Alu RNA Regulates the Cellular Pool of Active Ribosomes by Targeted Delivery of SRP9/14 to 40S Subunits

Article

Alu RNA regulates the cellular pool of active ribosomes by targeted delivery of SRP9/14 to 40S subunits

IVANOVA, Elena, et al.

Abstract

The human genome contains about 1.5 million Alu elements, which are transcribed into Alu RNAs by RNA polymerase III. Their expression is upregulated following stress and viral infection, and they associate with the SRP9/14 protein dimer in the cytoplasm forming Alu RNPs. Using cell-free translation, we have previously shown that Alu RNPs inhibit polysome formation. Here, we describe the mechanism of Alu RNP-mediated inhibition of translation initiation and demonstrate its effect on translation of cellular and viral RNAs. Both cap-dependent and IRES-mediated initiation is inhibited. Inhibition involves direct binding of SRP9/14 to 40S ribosomal subunits and requires Alu RNA as an assembly factor but its continuous association with 40S subunits is not required for inhibition. Binding of SRP9/14 to 40S prevents 48S complex formation by interfering with the recruitment of mRNA to 40S subunits. In cells, overexpression of Alu RNA decreases translation of reporter mRNAs and this effect is alleviated with a mutation that reduces its affinity for SRP9/14. Alu RNPs also inhibit the translation of cellular mR- NAs resuming [...]

Reference

IVANOVA, Elena, et al. Alu RNA regulates the cellular pool of active ribosomes by targeted delivery of SRP9/14 to 40S subunits. Nucleic Acids Research, 2015, vol. 43, no. 5, p. 2874-2887

DOI : 10.1093/nar/gkv048

Available at: http://archive-ouverte.unige.ch/unige:55879

Disclaimer: layout of this document may differ from the published version.

1 / 1 Nucleic Acids Research Advance Access published February 19, 2015 Nucleic Acids Research, 2015 1 doi: 10.1093/nar/gkv048 Alu RNA regulates the cellular pool of active ribosomes by targeted delivery of SRP9/14 to 40S subunits Elena Ivanova1,*,AudreyBerger1,AnneScherrer1, Elena Alkalaeva2 and Katharina Strub1,*

1Departement´ de biologie cellulaire, UniversitedeGen´ eve,` Sciences III, 1211 Geneve,` Switzerland and 2Engelhardt Institute of Molecular Biology, Russian Academy of Sciences, 119991 Moscow, Russia

Received October 16, 2014; Revised January 08, 2015; Accepted January 12, 2015

ABSTRACT tional control may occur at different steps during protein synthesis, the majority of the mechanisms target translation The human genome contains about 1.5 million Alu initiation (1,2). Downloaded from elements, which are transcribed into Alu RNAs by The canonical pathway for translation initiation proceeds RNA polymerase III. Their expression is upregulated through sequential formation of several initiation com- following stress and viral infection, and they as- plexes (3). Ternary complex and the initiation factors bind sociate with the SRP9/14 protein dimer in the cy- to the 40S ribosomal subunit yielding the 43S preinitiation

toplasm forming Alu RNPs. Using cell-free transla- complex, which is then loaded onto the 5′-proximal region http://nar.oxfordjournals.org/ tion, we have previously shown that Alu RNPs inhibit of an mRNA and scans for the initiation codon. Once the polysome formation. Here, we describe the mecha- initiation codon is positioned at the P-site, the 48S initia- nism of Alu RNP-mediated inhibition of translation tion complex is assembled. The joining of the 60S ribosomal initiation and demonstrate its effect on translation subunit leads to formation of the 80S initiation complex, which then proceeds to elongation cycles. of cellular and viral RNAs. Both cap-dependent and Translation initiation is regulated by the orchestrated ac- IRES-mediated initiation is inhibited. Inhibition in- tion of multiple control mechanisms, many of which re- volves direct binding of SRP9/14 to 40S ribosomal main to be elucidated. We have previously shown that the subunits and requires Alu RNA as an assembly fac- noncoding, retrotransposon-derived Alu RNA in complex by guest on February 27, 2015 tor but its continuous association with 40S subunits with the heterodimeric protein SRP9/14 (forming together is not required for inhibition. Binding of SRP9/14 to the Alu RNP) is able to diminish polysome formation in a 40S prevents 48S complex formation by interfering wheat germ translation system and thus, most likely inter- with the recruitment of mRNA to 40S subunits. In feres with translation initiation (4). These data raised the cells, overexpression of Alu RNA decreases transla- intriguing possibility that Alu RNPs are involved in a novel tion of reporter mRNAs and this effect is alleviated translational control pathway. with a mutation that reduces its afﬁnity for SRP9/14. Alu elements are derived from the 7SL RNA gene (5), which encodes the RNA moiety of the signal recognition Alu RNPs also inhibit the translation of cellular mR- particle (SRP), and following retrotransposition Alu ele- NAs resuming translation after stress and of viral ments now make up over 10% of the human genome mass. mRNAs suggesting a role of Alu RNPs in adapting The modern Alu element is composed of two similar, but the translational output in response to stress and vi- not identical monomers named the left arm and the right ral infection. arm (Figure 1A). Based on mutations at diagnostic posi- tions, Alu elements are divided into three families of different evolutionary ages (8). The most ancient family is INTRODUCTION named AluJ followed by AluS and AluY. Alu elements can Translation regulation ensures protein homeostasis under be part of a polymerase II transcription unit and are there- normal growth conditions. In addition, modulating the fore present in pre-mRNAs and mRNAs. These embedded translation effciency of already existing mRNAs provides Alu sequences can infuence gene expression in many ways a rapid mechanism for adapting protein expression in de- for example by providing alternative splice sites as well as velopment, memory formation, synaptic plasticity and in target sites of miRNAs and editing enzymes (6). response to stress and apoptotic signals. Although transla-

*To whom correspondence should be addressed. Tel : +41 22 379 67 24; Email: [email protected] Correspondence may also be addressed to Elena Ivanova. Email: [email protected]

C The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research. ⃝ This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by-nc/4.0/), which permits non-commercial re-use, distribution, and reproduction in any medium, provided the original work is properly cited. For commercial re-use, please contact [email protected] 2 Nucleic Acids Research, 2015

A B Alu RNP A AC AluY RNP C U

G U ]%[ A A U 40 CG scAluY RNP CG 50 GG 70 CG UC UA C A G A A G A A G A G G CC GAGGCGGG UCAC GGUCAGGA A SRP9/14 80 noi .ffe AluY RNA U C C GG CUCUGCCC CGGUCCU G G AGUG U A A Left arm U G UA C A G A C C UG C 110 A U A 90 A CG 5' U 100 AC A scAluY RNA GC A 120 20 C G A AC 10 A CG A scAlu RNP U G T C A h9/14 U C GG * A A talsnar A A 130 C U AC A A 170 G U A A C A CG U 230 C G U 190 200 220 C G 180 A 210 GG U A U A AA GAA A C CU A G GGC GAGGC GGAG UGGCGU CCCUGG GGAG UGCAGUG GCCGA SRP9/14 A G

U CCG A t G CUCUG CC UC AGCGAGA CGGGUCC CCUC AGUCAC CCGGUU Right arm U G A21 AG C G GA C CG140 280 270 A 260 250 CG 3' 240 GC C G GU GG G A U U GG * 150 [nM] C D E RRL + edeine 0.5 µM 48S assembly 5’ E P A 3’ 120 10000 AMV Buffer 100 5000 5’ E P A 3’ 0 80 AMV 10000 60 AluY A RNP 16-18 nt 5000

40 0

10000 translation eff. [%] 20 scAluY A RNP Downloaded from 0 Fragment analysis 5000 A A ABI PRISM 0

Buffer AluY 10000 scAluY scAluY A RNA 100 nM 5000 Relative fluorescence units

0 A F AluY RNP 10000 h9/14 A 120 scAluY RNP 5000

A http://nar.oxfordjournals.org/ 100 scAluY RNA 0 80 h9/14 5’-end unspecific peaks 48S 60 40 H 150 Buffer 20 AluYA 48S assembly eff. [%] 48S assembly eff. 0 scAluYA 0 200 400 600 800 1000 100 [nM]

G 50 by guest on February 27, 2015 80S assembly Elongation 500 3000 Buffer Buffer [%] eff. assembly 48S 2000 300 0 1000 100 0 48S 80S pre TC 0 500 3000 AluYA RNP AluYA RNP 300 I 120 2000

1000 100 0 100 0 500 3000 scAluYA RNP scAluYA RNP 80 2000 300 Relative fluorescence units 1000 100 60

Relative fluorescence units 0 0 40 unspecific peaks unspecific peaks 80S 80S 5’-end 5’-end preTC 20 48S assembly eff. [%] 48S assembly eff. 0 43S 48S + Alu RNP

Figure 1. Alu RNPs repress translation initiation by inhibiting 48S complex formation. (A)SecondarystructuremodelofAluYA RNA. Binding sites of h9/14 are indicated by analogy to SRP RNA. Preparation of Alu RNPs is described in Supplementary Figure S1. (B)Translationeffciencies of uncapped pPL mRNA in RRL supplemented with increasing concentrations of Alu RNPs or the h9/14 protein or the AluYA/scAluYA RNAs alone. [35S]-labeled proteins were resolved by SDS-PAGE and quantifed by phosphorimager (see Supplementary Figure S2A and B for SDS-PAGE autoradiographs). Trans- lation effciency was calculated as a percentage of the value obtained in the absence of RNPs. Error bars are shown as SD (n 3). (C)Translationeffciencies of uncapped pPL mRNA in RRL translation reaction synchronized by 0.5 ␮M edeine in the presence of 100 nM AluYA/scAluY≥ A RNP. Translation reactions were incubated 3 min at 30◦Cbeforetheadditionof0.5␮Medeine.Translationmixtureswereincubatedanother1minandthensupplementedwith the RNPs. See also Supplementary Figure S2C. (D)Schematicrepresentationofthetoeprintanalysis.Reversetranscriptionbyavianmyeloblastosisvirus reverse transcriptase (AMV) stalls upon encounter with ribosomal complexes. Fluorescently labeled cDNAs were analyzed by capillary electrophoresis. (E) Toeprinting analysis of 48S complexes reconstituted in the presence of 500 nM Alu RNPs, h9/14 or scAluYA RNA. See also Supplementary Figure S2D for toeprint analysis of MVHL-stop mRNA in the absence of 40S and translation factors. (F)Relativeeffciency of 48S complex formation in the presence of increasing concentrations of Alu RNPs, h9/14 or scAluYA RNA. To calculate the effciency of 48S complex assembly, the intensity of the 48S toeprint signal was quantifed as described in ‘Materials and Methods’ section. The relative effciency of 48S complex assembly was expressed as a percentage of the value obtained in the absence of RNPs (buffer). Error bars are shown as SD (n 3). (G)Toeprintanalysisof80Scomplexes(leftpanel)andpreTC (right panel) reconstituted in the presence of 500 nM AluYA RNP or 1 ␮MscAluYA≥RNP. Quantifcation is shown in (H). Error bars are shown as SD (n 3). (I)Relativeeffciency of 48S complex assembly in the presence of 500 nM scAluYA RNP added either to the preassembled 43S complexes (43S) or ≥to preassembled 48S complexes (48S). Error bars are shown as SD (n 3). ≥ Nucleic Acids Research, 2015 3

Alu elements can also be transcribed by RNA polymerase mRNA. For edeine-synchronized translation the reaction III into the noncoding dimeric Alu RNA (7), and under programmed with 125 ng of uncapped pPL mRNA was frst normal physiological conditions their expression is thought incubated for 3 min at 30◦Candthentheinitiationwasar- to be repressed by various cis- and trans-acting factors (8) rested by the addition of edeine to 0.5 ␮M. The reaction was most likely to keep retrotransposition events at low levels. incubated one more minute before the addition of 100 nM However, their abundance is increased about 10-fold and Alu RNPs and translation continued for 15 min. Synthe- higher in response to heat shock and viral infection (6). Rel- sized polypeptides were resolved by SDS-PAGE and quan- atively little is known about cellular functions of Alu RNA. tifed by phosphorimager analysis. It has been shown to inhibit pol. II-dependent transcription, and its inhibitory activity was assigned to the right arm Assembly and analysis of translation complexes (9). The dimeric Alu RNA transcripts can be further pro- For 43S complex assembly 75 nM 40S ribosomal subunits cessed into small cytoplasmic Alu (scAlu) RNA by en- were incubated with 500 nM eIF2, 100 nM eIF3, 200 nM Met donucleolytic cleavage (10) (Figure 1A), and Alu and scAlu eIF1, 200 nM eIF1A and 75 nM Met-tRNAi for 10 min RNAs have been shown to form complexes comprising at 37◦C. To assemble the 48S complex on the MVHL-stop SRP9/14 and, for the dimeric Alu RNP, the poly(A)- mRNA the 43S complex reaction was supplemented with binding protein (11–13). 200 nM eIF4GI738–1116,200nMeIF4A,200nMeIF4B, SRP9/14 was discovered as a subunit of SRP,which binds 37.5 nM mRNA and incubated at 37◦C for another 10 min. the Alu portion of 7SL RNA. The protein is required for For toeprint assays, the mRNA was incubated with fuo- Downloaded from the elongation arrest activity of SRP, which ensures effcient rescently labeled oligonucleotide for 10 min at 37◦C before protein translocation into the endoplasmic reticulum (ER) addition to the assembly reaction. The 80S complex was as- in mammalian cells (14). In addition to forming complexes sembled by incubating the 48S complex with 200 nM eIF5, with 7SL RNA and Alu RNA, the majority of SRP9/14 200 nM eIF5B and 100 nM 60S subunits at 37◦Cfor10min.

