Maeda, K., 2017. “New Method of Measurement of Epidermal Turnover in Humans.” Cosmetics (4), 47. Mahrle, G., Bolling, R., Osborn, M., Weber, K., 1983. “Intermediate Filaments of the Vimentin and Prekeratin Type in Human Epidermis.” J Invest Dermatol (81), 46–48. Mahrle, G., Schulze, H.J., Kuhn, A., Wevers, A., 1989. “Immunostaining of keratin and vimentin in epidermis: comparison of different post-embedding immunogold techniques for electron microscopy.” J Histochem Cytochem (37), 863–868. Mardaryev, A.N., Liu, B., Rapisarda, V., Poterlowicz, K., Malashchuk, I., Rudolf, J., Sharov, A.A., Jahoda, C.A., Fessing, M.Y., Benitah, S.A., Xu, G.L., Botchkarev, V.A., 2016. “Cbx4 maintains the epithelial lineage identity and cell proliferation in the developing stratified epithelium.” J Cell Biol (212), 77–89. Marié, I.J., Chang, H.-M., Levy, D.E., 2018. “HDAC stimulates gene expression through BRD4 availability in response to IFN and in interferonopathies.” J Exp Med (215), 3194–3212. 222

Marshall, O.J., Brand, A.H., 2017. “Chromatin state changes during neural development revealed by in vivo cell-type specific profiling.” Nat Commun (8), 2271. Martínez-Balbás, M.A., Bauer, U.-M., Nielsen, S.J., Brehm, A., Kouzarides, T., 2000. “Regulation of E2F1 activity by acetylation.” EMBO J (19), 662–671. Martínez-Cerdeño, V., Lemen, J.M., Chan, V., Wey, A., Lin, W., Dent, S.R., Knoepfler, P.S., 2012. “N-Myc and GCN5 Regulate Significantly Overlapping Transcriptional Programs in Neural Stem Cells.” PLoS One (7), 39456. Martinez, E., Kundu, T.K., Fu, J., Roeder, R.G., 1998. “A human SPT3-TAFII31-GCN5-L acetylase complex distinct from transcription factor IID.” J Biol Chem (273), 23781– 23785. Martinez, E., Palhan, V.B., Tjernberg, A., Lymar, E.S., Gamper, A.M., Kundu, T.K., Chait, B.T., Roeder, R.G., 2001. “Human STAGA Complex Is a Chromatin-Acetylating Transcription Coactivator That Interacts with Pre-mRNA Splicing and DNA Damage- Binding Factors In Vivo.” Mol Cell Biol (21), 6782–6795. Maruyama, H., Ishitsuka, Y., Fujisawa, Y., Furuta, J., Sekido, M., Kawachi, Y., 2014. “B- Myb enhances proliferation and suppresses differentiation of keratinocytes in three- dimensional cell culture.” Arch Dermatol Res (306), 375–384. Mateo, F., Vidal-Laliena, M., Canela, N., Zecchin, A., Martínez-Balbás, M., Agell, N., Giacca, M., Pujol, M.J., Bachs, O., 2009. “The transcriptional co-activator PCAF regulates cdk2 activity.” Nucleic Acids Res (37), 7072–7084. Maurice, T., Duclot, F., Meunier, J., Naert, G., Givalois, L., Meffre, J., Célérier, A., Jacquet, C., Copois, V., Mechti, N., Ozato, K., Gongora, C., 2008. “Altered memory capacities and response to stress in p300/CBP-associated factor (PCAF) histone acetylase knockout mice.” Neuropsychopharmacology (33), 1584–1602. Maytin, E. V., Habener, J.F., 1998. “Transcription Factors C/EBPα, C/EBPβ, and CHOP (Gadd153) Expressed During the Differentiation Program of Keratinocytes In Vitro and In Vivo.” J Invest Dermatol (110), 238–246. McCawley, Lisa J., Wright, J., LaFleur, B.J., Crawford, H.C., Matrisian, L.M., 2008. “Keratinocyte Expression of MMP3 Enhances Differentiation and Prevents Tumor Establishment.” Am J Pathol (173), 1528–1539. McCool, K.W., Xu, X., Singer, D.B., Murdoch, F.E., Fritsch, M.K., 2007. “The Role of Histone Acetylation in Regulating Early Gene Expression Patterns during Early Embryonic Stem Cell Differentiation.” J Biol Chem (282), 6696–6706. McGrath, J.A., Eady, R.A.J., Pope, F.M., 2004. “Anatomy and Organization of Human Skin.” In: Rook’s Textbook of Dermatology. Blackwell Publishing, Inc., Malden, Massachusetts, USA, pp. 45–128. McMahon, S.B., Wood, M.A., Cole, M.D., 2000. “The essential cofactor TRRAP recruits the histone acetyltransferase hGCN5 to c-Myc.” Mol Cell Biol (20), 556–562. McMillan, J.R., Haftek, M., Akiyama, M., South, A.P., Perrot, H., McGrath, J.A., Eady, R.A.J., Shimizu, H., 2003. “Alterations in desmosome size and number coincide with the loss of keratinocyte cohesion in skin with homozygous and heterozygous defects in the desmosomal protein plakophilin 1.” J Invest Dermatol (121), 96–103. McMullan, R., Lax, S., Robertson, V.H., Radford, D.J., Broad, S., Watt, F.M., Rowles, A., Croft, D.R., Olson, M.F., Hotchin, N.A., 2003. “Keratinocyte Differentiation Is Regulated by the Rho and ROCK Signaling Pathway.” Curr Biol (13), 2185–2189. 223

