DOCSLIB.ORG

The DHX33 RNA Helicase Promotes Mrna Translation Initiation Yandong Zhang South University of Science and Technology of China, Shenzhen

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The DHX33 RNA Helicase Promotes Mrna Translation Initiation Yandong Zhang South University of Science and Technology of China, Shenzhen Washington University School of Medicine Digital Commons@Becker Open Access Publications 2015 The DHX33 RNA helicase promotes mRNA translation initiation Yandong Zhang South University of Science and Technology of China, Shenzhen Jin You South University of Science and Technology of China, Shenzhen Xingshun Wang South University of Science and Technology of China, Shenzhen Jason Weber Washington University School of Medicine in St. Louis Follow this and additional works at: https://digitalcommons.wustl.edu/open_access_pubs Recommended Citation Zhang, Yandong; You, Jin; Wang, Xingshun; and Weber, Jason, ,"The DHX33 RNA helicase promotes mRNA translation initiation." Molecualar and Cellular Biology.35,17. 2918-2931. (2015). https://digitalcommons.wustl.edu/open_access_pubs/4083 This Open Access Publication is brought to you for free and open access by Digital Commons@Becker. It has been accepted for inclusion in Open Access Publications by an authorized administrator of Digital Commons@Becker. For more information, please contact [email protected]. The DHX33 RNA Helicase Promotes mRNA Translation Initiation Yandong Zhang,b Jin You,b Xingshun Wang,b Jason Webera ICCE Institute, Department of Internal Medicine, Division of Molecular Oncology, Washington University School of Medicine, St. Louis, Missouri, USAa; Department of Biology, South University of Science and Technology of China, Shenzhen, Guangdong, People’s Republic of Chinab Downloaded from DEAD/DEAH box RNA helicases play essential roles in numerous RNA metabolic processes, such as mRNA translation, pre- mRNA splicing, ribosome biogenesis, and double-stranded RNA sensing. Herein we show that a recently characterized DEAD/ DEAH box RNA helicase, DHX33, promotes mRNA translation initiation. We isolated intact DHX33 protein/RNA complexes in cells and identified several ribosomal proteins, translation factors, and mRNAs. Reduction of DHX33 protein levels markedly reduced polyribosome formation and caused the global inhibition of mRNA translation that was rescued with wild-type DHX33 but not helicase-defective DHX33. Moreover, we observed an accumulation of mRNA complexes with the 80S ribosome in the absence of functional DHX33, consistent with a stalling in initiation, and DHX33 more preferentially promoted structured mRNA translation. We conclude that DHX33 functions to promote elongation-competent 80S ribosome assembly at the late http://mcb.asm.org/ stage of mRNA translation initiation. Our results reveal a newly recognized function of DHX33 in mRNA translation initiation, further solidifying its central role in promoting cell growth and proliferation. ammalian cells maintain tight control of global mRNA Human DHX33 belongs to the DEAH box family of ATP-de- Mtranslation through the production of ribosomes (1, 2); de- pendent RNA helicases, a large family of proteins thought to be regulation in mRNA translation is frequently found in human involved in various aspects of RNA metabolism (17). Many of diseases (3–6) and is regarded as one of the many factors contrib- these RNA helicases remain poorly studied. Recently, we and uting to cancer development (7–9). other groups have identified DHX33 to be an important partici- on August 15, 2015 by Washington University in St. Louis Most eukaryotic protein translation initiation occurs by an or- pant in rRNA biogenesis and in mediating inflammasome forma- dered assembly of a preinitiation complex on the 5= cap of mRNA tion in response to extracellular double-stranded RNA (dsRNA) (10). After mature mRNA is transported