exists as a free protein in primate cells (11). Peptide elongation reaction and assembly of preTC was per- http://nar.oxfordjournals.org/ In the present study, we have investigated the role of Alu formed by incubation of the 80S complex with 300 nM RNPs in regulating translation using both a rabbit reticu- eEF1, 50 nM eEF2 and 100 nM aminoacylated total calf locyte lysate and a mammalian translation system reconsti- liver tRNA for 10 min at 37◦C. All assembly reactions were tuted from purifed components. Our studies demonstrate performed in buffer containing 20 mM Tris–HCl pH 7.5, that Alu RNPs interfere with the formation of the 48S com- 120 mM KCl, 2.5 mM MgCl2,2mMDTT,0.25mMsper- plex by a novel mechanism in which Alu RNPs act directly midine, 0.1 mM ethylenediaminetetraacetic acid (EDTA), 2 on the 40S ribosomal subunit to prevent its association with mM adenosine triphosphate (ATP )and 0.2 mM guanosine the mRNA. Moreover, the SRP9/14 protein dimer consti- triphosphate (GTP). tutes the inhibitory component, which has to be transferred Reaction mixtures for 48S complex assembly on HCV- by guest on February 27, 2015 to 40S by the Alu RNA. This mechanism effciently inhibits NS’ mRNA contained 75 nM 40S subunits, 500 nM eIF2, cap-dependent as well as IRES-mediated translation initi- 100 nM eIF3 and 37.5 nM HCV-NS’ mRNA. The CrPV- ation. Overexpression of Alu RNA in HEK 293T cells in- 40S complex was obtained by incubating 75 nM 40S sub- hibits in an SRP9/14-dependent fashion translation of mR- units with 75 nM CrPV-VHLM mRNA. NAs that initiate protein synthesis de novo. Our results are Toeprint assay was performed as described previously consistent with a physiological role of Alu RNPs in the (19) except that reverse transcription reaction was incu- translational response to viral infection and stress. bated for 15 min at 37◦C. For quantifcation, the toeprint signal from the translation complex was expressed as a percentage of the combined intensities of itself, the signal MATERIALS AND METHODS from the 5′-end of the mRNA and all peaks between them. Plasmid construction, in vitro transcription, purifcation of Toeprint signals on CrPV-VHLM RNA were quantifed us- the proteins, RNPs and ribosomal subunits, aminoacyla- ing invariable peaks in the area between AUG and 3′-end of tion of tRNA, ribosome binding assay, cell culture and the mRNA. Briefy, the intensity of 48S toeprint was nor- northern blot are described in the ‘Extended Methods’ sec- malized to one of the three different peaks which intensity tion. was constant throughout different experiments. All three normalizations gave identical results. 43S and 48S complexes assembled with [35S]-Met- In vitro translation in RRL Met 32 tRNAi and [ P]-MVHL-stop mRNA were subjected to RRL (Green Hectares, Oregon, USA) was treated with mi- centrifugation through 5–25% sucrose gradient containing crococcal nuclease as described (49) with some modifca- 20 mM Tris–HCl pH 7.5, 100 mM potassium acetate, 5 mM tions: micrococcal nuclease concentration was decreased to MgCl2, 2 mM DTT in a Beckman SW60 rotor at 60000 rpm 75 U/ml fnal and incubation time was reduced to 10 min at for 2 h. Fractions were analyzed by scintillation counting. 35 20◦C. Translation reactions containing L-[ S]-methionine (Anawa, Zurich, Switzerland) were carried out in the pres- Transfection, luciferase assay and metabolic labeling ence of 100 mM potassium acetate and 1.5 mM magnesium acetate in a fnal volume of 10 ␮lat30◦Cfor20min.Trans- HEK 293T cells were transfected with TransIT-T2020 lation mix was preincubated with Alu RNPs, Alu RNAs reagent (Mirus) according to manufacturer’s protocol. Lu- or h9/14 for 3 min at 30◦C prior to addition of 125 ng ciferase assays were performed 24 h post-transfection using 4 Nucleic Acids Research, 2015

Luciferase Assay Kit (Promega). For estradiol-induced lu- of either AluYA or scAluYA RNPs diminished the transla- ciferase expression, HEK 293T cells were transiently trans- tion effciencies of pPL mRNA in a similar, dose-dependent fected with a GAL-responsive luciferase reporter plasmid manner whereas the addition of RNA or protein alone had and with a plasmid expressing the protein GAL4 fused no effect (Figure 1B). Translation effciency was reduced to to the hormone binding domain of human estrogen re- 50% in the presence of 100 nM AluYA or scAluYA RNPs ceptor. Cells were stimulated with 100 nM estradiol at and, surprisingly, remained unchanged up to 5-fold higher 24 h post-transfection and bioluminescence was recorded RNP concentrations indicating that the inhibitory effect continuously for 24 h. Metabolic labeling with [35S]- reached saturation. methionine/cysteine was performed 48 h post-transfection. In contrast, Alu RNPs were unable to inhibit the synthe- After 15 min, pulse labeling cells were washed twice with sis of pPL when added to translation reactions that were ice-cold phosphate buffered saline and lysed in buffer con- after a short incubation treated with 0.5 ␮M edeine (‘Ma- taining 20 mM Tris–HCl pH 7.5, 300 mM KCl, 1% Triton terials and Methods’ section). Edeine inhibits initiation but X-100, 0.1% SDS, 1 mM EGTA and protease inhibitors. allows translation of already formed initiation complexes Aliquots of lysates were precipitated with 10% TCA, pel- (17) (Figure 1C). This shows experimentally that Alu RNPs lets were boiled for 15 min washed twice with 10% TCA interfere with initiation in RRL translation reactions. followed by acetone, dissolved in 1% SDS and analyzed by We next studied the effect of Alu RNPs on the assem- scintillation counting. Where indicated, cells were treated bly of different translation complexes from purifed mam- with 500 ␮M sodium arsenite for 30 min then the media malian translation factors and high-salt purifed riboso- was changed and cells were allowed to recover for 0, 30, 60, mal subunits (18). The assembly effciency was determined Downloaded from 90 and 120 min prior to pulse labeling. by primer extension inhibition (toeprinting) using fuorescently labeled DNA primers and capillary electrophoresis Viral infection (Figure 1D) (19,20). To study the effect of Alu RNPs on 48S complex assem- HEK293T cells were transfected with pDL7enh, pDLscAlu bly, we combined initiation factors, 40S ribosomal subunits, http://nar.oxfordjournals.org/ or pDL4.5S and 24 h later infected with VSV-PeGFP (50) Met methionyl-tRNAi , ATP, GTP and Alu RNPs prior to at a multiplicity of infection of 10 PFU/cell in Dulbecco’s addition of the mRNA (Material and methods). In the pres- modifed Eagle’s medium (DMEM) 2% fetal bovine serum ence of either AluYA or scAluYA RNPs a dose-dependent (FBS). Six hours post-infection, the media was changed and 35 decrease in the effciency of 48S complex formation was ob- cells were pulse labeled with [ S]-methionine/cysteine for served reminiscent of the dose-dependent decrease of trans- 15 min, proteins were precipitated in 10% TCA, resolved by lation observed in RRL. Like in RRL, the RNA or protein SDS-PAGE and quantifed by phosphorimager analysis. components alone had no effect on 48S complex formation (Figure 1E and F). Interestingly, the inhibition seen for Statistics AluYA RNP was stronger than for scAluYA RNP suggest- by guest on February 27, 2015 ing that both arms contribute individually to the activity Error bars in the fgures represent the standard deviation (Figure 1F). This difference was not observed in the RRL, (SD) or where indicated as the standard error of the mean probably because the less stable right arm of the AluYA (SEM). Statistical analysis was performed using an un- RNP was partially degraded during the translation reaction paired two-tailed Student’s t test. Analysis of the luciferase (4). expression data was done using the paired two-tailed t test. We further analyzed the effect of Alu RNPs on 80S complex assembly and elongation. To this end, Alu RNPs were RESULTS added to the reconstituted 48S and 80S complexes before Alu RNPs inhibit assembly of 48S initiation complex forming 80S and pre-termination complexes (preTC), respectively ((‘Materials and Methods’ section). We observed Expression of the three different families of Alu elements no signifcant changes in the effciencies of 80S initiation has so far been poorly investigated. Based on cDNA anal- complex formation and of preTC formation in the presence ysis (15,16), the AluY elements are most abundantly ex- of AluYA and scAluYA RNPs (Figure 1GandH). pressed. We therefore chose to use in vitro transcribed These results demonstrated that Alu RNPs inhibit trans- AluYA and scAluYA RNAs derived from the Alu element lation initiation in mammalian translation systems consis- in the human ␣-fetoprotein gene (Table 1)togetherwith tent with the differences observed in the polysome profles human SRP9/14 (h9/14) to assemble AluYA and scAluYA using the wheat germ translation system (4). The inhibitory RNPs, respectively. The RNPs were purifed by gel fltration effect occurs prior to formation of the 48S complex. In the chromatography, and the integrity of the RNA moiety was reconstituted mammalian system, the inhibition was max- confrmed by denaturing polyacrylamide gel electrophore- imal at 5-fold higher particle concentration (500 nM) than sis followed by ethidium bromide staining (Supplementary in RRL (100 nM), which we attributed to absolute and rel- Figure S1B). Western blot analysis demonstrated that the ative differences in the abundances of active ribosomes and AluYA and the scAluYA RNPs contained, respectively, two initiation factors as compared to RRL. Moreover, a frac- and one molecules of h9/14 per molecule of RNA (Supple- tion of the Alu particles might be inactivated by nonspecifc mentary Figure S1C). binding to components present at elevated and imbalanced To examine the effects of AluYA and scAluYA RNPs on concentrations in the reconstituted system. translation we used a rabbit reticulocyte lysate (RRL) programmed with bovine preprolactin (pPL) mRNA. Addition Nucleic Acids Research, 2015 5

Table 1. Alu RNAs and Alu RNPs used in this study RNP Family Origin Protein component

AluYA Y Dimeric Alu, human ␣-fetoprotein gene, NG 023028.1 h9/14 scAluYA Y Left arm Alu, human ␣-fetoprotein gene, NG 023028.1 h9/14 scAluYL Y Left arm Alu, human low-density lipoprotein receptor gene NM 001195803.1 h9/14 scAluYa5 Y Left arm Alu, Alu Ya5a consensus sequence h9/14 scAluYf2 Y Left arm, Alu Yf2a consensus sequence h9/14 scAluYj4 Y Left arm, Alu Yj4a consensus sequence h9/14 SA151 7SL SRP-Alu domain, nucleotides 1–99 and 251–299 of the human 7SL RNA gene h9/14 SA110 7SL SRP-Alu domain, nucleotides 1–74 and 271–299 of the human 7SL RNA gene h9/14 SA86 7SL SRP-Alu domain, nucleotides 1–64 and 283–299 of the human 7SL RNA gene h9/14 scAluYA 14A5 Y Left arm Alu, human ␣-fetoprotein gene h9/14A5 scAluYA 9–3A Y Left arm Alu, human ␣-fetoprotein gene h9-3A/14 scAluYNF1 Y Left arm Alu, human NF1 gene (51)- aConsensus sequences were taken from Repeat Masker library, www.repeatmasker.org.