Meng, X., Qiu, L., Song, H., Dang, N., 2018. “MAPK pathway involved in epidermal terminal differentiation of normal human epidermal keratinocytes.” Open Med (13), 189–195. Messina, D.N., Glasscock, J., Gish, W., Lovett, M., 2004. “An ORFeome-based Analysis of Human Transcription Factor Genes and the Construction of a Microarray to Interrogate Their Expression.” Genome Res (14), 2041–2047. Miettinen, P.J., Berger, J.E., Meneses, J., Phung, Y., Pedersen, R.A., Werb, Z., Derynck, R., 1995. “Epithelial immaturity and multiorgan failure in mice lacking epidermal growth factor receptor.” Nature (376), 337–341. Mills, A.A., Zheng, B., Wang, X.-J., Vogel, H., Roop, D.R., Bradley, A., 1999. “p63 is a p53 homologue required for limb and epidermal morphogenesis.” Nature (398), 708– 713. Miotto, B., Struhl, K., 2008. “HBO1 histone acetylase is a coactivator of the replication licensing factor Cdt1.” Genes Dev (22), 2633–2638. Miyai, M., Hamada, M., Moriguchi, T., Hiruma, J., Kamitani-Kawamoto, A., Watanabe, H., Hara-Chikuma, M., Takahashi, K., Takahashi, S., Kataoka, K., 2016. “Transcription Factor MafB Coordinates Epidermal Keratinocyte Differentiation.” J Invest Dermatol (136), 1848–1857. Mlacki, M., Darido, C., Jane, S.M., Wilanowski, T., 2014. “Loss of Grainy Head-Like 1 Is Associated with Disruption of the Epidermal Barrier and Squamous Cell Carcinoma of the Skin.” PLoS One (9), 89247. Moll, I., Houdek, P., Schmidt, H., Moll, R., 1998. “Characterization of Epidermal Wound Healing in a Human Skin Organ Culture Model: Acceleration by Transplanted Keratinocytes1.” J Invest Dermatol (111), 251–258. Moris, N., Edri, S., Seyres, D., Kulkarni, R., Domingues, A.F., Balayo, T., Frontini, M., Pina, C., 2018. “Histone Acetyltransferase KAT2A Stabilizes Pluripotency with Control of Transcriptional Heterogeneity.” Stem Cells (36), 1828–1838. Murray, K., 1964. “The Occurrence of iε-N-Methyl Lysine in Histones.” Biochemistry (3), 10–15. Nagarajan, P., Ge, Z., Sirbu, B., Doughty, C., Agudelo Garcia, P.A., Schlederer, M., Annunziato, A.T., Cortez, D., Kenner, L., Parthun, M.R., 2013. “Histone Acetyl Transferase 1 Is Essential for Mammalian Development, Genome Stability, and the Processing of Newly Synthesized Histones H3 and H4.” PLoS Genet (9), 1003518. Nagarajan, P., Romano, R.-A., Sinha, S., 2008. “Transcriptional control of the differentiation program of interfollicular epidermal keratinocytes.” Crit Rev Eukaryot Gene Expr (18), 57–79. Nagy, Z., Tora, L., 2007. “Distinct GCN5/PCAF-containing complexes function as coactivators and are involved in transcription factor and global histone acetylation.” Oncogene (26), 5341–5357. Nguyen, B.-C., Lefort, K., Mandinova, A., Antonini, D., Devgan, V., Della Gatta, G., Koster, M.I., Zhang, Z., Wang, J., Tommasi di Vignano, A., Kitajewski, J., Chiorino, G., Roop, D.R., Missero, C., Dotto, G.P., 2006. “Cross-regulation between Notch and p63 in keratinocyte commitment to differentiation.” Genes Dev (20), 1028–1042.

224

Nguyen, D.X., Baglia, L.A., Huang, S.-M., Baker, C.M., McCance, D.J., 2004. “Acetylation regulates the differentiation-specific functions of the retinoblastoma protein.” EMBO J (23), 1609–1618. Nicolas, D., Zoller, B., Suter, D.M., Naef, F., 2018. “Modulation of transcriptional burst frequency by histone acetylation.” Proc Natl Acad Sci (115), 7153–7158. Nylander, K., Vojtesek, B., Nenutil, R., Lindgren, B., Roos, G., Zhanxiang, W., Sjöström, B., Dahlqvist, A., Coates, P.J., 2002. “Differential expression of p63 isoforms in normal tissues and neoplastic cells.” J Pathol (198), 417–427. O’Sullivan, R.J., Kubicek, S., Schreiber, S.L., Karlseder, J., 2010. “Reduced histone biosynthesis and chromatin changes arising from a damage signal at telomeres.” Nat Struct Mol Biol (17), 1218–1225. Ogryzko, V. V, Kotani, T., Zhang, X., Schiltz, R.L., Howard, T., Yang, X.J., Howard, B.H., Qin, J., Nakatani, Y., 1998. “Histone-like TAFs within the PCAF histone acetylase complex.” Cell (94), 35–44. Ogryzko, V. V, Schiltz, R.L., Russanova, V., Howard, B.H., Nakatani, Y., 1996. “The transcriptional coactivators p300 and CBP are histone acetyltransferases.” Cell (87), 953–959. Oh, H.-S., Smart, R.C., 1998. “Expression of CCAAT/Enhancer Binding Proteins (C/EBP) is Associated with Squamous Differentiation in Epidermis and Isolated Primary Keratinocytes and is Altered in Skin Neoplasms.” J Invest Dermatol (110), 939–945. Orpinell, M., Fournier, M., Riss, A., Nagy, Z., Krebs, A.R., Frontini, M., Tora, L., 2010. “The ATAC acetyl transferase complex controls mitotic progression by targeting non- histone substrates.” EMBO J (29), 2381–2394. Owen, D.J., Ornaghi, P., Yang, J.C., Lowe, N., Evans, P.R., Ballario, P., Neuhaus, D., Filetici, P., Travers, A.A., 2000. “The structural basis for the recognition of acetylated histone H4 by the bromodomain of histone acetyltransferase Gcn5p.” EMBO J (19), 6141–6149. Owens, D.W., Brunton, V.G., Parkinson, E.K., Frame, M.C., 2000. “E-Cadherin at the Cell Periphery Is a Determinant of Keratinocyte Differentiation in Vitro.” Biochem Biophys Res Commun (269), 369–376. Palazzo, E., Kellett, M.D., Cataisson, C., Bible, P.W., Bhattacharya, S., Sun, H., Gormley, A.C., Yuspa, S.H., Morasso, M.I., 2017. “A novel DLX3–PKC integrated signaling network drives keratinocyte differentiation.” Cell Death Differ (24), 717–730. Pankotai, T., Komonyi, O., Bodai, L., Ujfaludi, Z., Muratoglu, S., Ciurciu, A., Tora, L., Szabad, J., Boros, I., 2005. “The Homologous Drosophila Transcriptional Adaptors ADA2a and ADA2b Are both Required for Normal Development but Have Different Functions.” Mol Cell Biol (25), 8215–8227. Paolinelli, R., Mendoza-Maldonado, R., Cereseto, A., Giacca, M., 2009. “Acetylation by GCN5 regulates CDC6 phosphorylation in the S phase of the cell cycle.” Nat Struct Mol Biol (16), 412–420. Paramio, J.M., Segrelles, C., Casanova, M.L., Jorcano, J.L., 2000. “Opposite Functions for E2F1 and E2F4 in Human Epidermal Keratinocyte Differentiation.” J Biol Chem (275), 41219–41226.