into the cytosol, the dis- (18–20). Oncogenic Ras alleles and downstream components of tinct 5= cap of mRNA is recognized and bound by a large protein the phosphatidylinositol 3-kinase/AKT/mTOR pathway induce complex comprising eukaryotic initiation factor 4E (eIF4E), DHX33 protein expression, indicating the potential importance eIF4A, and eIF4G as well as poly(A)-binding protein (PABP) (1, for DHX33 in relaying cell growth regulation signals to the trans- 11, 12). These factors coordinately prevent mRNA degradation lational machinery (21). while priming mRNAs for translation initiation. We found DHX33 localized in both the cytosol and the nucleus The initial step in mRNA translation involves formation of a in several established human cancer cell lines. Furthermore, en- ternary complex between eIF2-GTP, Met-tRNA interference, and dogenous DHX33 interacted with the monoribosome, eIF3 com- small 40S ribosomal subunits. This process is stimulated by the plex, DDX3, and mRNAs, implying that it may also be involved in translation initiation factors eIF1, eIF3, eIF4F, and eIF5 (13). This processes other than nucleolar ribosome production. Through large complex, termed the 43S preinitiation complex, attaches to polysome profiling and mRNA translation studies, we found that the activated 5= cap of mRNA. Bound RNA helicases are respon- wild-type DHX33 promotes mRNA translation initiation in a sible for unwinding various secondary structures in mRNA as the mechanism that requires its helicase activity. Thus, our data indi- complex scans along the mRNA from the 5= end to the 3= end until cate that DHX33 promotes mRNA translation initiation by pro- it finds the initiation codon. The 60S large ribosome subunit then moting elongation-competent 80S ribosome assembly. joins with the 40S subunit to form an 80S ribosome under guid- ance from eIF5B-GTP (2, 13). eIF2-GTP and eIF5B-GTP are then MATERIALS AND METHODS hydrolyzed into their GDP forms to promote the assembly of the Cell culture. T47D and HCC1806 breast cancer cell lines were maintained functional initiation complex (14). The detailed mechanism of in RPMI 1640 medium containing 10% fetal bovine serum (FBS), 2 mM how elongation-competent 80S ribosomes are assembled prior to initiation or what triggers initiation is not well understood. Mammalian mRNAs often contain highly structured untrans- Received 24 March 2015 Returned for modification 12 April 2015 Accepted 15 June 2015 lated regions (UTRs) at the 5= ends of their open reading frame Accepted manuscript posted online 22 June 2015 sequences that must be unwound to allow ribosome recruitment Citation Zhang Y, You J, Wang X, Weber J. 2015. The DHX33 RNA helicase and scanning. Not surprisingly, unwinding of secondary struc- promotes mRNA translation initiation. Mol Cell Biol 35:2918–2931. tures in the mRNA 5= UTR involves the activity of specialized RNA doi:10.1128/MCB.00315-15. helicases (15). eIF4A and DDX3 are common RNA helicases Address correspondence to Yandong Zhang, [email protected], or shared between mammals and Saccharomyces cerevisiae yeast cells, Jason Weber, [email protected]. while DHX29 appears to be a mammal-specific RNA helicase im- Copyright © 2015, American Society for Microbiology. All Rights Reserved. portant in unwinding highly structured mRNA sequences (16). In doi:10.1128/MCB.00315-15 the study described in this report, we identified a new RNA heli- The authors have paid a fee to allow immediate free access to this article. case, DHX33, involved in translation initiation. 