Vagus Nerve Stimulation and Modulation of the Locus Coeruleus in a Preclinical Model for Multiple Sclerosis

Vagus nerve stimulation and modulation of the locus coeruleus in a preclinical model for multiple sclerosis

Dinah Arys Student number: 01303288

Supervisor(s): Prof. Dr. Robrecht Raedt, Dr. Guy Laureys

A dissertation submitted to Ghent University in partial fulfilment of the requirements for the degree of Master of Science in the Biomedical Sciences

Academic year: 2017-2018

Vagus nerve stimulation and modulation of the locus coeruleus in a preclinical model for multiple sclerosis

Dinah Arys Student number: 01303288

Supervisor(s): Prof. Dr. Robrecht Raedt, Dr. Guy Laureys

A dissertation submitted to Ghent University in partial fulfilment of the requirements for the degree of Master of Science in the Biomedical Sciences

Academic year: 2017-2018

Preface

Writing this thesis has been an interesting and challenging journey. It has been an instructive experience which gave me the opportunity to expand my knowledge and skills in the field of neuroscientific research. Without the help of many people, I wouldn’t have been able to write this thesis. So, I would like to thank them all.

First of all, I would like to thank my promotor Prof. Dr. Robrecht Readt, for giving me the opportunity to carry out my thesis in the Laboratory for clinical and experimental neurophysiology (LCEN) and for his guidance and many advice. Further, I would like to thank Dr. Guy Laureys for giving me the chance to carry out his project and for his guidance with designing the study protocol. I also want to thank Prof. Dr. Sarah Gerlo, for her guidance during the RT-qPCR analyzes.

Furthermore, I would like to thank Latoya Stevens and Wouter van Lysebettens in particular, for teaching me everything in the past two years and for always being there for me when I had questions or problems. I would also like to thank the other doctoral students for helping me whenever I needed it.

Finally, I would like to thank my fellow lab students, for making the days at the laboratory much more fun. My family and friends, for their endless support. And Jari, for his interest in my project and for his support and motivating words during the past two years.

Table of contents 1. Introduction ...... 3 The locus coeruleus-noradrenaline system: anatomy and physiology ...... 3 Multiple sclerosis ...... 4 1.2.1 Definition and clinical subtypes ...... 4 1.2.2 Immunopathogenesis of multiple sclerosis ...... 5 Role of the locus coeruleus-noradrenaline system in MS ...... 7 Chemogenetics ...... 9 1.4.1 Development of DREADDs ...... 9 1.4.2 Classification of DREADDs ...... 10 1.4.3 Cell specific expression of DREADDs ...... 12 Vagus nerve stimulation (VNS) ...... 14 1.5.1 Principle ...... 14 1.5.2 Vagus nerve: anatomy ...... 14 1.5.3 Mechanism of action (MOA) ...... 15 Objectives of the project ...... 16 2. Materials & methods ...... 17 Laboratory animals ...... 17 Stereotactical surgery: injection of vector ...... 17 Unit recording ...... 18 Perfusion and immunohistochemistry (IHC) ...... 19 Design of the pilot experiment ...... 20 Validation of stereotactical coordinates of the left lateral ventricle ...... 20 Implantation of a VNS-electrode and stereotactical placement of a cannula ...... 21 ICV injection of TNF-α or Ringers’ solution ...... 21 RT-qPCR ...... 21 Statistics ...... 23 3. Results ...... 23 Validation of stereotactical coordinates of the left lateral ventricle ...... 23 Immunohistochemistry: validation of vector expression ...... 24 Unit recording ...... 31 RT-qPCR analysis ...... 33 4. Discussion ...... 36 Immunohistochemistry: validation of vector expression ...... 36 Unit recording ...... 40 RT-qPCR analysis ...... 41 5. Conclusion ...... 43 6. References ...... 44