225

Parker, D., Ferreri, K., Nakajima, T., LaMorte, V.J., Evans, R., Koerber, S.C., Hoeger, C., Montminy, M.R., 1996. “Phosphorylation of CREB at Ser-133 induces complex formation with CREB-binding protein via a direct mechanism.” Mol Cell Biol (16), 694–703. Patel, S., Xi, Z.F., Seo, E.Y., McGaughey, D., Segre, J.A., 2006. “Klf4 and corticosteroids activate an overlapping set of transcriptional targets to accelerate in utero epidermal barrier acquisition.” Proc Natl Acad Sci (103), 18668–18673. Pellegrini, G., Dellambra, E., Golisano, O., Martinelli, E., Fantozzi, I., Bondanza, S., Ponzin, D., McKeon, F., De Luca, M., 2001. “p63 identifies keratinocyte stem cells.” Proc Natl Acad Sci (98), 3156–3161. Pelletier, N., Champagne, N., Stifani, S., Yang, X.-J., 2002. “MOZ and MORF histone acetyltransferases interact with the Runt-domain transcription factor Runx2.” Oncogene (21), 2729–2740. Perez-Campo, F.M., Borrow, J., Kouskoff, V., Lacaud, G., 2009. “The histone acetyl transferase activity of monocytic leukemia zinc finger is critical for the proliferation of hematopoietic precursors.” Blood (113), 4866–4874. Perez-Campo, F.M., Costa, G., Lie-a-Ling, M., Kouskoff, V., Lacaud, G., 2013. “The MYSTerious MOZ, a histone acetyltransferase with a key role in haematopoiesis.” Immunology (139), 161–165. Perez-Campo, F.M., Costa, G., Lie-A-Ling, M., Stifani, S., Kouskoff, V., Lacaud, G., 2014. “MOZ-mediated repression of p16INK4a is critical for the self-renewal of neural and hematopoietic stem cells.” Stem Cells (32), 1591–1601. Phillips, D., 1963. “The presence of acetyl groups in histones.” Biochem J (87), 258–263. Phillips, M.A., Jessen, B.A., Lu, Y., Qin, Q., Stevens, M.E., Rice, R.H., 2004. “A distal region of the human TGM1 promoter is required for expression in transgenic mice and cultured keratinocytes.” BMC Dermatol (4), 2. Pickard, A., Wong, P.-P., McCance, D.J., 2010. “Acetylation of Rb by PCAF is required for nuclear localization and keratinocyte differentiation.” J Cell Sci (123), 3718–3726. Pilcher, B.K., Dumin, J.A., Sudbeck, B.D., Krane, S.M., Welgus, H.G., Parks, W.C., 1997. “The Activity of Collagenase-1 Is Required for Keratinocyte Migration on a Type I Collagen Matrix.” J Cell Biol (137), 1445–1457. Platzer, W., 2008. Color Atlas of Human Anatomy: Locomotor System, 6th ed. Thieme Medical Publishers, Stuttgart, Germany. Pogo, B.G., Allfrey, V.G., Mirsky, A.E., 1966. “RNA synthesis and histone acetylation during the course of gene activation in lymphocytes.” Proc Natl Acad Sci (55), 805– 812. Pokholok, D.K., Harbison, C.T., Levine, S., Cole, M., Hannett, N.M., Lee, T.I., Bell, G.W., Walker, K., Rolfe, P.A., Herbolsheimer, E., Zeitlinger, J., Lewitter, F., Gifford, D.K., Young, R.A., 2005. “Genome-wide map of nucleosome acetylation and methylation in yeast.” Cell (122), 517–527. Ponec, M., Gibbs, S., Weerheim, A., Kempenaar, J., Mulder, A., Mommaas, A.M., 1997. “Epidermal growth factor and temperature regulate keratinocyte differentiation.” Arch Dermatol Res (289), 317–326.

226

Potten, C.S., 1974. “The Epidermal Proliferative Unit: the Possible Role of the Central Basal Cell.” Cell Prolif (7), 77–88. Puri, P.L., Sartorelli, V., Yang, X.J., Hamamori, Y., Ogryzko, V. V, Howard, B.H., Kedes, L., Wang, J.Y., Graessmann, A., Nakatani, Y., Levrero, M., 1997. “Differential roles of p300 and PCAF acetyltransferases in muscle differentiation.” Mol Cell (1), 35–45. Qi, D., Larsson, J., Mannervik, M., 2004. “Drosophila Ada2b Is Required for Viability and Normal Histone H3 Acetylation.” Mol Cell Biol (24), 8080–8089. Qiao, L., Zhang, Q., Zhang, W., Chen, J.J., 2018. “The lysine acetyltransferase GCN5 contributes to human papillomavirus oncoprotein E7-induced cell proliferation via upregulating E2F1.” J Cell Mol Med (22), 5333–5345. Raab, J.R., Wager, K.E., Morowitz, J.M., Magness, S.T., Gracz, A.D., 2019. “Intestinal stem cell differentiation is associated with dynamic changes in the chromatin landscape.” bioRxiv 637181. Ramos, Y.F.M., Hestand, M.S., Verlaan, M., Krabbendam, E., Ariyurek, Y., van Galen, M., van Dam, H., van Ommen, G.-J.B., den Dunnen, J.T., Zantema, A., ’t Hoen, P.A.C., 2010. “Genome-wide assessment of differential roles for p300 and CBP in transcription regulation.” Nucleic Acids Res (38), 5396–5408. Ramsey, M.R., He, L., Forster, N., Ory, B., Ellisen, L.W., 2011. “Physical association of HDAC1 and HDAC2 with p63 mediates transcriptional repression and tumor maintenance in squamous cell carcinoma.” Cancer Res (71), 4373–4379. Rangarajan, A., Talora, C., Okuyama, R., Nicolas, M., Mammucari, C., Oh, H., Aster, J.C., Krishna, S., Metzger, D., Chambon, P., Miele, L., Aguet, M., Radtke, F., Dotto, G.P., 2001. “Notch signaling is a direct determinant of keratinocyte growth arrest and entry into differentiation.” EMBO J (20), 3427–3436. Rea, S., Eisenhaber, F., O’Carroll, D., Strahl, B.D., Sun, Z.-W., Schmid, M., Opravil, S., Mechtler, K., Ponting, C.P., Allis, C.D., Jenuwein, T., 2000. “Regulation of chromatin structure by site-specific histone H3 methyltransferases.” Nature (406), 593–599. Rest, E.B., 1999. “Histologic Diagnosis of Inflammatory Skin Diseases. An Algorithmic Method Based on Pattern Analysis.” Am J Clin Pathol (112), 271–272. Rheinwald, J.G., Green, H., 1975a. “Serial cultivation of strains of human epidermal keratinocytes: the formation of keratinizing colonies from single cells.” Cell (6), 331– 343. Rheinwald, J.G., Green, H., 1975b. “Formation of a keratinizing epithelium in culture by a cloned cell line derived from a teratoma.” Cell (6), 317–330. Ricci, A.R., Genereaux, J., Brandl, C.J., 2002. “Components of the SAGA histone acetyltransferase complex are required for repressed transcription of ARG1 in rich medium.” Mol Cell Biol (22), 4033–4042. Richard, M.H., Viac, J., Reano, A., Gaucherand, M., Thivolet, J., 1990. “Vimentin expression in normal human keratinocytes grown in serum-free defined MCDB 153 medium.” Arch Dermatol Res (282), 512–515. Riss, A., Scheer, E., Joint, M., Trowitzsch, S., Berger, I., Tora, L., 2015. “Subunits of ADA- two-A-containing (ATAC) or Spt-Ada-Gcn5-acetyltrasferase (SAGA) Coactivator Complexes Enhance the Acetyltransferase Activity of GCN5.” J Biol Chem (290), 28997–29009. 227