2918 mcb.asm.org Molecular and Cellular Biology September 2015 Volume 35 Number 17 DHX33 Promotes mRNA Translation L-glutamine, streptomycin, and penicillin. SKBR3, HeLa, BT549, and ifications. Reverse transcription (RT) reactions were performed using a MDAMB361 cells were maintained in Dulbecco’s modified Eagle’s me- SuperScript III first-strand synthesis system (Life Technologies) with an dium (DMEM) containing 10% FBS, streptomycin, and penicillin. oligo(dT) primer. Real-time PCR was performed on a StepOnePlus sys- HEK293T cells were maintained in DMEM with 10% FBS, streptomycin, tem using SsoFast EvaGreen supermix (Bio-Rad) to amplify GAPDH and penicillin. (glyceraldehyde-3-phosphate dehydrogenase) and DDX5 from mono- Lentivirus production. The sequences of short hairpin RNAs some/disome and polysome fractions. The numbers of transcripts per (shRNAs) targeting human DHX33 (shDHX33) are as follows (5= to 3=): GC fraction were calculated from a standard curve generated from serial di- TCAATATCTATCGGACCTT for shDHX33 number 1 (#1-shDHX33), CT lutions of a cDNA sample with a known total RNA amount. The GAPDH CGGGAAACTTCCTCTGAAA for #2-shDHX33, GCAATTTCAGACTC and DDX5 mRNA distribution per fraction was calculated as a percentage Downloaded from TTTGCTT for #3-shDHX33, GCTATCGCAAAGTGATCATTT for #4- of the total number of transcripts in all collected fractions. shDHX33; and CATTTCCTTTAGAACCCAAAT for #5-shDHX33. A [35S]methionine pulse-chase labeling. Cells were starved in cysteine- pLKO.1 vector carrying shRNA for a scrambled sequence (shScrambled) and methionine-free medium for 4 h and then pulsed with [35S]methio- was purchased from Addgene. A series of deletion mutants of DHX33 was nine (50 ␮Ci/ml)-containing medium for 15 min before being harvested. generated, using a QuikChange site-directed mutagenesis kit (Strat- The cells were lysed, and supernatants were precipitated with trichloro- agene), according to the primers designed by Stratagene online software. acetic acid at a concentration of 10%. Protein pellets were subsequently To produce knockdown virus, HEK293T cells were transfected with dissolved with 1% SDS, and the protein concentration was analyzed. An pLKO.1-shRNA, pCMV-VSV-G, and pHR8.2⌬R, which were used for equal amount of protein lysates (25 ␮g) was loaded onto an SDS-poly- virus packaging, by use of the Lipofectamine 2000 reagent (Life Technol- acrylamide gel, and the gel was transferred to a polyvinylidene difluoride
Load more

Recommended publications
  • Evidence for Differential Alternative Splicing in Blood of Young Boys With
    Stamova et al. Molecular Autism 2013, 4:30 http://www.molecularautism.com/content/4/1/30 RESEARCH Open Access Evidence for differential alternative splicing in blood of young boys with autism spectrum disorders Boryana S Stamova1,2,5*, Yingfang Tian1,2,4, Christine W Nordahl1,3, Mark D Shen1,3, Sally Rogers1,3, David G Amaral1,3 and Frank R Sharp1,2 Abstract Background: Since RNA expression differences have been reported in autism spectrum disorder (ASD) for blood and brain, and differential alternative splicing (DAS) has been reported in ASD brains, we determined if there was DAS in blood mRNA of ASD subjects compared to typically developing (TD) controls, as well as in ASD subgroups related to cerebral volume. Methods: RNA from blood was processed on whole genome exon arrays for 2-4–year-old ASD and TD boys. An ANCOVA with age and batch as covariates was used to predict DAS for ALL ASD (n=30), ASD with normal total cerebral volumes (NTCV), and ASD with large total cerebral volumes (LTCV) compared to TD controls (n=20). Results: A total of 53 genes were predicted to have DAS for ALL ASD versus TD, 169 genes for ASD_NTCV versus TD, 1 gene for ASD_LTCV versus TD, and 27 genes for ASD_LTCV versus ASD_NTCV. These differences were significant at P <0.05 after false discovery rate corrections for multiple comparisons (FDR <5% false positives). A number of the genes predicted to have DAS in ASD are known to regulate DAS (SFPQ, SRPK1, SRSF11, SRSF2IP, FUS, LSM14A). In addition, a number of genes with predicted DAS are involved in pathways implicated in previous ASD studies, such as ROS monocyte/macrophage, Natural Killer Cell, mTOR, and NGF signaling.