Samenvatting Achtergrond: Recente studies wijzen op een rol van gereduceerde noradrenaline (NA) levels en noradrenerge signalisatie in de pathofysiologie van multiple sclerose. Het hoofddoel van dit project is onderzoeken of een toegenomen NA release vanuit de locus coeruleus (LC), de voornaamste bron van NA in het centrale-zenuwstelsel, de immuun respons kan moduleren in het TNF-α-geïnduceerde neuro-inflammatoir-ratmodel. Twee methodes die de noradrenerge output van de LC zouden stimuleren zijn chemogenetische modulatie met de excitatoire hM3Dq designer-recepter-exclusively-activated-by-designer-drugs (DREADD) en nervus vagus stimulatie. Methoden: Een AAV2/7-PRSx8-hM3Dq-mCherry-vector werd geïnjecteerd in de LC, om de expressie van de hM3Dq DREADD te induceren. De selectiviteit van de DREADD expressie werd nagegaan a.d.h.v. een immunohistochemische dubbelkleuring tegen mCherry en tyrosine hydroxylase. De elektrofysiologische respons van LC neuronen op DREADD activatie m.b.v. clozapine werd gemeten met unit recording. Het TNF-α neuro-inflammatoir-ratmodel werd gecreëerd door intracerebroventriculaire injectie van TNF-α. Pro-inflammatoire condities werden geëvalueerd a.d.h.v. een RT-qPCR analyse voor inflammatoire target genen. Resultaten: Virale expressie was niet selectief voor noradrenerge neuronen van de LC, maar was ook aanwezig in regio’s rondom de noradrenerge nucleus. Injectie van clozapine leidt tot een stijging in vuurfrequentie van zowel controle als hM3Dq getransduceerde units. Er konden geen significante verschillen in mRNA expressie levels van target genen aangetoond worden tussen TNF-α behandelde en controle dieren. Besluiten: De chemogenetische modulatie van de LC met hM3Dq vereist verder onderzoek. Door mogelijke interacties van clozapine met endogene receptoren, kan niets besloten worden omtrent selectieve hM3Dq activatie in hM3Dq units. Het TNF-α ratmodel kon niet gevalideerd worden, vermoedelijk door een te kleine sample size en normalisatie van mRNA expressie levels na 24h.

Summary Background: Recent studies suggest that reduced noradrenaline (NA) levels and noradrenergic signalization may play a role in the pathophysiology of multiple sclerosis. The main goal of this project is to investigate if an increased NA release from the locus coeruleus (LC), the main source of NA in the central nervous system, can modulate the immune response in the TNF-α-induced neuroinflammatory-rat-model. Two methods that would increase the noradrenergic output of the LC are chemogenetic modulation with the excitatory hM3Dq designer-receptor-exclusively-activated-by-designer-drugs (DREADD) and vagus nerve stimulation. Methods: An AAV2/7-PRSx8-hM3Dq-mCherry vector was injected into the LC, to induce the expression of the hM3Dq DREADD. The selectivity of the DREADD expression was investigated by an immunohistochemical double-staining against mCherry and tyrosine hydroxylase. The electrophysiological response of LC neurons to DREADD activation by means of clozapine was measured with unit recording. The TNF-α neuroinflammatory ratmodel was created by intracerebroventricular injection of TNF-α. Proinflammatory conditions were evaluated by a RT-qPCR analysis for inflammatory target genes. Results: Viral expression was not selective for noradrenergic neurons of the LC, but was also present in regions around the noradrenergic nucleus. Injection of clozapine leads to an increase in fire frequency of both control and hM3Dq transduced units. No significant differences in mRNA expression-levels of target genes could be demonstrated between TNF- α treated and control animals. Conclusions: The chemogenetic modulation of the LC with hM3Dq requires further investigation. Due to possible interactions of clozapine with endogenous receptors, no conclusion about selective hM3Dq activation in hM3Dq units could be made. The TNF-α ratmodel could not be validated, presumably due to a small sample size and resolution of mRNA expression levels after 24h.