Robinson, P.J., Rhodes, D., 2006. “Structure of the ‘30nm’ chromatin fibre: A key role for the linker histone.” Curr Opin Struct Biol (16), 336–343. Rodríguez, D., Morrison, C.J., Overall, C.M., 2010. “Matrix metalloproteinases: What do they not do? New substrates and biological roles identified by murine models and proteomics.” Biochim Biophys Acta - Mol Cell Res (1803), 39–54. Romano, R.-A., Birkaya, B., Sinha, S., 2007. “A Functional Enhancer of Keratin14 Is a Direct Transcriptional Target of ΔNp63.” J Invest Dermatol (127), 1175–1186. Romano, R.-A., Ortt, K., Birkaya, B., Smalley, K., Sinha, S., 2009. “An Active Role of the ΔN Isoform of p63 in Regulating Basal Keratin Genes K5 and K14 and Directing Epidermal Cell Fate.” PLoS One (4), 5623. Romano, R.A., Smalley, K., Magraw, C., Serna, V.A., Kurita, T., Raghavan, S., Sinha, S., 2012. “ΔNp63 knockout mice reveal its indispensable role as a master regulator of epithelial development and differentiation.” Development (139), 772–782. Rompolas, P., Mesa, K.R., Kawaguchi, K., Park, S., Gonzalez, D., Brown, S., Boucher, J., Klein, A.M., Greco, V., 2016. “Spatiotemporal coordination of stem cell commitment during epidermal homeostasis.” Science (352), 1471–1474. Rorke, E.A., Adhikary, G., Jans, R., Crish, J.F., Eckert, R.L., 2010. “AP1 factor inactivation in the suprabasal epidermis causes increased epidermal hyperproliferation and hyperkeratosis but reduced carcinogen-dependent tumor formation.” Oncogene (29), 5873–5882. Sabo, A., Lusic, M., Cereseto, A., Giacca, M., 2008. “Acetylation of Conserved Lysines in the Catalytic Core of Cyclin-Dependent Kinase 9 Inhibits Kinase Activity and Regulates Transcription.” Mol Cell Biol (28), 2201–2212. Sanchez, R., Zhou, M.-M., 2011. “The PHD finger: a versatile epigenome reader.” Trends Biochem Sci (36), 364–372. Sandoz, J., Nagy, Z., Catez, P., Caliskan, G., Geny, S., Renaud, J.-B., Concordet, J.-P., Poterszman, A., Tora, L., Egly, J.-M., Le May, N., Coin, F., 2019. “Functional interplay between TFIIH and KAT2A regulates higher-order chromatin structure and class II gene expression.” Nat Commun (10), 1288. Sartorelli, V., Puri, P.L., Hamamori, Y., Ogryzko, V., Chung, G., Nakatani, Y., Wang, J.Y., Kedes, L., 1999. “Acetylation of MyoD directed by PCAF is necessary for the execution of the muscle program.” Mol Cell (4), 725–734. Schlage, P., auf dem Keller, U., 2015. “Proteomic approaches to uncover MMP function.” Matrix Biol (44–46), 232–238. Schlage, P., Kockmann, T., Sabino, F., Kizhakkedathu, J.N., Auf dem Keller, U., 2015. “Matrix Metalloproteinase 10 Degradomics in Keratinocytes and Epidermal Tissue Identifies Bioactive Substrates With Pleiotropic Functions.” Mol Cell Proteomics (14), 3234–3246. Schumacher, M., Schuster, C., Rogon, Z.M., Bauer, T., Caushaj, N., Baars, S., Szabowski, S., Bauer, C., Schorpp-Kistner, M., Hess, J., Holland-Cunz, S., Wagner, E.F., Eils, R., Angel, P., Hartenstein, B., 2014. “Efficient Keratinocyte Differentiation Strictly Depends on JNK-Induced Soluble Factors in Fibroblasts.” J Invest Dermatol (134), 1332–1341.

228

Segre, J.A., Bauer, C., Fuchs, E., 1999. “Klf4 is a transcription factor required for establishing the barrier function of the skin.” Nat Genet (22), 356–360. Sen, R., Pezoa, S., Carpio Shull, L., Hernandez-Lagunas, L., Niswander, L., Artinger, K., Sen, R., Pezoa, S.A., Carpio Shull, L., Hernandez-Lagunas, L., Niswander, L.A., Artinger, K.B., 2018. “Kat2a and Kat2b Acetyltransferase Activity Regulates Craniofacial Cartilage and Bone Differentiation in Zebrafish and Mice.” J Dev Biol (6), 27. Sen, G.L., Boxer, L.D., Webster, D.E., Bussat, R.T., Qu, K., Zarnegar, B.J., Johnston, D., Siprashvili, Z., Khavari, P.A., 2012. “ZNF750 Is a p63 Target Gene that Induces KLF4 to Drive Terminal Epidermal Differentiation.” Dev Cell (22), 669–677. Senoo, M., Pinto, F., Crum, C.P., McKeon, F., 2007. “p63 Is Essential for the Proliferative Potential of Stem Cells in Stratified Epithelia.” Cell (129), 523–536. Sethi, I., Romano, R.A., Gluck, C., Smalley, K., Vojtesek, B., Buck, M.J., Sinha, S., 2015. “A global analysis of the complex landscape of isoforms and regulatory networks of p63 in human cells and tissues.” BMC Genomics (16). Shahbazian, M.D., Grunstein, M., 2007. “Functions of Site-Specific Histone Acetylation and Deacetylation.” Annu Rev Biochem (76), 75–100. Sharma, M., Zarnegar, M., Li, X., Lim, B., Sun, Z., 2000. “Androgen Receptor Interacts with a Novel MYST Protein, HBO1.” J Biol Chem (275), 35200–35208. Sharpless, N.E., 2005. “INK4a/ARF: A multifunctional tumor suppressor locus.” Mutat Res Mol Mech Mutagen (576), 22–38. Shogren-Knaak, M., Ishii, H., Sun, J.-M., Pazin, M.J., Davie, J.R., Peterson, C.L., 2006. “Histone H4-K16 Acetylation Controls Chromatin Structure and Protein Interactions.” Science (311), 844–847. Smith, E.R., Belote, J.M., Schiltz, R.L., Yang, X.-J., Moore, P.A., Berger, S.L., Nakatani, Y., Allis, C.D., 1998. “Cloning of Drosophila GCN5: Conserved features among metazoan GCN5 family members.” Nucleic Acids Res (26), 2948–2954. Smirnov, A., Lena, A.M., Cappello, A., Panatta, E., Anemona, L., Bischetti, S., Annicchiarico-Petruzzelli, M., Mauriello, A., Melino, G., Candi, E., 2019. “ZNF185 is a p63 target gene critical for epidermal differentiation and squamous cell carcinoma development.” Oncogene (38), 1625–1638. Smits, J.P.H., Niehues, H., Rikken, G., van Vlijmen-Willems, I.M.J.J., van de Zande, G.W.H.J.F., Zeeuwen, P.L.J.M., Schalkwijk, J., van den Bogaard, E.H., 2017. “Immortalized N/TERT keratinocytes as an alternative cell source in 3D human epidermal models.” Sci Rep (7), 11838. Soares, E., Zhou, H., 2018. “Master regulatory role of p63 in epidermal development and disease.” Cell Mol Life Sci (75), 1179–1190. Song, X., Wong, M.D., Kawase, E., Xi, R., Ding, B.C., McCarthy, J.J., Xie, T., 2004. “Bmp signals from niche cells directly repress transcription of a differentiation-promoting gene, bag of marbles, in germline stem cells in the Drosophila ovary.” Development (131), 1353–1364. Sorrell, J.M., 2004. “Fibroblast heterogeneity: more than skin deep.” J Cell Sci (117), 667– 675.