    [Show full text]
  • DHX29 Antibody A
    Revision 1 C 0 2 - t DHX29 Antibody a e r o t S Orders: 877-616-CELL (2355) [email protected] Support: 877-678-TECH (8324) 9 5 Web: [email protected] 1 www.cellsignal.com 4 # 3 Trask Lane Danvers Massachusetts 01923 USA For Research Use Only. Not For Use In Diagnostic Procedures. Applications: Reactivity: Sensitivity: MW (kDa): Source: UniProt ID: Entrez-Gene Id: WB, IP H M R Endogenous 155 Rabbit Q7Z478 54505 Product Usage Information Application Dilution Western Blotting 1:1000 Immunoprecipitation 1:50 Storage Supplied in 10 mM sodium HEPES (pH 7.5), 150 mM NaCl, 100 µg/ml BSA and 50% glycerol. Store at –20°C. Do not aliquot the antibody. Specificity / Sensitivity DHX29 Antibody detects endogenous levels of total DHX29 protein. Species Reactivity: Human, Mouse, Rat Source / Purification Polyclonal antibodies are produced by immunizing animals with a synthetic peptide corresponding to residues at the C-terminus of human DHX29. Antibodies were purified by protein A and peptide affinity chromatography. Background DHX29 is an ATP-dependent RNA helicase that belongs to the DEAD-box helicase family (DEAH subfamily). DHX29 contains one central helicase and one helicase at the carboxy-terminal domain (1). Its function has not been fully established but DHX29 was recently shown to facilitate translation initiation on mRNAs with structured 5' untranslated regions (2). DHX29 binds 40S subunits and hydrolyzes ATP, GTP, UTP, and CTP. Hydrolysis of nucleotide triphosphates by DHX29 is strongly stimulated by 43S complexes and is required for DHX29 activity in promoting 48S complex formation (2). 1. de la Cruz, J.
    [Show full text]
  • Eliseev, B., Yeramala, L., Leitner, A., Karuppasamy, M., Raimondeau, E., Huard, K., Alkalaeva, E., Aebersold, R., & Schaffitzel, C
    Eliseev, B., Yeramala, L., Leitner, A., Karuppasamy, M., Raimondeau, E., Huard, K., Alkalaeva, E., Aebersold, R., & Schaffitzel, C. (2018). Structure of a human cap-dependent 48S translation pre-initiation complex. Nucleic Acids Research, 46(5), 2678-2689. [gky054]. https://doi.org/10.1093/nar/gky054 Publisher's PDF, also known as Version of record License (if available): CC BY Link to published version (if available): 10.1093/nar/gky054 Link to publication record in Explore Bristol Research PDF-document This is the final published version of the article (version of record). It first appeared online via Oxford University Press at https://academic.oup.com/nar/advance-article/doi/10.1093/nar/gky054/4833217 . Please refer to any applicable terms of use of the publisher. University of Bristol - Explore Bristol Research General rights This document is made available in accordance with publisher policies. Please cite only the published version using the reference above. Full terms of use are available: http://www.bristol.ac.uk/red/research-policy/pure/user-guides/ebr-terms/ 2678–2689 Nucleic Acids Research, 2018, Vol. 46, No. 5 Published online 1 February 2018 doi: 10.1093/nar/gky054 Structure of a human cap-dependent 48S translation pre-initiation complex Boris Eliseev1, Lahari Yeramala1, Alexander Leitner2, Manikandan Karuppasamy1, Etienne Raimondeau1, Karine Huard1, Elena Alkalaeva3, Ruedi Aebersold2,4 and Christiane Schaffitzel1,5,* 1European Molecular Biology Laboratory, Grenoble Outstation, 71 Avenue des Martyrs, 38042 Grenoble, France,
    [Show full text]
  • Rps3/Us3 Promotes Mrna Binding at the 40S Ribosome Entry Channel and Stabilizes Preinitiation Complexes at Start Codons
    Rps3/uS3 promotes mRNA binding at the 40S ribosome entry channel and stabilizes preinitiation complexes at start codons Jinsheng Donga, Colin Echeverría Aitkenb, Anil Thakura, Byung-Sik Shina, Jon R. Lorschb,1, and Alan G. Hinnebuscha,1 aLaboratory of Gene Regulation and Development, Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD 20892; and bLaboratory on the Mechanism and Regulation of Protein Synthesis, Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD 20892 Contributed by Alan G. Hinnebusch, January 24, 2017 (sent for review December 15, 2016; reviewed by Jamie H. D. Cate and Matthew S. Sachs) Met The eukaryotic 43S preinitiation complex (PIC) bearing Met-tRNAi rearrangement to PIN at both near-cognate start codons (e.g., in a ternary complex (TC) with eukaryotic initiation factor (eIF)2-GTP UUG) and cognate (AUG) codons in poor Kozak context; hence scans the mRNA leader for an AUG codon in favorable “Kozak” eIF1 must dissociate from the 40S subunit for start-codon rec- context. AUG recognition provokes rearrangement from an open ognition (Fig. 1A). Consistent with this, structural analyses of PIC conformation with TC bound in a state not fully engaged with partial PICs reveal that eIF1 and eIF1A promote rotation of the “ ” the P site ( POUT ) to a closed, arrested conformation with TC tightly 40S head relative to the body (2, 3), thought to be instrumental bound in the “P ” state. Yeast ribosomal protein Rps3/uS3 resides IN in TC binding in the POUT conformation, but that eIF1 physically in the mRNA entry channel of the 40S subunit and contacts mRNA Met clashes with Met-tRNAi in the PIN state (2, 4), and is both via conserved residues whose functional importance was unknown.