1. Introduction The locus coeruleus-noradrenaline system: anatomy and physiology

Noradrenaline (NA) is the main neurotransmitter used by the sympathetic nervous system (SNS). In addition to its roles in the periphery, it is also a modulatory neurotransmitter of the central nervous system (CNS). The primary source of NA in the CNS, is the locus coeruleus (LC). The LC is a nucleus located bilaterally in the dorsal wall of the pons, lining the lateral floor of the fourth ventricle (fig. 1). Each LC nucleus consists of Fig.1: Anatomical location of the LC. approximately 45 000 to 60 000 noradrenergic Figure from Higgings E.S. and George M.S (2009) [3]. neurons in humans and 1600 neurons in rodents [1,2]. The LC projects to extensive areas throughout the neuroaxis, with exception of the basal ganglia. Because of this, the LC plays a role in modulating several physiological functions, such as attention, arousal, cognition and stress response [4]. The LC is a known wakefulness promoting nucleus, as it is part of the reticular activating system. The ability of the LC to increase wakefulness, results from its excitatory projections to the neocortex, thalamus, several wakefulness promoting nuclei of the forebrain and brain stem, and inhibitory projections to the sleep promoting gamma- aminobutyric acid (GABA) neurons of the basal forebrain and hypothalamus. Furthermore, the LC-NA system plays a role in controlling autonomic function. Activity of the LC is correlated with an increase in sympathetic activity and a decrease in parasympathetic activity. This results from direct projections to sympathetic and parasympathetic preganglionic neurons of the spinal cord and indirect projections to several autonomic brain stem nuclei. Moreover, the LC forms the only noradrenergic projection to the hippocampus. This projection contributes to memory formation and retrieval. The LC also has an excitatory projection to the amygdala, which is correlated with increased anxiety and may also play a role in forming and retrieving emotional memories [5].

Animal studies have shown that LC neurons can exhibit two modes of neuronal firing: tonic and phasic firing. These neuronal firing modes depend on arousal state and level of interest. Tonic activity is characterized by a sustained and regular frequency (1-3 Hz) discharge pattern, is the highest during wakefulness, decreases during slow-wave sleep and disappears in rapid eye movement (REM) sleep. In response to environmental stimuli that elicit exploratory behavior and disengagement from a task, tonic activity will increase. During accurate task

3 performance, reﬂecting focused attentiveness, LC neurons ﬁre tonically at a moderate rate and respond phasically to task-relevant target stimuli. Phasic activity is characterized by bursts of 2-3 action potentials and is associated with highly accurate behavioral responses [4,6].

Noradrenergic neurons of the LC can be identified in immunohistochemical stainings by immunoreactivity for tyrosine hydroxylase (TH), the rate-limiting enzyme for catecholamine synthesis. In LC neurons, NA is synthesized from tyrosine by tyrosine hydroxylase, with formation of L-DOPA (L-dihydroxyphenylalanine), which is converted to dopamine by L-amino acid decarboxylase. Dopamine is then converted to NA by action of dopamine β-hydroxylase. The release of NA can happen synaptic or at non-synaptic release sites. Extrasynaptic NA can exert paracrine effects on neurons, glial cells, immune cells and micro vessels [4]. Once released, NA acts via G-protein coupled α1-, α2- and β-adrenergic receptors. NA has the highest affinity for α2-receptors. Each receptor family can further be divided into subtypes: α1-

A,B,C,D , α2-A,B,C and β-1,2,3 adrenergic receptors [7]. In general, excitatory effects are mediated by α1- and β-receptors and inhibitory effects are mediated by α2-receptors [4].

The α2-A- and α2-C-receptors are mainly found in the CNS, whereas the α2-B-receptors are more found on vascular smooth muscle. When NA binds to the α2-receptor, it couples to a heterotrimeric Gi-protein, which leads to inhibition of adenylyl cyclase isoforms, which in turn leads to a decrease in intracellular cyclic adenosine monophosphate (cAMP) production. This causes hyperpolarization in neurons [7,8]. The α1-receptors are found in various organs, including the brain, heart, blood vessels, liver, kidney, prostate and spleen. When NA binds to the α1-receptor, it couples to a Gq-protein, leading to activation of phospholipase C, which produces the intracellular messengers inositol trisphosphate (IP3) and diacylglycerol (DAG), from the hydrolysis of phosphatidylinositol 4,5-bisphosphate (PIP2). IP3 triggers the release of calcium from the endoplasmic reticulum, while DAG recruits protein kinase C to the membrane and activates it [7,9]. This leads to enhanced excitability in neurons. The β-receptors are found in the CNS, kidney, heart, adipocytes, bronchial and vascular smooth muscle cells, lymphocytes, endothelial cells and hepatocytes. When NA binds to the β-receptor, it couples to a Gs-protein, which leads to activation of adenylyl cyclase isoforms, which in turn leads to an increase in intracellular cAMP, further leading to the activation of protein kinase A (PKA) [7,10].