229

Spalding, K.L., Bhardwaj, R.D., Buchholz, B.A., Druid, H., Frisén, J., 2005. “Retrospective birth dating of cells in humans.” Cell (122), 133–143. Spedale, G., Timmers, H.T.M., Pijnappel, W.W.M.P., 2012. “ATAC-king the complexity of SAGA during evolution.” Genes Dev (26), 527–541. Stepp, M.A., Spurr-Michaud, S., Tisdale, A., Elwell, J., Gipson, I.K., 1990. “Alpha 6 beta 4 integrin heterodimer is a component of hemidesmosomes.” Proc Natl Acad Sci (87), 8970–8974. Stilling, R.M., Rönicke, R., Benito, E., Urbanke, H., Capece, V., Burkhardt, S., Bahari- Javan, S., Barth, J., Sananbenesi, F., Schütz, A.L., Dyczkowski, J., Martinez- Hernandez, A., Kerimoglu, C., Dent, S.Y.R., Bonn, S., Reymann, K.G., Fischer, A., 2014. “K-Lysine acetyltransferase 2a regulates a hippocampal gene expression network linked to memory formation.” EMBO J (33), 1912–1927. Subramanian, A., Tamayo, P., Mootha, V.K., Mukherjee, S., Ebert, B.L., Gillette, M.A., Paulovich, A., Pomeroy, S.L., Golub, T.R., Lander, E.S., Mesirov, J.P., 2005. “Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles.” Proc Natl Acad Sci U S A (102), 15545–15550. Sun, J., Paduch, M., Kim, S.-A., Kramer, R.M., Barrios, A.F., Lu, V., Luke, J., Usatyuk, S., Kossiakoff, A.A., Tan, S., 2018. “Structural basis for activation of SAGA histone acetyltransferase Gcn5 by partner subunit Ada2.” Proc Natl Acad Sci (115), 10010– 10015. Sunami, Y., Araki, M., Ito, A., Hironaka, Y., Yoshida, M., Ohsaka, A., Komatsu, N., 2014. “Histone Acetyltransferase Pcaf Is Required for ATRA-Induced Granulocytic Differentiation in Acute Promyelocytic Leukemia Cells.” Blood (124). 617. Sunami, Y., Araki, M., Kan, S., Ito, A., Hironaka, Y., Imai, M., Morishita, S., Ohsaka, A., Komatsu, N., 2017. “Histone Acetyltransferase p300/CREB-binding Protein- associated Factor (PCAF) Is Required for All-trans-retinoic Acid-induced Granulocytic Differentiation in Leukemia Cells.” J Biol Chem (292), 2815–2829. Suzuki, A., Itami, S., Ohishi, M., Hamada, K., Inoue, T., Komazawa, N., Senoo, H., Sasaki, T., Takeda, J., Manabe, M., Mak, T.W., Nakano, T., 2003. “Keratinocyte-specific Pten deficiency results in epidermal hyperplasia, accelerated hair follicle morphogenesis and tumor formation.” Cancer Res (63), 674–681. Swart, G.W.M., van Groningen, J.J.M., van Ruissen, F., Bergers, M., Schalkwijk, J., 1997. “Transcription Factor C/EBPα: Novel Sites of Expression and Cloning of the Human Gene.” Biol Chem (378), 373–380. Syntichaki, P., Topalidou, I., Thireos, G., 2000. “The Gcn5 bromodomain co-ordinates nucleosome remodelling.” Nature (404), 414–417. Tanaka, Y., Naruse, I., Maekawa, T., Masuya, H., Shiroishi, T., Ishii, S., 1997. “Abnormal skeletal patterning in embryos lacking a single Cbp allele: A partial similarity with Rubinstein-Taybi syndrome.” Proc Natl Acad Sci (94), 10215–10220. Tanner, K.G., Langer, M.R., Kim, Y., Denu, J.M., 2000. “Kinetic Mechanism of the Histone Acetyltransferase GCN5 from Yeast.” J Biol Chem (275), 22048–22055. Tanner, K.G., Trievel, R.C., Kuo, M.-H., Howard, R.M., Berger, S.L., Allis, C.D., Marmorstein, R., Denu, J.M., 1999. “Catalytic Mechanism and Function of Invariant Glutamic Acid 173 from the Histone Acetyltransferase GCN5 Transcriptional Coactivator.” J Biol Chem (274), 18157–18160. 230

Tao, J., Kuliyev, E., Wang, X., Li, X., Wilanowski, T., Jane, S.M., Mead, P.E., Cunningham, J.M., 2005. “BMP4-dependent expression of Xenopus Grainyhead-like 1 is essential for epidermal differentiation.” Development (132), 1021–1034. Tarayrah, L., Chen, X., 2013. “Epigenetic regulation in adult stem cells and cancers.” Cell Biosci (3), 41. Tenchini, M.L., Ranzati, C., Malcovati, M., 1992. “Culture techniques for human keratinocytes.” Burns (18), S11–S16. Teulière, J., Faraldo, M.M., Shtutman, M., Birchmeier, W., Huelsken, J., Thiery, J.P., Glukhova, M.A., 2004. “beta-catenin-dependent and -independent effects of DeltaN- plakoglobin on epidermal growth and differentiation.” Mol Cell Biol (24), 8649–8661. The Gene Ontology Consortium, 2019. “The Gene Ontology Resource: 20 years and still GOing strong.” Nucleic Acids Res (47), D330–D338. Thomas, T., Dixon, M.P., Kueh, A.J., Voss, A.K., 2008. “Mof (MYST1 or KAT8) is essential for progression of embryonic development past the blastocyst stage and required for normal chromatin architecture.” Mol Cell Biol (28), 5093–5105. Thomas, T., Voss, A.K., 2007. “The Diverse Biological Roles of MYST Histone Acetyltransferase Family Proteins.” Cell Cycle (6), 696–704. Tie, F., Banerjee, R., Stratton, C.A., Prasad-Sinha, J., Stepanik, V., Zlobin, A., Diaz, M.O., Scacheri, P.C., Harte, P.J., 2009. “CBP-mediated acetylation of histone H3 lysine 27 antagonizes Drosophila Polycomb silencing.” Development (136), 3131–3141. Toulza, E., Mattiuzzo, N.R., Galliano, M.-F., Jonca, N., Dossat, C., Jacob, D., de Daruvar, A., Wincker, P., Serre, G., Guerrin, M., 2007. “Large-scale identification of human genes implicated in epidermal barrier function.” Genome Biol (8), R107. Toyoshima, K., Seta, Y., Takeda, S., Harada, H., 1998. “Identification of Merkel Cells by an Antibody to Villin.” J Histochem Cytochem (46), 1329–1334. Trisciuoglio, D., Di Martile, M., Del Bufalo, D., 2018. “Emerging Role of Histone Acetyltransferase in Stem Cells and Cancer.” Stem Cells Int (2018), 8908751. Tse, C., Sera, T., Wolffe, A.P., Hansen, J.C., 1998. “Disruption of higher-order folding by core histone acetylation dramatically enhances transcription of nucleosomal arrays by RNA polymerase III.” Mol Cell Biol (18), 4629–38. Turner, F.E., Broad, S., Khanim, F.L., Jeanes, A., Talma, S., Hughes, S., Tselepis, C., Hotchin, N.A., 2006. “Slug Regulates Integrin Expression and Cell Proliferation in Human Epidermal Keratinocytes.” J Biol Chem (281), 21321–21331. Tzelepis, K., Koike-Yusa, H., De Braekeleer, E., Li, Y., Metzakopian, E., Dovey, O.M., Mupo, A., Grinkevich, V., Li, M., Mazan, M., Gozdecka, M., Ohnishi, S., Cooper, J., Patel, M., McKerrell, T., Chen, B., Domingues, A.F., Gallipoli, P., Teichmann, S., Ponstingl, H., McDermott, U., Saez-Rodriguez, J., Huntly, B.J.P., Iorio, F., Pina, C., Vassiliou, G.S., Yusa, K., 2016. “A CRISPR Dropout Screen Identifies Genetic Vulnerabilities and Therapeutic Targets in Acute Myeloid Leukemia.” Cell Rep (17), 1193–1205.