    [Show full text]
  • Human Proteins That Interact with RNA/DNA Hybrids
    Downloaded from genome.cshlp.org on October 4, 2021 - Published by Cold Spring Harbor Laboratory Press Resource Human proteins that interact with RNA/DNA hybrids Isabel X. Wang,1,2 Christopher Grunseich,3 Jennifer Fox,1,2 Joshua Burdick,1,2 Zhengwei Zhu,2,4 Niema Ravazian,1 Markus Hafner,5 and Vivian G. Cheung1,2,4 1Howard Hughes Medical Institute, Chevy Chase, Maryland 20815, USA; 2Life Sciences Institute, University of Michigan, Ann Arbor, Michigan 48109, USA; 3Neurogenetics Branch, National Institute of Neurological Disorders and Stroke, NIH, Bethesda, Maryland 20892, USA; 4Department of Pediatrics, University of Michigan, Ann Arbor, Michigan 48109, USA; 5Laboratory of Muscle Stem Cells and Gene Regulation, National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland 20892, USA RNA/DNA hybrids form when RNA hybridizes with its template DNA generating a three-stranded structure known as the R-loop. Knowledge of how they form and resolve, as well as their functional roles, is limited. Here, by pull-down assays followed by mass spectrometry, we identified 803 proteins that bind to RNA/DNA hybrids. Because these proteins were identified using in vitro assays, we confirmed that they bind to R-loops in vivo. They include proteins that are involved in a variety of functions, including most steps of RNA processing. The proteins are enriched for K homology (KH) and helicase domains. Among them, more than 300 proteins preferred binding to hybrids than double-stranded DNA. These proteins serve as starting points for mechanistic studies to elucidate what RNA/DNA hybrids regulate and how they are regulated.
    [Show full text]
  • Yeast Eif4a Enhances Recruitment of Mrnas Regardless of Their Structural Complexity
    1 Yeast eIF4A enhances recruitment of mRNAs regardless of their structural complexity 2 3 Paul Yourik1, Colin Echeverría Aitken1,3, Fujun Zhou1, Neha Gupta1,2, Alan G. Hinnebusch2,4, Jon R. Lorsch1,4 4 5 1Laboratory on the Mechanism and Regulation of Protein Synthesis, Eunice Kennedy Shriver National Institute of Child 6 Health and Human Development, National Institutes of Health, Bethesda, MD 20892 7 2Laboratory of Gene Regulation and Development, Eunice Kennedy Shriver National Institute of Child Health and 8 Human Development, National Institutes of Health, Bethesda, MD 20892, USA 9 3Current address: Biology Department, Vassar College, Poughkeepsie, New York 12604, USA 10 4Corresponding Author 11 12 ABSTRACT 13 eIF4A is a DEAD-box RNA-dependent ATPase thought to unwind RNA secondary structure in the 5'-untranslated 14 regions (UTRs) of mRNAs to promote their recruitment to the eukaryotic translation pre-initiation complex (PIC). We 15 show that eIF4A’s ATPase activity is markedly stimulated in the presence of the PIC, independently of eIF4E•eIF4G, 16 but dependent on subunits i and g of the heteromeric eIF3 complex. Surprisingly, eIF4A accelerated the rate of 17 recruitment of all mRNAs tested, regardless of their degree of structural complexity. Structures in the 5'-UTR and 3' of 18 the start codon synergistically inhibit mRNA recruitment in a manner relieved by eIF4A, indicating that the factor does 19 not act solely to melt hairpins in 5'-UTRs. Our findings that eIF4A functionally interacts with the PIC and plays 20 important roles beyond unwinding 5'-UTR structure is consistent with a recent proposal that eIF4A modulates the 21 conformation of the 40S ribosomal subunit to promote mRNA recruitment.