AluY RNA but not the Alu portion of 7SL RNA confers in- basic pentapeptide in the C-terminal region of SRP14 and hibitory activity to the Alu RNP

three lysines in SRP9 (Figure 2D, residues labeled in black) Downloaded from that are essential for the elongation arrest activity of the As mentioned before Alu RNPs are ancestrally related to SRP (14,21). The two patches are located in proximity in the Alu domain of SRP.However, the latter inhibits nascent SRP9/14 and were therefore proposed to form together a chain elongation and has no function in translation ini- functional minidomain (21). We decided to investigate the tiation. We wanted to examine whether the Alu domain possibility that the same amino acid residues may also be alone, separated from the S domain of SRP, was able to required for Alu RNP-mediated inhibition of translation. http://nar.oxfordjournals.org/ inhibit translation initiation. We synthesized RNA repre- We assembled scAluYA RNPs with the mutated proteins senting truncated versions of the 7SL Alu domain (SA86, h9/14A5 and h9-3A/14 (Figure 2D). The scAluYA RNA SA110 and SA151, Supplementary Figure S3A, Table 1). formed stable complexes with both mutated protein dimers Furthermore, we produced AluY RNAs representing the (Supplementary Figure S4A). different subfamilies of the genomic AluY elements to gen- When added to pPL-primed RRL the scAlu RNPs con- eralize our fndings on AluY RNPs (Table 1, Supplemen- taining h9-3A/14 and h9/14A5 completely failed to inhibit tary Figure S3C). Particles were purifed and analyzed as translation (Figure 2E), and each particle had a strongly before and their RNA and protein contents were consistent reduced capacity to inhibit formation of the 48S complex with a 1:1 stoichiometry of the complexes (Supplementary by guest on February 27, 2015 (Figure 2F). Figure S3E). These results demonstrated that SRP9/14 is essential for The effect of the AluYL and SA110 RNPs on translation the inhibitory activity of the Alu RNP, and that the func- effciency was monitored at different concentrations in the tional activity of the Alu RNP involves the same minido- pPL-primed RRL. The scAluYL RNP decreased the trans- main in SRP9/14 as the elongation arrest activity of SRP. lation effciency in a concentration-dependent way reminiscent of the results obtained for the scAluYA RNP (Figures 1B and 2A). In contrast, the SA110 RNP had no effect at all Alu RNPs prevent association of the 43S complex with the concentrations tested. Analysis of the activities of three ad- mRNA ditional AluY RNPs and of SA86 and SA151 RNPs showed Next, we wanted to address the question whether Alu RNPs that all AluY RNPs inhibited translation whereas SA151 interfere with the formation of the 48S complex, which is to and SA86 RNPs had no effect (Figure 2B). say with the recruitment of the mRNA to the 43S complex, We chose two representative RNPs, scAluYL and the or whether they already inhibit 43S complex formation. To SA110 RNPs, to determine the effects on 48S complex for- this end, we reconstituted 43S and 48S complexes from puri- mation. We observed a concentration-dependent decrease fed components in the presence of the AluYA or scAluYA in the formation of the 48S complex for the scAluYL RNP RNPs and as a negative control we used the SA110 RNP. whereas the SA110 RNP had no detectable effect at all con- Formation of 43S and 48S complexes was performed in the 35 Met 32 centrations (Figure 2C). presence of [ S]-Met-tRNAi or [ P]-labeled MVHL- Hence, despite a remarkable sequence similarity between stop mRNA, respectively, and the assembly reactions were the SRP Alu RNA and the AluY RNAs, only the AluY fractionated by sucrose gradient centrifugation to monitor RNPs, and not the SRP Alu domain, possess the inhibitory the distribution of the radioactive components. activity. None of the Alu RNPs affected the association of [35S]- Met Met-tRNAi with the 40S subunit (Figure 3A). In contrast, a signifcant reduction in [32P]-labeled mRNA was The functional activity of the Alu RNP depends on specifc found to comigrate with 40S subunits in the presence of amino acid residues in SRP9/14, which are also required for AluYA and scAluYA RNPs and a corresponding increase of elongation arrest activity of SRP free RNA was observed in the upper fractions (Figure 3B). Mutational analysis of SRP9/14 revealed that it contains As also observed in the toeprint assay (Figure 1E), the ef- two positively charged patches of amino acid residues, a fect was more pronounced for the AluYA RNP than for 6 Nucleic Acids Research, 2015

A D 95 100 105

[%] 107±3 SA110 100 h14 wt LKKRDKKNKTKKTKAAAAA eff.

80 h14A5 LKAAAAANKTKKTKAAAAA 60 50±2 scAluY L 60 65 40 20 h9 wt DVKKIEK FHSQLMRLM

Translation h9-3A DVAAI EAFHSQL MRLM 0 0 20 4060 80 100 RNP [nM] B E 120 [%] 100 A 80 107±19 scAluY 9-3A 100 103±20 scAluYA 14A5 60 40 eff.[%] Downloaded from 20 ion 50 46±8 scAluYA

Translation eff. 0

Translat 0 SA86 Buffer SA151 020406080100 scAluYf2scAluYj4 scAluYa5 RNP [nM] 100 nM http://nar.oxfordjournals.org/ C F

100 100 83±3 scAluYA 14A5 91± 13 SA 110 80 80 78±10 scAluYA 9-3A 60 60 A 49 ± 6 scAluYL 48± 6 scAluY 40 40 20 20 0 by guest on February 27, 2015

0 48S assembly eff. [%] 05001000

48S assembly eff. [%] 0 500 1000 RNP [nM] RNP [nM]

Figure 2. The inhibitory activity of the Alu RNP depends on the identity of its RNA component and the presence of the two positively charged patches in SRP9/14. (A)Translationeffciency of uncapped pPL mRNA in RRL supplemented with increasing concentrations of the SA110 or the scAluYL RNP. Error bars are shown as SD (n 3). See also Supplementary Figure S3B. (B)Translationeffciency of uncapped pPL mRNA in RRL supplemented with 100 nM SA151, SA86, scALuYa5,≥ scAluYf2 or scAluYj4 RNPs. Error bars are shown as SD (n 3). See also Supplementary Figure S3D. (C) Relative effciency of 48S complex formation in the presence of increasing concentrations of SA110 or scAluY≥ L RNPs. Error bars are shown as SD (n 3). (D) Mutations introduced in the h14 and h9 proteins. Numbers correspond to the human sequence. Amino acid residues of interest are shown in black.≥ Mutated residues are shown in grey. (E)Translationeffciency of uncapped pPL mRNA in RRL supplemented with increasing concentrations of scAluYA,scAluYA 14A5 or scAluYA 9-3A RNPs. Error bars are shown as SD (n 3). See also Supplementary Figure S4B. (F)Relativeeffciency of 48S complex formation in the presence of increasing concentrations of scAluYA,scAluY≥ A 14A5 or scAluYA 9-3A RNPs. Error bars are shown as SD (n 3). ≥ the scAluYA RNP. Addition of the inactive SA110 RNP to Alu RNPs inhibit initiation of capped mRNAs with different the assembly reaction did not affect the association of the 5′ UTRs mRNA with the 40S subunit. So far, we used uncapped mRNAs in the experiments. How- To confrm that Alu RNPs inhibited initiation after 43S A ever, translation of mRNAs in vivo usually depends on the complex formation, we added the scAluY RNP to the pre- cap structure. In addition, most translation regulators affect assembled 43S complexes prior to addition of mRNA. The mRNA recruitment to the 43S complex by interacting with intensity of the 48S toeprint was strongly decreased (Figure the 5′ or 3′ UTR of the mRNA. To investigate whether the 1I). In contrast, the addition of the scAluYA RNP to the cap structure and the 5′ UTR affect the inhibitory activity assembled 48S complexes did not cause its dissociation. of Alu RNPs, we generated reporter constructs in which the Taken together these results indicate that Alu RNPs pre- Firefy luciferase coding sequence (Fluc) was fused to the 5′ vent the association of the 43S complex with the mRNA. UTRs of the ␤-globin (␤-glo), ␤-actin (␤-act) and LINE-1 Furthermore, Alu RNPs cannot displace the mRNA, once (L1) mRNAs. The ␤-glo and ␤-act mRNAs have relatively the 48S complex is assembled. short 5′ UTRs (53 and 84 nucleotides, respectively) while the L1 5′ UTR is GC-rich and 900 nucleotides in length. Uncapped and capped transcripts of the three reporter con- Nucleic Acids Research, 2015 7

43S Buffer 20 Buffer 20 Buffer ]%[ ANRt - ] S

]%[ ]%[15 ANRt - ] S [ AluYA A 43S 43S scAluY SA110

ANRt-]S

Met 15

Met 15 Met 10 10 10

[

35 35

35 5 5 [ 5

1 5 10 15 1 5 10 15 1 5 10 15 Fraction Fraction Fraction B 20 Buffer Buffer ]%[ 20 Buffer

]%[ ]%[ AN A 15 AluYA 48S scAluY 48S SA110

ANRm-]P 48S 15

15 ANRm-

Rm 10 10

-]P [ -]P

10 ]P 48S

48S 32

[ 32

[ 5 5 5 Downloaded from

1 5 10 15 1 5 10 15 1 5 10 15 Fraction Fraction Fraction

Figure 3. Alu RNPs do not affect 43S complex formation but prevent its recruitment to the mRNA. (A, B)43Sand48Scomplexeswerereconstitutedin

A, A 35 Met 32 http://nar.oxfordjournals.org/ the presence of 0.5 ␮MAluY scAluY or SA110 RNPs and either [ S]-Met-tRNAi (A) or [ P]-labeled MVHL-stop mRNA (B). Reconstitution reactions were fractionated on 5–20% sucrose gradients. Results are expressed as percentage of total cpm across all fractions. All experiments were repeated twice. structs were translated in RRL in the presence of AluYA RNP and the scAluYA 14A5 RNP, the negative controls, and scAluYA RNPs. Translation effciencies were not sig- did not signifcantly reduce the formation of 48S initiation nifcantly different between the capped and uncapped tran- complexes (Figure 4CandD). scripts and between the reporter mRNAs comprising differ- We conclude that the mechanism of translation inhibi-

ent 5′ UTRs (Figure 4A). They were reduced by 40–60% in tion by Alu RNPs is neither mRNA template- nor initiation by guest on February 27, 2015 the presence of both Alu RNPs (Figure 4A). Hence, Alu factor-dependent, which suggested to us that the Alu RNP RNPs can inhibit cap-dependent translation of mRNAs might act directly on the 40S subunit. with different 5′ UTRs. Alu RNA promotes functional binding of SRP9/14 to 40S Alu RNPs inhibit IRES-dependent translation initiation subunits Many viruses have evolved alternative mechanisms of trans- In parallel experiments in our laboratory, we have recently lation initiation that use internal ribosome entry sites discovered that SRP9/14 can bind directly to 40S subunits (IRES) in the 5′-UTRs of viral mRNAs. IRES-mediated and that binding to 40S is required for stress granule local- initiation is cap-independent and bypasses the requirements ization. Furthermore, we found that binding of SRP9/14 for certain initiation factors. to 40S subunits and Alu RNA is mutually exclusive (24). To determine whether Alu RNPs could also block IRES- However, translation initiation is only inhibited by the Alu mediated translation initiation, we made reporter con- RNP and not by the protein alone, and both the RNA and structs containing IRES sequences from the hepatitis C protein moieties are essential for the inhibitory activity of virus (HCV) and the cricket paralysis virus (CrPV) up- the Alu RNP. To study the roles of the RNA and the pro- stream of Fluc. Formation of the 48S complex on HCV tein components of the Alu RNP in inhibiting initiation, IRES is dependent on eIF3 and either eIF2/eIF5 or eIF5B, we performed binding experiments. High salt purifed 40S whereas the CrPV IRES directly recruits the 40S subunit to and 60S subunits were incubated with the scAluYA RNP the start codon without the need for initiation factors (22). and with h9/14 alone, and the complexes fractionated on Both AluYA and scAluYA RNPs reduced the translation sucrose gradients. effciencies of both reporter mRNAs by approximately 50% Upon addition of the scAluYA RNP to either of the two (Figure 4A). Furthermore, the Alu RNPs containing the subunits, we found one third of h9/14 comigrating with 40S mutated h9/14A5 or h9–3A/14 did not signifcantly inhibit subunits whereas less than 10% comigrated with the 60S CrPV- and HCV-mediated translation (Figure 4B). subunits (Figure 5A). Remarkably, the scAluYA RNA mi- We also performed 48S complex assembly on CrPV- grated exclusively in the top fractions consistent with the VHLM (see Supplementary Methods) and the HCV-NS’ notion that the 40S-bound h9/14 was dissociated from the (23) mRNAs containing the HCV and the CrPV IRES, re- Alu RNA. In contrast, free h9/14 bound quantitatively and spectively. In both cases, 48S complex formation was specif- nonselectively to both the 40S and the 60S subunits (Fig- ically inhibited by the scAluYA RNP whereas the SA110 ure 5B). 8 Nucleic Acids Research, 2015

AB 140 Buffer

100 ]%[ Buffer 120 h9/14A5 A

scAluY n .ffe h9-3A/14 80 100 AluYA

60 80

o it

40 alsn 60

a rt

translation eff. [%] 20 20 0 β-glo β-act L1 β-glo β-act L1 HCV CrPV 0 CrPV HCV uncapped capped