231

Ullah, M., Pelletier, N., Xiao, L., Zhao, S.P., Wang, K., Degerny, C., Tahmasebi, S., Cayrou, C., Doyon, Y., Goh, S.-L., Champagne, N., Côté, J., Yang, X.-J., 2008. “Molecular architecture of quartet MOZ/MORF histone acetyltransferase complexes.” Mol Cell Biol (28), 6828–6843. van Roy, F., Berx, G., 2008. “The cell-cell adhesion molecule E-cadherin.” Cell Mol Life Sci (65), 3756–3788. Varani, J., Perone, P., Deming, M.O., Warner, R.L., Aslam, M.N., Bhagavathula, N., Dame, M.K., Voorhees, J.J., 2009. “Impaired keratinocyte function on matrix metalloproteinase-1 (MMP-1) damaged collagen.” Arch Dermatol Res (301), 497–506. Vassilev, A., Yamauchi, J., Kotani, T., Prives, C., Avantaggiati, M.L., Qin, J., Nakatani, Y., 1998. “The 400 kDa Subunit of the PCAF Histone Acetylase Complex Belongs to the ATM Superfamily.” Mol Cell (2), 869–875. Velez-delValle, C., Marsch-Moreno, M., Castro-Muñozledo, F., Galván-Mendoza, I.J., Kuri-Harcuch, W., 2016. “Epithelial cell migration requires the interaction between the vimentin and keratin intermediate filaments.” Sci Rep (6), 24389. Verzi, M.P., Shin, H., He, H.H., Sulahian, R., Meyer, C.A., Montgomery, R.K., Fleet, J.C., Brown, M., Liu, X.S., Shivdasani, R.A., 2010. “Differentiation-Specific Histone Modifications Reveal Dynamic Chromatin Interactions and Partners for the Intestinal Transcription Factor CDX2.” Dev Cell (19), 713–726. Vogler, C., Huber, C., Waldmann, T., Ettig, R., Braun, L., Izzo, A., Daujat, S., Chassignet, I., Lopez-Contreras, A.J., Fernandez-Capetillo, O., Dundr, M., Rippe, K., Längst, G., Schneider, R., 2010. “Histone H2A C-Terminus Regulates Chromatin Dynamics, Remodeling, and Histone H1 Binding.” PLoS Genet (6), e1001234. Voss, A.K., Collin, C., Dixon, M.P., Thomas, T., 2009. “Moz and Retinoic Acid Coordinately Regulate H3K9 Acetylation, Hox Gene Expression, and Segment Identity.” Dev Cell (17), 674–686. Voss, A.K., Thomas, T., 2018. “Histone Lysine and Genomic Targets of Histone Acetyltransferases in Mammals.” BioEssays (40), 1800078. Wang, A., Kurdistani, S.K., Grunstein, M., 2002. “Requirement of Hos2 Histone Deacetylase for Gene Activity in Yeast.” Science (298), 1412–1414. Wang, C.-Y., Yang, S.-F., Wang, Z., Tan, J.-M., Xing, S.-M., Chen, D.-C., Xu, S.-M., Yuan, W., 2013. “PCAF acetylates Runx2 and promotes osteoblast differentiation.” J Bone Miner Metab (31), 381–389. Wang, L., Dent, S.Y.R., 2014. “Functions of SAGA in development and disease.” Epigenomics (6), 329–39. Wang, L., Koutelou, E., Hirsch, C., McCarthy, R., Schibler, A., Lin, K., Lu, Y., Jeter, C., Shen, J., Barton, M.C., Dent, S.Y.R., 2018. “GCN5 Regulates FGF Signaling and Activates Selective MYC Target Genes during Early Embryoid Body Differentiation.” Stem Cell Reports (10), 287–299. Wang, W., Pan, K., Chen, Y., Huang, C., Zhang, X., 2012. “The acetylation of transcription factor HBP1 by p300/CBP enhances p16INK4A expression.” Nucleic Acids Res (40), 981–95. Wang, X, Pan, L., Feng, Y., Wang, Y., Han, Q., Han, L., Han, S., Guo, J., Huang, B., Lu, J., 2008. “p300 plays a role in p16INK4a expression and cell cycle arrest.” Oncogene (27), 1894–1904. 232