    [Show full text]
  • Alu RNA Regulates the Cellular Pool of Active Ribosomes by Targeted Delivery of SRP9/14 to 40S Subunits
    Article Alu RNA regulates the cellular pool of active ribosomes by targeted delivery of SRP9/14 to 40S subunits IVANOVA, Elena, et al. Abstract The human genome contains about 1.5 million Alu elements, which are transcribed into Alu RNAs by RNA polymerase III. Their expression is upregulated following stress and viral infection, and they associate with the SRP9/14 protein dimer in the cytoplasm forming Alu RNPs. Using cell-free translation, we have previously shown that Alu RNPs inhibit polysome formation. Here, we describe the mechanism of Alu RNP-mediated inhibition of translation initiation and demonstrate its effect on translation of cellular and viral RNAs. Both cap-dependent and IRES-mediated initiation is inhibited. Inhibition in- volves direct binding of SRP9/14 to 40S ribosomal subunits and requires Alu RNA as an assembly factor but its continuous association with 40S subunits is not required for inhibition. Binding of SRP9/14 to 40S prevents 48S complex formation by interfering with the recruitment of mRNA to 40S subunits. In cells, overexpression of Alu RNA decreases transla- tion of reporter mRNAs and this effect is alleviated with a mutation that reduces its affinity for SRP9/14. Alu RNPs also inhibit the translation of cellular mR- NAs resuming [...] Reference IVANOVA, Elena, et al. Alu RNA regulates the cellular pool of active ribosomes by targeted delivery of SRP9/14 to 40S subunits. Nucleic Acids Research, 2015, vol. 43, no. 5, p. 2874-2887 DOI : 10.1093/nar/gkv048 Available at: http://archive-ouverte.unige.ch/unige:55879 Disclaimer: layout of this document may differ from the published version.
    [Show full text]
  • DHX29 (G63) Antibody A
    Revision 1 C 0 2 - t DHX29 (G63) Antibody a e r o t S Orders: 877-616-CELL (2355) [email protected] Support: 877-678-TECH (8324) 8 4 Web: [email protected] 6 www.cellsignal.com 4 # 3 Trask Lane Danvers Massachusetts 01923 USA For Research Use Only. Not For Use In Diagnostic Procedures. Applications: Reactivity: Sensitivity: MW (kDa): Source: UniProt ID: Entrez-Gene Id: WB H M R Mk Endogenous 155 Rabbit Q7Z478 54505 Product Usage Information Application Dilution Western Blotting 1:1000 Storage Supplied in 10 mM sodium HEPES (pH 7.5), 150 mM NaCl, 100 µg/ml BSA and 50% glycerol. Store at –20°C. Do not aliquot the antibody. Specificity / Sensitivity DHX29 (G63) Antibody detects endogenous levels of total DHX29 protein. Species Reactivity: Human, Mouse, Rat, Monkey Source / Purification Polyclonal antibodies are produced by immunizing animals with a synthetic peptide corresponding to a sequence around Gly63 of human DHX29 protein. Antibodies are purified by protein A and peptide affinity chromatography. Background DHX29 is an ATP-dependent RNA helicase that belongs to the DEAD-box helicase family (DEAH subfamily). DHX29 contains one central helicase and one helicase at the carboxy-terminal domain (1). Its function has not been fully established but DHX29 was recently shown to facilitate translation initiation on mRNAs with structured 5' untranslated regions (2). DHX29 binds 40S subunits and hydrolyzes ATP, GTP, UTP, and CTP. Hydrolysis of nucleotide triphosphates by DHX29 is strongly stimulated by 43S complexes and is required for DHX29 activity in promoting 48S complex formation (2). 1. de la Cruz, J.