C HCV D CrPV Downloaded from

10000 Buffer 10000 Buffer 5000 5000 0 0 A A 10000 scAluY 10000 scAluY http://nar.oxfordjournals.org/ 5000 5000 0 0 10000 10000 scAluY A 14A5 scAluY A 14A5 5000 5000 0 0 Relative fluorescence units Relative fluorescence units 10000 10000 SA110 SA110

5000 by guest on February 27, 2015 5000 0 0 Electrophoretic mobility 5’-end unspecific peaks 48S 5’-end unspecific peaks 48S

100 100

80 80

60 60

40 40

20 20 48S assembly eff. [%] 48S assembly eff. 0 [%] 48S assembly eff. 0 A A

A A SA110 SA110 scAluY scAluY

scAluY 14A5 scAluY 14A5

Figure 4. Alu RNPs inhibit cap-dependent and IRES-dependent translation. Translation effciencies in RRL of the indicated reporter mRNAs in the presence of (A)100nMAluYA or scAluYA RNP; (B)100nMscAluYA 14A5 RNP or scAluYA 9–3A RNP. The translation effciency of each mRNA in the absence of the RNP (buffer) was set to 100%. Error bars are shown as SD (n 3). See also Supplementary Figure S5A. (C)Toeprintanalysisof48S complex assembly on HCV-NS’ mRNA (23) in the presence of 1 ␮MAluRNPsasindicated.Quanti≥ fcation is shown in lower panel. Dashed line indicates 48S complex assembly in the absence of RNPs, which was set to 100%. Error bars are shown as SD (n 3). (D) Toeprint analysis of 48S complex assembly on CrPV-VHLM mRNA in the presence of 0.5 ␮MAluRNPs.Quantifcation is shown in lower panel.≥ Dashed line indicates 48S complex assembly in the absence of RNPs, which was set to 100%. Error bars are shown as SD (n 3). See also Supplementary Figure S5B. ≥ Nucleic Acids Research, 2015 9

A B C scAluYA RNP + 40S 1 2 3 4 5 6 7 8 9 10 11 12 1314 h9/14 + 40S 40S 60S A h14 1 2 3 4 5 6 7 8 9 10 11 12 1314 scAluY RNP 60S 10 min. or 40S + h14 37˚C 80S h9/14 scAlu 40S 60S S15 S15 40S 60S 80S scAluYA RNP + 60S h9/14 + 60S 1 2 3 4 5 6 7 8 9 10 111213 1415 1 2 3 4 5 6 7 8 9 10 11 12 1314 1 2 3 4 5 6 7 8 9 10 11 1213 14 scAluYA RNP h14 h14 h14 h9/14 h14 scAlu L9 L9

D E 15±3% 40S Downloaded from 1 2 3 4 5 6 7 8 9 10 11 12 1314 1 2 3 4 5 6 7 8 9 10 11 12 1314 h14 h14 scAluYA RNP scAluYA 14A5 RNP + 40S + 43S scAlu scAlu

6±2% 40S http://nar.oxfordjournals.org/ 1 2 3 4 5 6 7 8 9 10 11 12 1314 1 2 3 4 5 6 7 8 9 10 11 12 1314 h14 SA110 RNP scAluYA 9-3A RNP h14 + 43S + 40S scAlu SA110 F

120 120 120 by guest on February 27, 2015 100 100 * 100 ** ** 80 ** 80 80 60 60 60 40 40 40

translation eff. [%] translation eff. 20 [%] translation eff. 20 [%] translation eff. 20 0 0 0 - + + + - - RNP 100 nM - + + + - - RNP 100 nM - + + + - - RNP 100 nM - - + - + - h9/14 100 nM - - + - + - RNA 100 nM - - + - + - h9/14A5 100 nM - - - + - + h9/14 200 nM - - - + - + RNA 200 nM - - - + - + h9/14A5 200 nM

Figure 5. Alu RNA is required for the specifcdeliveryofSRP9/14 to an inhibitory site in the 40S subunit. Binding of scAluYA RNP (A)orh9/14 (B)to the 40S (top panel) or 60S (bottom panel) subunits. Equimolar amounts of RNP were incubated with ribosomal subunits and the binding reactions were fractionated on 5–20% sucrose gradients. Fractions 13 and 14 contain 40S dimers. (C)BindingofscAluYA RNP (upper panel) or h9/14 (lower panel) to the reassembled 80S ribosomes. To form 80S ribosomes, equimolar amounts of 40S and 60S were incubated at 37◦Cfor10min.AluRNPwasaddedand the binding reaction was incubated for another 10 min and fractionated on 10–30% sucrose gradients. 40S- and 60S-containing fractions were identifed by probing for S15 and L9, respectively. (D)BindingofscAluYA RNP (left panel) or SA110 RNP (right panel) to the 43S complex. SRP9/14 in ribosomal fractions was quantifed from Western blots against h14. The signal intensities in 40S-containing fractions (9 and 10) were expressed as a percentage of the total signal intensity across all fractions. Data are shown as mean SD (n 3). (E)BindingofscAluYA 14A5 RNP (top panel) or scAluYA 9-3A RNP (bottom panel) to 40S subunits. (F)Translationeffciency of pPL mRNA± in≥ RRL supplemented with 100 or 200 nM h9/14 (left panel), scAluYA RNA (middle panel) or h9/14A5 (right panel). scAluYA RNP were added to 100 nM. Error bars are shown as SD (n 3). *P < 0.05, **P < 0.01 by Student’s t-test. See also Supplementary Figure S7. ≥

We next examined the binding of the scAluYA RNP and the addition scAluYA RNP we found h9/14 to be exclu- h9/14 to 80S ribosomes. To this end, 80S ribosomes were sively associated with 40S subunits whereas in the absence allowed to associate from high salt purifed 40S and 60S of the Alu RNA the protein bound nonselectively and was subunits for 10 min before the addition of the Alu RNP or equally distributed between 40S and 60S containing frac- h9/14. Only a fraction of the subunits assembled into 80S tions (Figure 5C). Hence, the presence of the Alu RNA ap- ribosomes in the presence of 1.5 mM magnesium acetate pears to confer binding specifcity to h9/14. This is further and individual subunits were therefore still present. Upon supported by the fact that all h9/14 bound quantitatively 10 Nucleic Acids Research, 2015 to 40S subunits even when present in a 2-fold molar excess subunits. These results indicated that SRP9/14 binding to over 40S indicating that it has more than one binding site on the 40S subunit was required but not suffcient for Alu the 40S subunit (Supplementary Figure S6). In contrast the RNP-mediated inhibition of 48S complex formation. Sup- presence of 2-fold molar excess of scAluYA RNP over 40S plementing the translation reactions containing scAluYA did not increase the amount of the 40S-bound h9/14 sug- RNP with equimolar amounts of h9/14A5 did not sig- gesting that in this case the binding is saturable and occurs nifcantly change the inhibitory activity of the scAluYA most likely to one specifc site on the ribosome. RNP (Figure 5F, right panel). However, a 2-fold excess of We also incubated 43S complexes reconstituted from pu- h9/14A5 over the scAluYA RNP diminished the inhibitory rifed components with scAluYA RNP. We found 15% of effect. Binding of h9/14 to Alu RNAs is characterized by SRP9/14 comigrating with the 43S complex (Figure 5D, high on and off-rates (25). In the presence of an excess of top panel). The amount of SRP9/14 bound to 40S was re- h9/14A5 over the wild-type protein, the latter was presum- duced 3-fold in the sample containing the inactive SA110 ably exchanged with the mutated protein forming the in- RNP (Figure∼ 5D, bottom panel). The correlation between active scAluYA 14A5 RNP, which lead to a loss in the in- the ability of Alu RNPs to promote binding of h9/14 to hibitory activity of the RNP. the 40S subunit and the corresponding capacity to inhibit translation initiation was fully consistent with the notion Increased cellular levels of Alu RNA decrease synthesis of re- that the RNA component of the Alu RNP acted as an as- porter proteins in mammalian cells sembly factor to promote functional binding of SRP9/14 to 40S subunits. We next wanted to determine whether in the cell an increase Downloaded from in Alu RNP levels could infuence translation effciency. We Alu RNA is not part of the inactive 40S complex chose to express the short scAlu RNA in HEK 293T cells, because it is more stable than Alu RNA (26) and because it The previous results suggested that the functional associ- lacks the inhibitory activities in Pol II-dependent transcrip- ation of SRP9/14 with the 40S subunit mediated by the

tion and in PKR activation (9,27,28). The overexpressed http://nar.oxfordjournals.org/ Alu RNA is suffcient to render 40S incompetent for initia- scAluYNF1 RNA (Table 1) is expected to bind SRP9/14, tion. If indeed the continuous association of the Alu RNA since human cells have a large pool of free SRP9/14 (11). were not required to inactivate the 40S subunit, the released As controls, we expressed 7SL RNA and 4.5S RNA, a 90 RNA might serve in another round of targeted delivery of nucleotide-long, rodent-specifc RNA, which fails to bind free SRP9/14 to 40S. To assess this hypothesis, we supple- SRP9/14 (29). Expression of the RNAs was confrmed by mented the RRL translation reaction containing scAluYA northern blot analysis (Figure 6B) which showed that lev- RNP with an equal amount or a 2-fold excess of h9/14. els of scAluYNF1 RNA and 7SL RNA were increased 5–10 The presence of excess h9/14 signifcantly enhanced the in- A and 1.5–2-fold respectively, compared to the corresponding hibitory activity of the scAluY RNP, while the protein by guest on February 27, 2015 endogenous RNA levels. alone at the same concentrations had no effect on transla- The effect on translation was assessed by co-transfection tion (Figure 5F, left panel). Hence, the Alu RNA is not part of plasmids expressing the non-coding RNAs (ncRNAs) to- of the inactive 40S complex. gether with reporter plasmids expressing the Fluc down- Next, we examined whether an excess of Alu RNA over stream of different 5 UTRs (Figure 6A). We also studied Alu RNP affected the activity of the Alu RNP. An equal ′ IRES-dependent protein synthesis using bicistronic genes amount or a 2-fold excess of the scAluYA RNA over the in which the Renilla (Rluc) and Firefy luciferase coding se- scAluYA RNP attenuated the inhibition (Figure 5F, middle quences were separated by an IRES element. panel). These results are consistent with the mutually ex- Expression of the Fluc was reduced for all reporter plas- clusive and reversible binding of SRP9/14 to either the Alu mids co-expressed with the scAluYNF1 RNA (Figure 6C). RNA or to a functionally important site in the 40S subunit. Similarly, the cap-dependent translation of Rluc from the The competition between 40S and Alu RNA may also ex- upstream open reading frame of the bicistronic mRNAs was plain why the inhibitory effect of Alu RNPs saturated at also diminished (Figure 6C). In contrast, the negative con- around 50% (Figure 1BandF).Thetargetedtransferof trols, 4.5S and 7SL RNAs, did not signifcantly affect lu- SRP9/14 from the Alu RNP to 40S leads to the release of ciferase expression, although higher levels of 7SL RNA had free RNA and to the concomitant decrease in the amount a slight tendency to increase it. Northern blot analysis re- of 40S subunits available for SRP9/14 binding. Saturation vealed that each reporter plasmid produced an mRNA of is reached when 40S subunits are no longer able to compete the expected size, which was present in comparable amounts with the Alu RNA for SRP9/14 binding. in the samples expressing ncRNAs (Supplementary Figure S8A). Functional role of SRP14 and SRP9 in 40S inactivation To confrm that the inhibitory effect was dependent on Next, we examined whether the inactive scAluYA 14A5 h9/14, we expressed a mutated scAluYNF1 RNA where C25 and scAluYA 9-3A RNPs were able to mediate binding of replaced G25. This mutation causes a 60-fold decrease in the mutated proteins to the 40S subunit. Both Alu RNPs affnity for h9/14 (30). Notably, the mutation does not com- were incubated individually with 40S subunits and the completely abolish complex formation, since the dissociation plexes analyzed by sucrose gradients (Figure 5E). As ob- constant of the complex with the mutated RNA remains served in similar experiments with the protein alone (24), rather high (nanomolar range). The mutated RNA was ex- h9/14A5 was absent from the 40S fractions whereas h9- pressed at comparable levels as the wild type scAluYNF1 3A/14 bound as effciently as the wild type protein to 40S RNA (Figure 6B). For fve out of six reporter mRNAs Nucleic Acids Research, 2015 11

β-act SV40 L1 Firefly poly(A) 18S 5’-UTR or EMCV/HCV/ 7SL SV40 Renilla CrPV Firefly poly(A) scAlu IRES 4.5S + Ctrl/scAlu/ Ctrl 7SL Ctrl 7SL Ctrl 7SL Ctrl 7SL Ctrl 7SL Enh TTTT scAlu 4.5S scAlu 4.5S scAlu 4.5S 7SL/4.5S G25C G25C G25C scAlu G25C4.5S scAlu G25C4.5S ncRNA EMCV HCV CrPV β-act L1