Wang, Xuan, Pasolli, H.A., Williams, T., Fuchs, E., 2008. “AP-2 factors act in concert with Notch to orchestrate terminal differentiation in skin epidermis.” J Cell Biol (183), 37– 48. Wang, Y.-L., Faiola, F., Xu, M., Pan, S., Martinez, E., 2008. “Human ATAC Is a GCN5/PCAF-containing acetylase complex with a novel NC2-like histone fold module that interacts with the TATA-binding protein.” J Biol Chem (283), 33808–15. Wang, Y., Fischle, W., Cheung, W., Jacobs, S., Khorasanizadeh, S., Allis, C.D., 2004. “Beyond the double helix: writing and reading the histone code.” Novartis Found Symp (259), 3–17; discussion 17-21, 163–9. Wang, Yugang, Guo, Y.R., Liu, K., Yin, Z., Liu, R., Xia, Y., Tan, L., Yang, P., Lee, J.H., Li, X.J., Hawke, D., Zheng, Y., Qian, X., Lyu, J., He, J., Xing, D., Tao, Y.J., Lu, Z., 2017. “KAT2A coupled with the α-KGDH complex acts as a histone H3 succinyltransferase.” Nature (552), 273–277. Wang, Yajun, Yun, C., Gao, B., Xu, Y., Zhang, Y., Wang, Yiming, Kong, Q., Zhao, F., Wang, C.-R., Dent, S.Y.R., Wang, J., Xu, X., Li, H.-B., Fang, D., 2017. “The Lysine Acetyltransferase GCN5 Is Required for iNKT Cell Development through EGR2 Acetylation.” Cell Rep (20), 600–612. Wang, Z., Zang, C., Cui, K., Schones, D.E., Barski, A., Peng, W., Zhao, K., 2009. “Genome- wide Mapping of HATs and HDACs Reveals Distinct Functions in Active and Inactive Genes.” Cell (138), 1019–1031. Wang, Z., Zang, C., Rosenfeld, J.A., Schones, D.E., Barski, A., Cuddapah, S., Cui, K., Roh, T.-Y., Peng, W., Zhang, M.Q., Zhao, K., 2008. “Combinatorial patterns of histone acetylations and methylations in the human genome.” Nat Genet (40), 897–903. Weinstein, G.D., McCullough, J.L., Ross, P., 1984. “Cell proliferation in normal epidermis.” J Invest Dermatol (82), 623-628. Welter, J.F., Crish, J.F., Agarwal, C., Eckert, R.L., 1995. “Fos-related antigen (Fra-1), junB, and junD activate human involucrin promoter transcription by binding to proximal and distal AP1 sites to mediate phorbol ester effects on promoter activity.” J Biol Chem (270), 12614–12622. Welter, J.F., Eckert, R.L., 1995. “Differential expression of the fos and jun family members c-fos, fosB, Fra-1, Fra-2, c-jun, junB and junD during human epidermal keratinocyte differentiation.” Oncogene (11), 2681–2687. Welter, J.F., Gali, H., Crish, J.F., Eckert, R.L., 1996. “Regulation of Human Involucrin Promoter Activity by POU Domain Proteins.” J Biol Chem (271), 14727–14733. Wen, H., Li, J., Song, T., Lu, M., Kan, P.-Y., Lee, M.G., Sha, B., Shi, X., 2010. “Recognition of histone H3K4 trimethylation by the plant homeodomain of PHF2 modulates histone demethylation.” J Biol Chem (285), 9322–9326. Wertz, P., 2018. “Epidermal Lamellar Granules.” Skin Pharmacol Physiol (31), 262–268. Westerhof, W., 2006. “The discovery of the human melanocyte.” Pigment Cell Res (19), 183–193. Wilanowski, T., Caddy, J., Ting, S.B., Hislop, N.R., Cerruti, L., Auden, A., Zhao, L.-L., Asquith, S., Ellis, S., Sinclair, R., Cunningham, J.M., Jane, S.M., 2008. “Perturbed desmosomal cadherin expression in grainy head-like 1-null mice.” EMBO J (27), 886– 897. 233

Wilde, J.J., Siegenthaler, J.A., Dent, S.Y.R., Niswander, L.A., 2017. “Diencephalic Size Is Restricted by a Novel Interplay Between GCN5 Acetyltransferase Activity and Retinoic Acid Signaling.” J Neurosci (37), 2565–2579. Wilkins, B.J., Rall, N.A., Ostwal, Y., Kruitwagen, T., Hiragami-Hamada, K., Winkler, M., Barral, Y., Fischle, W., Neumann, H., 2014. “A Cascade of Histone Modifications Induces Chromatin Condensation in Mitosis.” Science (343), 77–80. Williams, A., 2014. “Central nervous system regeneration-where are we?” Qjm (107), 335– 339. Winkler, G.S., Kristjuhan, A., Erdjument-Bromage, H., Tempst, P., Svejstrup, J.Q., 2002. “Elongator is a histone H3 and H4 acetyltransferase important for normal histone acetylation levels in vivo.” Proc Natl Acad Sci U S A (99), 3517–3522. Wiper-Bergeron, N., Salem, H.A., Tomlinson, J.J., Wu, D., Hache, R.J.G., 2007. “Glucocorticoid-stimulated preadipocyte differentiation is mediated through acetylation of C/EBPbeta by GCN5.” Proc Natl Acad Sci (104), 2703–2708. Wong, K., Zhang, J., Awasthi, S., Sharma, A., Rogers, L., Matlock, E.F., Van Lint, C., Karpova, T., McNally, J., Harrod, R., 2004. “Nerve Growth Factor Receptor Signaling Induces Histone Acetyltransferase Domain-dependent Nuclear Translocation of p300/CREB-binding Protein-associated Factor and hGCN5 Acetyltransferases.” J Biol Chem (279), 55667–55674. Wu, N., Rollin, J., Masse, I., Lamartine, J., Gidrol, X., 2012. “p63 regulates human keratinocyte proliferation via MYC-regulated gene network and differentiation commitment through cell adhesion-related gene network.” J Biol Chem (287), 5627– 5638. Xin, Y., Lu, Q., Li, Q., 2011. “IKK1 Control of Epidermal Differentiation Is Modulated by Notch Signaling.” Am J Pathol (178), 1568–1577. Xu, W., Edmondson, D.G., Evrard, Y.A., Wakamiya, M., Behringer, R.R., Roth, S.Y., 2000. “Loss of Gcn5l2 leads to increased apoptosis and mesodermal defects during mouse development.” Nat Genet (26), 229–232. Xu, W., Edmondson, D.G., Roth, S.Y., 1998. “Mammalian GCN5 and P/CAF acetyltransferases have homologous amino-terminal domains important for recognition of nucleosomal substrates.” Mol Cell Biol (18), 5659–5669. Xue, L., Wu, J., Zheng, W., Wang, P., Li, J., Zhang, Z., Tong, T., 2004. “Sp1 is involved in the transcriptional activation of p16 INK4 by p21 Waf1 in HeLa cells.” FEBS Lett (564), 199–204. Xue, M., Jackson, C.J., 2008. “Autocrine Actions of Matrix Metalloproteinase (MMP)-2 Counter the Effects of MMP-9 to Promote Survival and Prevent Terminal Differentiation of Cultured Human Keratinocytes.” J Invest Dermatol (128), 2676– 2685. Yamauchi, T., Yamauchi, J., Kuwata, T., Tamura, T., Yamashita, T., Bae, N., Westphal, H., Ozato, K., Nakatani, Y., 2000. “Distinct but overlapping roles of histone acetylase PCAF and of the closely related PCAF-B/GCN5 in mouse embryogenesis.” Proc Natl Acad Sci (97), 11303–11306. Yang, A., Schweitzer, R., Sun, D., Kaghad, M., Walker, N., Bronson, R.T., Tabin, C., Sharpe, A., Caput, D., Crum, C., McKeon, F., 1999. “p63 is essential for regenerative proliferation in limb, craniofacial and epithelial development.” Nature (398), 714–718. 234