    [Show full text]
  • Migration and Epithelial-To-Mesenchymal Transition of Lung Cancer Can Be Targeted Via Translation Initiation Factors Eif4e and E
    Laboratory Investigation (2016) 96, 1004–1015 © 2016 USCAP, Inc All rights reserved 0023-6837/16 Migration and epithelial-to-mesenchymal transition of lung cancer can be targeted via translation initiation factors eIF4E and eIF4GI Oshrat Attar-Schneider1,2,4, Liat Drucker2,4,5 and Maya Gottfried1,3,4,5 Metastasis underlies cancer morbidity and accounts for disease progression and significant death rates generally and in non-small cell lung cancer (NSCLC) particularly. Therefore, it is critically important to understand the molecular events that regulate metastasis. Accumulating data portray a central role for protein synthesis, particularly translation initiation (TI) factors eIF4E and eIF4G in tumorigenesis and patients' survival. We have published that eIF4E/eIF4GI activities and consequently NSCLC cell migration are modulated by bone-marrow mesenchymal stem cell secretomes, suggesting a role for TI in metastasis. Here, we aimed to expand our understanding of the TI factors significance to NSCLC characteristics, particularly epithelial-to-mesenchymal transition (EMT) and migration, supportive of metastasis. In a model of NSCLC cell lines (H1299, H460), we inhibited eIF4E/eIF4GI's expressions (siRNA, ribavirin) and assessed NSCLC cell lines' migration (scratch), differentiation (EMT, immunoblotting), and expression of select microRNAs (qPCR). Initially, we determined an overexpression of several TI factors (eIF4E, eIF4GI, eIF4B, and DHX29) and their respective targets in NSCLC compared with normal lung samples (70–350%↑, Po0.05). Knockdown (KD) of eIF4E/eIF4GI in NSCLC cell lines (70%↓, Po0.05) also manifested in decreased target levels (ERα, SMAD5, NFkB, CyclinD1, c-MYC, and HIF1α) (20–50%↓, Po0.05). eIF4E/eIF4GI KD also attenuated cell migration (60–75%↓, Po0.05), EMT promoters (15–90%↓, Po0.05), and enhanced EMT suppressors (30–380%↑, Po0.05).
    [Show full text]
  • Identification of Host DEAD-Box RNA Helicases That Regulate Cellular Tropism of Oncolytic Myxoma Virus in Human Cancer Cells
    www.nature.com/scientificreports OPEN Identifcation of host DEAD-box RNA helicases that regulate cellular tropism of oncolytic Myxoma virus Received: 29 March 2017 Accepted: 6 November 2017 in human cancer cells Published: xx xx xxxx Masmudur M. Rahman1, Eugenie Bagdassarian2, Mohamed A. M. Ali3 & Grant McFadden1 Myxoma virus (MYXV), a Leporipoxvirus, is being developed as an oncolytic virotherapeutic for the treatment of a variety of human cancers. MYXV tropism for human cancer cells is largely mediated by intracellular signaling networks that regulate viral replication or innate antiviral response pathways. Thus, MYXV is fully or partially permissive for the majority of human cancer cells that harbor defects in antiviral signaling, but a minority are nonpermissive because the virus infection aborts before its completion. To identify host factors relevant for MYXV tropism in human cancer cells, we performed a small interfering RNA (siRNA) library screen targeting the 58 human DEAD-box RNA helicases in two permissive human cancer cells (HeLa and A549), one semi-permissive (786-0), and one nonpermissive cell line (PANC-1). Five host RNA helicases (DDX3X, DDX5, DHX9, DHX37, DDX52) were inhibitory for optimal replication and thus classifed as anti-viral, while three other cellular RNA helicases (DHX29, DHX35, RIG-I) were identifed as pro-viral or pro-cellular because knockdown consistently reduced MYXV replication and/or required metabolic functions of permissive cancer cells. These fndings suggest that replication of MYXV, and likely all poxviruses, is dramatically regulated positively and negatively by multiple host DEAD-box RNA helicases. MYXV is the prototypic member of the Leporipoxvirus genus of Poxviridae family of viruses, which causes myx- omatosis disease in European rabbits, but is utterly non-pathogenic for all other non-leporid species.