C D

4.5S 7000 Ctrl 140 7SL 6000 120 ** ** scAlu scAlu ** 100 G25C 5000 * 4000 80 ** 60 3000

40 [counts/min] 2000 20 Bioluminescence 1000 Luciferase activity [%] 0 0 β-act L1 EMCV HCV CrPV Rluc 0 5 10 15 20 Time after stimulation [h]

E Downloaded from 40 F 30 mock VSV ** 20 scAlu - + - + 100 10 L 0 80 protein synthesis [%]

30 60 90 120 http://nar.oxfordjournals.org/ recovery, min G 60 N 40 4.5S 120 ** * P scAlu 20 100 M

80 viral protein synthesis [%] 0 60 4.5S scAlu 40 CB 20 protein synthesis [%]

0 by guest on February 27, 2015 -Ars 60 90 120 +Ars

Figure 6. Expression of scAlu RNA reduces the translational capacity of HEK 293T cells. (A) Constructs used for luciferase reporter assay. Sequences of ncRNAs were cloned downstream of the 7SL gene enhancer element (Enh). (B) Northern blot analysis of transiently transfected HEK 293T cells. Mem- branes containing 0.5 ␮goftotalRNAperlanewerehybridizedwith[32P]-labeled oligonucleotides complementary to 4.5S RNA, 7SL RNA, scAluYNF1 RNA and 18S RNA (loading control). (C)Translationeffciency of reporter mRNAs in HEK 293T cells expressing different ncRNAs. Luciferase activity was measured 24 h post-transfection, normalized to ␮g of protein in the cell lysate and expressed as a percentage of the value obtained in control cells (ctrl) transfected with the empty vector pDL7Enh. Error bars are shown as SEM (n 5). *P < 0.05, **P < 0.01 by Student’s t-test. See Supplementary Figure S8A for northern blot analysis of reporter mRNAs. (D)BioluminescencerecordingsofHEK293Tcellsexpressingtheestradiol-inducedluciferase≥ reporter gene along with pDLscAlu (scAlu) or pDL7enh (Ctrl) following stimulation with 100 nM estradiol. (E) Relative total protein synthesis in HEK 293T cells after arsenite treatment (top panel). Control cells were treated with 500 ␮M sodium arsenite for 30 min at 48 h post-transfection, allowed to recover for the indicated times and pulse labeled with [35S]-methionine/cysteine for 15 min. 100 ␮goftotalproteinwasprecipitatedin10%TCA,[35S]- incorporation was determined by scintillation counting and expressed as a percentage of that in untreated cells. Error bars are shown as SEM (n 5). Bottom panel shows total protein synthesis in untreated cells (-Ars) and cells expressing scAluYNF1 or 4.5S RNA treated for 30 minutes with 500≥␮M sodium arsenite and allowed to recover for 60, 90 and 120 min (+Ars). Total protein synthesis is expressed as a percentage of that in control cells measured in parallel. Error bars are shown as SEM (n 5). *P < 0.05, **P < 0.01 by Student’s t-test. Expression of scAluYNF1 RNA is shown in Supplementary Figure S8D. (F)RepresentativeautoradiographfollowingSDS-PAGEofVSV-infectedcelllysates.HEK293TcellsexpressingscAluY≥ NF1, 4.5S RNA or control cells were infected with VSV for 6 h, pulse labeled with [35S]-methionine/cysteine for 15 min and 100 ␮goftotalproteinwasdisplayedby5–20% gradient SDS-PAGE. Bands corresponding to viral proteins are indicated. Coomassie-blue staining (bottom panel) was used to check uniform loading. Quantifcation of the viral protein synthesis is shown on the right. Viral protein synthesis in cells expressing scAluYNF1 RNA or 4.5S RNA was calculated as the sum of the intensities of the viral protein bands and expressed as a percentage of the control, which was set to 100%. Error bars are shown as SD (n 3). **P < 0.01 by Student’s t-test. Expression of scAluYNF1 RNA is shown in Supplementary Figure S8E. ≥ tested, luciferase expression levels were signifcantly higher repressed. Presumably, low levels of scAlu RNPs might be in cells expressing the mutated scAluYNF1 RNA than in cells suffcient to inhibit translation of this mRNA. expressing the wild type RNA (Figure 6C). Thus, the G25C We next studied the effect of Alu expression on mutation diminished the inhibitory activity as expected if, global cellular translation by measuring total [35S]- as observed in the in vitro experiments, Alu RNA bind- methionine/cysteine incorporation following a 15 min ing to h9/14 was required for translation inhibition in vivo. pulse, and somewhat surprisingly, no signifcant changes Only the L1-dependent Fluc expression was still strongly were seen in [35S]-incorporation in response to scAlu RNA expression (Figure 6E, lower panel, Ars). Additionally, − 12 Nucleic Acids Research, 2015 protein analysis by SDS-PAGE did not reveal any notice- protein synthesis by approximately 25% compared to cells able changes in the expression of specifc proteins at high expressing 4.5S RNA (Figure 6F). This demonstrates that levels of scAluYNF1 RNA (Supplementary Figure S8B). We Alu RNPs are able to suppress translation of the VSV mR- therefore reasoned that the Alu RNP-mediated decrease in NAs in the cell following infection. active 40S subunits might severely hamper protein synthesis from mRNAs starting translation de novo such as the newly DISCUSSION synthesized reporter mRNAs whereas protein synthesis from polysome-associated mRNAs remained largely This study describes a novel mechanism of translation reg- unaffected. Ribosomal subunits are presumably recycled ulation affecting expression of all mRNAs including viral via a closed-loop structure in already existing polysomes mRNAs with IRES. We present evidence that Alu RNPs (44). To strengthen this hypothesis we performed two inhibit translation by interacting directly with the 40S sub- experiments. First, we expressed an estradiol-inducible unit, although only SRP9/14 remains bound to 40S whereas luciferase reporter plasmid in HEK 293T cells along with the Alu RNA is released and can act in another round of the scAluYNF1 RNA-expressing or the control plasmid. SRP9/14 binding to 40S. Binding of SRP9/14 prevents the Fluc mRNA synthesis was induced by the addition of recruitment of the 43S complex to the mRNA, possibly be- estradiol to the culture medium at 24 h post-transfection cause the entry of the mRNA into the small subunit is di- and luciferase activity was monitored during the next 24 rectly or indirectly blocked. In cells, this mechanism inter- h. While luciferase expression increased rapidly in control feres with translation initiation on viral and reporter mR- cells, it was strongly delayed in scAluYNF1 RNA-expressing NAs, and cellular mRNAs that resume the translation cy- Downloaded from cells (Figure 6D) consistent with our working hypothe- cle after stress-induced shutdown of protein synthesis. The sis that reduced concentrations of active 40S subunits same mechanism of translation regulation is likely to be hampered de novo initiation (Figure 6D). used in rodents and tree shrews, which also contain Alu-like Second, we monitored the effect of scAluYNF1 RNA ex- elements in their genomes.

pression on the translation effciency of endogenous mR- The unexpected feature in the Alu RNP-mediated trans- http://nar.oxfordjournals.org/ NAs after disassembly of the existing pool of polysomes lation inhibition is the role of the Alu RNA in the targeted by treatment with sodium arsenite (31). As expected, arsen- delivery of SRP9/14 to a functional site in the 40S subunit. ite treatment caused a dramatic 96–97% decrease in cellular The Alu RNA is not part of the inactive 40S-SRP9/14 com- protein synthesis (Figure 6E, top panel). At 60 min after ar- plexes and is therefore able to function in several rounds senite removal protein synthesis levels remained below 10% of SRP9/14 targeting to the 40S subunit (Figure 5F). This compared to normal cells and polysomes were hardly de- conclusion is supported by a parallel study from our lab- tectable (Supplementary Figure S8C). We then determined oratory (24). In this study, we show that upon addition of translation rates at 60, 90 and 120 min after removal of ar- the 40S subunit to an Alu RNP immobilized on beads via senite for cells expressing either the scAluYNF1 or the 4.5S its RNA moiety, a fraction of SRP9/14 dissociates within by guest on February 27, 2015 RNA, and the values were normalized to the correspond- minutes from the RNA to bind to the 40S subunit. Indeed, ing values for cells transfected with a control vector (Fig- SRP9/14 appears to equilibrate between the two binding ure 6E, bottom panel). A reduction in translation rate was partners (Figure 5A, C, D and (24)) suggesting that the specifcally seen in cells expressing scAluNF1 RNA while functional binding site of SRP9/14 in 40S has a similar cells expressing 4.5S RNA were unaffected. Hence, high affnity for SRP9/14 as Alu RNA. The capacity of SRP9/14 scAlu RNA levels delayed translation initiation of endoge- to exchange rapidly between binding partners has already nous mRNAs following disassembly of polysomes. previously been observed (25) and is consistent with a high off rate of the SRP14-9 fusion protein from a 7SL-Alu domain RNA (36). Viral protein synthesis is inhibited in cells expressing Alu The competition between Alu RNA and 40S for SRP9/14 RNA binding would explain why RNPs comprising Alu RNAs It was previously reported that Alu RNA levels increase in representing the Alu domain of 7SL RNA, which has the response to viral infection and that these RNAs accumu- highest affnity for SRP9/14 (29,30), did not confer an late in the cytoplasm as SRP9/14 containing RNPs (32,33). inhibitory activity to the RNP. The affnity of 40S for We used the vesicular stomatitis virus (VSV), a prototype SRP9/14 would be insuffcient to compete with these RNAs negative strand RNA virus, as a model to investigate the for SRP9/14 binding. A plausible explanation for the mu- effects of scAluYNF1 RNA expression on viral protein syn- tually exclusive binding of SRP9/14 to Alu RNA or to 40S thesis. VSV induces a shutdown of host translation by inter- subunits is to presume that the basic ␤-sheet formed by the fering with eIF4F complex formation (34). Although VSV two proteins, which represents the major binding domain mRNAs are capped and do not contain IRES sequences, for Alu RNA (37), will also be involved in binding the 40S their translation proceeds via an unconventional mecha- subunit, most likely via the 18S ribosomal RNA. The tar- nism, which bypasses the need of eIF4F for initiation (35). geted delivery of SRP9/14 to a functionally important site HEK 293T cells were transiently transfected with plasmids in 40S also predicts that the Alu RNA itself transiently in- expressing either scAluYNF1 or the 4.5S control RNA. Af- teract with the 40S subunit guiding SRP9/14 to its proper ter 48 h, cells were infected with VSV (MOI 10) and har- binding site. vested 6 h later by which time the host translation= machin- The essential feature in the protein for 40S-binding and ery was reprogrammed by VSV mRNAs. In cells overex- for initiation inhibition is the C-terminal pentapeptide of pressing scAluYNF1 RNA we observed a reduction in viral SRP14 (Figure 2E and F). Short basic oligopeptides are Nucleic Acids Research, 2015 13 frequently present in ribosomal and ribosome-binding pro- This study introduces a novel concept that a noncoding teins and have been shown to bind ribosomal RNA (38,39) RNA shuttles an RNA-binding protein to its functional (Supplementary Figure S9). The three residues K60, K61 binding site on a large molecular complex thereby regulat- and K64 in SRP9 are essential for the elongation arrest ing its activity. It is conceivable that this concept is not re- function of SRP (21) and are also required for 40S sub- stricted to translational control but is applicable to a mul- unit inactivation (Figure 2E and F). However, they are not titude of cellular processes and more examples of RNA- required for 40S binding. Interestingly, in SRP-ribosome- mediated protein delivery might be discovered in the future. nascent chain complex these residues are located in close proximity to 40S (40). Further studies will be required to determine the binding sites of SRP9/14 on the 40S subunit SUPPLEMENTARY DATA and whether the protein uses the same binding site in either Supplementary Data are available at NAR Online. function. Our data showed that SRP9/14 can be delivered to the 43S complex (Figures 1I and 5D) but not to the 80S ribosome (Figure 5C). This suggests that protein-binding site ACKNOWLEDGMENTS is not occupied by the ternary complex, eIF3, eIF1 and 1A We thank Drs Sergey Dmitriev for the pGL3R luciferase but is blocked by the presence of the 60S subunit. The pro- reporter plasmids, Jean Gruenberg for VSV-PeGFP, Do- tein SRP9/14 alone had no inhibitory activity, which is con- minique Belin for edeine and the genomic platform of the sistent with earlier observations that high levels of SRP9/14 University of Geneva for capillary electrophoresis services. are well tolerated in primate cells (11,41) We thank Kinsey Maundrell, Didier Picard and Ueli Schi- Downloaded from Only few regulatory factors acting directly on the 40S bler for reading the manuscript and for insightful advice. subunit have so far been described: the acute respiratory syndrome coronavirus nsp1 protein and the proapoptotic protein Reaper (42,43). As for SRP9/14, the binding sites FUNDING of these proteins in the 40S subunit remain to be revealed. Swiss National Science Foundation [31003A-143844], http://nar.oxfordjournals.org/ In cells, detectable effects on translation were observed Swiss-Russian Science and Technology Program, Canton for mRNAs initiating translation de novo. This may be of Geneva, Program on Molecular and Cellular Biology of because mRNAs in polysomes can adopt a closed-loop the Russian Academy of Sciences (to E.A.). Funding for conformation due to the interaction of the scaffold factor open access charge: Canton of Geneva. eIFG4 with the poly(A)-binding protein (44). Due to facil- Confict of interest statement. None declared. itated ribosome recycling within these structures, translation might be less sensitive to 40S inactivation by SRP9/14. Following stress and certain viral infections, polysomes are REFERENCES by guest on February 27, 2015 disassembled and translation undergoes major reprogram- 1. Sonenberg,N. and Hinnebusch,A.G. (2009) Regulation of translation ming with certain mRNAs engaging de novo in protein syn- initiation in eukaryotes: mechanisms and biological targets. Cell, 136, thesis (45,46) increasing the sensitivity of their translation 731–745. to 40S inactivation. 2. Hershey,J.W., Sonenberg,N. and Mathews,M.B. (2012) Principles of translational control: an overview. Cold Spring Harb. Perspect. Biol., Expression levels of Alu RNA are kept low to minimize 4,doi:10.1101/cshperspect.a011528. the detrimental effects of frequent retrotransposition events 3. Aitken,C.E. and Lorsch,J.R. (2012) A mechanistic overview of in primate cells (6). In HeLa cells, Alu RNAs are about 500- translation initiation in eukaryotes. Nat. Struct. Mol. Biol., 19, fold less abundant than ribosomes and it is therefore un- 568–576. 4. Hasler,J. and Strub,K. (2006) Alu RNP and Alu RNA regulate likely that Alu RNPs inactivate an important fraction of translation initiation in vitro. Nucleic Acids Res., 34,2374–2385. 40S subunits. However, expression of specifcAluRNAs 5. Quentin,Y. (1992) Origin of the Alu family: a family of Alu-like can be increased in certain tissues, like NDM29 RNA and monomers gave birth to the left and the right arms of the Alu BC200 RNA in the nervous tissue (6), and a transient in- elements. Nucleic Acids Res., 20,3397–3401. crease in Alu RNA expression has been observed in re- 6. Berger,A. and Strub,K. (2011) Multiple roles of Alu-related noncoding RNAs. Prog. Mol. Subcell. Biol., 51,119–146. sponse to viral infection and to various stresses (32,33,47). 7. Fuhrman,S.A., Deininger,P.L., LaPorte,P., Friedmann,T. and In addition, Alu RNA can act in several rounds of targeted Geiduschek,E.P. (1981) Analysis of transcription of the human Alu delivery of the protein (Figure 5F) thereby multiplying the family ubiquitous repeating element by eukaryotic RNA polymerase effect of its upregulation. The SRP9/14 is already present III. Nucleic Acids Res., 9,6439–6456. 8. Roy-Engel,A.M. (2012) LINEs, SINEs and other retroelements: do and Alu RNA levels increase within one hour and decline to birds of a feather fock together? Front. Biosci. (Landmark Ed.), 17, normal levels within 7 h after heat shock (47). Like other 1345–1361. regulatory mechanisms∼ in translation, the inhibitory action 9. Yakovchuk,P., Goodrich,J.A. and Kugel,J.F. (2009) B2 RNA and Alu of the Alu RNP is therefore rapid and transient. It is there- RNA repress transcription by disrupting contacts between RNA fore conceivable that lowering the pool of active 40S sub- polymerase II and promoter DNA within assembled complexes. Proc. Natl. Acad. Sci. U.S.A., 106,5569–5574. units might contribute to shaping the translational response 10. Maraia,R.J., Driscoll,C.T., Bilyeu,T., Hsu,K. and Darlington,G.J. in these adaptive processes and thereby also participate in (1993) Multiple dispersed loci produce small cytoplasmic Alu RNA. cellular defense mechanisms used against viral infection. A Mol. Cell. Biol., 13,4233–4241. recent study, which shows that HCV translation was more 11. Bovia,F., Fornallaz,M., Leffers,H. and Strub,K. (1995) The SRP9/14 subunit of the signal recognition particle (SRP) is present in more strongly affected by reduced cellular levels of 40S than cel- than 20-fold excess over SRP in primate cells and exists primarily free lular translation, supports this hypothesis (48). but also in complex with small cytoplasmic Alu RNAs. Mol. Biol. Cell, 6,471–484. 14 Nucleic Acids Research, 2015