Yang, L., Mao, C., Teng, Y., Li, W., Zhang, J., Cheng, X., Li, X., Han, X., Xia, Z., Deng, H., Yang, X., 2005. “Targeted Disruption of Smad4 in Mouse Epidermis Results in Failure of Hair Follicle Cycling and Formation of Skin Tumors.” Cancer Res (65), 8671–8678. Yang, X.-J., 2015. “MOZ and MORF acetyltransferases: Molecular interaction, animal development and human disease.” Biochim Biophys Acta - Mol Cell Res (1853), 1818– 1826. Yang, X.-J., Ogryzko, V. V., Nishikawa, J., Howard, B.H., Nakatani, Y., 1996. “A p300/CBP-associated factor that competes with the adenoviral oncoprotein E1A.” Nature (382), 319–324. Yao, T.P., Oh, S.P., Fuchs, M., Zhou, N.D., Ch’ng, L.E., Newsome, D., Bronson, R.T., Li, E., Livingston, D.M., Eckner, R., 1998. “Gene dosage-dependent embryonic development and proliferation defects in mice lacking the transcriptional integrator p300.” Cell (93), 361–372. Yi, Q., Xu, H., Yang, K., Wang, Y., Tan, B., Tian, J., Zhu, J., 2017. “Islet-1 induces the differentiation of mesenchymal stem cells into cardiomyocyte-like cells through the regulation of Gcn5 and DNMT-1.” Mol Med Rep (15), 2511–2520. Yin, Y.-W., Jin, H.-J., Zhao, W., Gao, B., Fang, J., Wei, J., Zhang, D.D., Zhang, J., Fang, D., 2015. “The Histone Acetyltransferase GCN5 Expression Is Elevated and Regulated by c-Myc and E2F1 Transcription Factors in Human Colon Cancer.” Gene Expr (16), 187–196. Yoon, H.-G., Choi, Y., Cole, P.A., Wong, J., 2005. “Reading and function of a histone code involved in targeting corepressor complexes for repression.” Mol Cell Biol (25), 324– 335. Young, M.D., Willson, T.A., Wakefield, M.J., Trounson, E., Hilton, D.J., Blewitt, M.E., Oshlack, A., Majewski, I.J., 2011. “ChIP-seq analysis reveals distinct H3K27me3 profiles that correlate with transcriptional activity.” Nucleic Acids Res (39), 7415–7427. Yu, G., Wang, L.-G., Han, Y., He, Q.-Y., 2012. “clusterProfiler: an R package for comparing biological themes among gene clusters.” OMICS (16), 284–287. Yu, Z., Lin, K.K., Bhandari, A., Spencer, J.A., Xu, X., Wang, N., Lu, Z., Gill, G.N., Roop, D.R., Wertz, P., Andersen, B., 2006. “The Grainyhead-like epithelial transactivator Get-1/Grhl3 regulates epidermal terminal differentiation and interacts functionally with LMO4.” Dev Biol (299), 122–136. Zegerman, P., Canas, B., Pappin, D., Kouzarides, T., 2002. “Histone H3 Lysine 4 Methylation Disrupts Binding of Nucleosome Remodeling and Deacetylase (NuRD) Repressor Complex.” J Biol Chem (277), 11621–11624. Zeng, L., Zhang, Q., Gerona-Navarro, G., Moshkina, N., Zhou, M.-M., 2008. “Structural Basis of Site-Specific Histone Recognition by the Bromodomains of Human Coactivators PCAF and CBP/p300.” Structure (16), 643–652. Zeng, L., Zhou, M.-M., 2002. “Bromodomain: an acetyl-lysine binding domain.” FEBS Lett (513), 124–128. Zhang, J.Y., Green, C.L., Tao, S., Khavari, P.A., 2004. “NF- B RelA opposes epidermal proliferation driven by TNFR1 and JNK.” Genes Dev (18), 17–22.

235

Zhang, P., Liu, Y., Jin, C., Zhang, M., Lv, L., Zhang, X., Liu, H., Zhou, Y., 2016a. “Histone H3K9 Acetyltransferase PCAF Is Essential for Osteogenic Differentiation Through Bone Morphogenetic Protein Signaling and May Be Involved in Osteoporosis.” Stem Cells (34), 2332–2341. Zhang, P., Liu, Y., Jin, C., Zhang, M., Tang, F., Zhou, Y., 2016b. “Histone Acetyltransferase GCN5 Regulates Osteogenic Differentiation of Mesenchymal Stem Cells by Inhibiting NF-κB.” J Bone Miner Res (31), 391–402. Zhang, S., Sun, G., Wang, Z., Wan, Y., Guo, J., Shi, L., 2015. “PCAF-mediated Akt1 acetylation enhances the proliferation of human glioblastoma cells.” Tumor Biol (36), 1455–1462. Zhang, Y., Reinberg, D., 2001. “Transcription regulation by histone methylation: interplay between different covalent modifications of the core histone tails.” Genes Dev (15), 2343–2360. Zhao, A., Qin, H., Fu, X., 2016. “What Determines the Regenerative Capacity in Animals?” Bioscience (66), 735-746. Zhao, L., Pang, A., Li, Y., 2018. “Function of GCN5 in the TGF-β1-induced epithelial-to- mesenchymal transition in breast cancer.” Oncol Lett (16), 3955–3963. Zhao, X.D., Han, X., Chew, J.L., Liu, J., Chiu, K.P., Choo, A., Orlov, Y.L., Sung, W.-K., Shahab, A., Kuznetsov, V.A., Bourque, G., Oh, S., Ruan, Y., Ng, H.-H., Wei, C.-L., 2007. “Whole-Genome Mapping of Histone H3 Lys4 and 27 Trimethylations Reveals Distinct Genomic Compartments in Human Embryonic Stem Cells.” Cell Stem Cell (1), 286–298. Zhao, Y., Garcia, B.A., 2015. “Comprehensive Catalog of Currently Documented Histone Modifications.” Cold Spring Harb Perspect Biol (7), a025064. Zhao, Y., Lang, G., Ito, S., Bonnet, J., Metzger, E., Sawatsubashi, S., Suzuki, E., Le Guezennec, X., Stunnenberg, H.G., Krasnov, A., Georgieva, S.G., Schüle, R., Takeyama, K.-I., Kato, S., Tora, L., Devys, D., 2008. “A TFTC/STAGA Module Mediates Histone H2A and H2B Deubiquitination, Coactivates Nuclear Receptors, and Counteracts Heterochromatin Silencing.” Mol Cell (29), 92–101. Zheng, C., Lu, X., Hansen, J.C., Hayes, J.J., 2005. “Salt-dependent Intra- and Internucleosomal Interactions of the H3 Tail Domain in a Model Oligonucleosomal Array.” J Biol Chem (280), 33552–33557. Zheng, Y., Thomas, P.M., Kelleher, N.L., 2013. “Measurement of acetylation turnover at distinct lysines in human histones identifies long-lived acetylation sites.” Nat Commun (4), 2203. Zhu, A.J., Watt, F.M., 1999. “beta-catenin signalling modulates proliferative potential of human epidermal keratinocytes independently of intercellular adhesion.” Development (126), 2285–2298. Zhu, S., Oh, H.S., Shim, M., Sterneck, E., Johnson, P.F., Smart, R.C., 1999. “C/EBPbeta modulates the early events of keratinocyte differentiation involving growth arrest and keratin 1 and keratin 10 expression.” Mol Cell Biol (19), 7181–7190.