    [Show full text]
  • Datasheet Blank Template
    SAN TA C RUZ BI OTEC HNOL OG Y, INC . DDX29 (H-248): sc-98409 BACKGROUND PRODUCT DDX29 (putative ATP-dependent RNA helicase DHX29) is a 1,369 amino acid Each vial contains 200 µg IgG in 1.0 ml of PBS with < 0.1% sodium azide protein encoded by the human gene DDX29. This protein belongs to the DEAD- and 0.1% gelatin. box helicase family (DEAH subfamily) and contains one helicase ATP-binding domain and one helicase C-terminal domain. DDX29 is a nuclear protein found APPLICATIONS on chromosome 5 that likely functions as an ATP-dependent RNA helicase. DDX29 (H-248) is recommended for detection of DDX29 of mouse, rat and RNA helicases are highly conserved enzymes that utilize the energy derived human origin by Western Blotting (starting dilution 1:200, dilution range from NTP hydrolysis to modulate the structure of RNA. RNA helicases par - 1:100-1:1000), immunoprecipitation [1-2 µg per 100-500 µg of total protein ticipate in all biological processes that involve RNA, including transcription, (1 ml of cell lysate)], immunofluorescence (starting dilution 1:50, dilution splicing and translation. range 1:50-1:500) and solid phase ELISA (starting dilution 1:30, dilution range 1:30-1:3000). REFERENCES Suitable for use as control antibody for DDX29 siRNA (h): sc-91695, DDX29 1. Dixon, M.J., Read, A.P., Donnai, D., Colley, A., Dixon, J. and Williamson, R. siRNA (m): sc-142929, DDX29 shRNA Plasmid (h): sc-91695-SH, DDX29 1991. The gene for Treacher Collins syndrome maps to the long arm of shRNA Plasmid (m): sc-142929-SH, DDX29 shRNA (h) Lentiviral Particles: chromosome 5.
    [Show full text]
  • General and Target-Specific Dexd/H RNA Helicases in Eukaryotic Translation Initiation
    International Journal of Molecular Sciences Review General and Target-Specific DExD/H RNA Helicases in Eukaryotic Translation Initiation Leo Shen 1 and Jerry Pelletier 1,2,3,* 1 Department of Biochemistry, McGill University, Montreal, QC H3G 1Y6, Canada; [email protected] 2 Department of Oncology, McGill University, Montreal, QC H4A 3T2, Canada 3 Rosalind and Morris Goodman Cancer Research Center, McGill University, Montreal, QC H3A 1A3, Canada * Correspondence: [email protected]; Tel.: +1-514-398-2323 Received: 5 June 2020; Accepted: 18 June 2020; Published: 20 June 2020 Abstract: DExD (DDX)- and DExH (DHX)-box RNA helicases, named after their Asp-Glu-x-Asp/His motifs, are integral to almost all RNA metabolic processes in eukaryotic cells. They play myriad roles in processes ranging from transcription and mRNA-protein complex remodeling, to RNA decay and translation. This last facet, translation, is an intricate process that involves DDX/DHX helicases and presents a regulatory node that is highly targetable. Studies aimed at better understanding this family of conserved proteins have revealed insights into their structures, catalytic mechanisms, and biological roles. They have also led to the development of chemical modulators that seek to exploit their essential roles in diseases. Herein, we review the most recent insights on several general and target-specific DDX/DHX helicases in eukaryotic translation initiation. Keywords: helicase; translation; initiation; DDX; DHX; eIF4A1; DDX3X; DHX9; DHX29; DHX36 1. Introduction RNA helicases play a role in all facets of RNA metabolism, ranging from transcription and translation, to processing and decay. These highly conserved enzymes use ATP to bind, unwind, and disrupt RNA structures and RNA-protein complexes [1].
    [Show full text]