12. Chang,D.Y., Nelson,B., Bilyeu,T., Hsu,K., Darlington,G.J. and 31. Farny,N.G., Kedersha,N.L. and Silver,P.A. (2009) Metazoan stress Maraia,R.J. (1994) A human Alu RNA-binding protein whose granule assembly is mediated by P-eIF2alpha-dependent and expression is associated with accumulation of small cytoplasmic Alu -independent mechanisms. RNA, 15,1814–1821. RNA. Mol. Cell. Biol., 14,3949–3959. 32. Chang,D.Y.,Hsu,K. and Maraia,R.J. (1996) Monomeric scAlu and 13. West,N., Roy-Engel,A.M., Imataka,H., Sonenberg,N. and nascent dimeric Alu RNAs induced by adenovirus are assembled into Deininger,P. (2002) Shared protein components of SINE RNPs. J. SRP9/14-containing RNPs in HeLa cells. Nucleic Acids Res., 24, Mol. Biol., 321,423–432. 4165–4170. 14. Lakkaraju,A.K., Mary,C., Scherrer,A., Johnson,A.E. and Strub,K. 33. Panning,B. and Smiley,J.R. (1995) Activation of expression of (2008) SRP keeps polypeptides translocation-competent by slowing multiple subfamilies of human Alu elements by adenovirus type 5 and translation to match limiting ER-targeting sites. Cell, 133,440–451. herpes simplex virus type 1. J. Mol. Biol., 248,513–524. 15. Shaikh,T.H., Roy,A.M., Kim,J., Batzer,M.A. and Deininger,P.L. 34. Connor,J.H. and Lyles,D.S. (2002) Vesicular stomatitis virus infection (1997) cDNAs derived from primary and small cytoplasmic Alu alters the eIF4F translation initiation complex and causes (scAlu) transcripts. J. Mol. Biol., 271,222–234. dephosphorylation of the eIF4E binding protein 4E-BP1. J. Virol., 16. Macia,A., Munoz-Lopez,M., Cortes,J.L., Hastings,R.K., Morell,S., 76,10177–10187. Lucena-Aguilar,G., Marchal,J.A., Badge,R.M. and Garcia-Perez,J.L. 35. Lee,A.S., Burdeinick-Kerr,R. and Whelan,S.P. (2013) A (2011) Epigenetic control of retrotransposon expression in human ribosome-specialized translation initiation pathway is required for embryonic stem cells. Mol. Cell. Biol., 31,300–316. cap-dependent translation of vesicular stomatitis virus mRNAs. Proc. 17. Kozak,M. and Shatkin,A.J. (1978) Migration of 40 S ribosomal Natl. Acad. Sci. U.S.A., 110,324–329. subunits on messenger RNA in the presence of edeine. J. Biol. Chem., 36. Weichenrieder,O., Kapp,U., Cusack,S. and Strub,K. (1997) 253,6568–6577. Identifcation of a minimal Alu RNA folding domain that specifcally 18. Alkalaeva,E.Z., Pisarev,A.V., Frolova,L.Y., Kisselev,L.L. and binds SRP9/14. RNA, 3,1262–1274. Pestova,T.V. (2006) In vitro reconstitution of eukaryotic translation 37. Weichenrieder,O., Wild,K., Strub,K. and Cusack,S. (2000) Structure reveals cooperativity between release factors eRF1 and eRF3. Cell, and assembly of the Alu domain of the mammalian signal recognition Downloaded from 125,1125–1136. particle. Nature, 408,167–173. 19. Shirokikh,N.E., Alkalaeva,E.Z., Vassilenko,K.S., Afonina,Z.A., 38. Dudek,J., Greiner,M., Muller,A., Hendershot,L.M., Kopsch,K., Alekhina,O.M., Kisselev,L.L. and Spirin,A.S. (2010) Quantitative Nastainczyk,W. and Zimmermann,R. (2005) ERj1p has a basic role analysis of ribosome-mRNA complexes at different translation in protein biogenesis at the endoplasmic reticulum. Nat. Struct. Mol. stages. Nucleic Acids Res., 38,e15. Biol., 12,1008–1014. 20. Gould,P.S., Bird,H. and Easton,A.J. (2005) Translation toeprinting 39. Muller,L., de Escauriaza,M.D., Lajoie,P., Theis,M., Jung,M., http://nar.oxfordjournals.org/ assays using fuorescently labeled primers and capillary Muller,A., Burgard,C., Greiner,M., Snapp,E.L., Dudek,J. et al. electrophoresis. Biotechniques, 38,397–400. (2010) Evolutionary gain of function for the ER membrane protein 21. Mary,C., Scherrer,A., Huck,L., Lakkaraju,A.K., Thomas,Y., Sec62 from yeast to humans. Mol. Biol. Cell, 21,691–703. Johnson,A.E. and Strub,K. (2010) Residues in SRP9/14 essential for 40. Halic,M., Becker,T., Pool,M.R., Spahn,C.M., Grassucci,R.A., elongation arrest activity of the signal recognition particle defne a Frank,J. and Beckmann,R. (2004) Structure of the signal recognition positively charged functional domain on one side of the protein. particle interacting with the elongation-arrested ribosome. Nature, RNA, 16,969–979. 427,808–814. 22. Thompson,S.R. (2012) Tricks an IRES uses to enslave ribosomes. 41. Chang,D.Y.,Sasaki-Tozawa,N., Green,L.K. and Maraia,R.J. (1995) Trends Microbiol., 20,558–566. A trinucleotide repeat-associated increase in the level of Alu 23. Reynolds,J.E., Kaminski,A., Kettinen,H.J., Grace,K., Clarke,B.E., RNA-binding protein occurred during the same period as the major Carroll,A.R., Rowlands,D.J. and Jackson,R.J. (1995) Unique features Alu amplifcation that accompanied anthropoid evolution. Mol. Cell. by guest on February 27, 2015 of internal initiation of hepatitis C virus RNA translation. EMBO J., Biol., 15,2109–2116. 14,6010–6020. 42. Colon-Ramos,D.A., Shenvi,C.L., Weitzel,D.H., Gan,E.C., Matts,R., 24. Berger,A., Ivanova,E., Gareau,C., Scherrer,A., Mazroui,R. and Cate,J. and Kornbluth,S. (2006) Direct ribosomal binding by a Strub,K. (2014) Direct binding of the Alu binding protein dimer cellular inhibitor of translation. Nat. Struct. Mol. Biol., 13,103–111. SRP9/14 to 40S ribosomal subunits promotes stress granule 43. Lokugamage,K.G., Narayanan,K., Huang,C. and Makino,S. (2012) formation and is regulated by Alu RNA. Nucleic Acids Res., 42, Severe acute respiratory syndrome coronavirus protein nsp1 is a novel 11203–11217. eukaryotic translation inhibitor that represses multiple steps of 25. Thomas,Y., Bui,N. and Strub,K. (1997) A truncation in the 14 kDa translation initiation. J. Virol., 86,13598–13608. protein of the signal recognition particle leads to tertiary structure 44. Amrani,N., Ghosh,S., Mangus,D.A. and Jacobson,A. (2008) changes in the RNA and abolishes the elongation arrest activity of Translation factors promote the formation of two states of the the particle. Nucleic Acids Res., 25,1920–1929. closed-loop mRNP. Nature, 453,1276–1280. 26. Liu,W.M., Maraia,R.J., Rubin,C.M. and Schmid,C.W. (1994) Alu 45. Walsh,D., Mathews,M.B. and Mohr,I. (2013) Tinkering with transcripts: cytoplasmic localisation and regulation by DNA translation: protein synthesis in virus-infected cells. Cold Spring methylation. Nucleic Acids Res., 22,1087–1095. Harb. Perspect. Biol., 5,a012351. 27. Chu,W.M., Ballard,R., Carpick,B.W., Williams,B.R. and 46. Yamasaki,S. and Anderson,P. (2008) Reprogramming mRNA Schmid,C.W. (1998) Potential Alu function: regulation of the activity translation during stress. Curr. Opin. Cell Biol., 20,222–226. of double-stranded RNA-activated kinase PKR. Mol. Cell. Biol., 18, 47. Liu,W.M., Chu,W.M., Choudary,P.V. and Schmid,C.W. (1995) Cell 58–68. stress and translational inhibitors transiently increase the abundance 28. Mariner,P.D., Walters,R.D., Espinoza,C.A., Drullinger,L.F., of mammalian SINE transcripts. Nucleic Acids Res., 23,1758–1765. Wagner,S.D., Kugel,J.F. and Goodrich,J.A. (2008) Human Alu RNA 48. Huang,J.Y., Su,W.C., Jeng,K.S., Chang,T.H. and Lai,M.M. (2012) is a modular transacting repressor of mRNA transcription during Attenuation of 40S ribosomal subunit abundance differentially affects heat shock. Mol. Cell, 29,499–509. host and HCV translation and suppresses HCV replication. PLoS 29. Bovia,F., Wolff,N., Ryser,S. and Strub,K. (1997) The SRP9/14 Pathog., 8,e1002766. subunit of the human signal recognition particle binds to a variety of 49. Jackson,R.J. and Hunt,T. (1983) Preparation and use of Alu-like RNAs and with higher affnity than its mouse homolog. nuclease-treated rabbit reticulocyte lysates for the translation of Nucleic Acids Res., 25,318–326. eukaryotic messenger RNA. Methods Enzymol., 96,50–74. 30. Bennett,E.A., Keller,H., Mills,R.E., Schmidt,S., Moran,J.V., 50. Das,S.C., Nayak,D., Zhou,Y.and Pattnaik,A.K. (2006) Visualization Weichenrieder,O. and Devine,S.E. (2008) Active Alu of intracellular transport of vesicular stomatitis virus nucleocapsids retrotransposons in the human genome. Genome Res., 18,1875–1883. in living cells. J. Virol., 80,6368–6377. 51. Dewannieux,M., Esnault,C. and Heidmann,T. (2003) LINE-mediated retrotransposition of marked Alu sequences. Nat. Genet., 35,41–48. 1

SUPPLEMENTARY DATA

Alu RNA regulates the cellular pool of active ribosomes by targeted delivery of

SRP9/14 to 40S subunits

Elena Ivanova, Audrey Berger, Anne Scherrer, Elena Alkalaeva and Katharina Strub

Supplementary Data includes Supplementary Methods, Supplementary References and nine Supplementary Figures. 2

SUPPLEMENTARY METHODS

Plasmids

Vectors for expression of h9/14, h9/14A5, h9-3A/14 were described in (1,2).

Plasmids encoding the eukaryotic translation initiation factors eIF1, 1A, 4A, 4B, 4G,

5, 5B and Escherichia coli Met-tRNA synthetase were described in (3). pGL3R-βglo, pGL3R-βact, pGL3R-L1, pGL3R-HCV, pGL3R-EMCV, pGl3R-CrPV were the kind gift of Dr. Sergey Dmitriev (4). PCR fragments amplified from these constructs and containing the Firefly luciferase ORF fused to 5ʼ-UTRs of β-globin, β-actin, LINE-1,

HCV IRES or CrPV IRES under the control of SP6 promoter was inserted to pUC18 plasmid digested by HindIII and EcoRI to generate pUCβglo, pUCβact and pUCL1, and by PstI and EcoRI to generate pUCHCV and pUCCrPV. Vectors for in vivo expression of monocistronic mRNAs containing Firefly luciferase ORF fused to 5ʼ-

UTRs of β-globin, β-actin and LINE-1 were prepared by insertion of PCR fragment containing respective 5ʼ-UTRs to pGL3R-EMCV digested by AflII and NcoI to remove upstream Renilla luciferase ORF and EMCV IRES. Plasmid pCrPV-VHLM was constructed by insertion of T7 promoter, CrPV IRES nucleotides 6028 to 6216 followed by a short ORF encoding Val-His-Leu-Met tripeptide, UAA stop codon and

100 nt random sequence taken from β-glucuronidase (GUS) gene, into the pUC18 vector. Plasmids pscAluYb8, pscAluYf2, pscAluYj4 were obtained from the plasmids pscAlu/α-feto and pSscAlu/LDL (1) using quick change protocol. pSAlu110 and pSAlu151 contained the Alu portion of 7SL RNA gene (nucleotides 1-74; 271-299 and 1-99; 251-299, respectively) with a closing loop GATT following position 74 or

99, preceded by the T7 promoter. 3

The pDLscAlu construct for scAluYNF1 RNA expression in cell lines was obtained by removing the neoTet reporter gene, Alu right arm and the internal A-rich linker from Alu-neoTet plasmid (5). The pDLscAluG25C construct was derived from pDLscAlu using the quick change protocol. Vector control plasmid pDL7enh was generated by digestion of pDLscAlu plasmid at EagI/EcoRI sites to remove the scAluYNF1 RNA coding sequence, followed by treatment with DNA Polymerase I,

Large (Klenow) Fragment (Promega, Madison, WI) and ligation with T4 DNA ligase

(Promega). Constructs for in vivo expression of 4.5S RNA and 7SL RNA were obtained by digestion of pDLscAlu with EagI and SpeI and insertion of the PCR fragment amplified from pS4.5S and p7Sswt (1), respectively.

In vitro transcription

Run-off in vitro transcription reactions were performed as described in (6,7). For

[32P]-MVHL-stop mRNA synthesis [32P]-UTP was added to the transcription reaction.

Preprolactin and MVHL-stop mRNAs were synthesized with SP6 RNA polymerase from plasmids pSP-BP4 (8) and MVHL-stop (9) linearized with EcoRI and XhoI.

Capped and uncapped RNAs encoding Firefly luciferase fused to various 5ʼ-UTRs were synthesized with SP6 RNA polymerase from plasmids pUCβglo, pUCβact, pUCL1, pUCCHV and pUCCrPV linearized with EcoRI. HCV-NSʼ and CrPV-VHLM mRNAs were synthesized with T7 RNA polymerase from plasmids pXL.HCV(40-

373).NSʼ (10) and pCrPV-VHLM linearized with EcoRI and SspI, respectively. The mRNAs were purified by LiCl precipitation, G50 sepharose chromatography, ethanol precipitation, and resuspended in water. Non-coding AluYA, scAluYA, scAluYL, and

4.5S RNAs were synthesized with T7 RNA polymerase from plasmids pPAlu, pPscAlu/a feto, pSscAlu/LDL and pS4.5S (1) linearized with SspI, SpeI, SpeI and 4

DraI, respectively. SA110, SA151 and SA86 RNAs were synthesized in the same way from plasmids pSAlu110, pSA151 and pSA86 linearized with XbaI. Non-coding

RNAs were purified on a preparative denaturing polyacrylamide gel as described

(11).

Purification of proteins, RNPs, ribosomal subunits

Expression and purification of recombinant translation initiation factors eIF1, 1A, 4A,

4B, 4G, 5B, 5 and Escherichia coli Met-tRNA synthetase and purification of eIF2, eIF3, eEF1H, eEF2, 40S and 60S ribosomal subunits was performed as described in

(3). Expression and purification of the recombinant eIF4GI738-1116 was done as described in (12). Human recombinant SRP9 and SRP14 proteins and their mutated forms were obtained as described previously (2) with minor modifications in purification procedure. Lysates of SRP9- and SRP14-overexpressing BL21pLysS cells were combined and SRP9/14 was purified by heparin-sepharose affinity chromatography, the eluted protein was dialysed against 50 mM Hepes pH 7.5, 300 mM potassium acetate, 1 mM EDTA, 0.01% Nikkol, 10 mM DTT and further purified by ion-exchange chromatography on cation exchanger (MonoS 5/50 GL, GE

Healthcare). Fractions containing SRP9/14 were pooled and dialysed against 20 mM

Hepes pH 7.5, 500 mM potassium acetate, 0.01% Nikkol, 10 mM DTT, 10% glycerol.

Alu RNPs were assembled in the buffer containing 20 mM HEPES, 500 mM potassium acetate, 5 mM magnesium acetate, 0.1% Nikkol and 4 mM DTT and purified on Superdex 200 column as described in (11). High salt concentration was used to ensure a 1:1 stoichiometry and to avoid nonspecific binding of an additional molecule(s) of SRP9/14 to Alu RNA. Resulting RNPs were then dialyzed against buffer (20 mM HEPES, 150 mM potassium acetate, 1.5 mM magnesium acetate, 5

0.01% Nikkol, 4 mM DTT and 10% glycerol). The concentrations of the RNPs were determined based on the optical absorption of the RNA at 260 nm and were confirmed electrophoretically by comparing the RNA and protein contents of the

RNPs to equal amounts of RNA and protein alone. All RNPs were examined for RNA integrity by denaturing polyacrylamide gel electrophoresis and the formation of the stoichiometric complexes with h9/14 was confirmed by Western blot analysis using anti-h14 antibodies.

Aminoacylation of the tRNA

Total calf liver tRNA (Novagen) was purified by size-exclusion chromatography through Superdex 200 column (GE Healthcare) and aminoacylated with rabbit

Met aminocyl tRNA synthases from RRL and a mix of 22 amino acids. tRNAi from E. coli (a kind gift of Dr. Vasily Haurilyuk) was aminoacylated with methionine or [35S]- methionine using E. coli methionyl-tRNA synthetase. Aminoacylation reactions were performed according to the previously described protocol (3).

Toeprinting analysis of ribosomal complexes

Translation complexes were analyzed by toeprint assay using fluorescently labeled

DNA oligonucleotides: 5′ [6-carboxyfluorescein] (FAM)-GCATGTGCAGAGGACAGG

3′ for MVHL-stop mRNA, 5′ (FAM)-GGGATTTCTGATCTCGGCG 3ʼ for HCV-NSʼ mRNA, 5′ (FAM)-TTAATGCGTGGTC 3ʼ for CrPV-VHLM mRNA.

Ribosome binding assay

Binding assays were performed in 30 µl by combining 3 pmols of purified ribosomal subunits or 43S complex with 3 pmols of scAluYA/SA110 RNP or h9/14 in the binding buffer containing 20 mM Tris-HCl pH 7.5, 150 mM potassium acetate, 1.5 mM 6 magnesium acetate, 2 mM DTT, 0.01% Nikkol. The mixtures were incubated for 10 min. at 37°C, adjusted to 100 µl and centrifuged through 5-20% sucrose gradient containing 20 mM Tris-HCl pH 7.5, 100 mM potassium acetate, 5 mM magnesium acetate, 2 mM DTT at 60000 rpm for 2 hours at 4°C in a Beckman SW60 rotor. To reassemble 80S ribosomes from high-salt purified 40S and 60S the subunits were incubated in equimolar amounts for 10 min. at 37°C in buffer containing 20 mM Tris-

HCl pH 7.5, 150 mM potassium acetate, 1.5 mM magnesium acetate, 4 mM DTT.

Then equimolar amount of scAuYA RNP or h9/14 was added and reaction was incubated for another 10 min. in the binding buffer before centrifugation through 10-

30% sucrose gradients at 40000 rpm for 5 hours in a Beckmann SW41 rotor.

Fractions were analyzed for the presence of h14 and S15 or L9 by Western blotting and for scAlu or SA110 RNA by Northern blotting.

Cell culture

HEK293T cells were cultivated in DMEM supplemented with 10% fetal bovine serum,

2mM L-glutamine, 100 units/ml penicillin and 100 μg/ml streptomycin.

Polysome fractionation

HEK 293T cells were incubated 10 min. with 100 µg/ml cycloheximide and lysed in

50 mM Tris-HCl (pH 7.5), 15 mM MgCl2, 100 mM potassium acetate, 0.5% NP-40, 2 mM DTT, 100 µg/ml cycloheximide, spun at 10000 x g for 5 min. and loaded on 7-

50% linear sucrose gradients (50 mM Tris-HCl pH 7.5, 100 mM potassium acetate,

12 mM MgCl2, 2 mM DTT) and centrifuged at 35000 rpm in a SW41 rotor for 3.5 hours. Following centrifugation gradients were displaced with 60% sucrose solution through a flow cell recording absorbance at 254 nM. 7

Nothern blot

Total cellular RNA was extracted using Tri-reagent (Sigma-Aldrich, St. Louis, MO), separated on 1% agarose-formaldehyde gel and transferred to Hybond-N membrane

(GE Healthcare, Waukesha, WI). The following radiolabeled oligonucleotides were used for detection: 5ʼ ATCGGGTGTCCGCACTAAG 3ʼ for 7SL RNA, 5ʼ

TCACCATGTTAGCCAGGATGGT 3ʼ for scAluY RNA, 5ʼ

GGGCATCACAGACCTGTT 3ʼ for 18S rRNA, 5ʼ

TCCCGAGTAGCTGGGACTACAGG 3ʼ for SA110 RNA, 5ʼ

GCCCAGGCTGGCCTCGAACTCGTG 3ʼ for 4.5S RNA.

SUPPLEMENTARY REFERENCES

1. Bovia, F., Wolff, N., Ryser, S. and Strub, K. (1997) The SRP9/14 subunit of the human signal recognition particle binds to a variety of Alu-like RNAs and with higher affinity than its mouse homolog. Nucleic Acids Res., 25, 318-326.

2. Mary, C., Scherrer, A., Huck, L., Lakkaraju, A.K., Thomas, Y., Johnson, A.E. and Strub, K. (2010) Residues in SRP9/14 essential for elongation arrest activity of the signal recognition particle define a positively charged functional domain on one side of the protein. RNA, 16, 969-979.

3. Pisarev, A.V., Unbehaun, A., Hellen, C.U. and Pestova, T.V. (2007) Assembly and analysis of eukaryotic translation initiation complexes. Methods Enzymol., 430, 147-177.

4. Andreev, D.E., Dmitriev, S.E., Terenin, I.M., Prassolov, V.S., Merrick, W.C. and Shatsky, I.N. (2009) Differential contribution of the m7G-cap to the 5' end-dependent translation initiation of mammalian mRNAs. Nucleic Acids Res., 37, 6135-6147.

5. Dewannieux, M., Esnault, C. and Heidmann, T. (2003) LINE-mediated retrotransposition of marked Alu sequences. Nat. Genet., 35, 41-48.

6. Gurevich, V.V., Pokrovskaya, I.D., Obukhova, T.A. and Zozulya, S.A. (1991) Preparative in vitro mRNA synthesis using SP6 and T7 RNA polymerases. Anal. Biochem., 195, 207-213.

7. Milligan, J.F. and Uhlenbeck, O.C. (1989) Synthesis of small RNAs using T7 RNA polymerase. Methods Enzymol., 180, 51-62.

8. Siegel, V. and Walter, P. (1988) Each of the activities of signal recognition particle (SRP) is contained within a distinct domain: analysis of biochemical mutants of SRP. Cell, 52, 39-49.

9. Alkalaeva, E.Z., Pisarev, A.V., Frolova, L.Y., Kisselev, L.L. and Pestova, T.V. (2006) In vitro reconstitution of eukaryotic translation reveals cooperativity between release factors eRF1 and eRF3. Cell, 125, 1125-1136. 9

10. Reynolds, J.E., Kaminski, A., Kettinen, H.J., Grace, K., Clarke, B.E., Carroll, A.R., Rowlands, D.J. and Jackson, R.J. (1995) Unique features of internal initiation of hepatitis C virus RNA translation. EMBO J., 14, 6010-6020.

11. Hasler, J. and Strub, K. (2006) Alu RNP and Alu RNA regulate translation initiation in vitro. Nucleic Acids Res., 34, 2374-2385.

12. Kolupaeva, V.G., de Breyne, S., Pestova, T.V. and Hellen, C.U. (2007) In vitro reconstitution and biochemical characterization of translation initiation by internal ribosomal entry. Methods Enzymol., 430, 409-439.

A B In vitro Recombinant transcribed h9/14 Alu RNA Alu 1.5RNA pmolsAlu 1.5RNP pmols scAlu4 pmolsRNAscAlu4 pmolsRNP

37°C 300 300 500 mM KOAc 200 200 5 mM MgOAc

100 100 Superdex 200

RNP C

h9/14100 fmolsAlu RNP50 fmols h9/1450 fmolsscAlu50 RNP fmols

RNA h14

Dialysis 150 mM KOAc 1 mM MgOAc

Fig. S1: Preparation of Alu RNPs

(A) Schematic representation of the Alu RNP purification procedure with a typical OD260 elution profile of a Superdex 200 column.

(B) Denaturing polyacrylamide gel electrophoresis of 150 ng of AluYA RNP and scAluYA RNP after proteinase K digestion. The concentration of RNPs was estimated by OD260 measurement. Same amounts of AluYA RNA and scAluYA RNA were loaded on the gel as a control of quantification.

Fig. S1, Ivanova et al. A B AluYA RNA AluY A RNP pPL pPL 0 10 20 50 100 0 100 200300 500 nM 0 10 20 50 100 0 100 200 300 500 nM 100 114 100 91 93 100 86 105 103 124 % 100 86 75 66 49 100 46 49 47 34 % scAluYA RNA scAluYA RNP pPL pPL 0 10 20 50 100 0 100 200 300 500 nM 0 10 20 50 100 0 100 200 300 500 nM 100 117 124 121 92 100 107 116 128 107 % 100 98 96 67 54 100 54 41 46 57 % h9/14

pPL

0 10 20 50 100 0 100 200 300 500 nM 100 99 90 92 95 100 92 108 159 155 % C D

- edeine + edeine 0.5µM 10000 A A A A mRNA 5000 Buffer scAluY AluY Buffer scAluY AluY

10000 Met units mRNA + 40S, eIFs, Met-tRNA pPL 5000

100 58 57 100 117 119 0 Relative fluorescence

48S 5’-end

Fig. S2: Alu RNPs dose-dependently inhibit 48S complex formation and do not affect assembly of the 80S and pretermination complexes. (A) and (B) Representative autoradiographs from experiments described in Figure 1B. Concentrations of RNPs and translation efficiencies of pPL mRNA are indicated below. (C) Representative autoradiograph from experiments described in Figure 1C. RRL programmed with pPL mRNA was incubated 3 min. prior to addition of 0.5 µM edeine. Alu RNPs were added after 1 min. incubation with edeine. (D) Electropherograms of toeprint assays of the MVHL mRNA in the absence of 40S and initiation factors and upon the 48S assembly on it.

Fig. S2, Ivanova et al. A B L U A C C scAluY RNP SA110 RNP G U A C SA86 SA110 SA151 C G 40 30 C G C G 70 pPL U A 50 GG 60 G GU 80 90 G U A A U A A C C A GGC G A GGC UGG UC G C U GCCC AGG UCUGGG UG UAG UG GCUA UG U U A G C CG C U C UG C C AG C G A CGGGUCC GACCU ACG UC AC CG AUAA 0 10 20 50 100 0 10 20 50 100 U G C C G U A C nM 5' U A A A 270 260 C G 3' 290 C C G 280 100 85 78 54 52 100 124 112 114 116 % 20 G C C G G C C G 10 G G C U G G

C scAluYA scAluYL scAluYb8 scAluYa5 scAluYf2 scAluYj4 SA110

scAluYA scAluYL scAluYb8 scAluYa5 scAluYf2 scAluYj4 SA110

D E

L SA151SA110SA86Y Ya5 Yf2 Yj4 SA151SA110SA86 Ya5 Yf2 Yj4 BufferSA151SA110SA86 Buffer Ya5 Yf2 Yj4 h14 pPL RNA

100 85 94 106 100 55 61 50 %

Fig. S3. Analysis of different scAlu Y RNPs and SA RNPs. (A) Secondary structure model of the SA151 RNA. Dashed lines mark portions included in SA110 and SA86 RNAs. (B) Representative autoradiographs from the experiments described in Figure 2A. Concentrations of RNPs and translation efficiencies of preprolactine mRNA in RRL are indicated below. (C) Sequence alignment of Alu elements from the Y family and of the SA110 portion of the 7SL RNA gene (see also Table 1). Identical nucleotides are shown as dots. (D) Representative autoradiographs from experiments described in Figure 2E. Translation efficiencies of pPL mRNA are indicated below. (E) Denaturing polyacrylamide gel eletrophoresis of 150 ng of SA151, SA110, SA86, scAluYL , scAluYa5, scAluYf2, scAluYj4 RNPs (left panel) and Western blot of 50 fmols of SA151, SA110, SA86, scAluYa5, scAluYf2, scAluYj4 RNPs (right panel) with anti-h14 antibodies.

Fig. S3, Ivanova et al. A

h9/14 h9/14A5h9-3A/14 h9/14 h9/14A5 h9-3A/14

RNA h14 100

B scAluYA 14A5 RNP scAluYA 9-3A RNP

pPL

0 10 20 50 100 0 10 20 50 100 nM 100 116 104 120 100 100 80 97 105 120 %

Fig. S4. Analysis of Alu RNPs containing mutated h9/14. (A) Denaturing polyacrylamide gel eletrophoresis after proteinase K digestion (left panel) and Western blot analysis with anti-h14 antibodies (right panel) of scAluYA , scAluYA 14A5, scAluYA 9-3A RNPs. (B) Representative autoradiographs from experiments described in Figure 2E. Translation efficiencies of pPL mRNA are indicated below.

Fig. S4, Ivanova et al. A

A A A A

A BufferscAluYAluY BufferscAluYAluY A

β-glo luc β-glo luc BufferscAluYAluY HCV luc 100 35 43 % 100 45 32 % 100 56 44 % β-act luc β-act luc

capped mRNA CrPV luc 100 65 60 % 100 47 53 % uncapped mRNA 100 49 35 % L1 luc L1 luc

100 59 41 % 100 57 38 %

7000 CrPV mRNA

4000

7000 CrPV mRNA + 40S

4000 Relative fluorescence units

48S 5’-end

Fig. S5. Alu RNPs inhibit cap-dependent and cap-independent translation in RRL. (A) Representative autoradiographs from experiments described in Figure 4A. Translation efficiencies of mRNAs examined are indicated below. (B) Toeprint analysis of the CrPV-VHLM mRNA in the absence and in the presence of 40S subunits. No toeprints were observed at the position of the 48S complex in the absence of 40S.

Fig. S5, Ivanova et al. 40S 1 2 3 4 5 6 7 8 9 10 11 12 13 14 scAluYA RNP + 40S h14

h9/14 + 40S h14

Fig. S6. Binding of h9/14 and scAlu YA RNP to 40S subunits.

Two-fold molar excess of h914 (A) or scAlu YA RNP (B) was incubated with 3 pmols of high-salt purified 40S for 10 min. at 37˚C and fractionated on 5-20% sucrose gradients. 40S-containing fractions were determined by probing for S15.

Fig. S6, Ivanova et al. RNP 100 nM - + + + - - h9/14 100 nM - - + - + - h9/14 200 nM - - - + - +

pPL

100 41 35 22 99 106 %

RNP 100 nM - + + + - - RNA 100 nM - - + - + - RNA 200 nM - - - + - +

pPL

100 55 54 76 127 111 %

RNP 100 nM - + + + - - h9/14A5 100 nM - - + - + - h9/14A5 200 nM - - - + - +

pPL

100 62 67 81 113 103 %

Fig. S7. Representative autoradiographs from the experiments described in Figure 5C. Translation efficiencies of pPL mRNA are indicated below.

Fig. S7, Ivanova et al. A

b-actCtrl scAlu7SLG25C4.5SCtrl scAlu7SLG25C4.5S EMCVCtrlscAlu7SLG25C4.5SCtrl scAlu7SLG25C4.5SCtrl scAlu7SLG25C4.5S

Fluc

GAPDH

EMCV HCV CrPV β-act L1

B C scAlu - + scAlu - + no Ars +Ars, 60 min. recovery 1 1

80S 0.8 80S 0.8 254 254 A

0.6 A 0.6 60S 40S polysomes 60S 0.4 0.4 40S polysomes

0 0 Top Bottom Top Bottom

35S CB

D +Ars E -Ars 0 30 60 90 120 min mock VSV scAlu - + - + - + - + - + - + scAlu - + - +

scAlu scAlu

18S 18S

Fig. S8. Expression of Alu RNA affects translation in HEK 293T cells. (A) Northern blot analysis of luciferase reporter mRNAs in HEK 293T cells expressing ncRNAs. (B) Representative autoradiograph (left panel) and coomassie blue staining (right panel) following SDS-PAGE of lysates of HEK 293T cells transfected with pDLscAlu or empty vector (Ctrl). Cells were harvested 48 hours post transfection. (C) Polysome profiles from HEK 293T cells in the absence of arsenite treatment (left panel) and cells incubated with 0.5 µM sodium arsenite for 30 min. and allowed to recover for another 60 min. Cell lysates were fractionated on 7-50% sucrose density gradient. (D) Northern blot analysis of transiently transfected HEK 293T cells after arsenite treatment. Cells were treated with 500 µM sodium arsenite for 30 min. at 48 hours post transfection and allowed to recover for the indicated times. (E) Northern blot analysis of transiently transfected HEK 293T cells after VSV infection for 6 hours.

Fig. S8, Ivanova et al. SRP14 (94-102) L K K R D K K N K DHX29 (353-361) E E K D K K K E P eIF3j (217-226) S K A K K K K K G eIF5 (155-163) K K E K E K K N R eIF5B (313-321) K K K K D K K K K RPS5 (191-199) K K K D E L E R V RPS6 (164-172) K E G K K P R T K RPS8 (139-148) K K R S K K I Q K RPS25 (4-13) K D D K K K K D A RPS27 (16-25) K R K H KK K K R L ERj1p (185-194) R K K R E K K K K NACb (71-80) R R K K K V V H R

Fig. S9. Basic oligopeptides are found in many ribosome ligands and ribosomal proteins.

Fig. S9, Ivanova et al.