Multiple sclerosis

1.2.1 Definition and clinical subtypes Multiple sclerosis (MS) is an autoimmune disease of the CNS, attributed to immune-mediated demyelination. The pathological hallmark of MS is the occurrence of multiple sclerotic lesions

4 or “plaques” in the white matter of the CNS. The plaques result from focal loss of myelin (with relative preservation of axons) and astrocytic gliosis [11]. MS plaques can be visualized with an MRI scan and are generally divided into three subtypes: active (acute), chronic-active and chronic-inactive plaques. This subdivision is made depending on the type of inflammatory cells seen in the lesions, the involvement of immunoglobulin and complement, the morphology of the plaque edge, the degree of oligodendrocyte injury and the degree of demyelination and remyelination [12]. Depending on the location of the plaques in the CNS, variable clinical symptoms are seen, including sensory, visual, motor, vestibular, bulbar, gait, bladder and cognitive impairments [13]. In general, the disease process has three components: 1) an initial phase of inflammation, which leads to 2) demyelination. Since oligodendrocytes are initially largely preserved, remyelination occurs. But in later stages, the oligodendrocytes themselves are damaged, leading to 3) axonal damage, which is the main cause of permanent disability [11,13].

MS patients are classified into three stages of disease progression. The most common form, affecting 85% of patients, is relapsing-remitting MS (RRMS). It is characterized by an initial attack of inflammatory demyelination, followed by a remission period in which symptoms will recover completely or partially. After recurring cycles of relapse and remission, the recovery during each remission disappears, thereby leaving a residual disability. 80% of these patients go on to develop secondary progressive MS (SPMS). In this course, progressive neurologic deterioration occurs, with or without relapses. Approximately 10% of MS patients is diagnosed with primary progressive MS (PPMS), characterized by progressive decline from the onset and an absence of relapses an remissions [13].

The etiology of MS is still unknown, but the disease probably develops in genetically susceptible individuals in combination with environmental factors (chemicals, smoking, vitamin D insufficiency) and exposure to a viral pathogen. Numerous potential viruses have been evaluated for a possible causal association with MS. Some studies suggest that Epstein Barr virus and human herpes virus 6 are associated with development of MS [11,12]. Moreover, in recent years, it has become evident that dysregulation of physiological NA levels or NA mediated signaling contributes to the pathology of MS [1].

1.2.2 Immunopathogenesis of multiple sclerosis During an immune response, a crosstalk occurs between the SNS and the immune system, this process is essential for maintaining homeostasis. NA is the main neurotransmitter used by the SNS and is involved in the regulation of inflammation. All lymphoid organs receive an extensive sympathetic innervation. NA, released from post-ganglionic fibers of the SNS,

5 modulates lymphocyte circulation, proliferation and cytokine production via activation of β2- adrenergic receptors (β2-AR’s), which are present on different immune cells. Studies indicate that a hypoactive SNS-immune interaction is present in MS and it’s rodent model, experimental autoimmune encephalomyelitis (EAE) [14]. The immune system plays an important role in the pathology of MS. Inflammation is present in all stages of the disease, but is more present in RRMS, while widespread axonal degeneration is seen in progressive forms [13].

The trigger for auto-immunity is the peripheral activation of myelin specific T- cells by dendritic cells (= antigen presenting cells (APC)), probably through molecular mimicry. This means there is presentation of a viral epitope that resembles the epitope of a self-antigen (e.g. myelin basic protein). Depending on the milieu of cytokines secreted by dendritic cells, the naive CD4+ T-cells differentiate into T-helper cells (TH1-, TH2- or TH17-cells). Once activated and differentiated, these autoreactive T-cells migrate to the CNS by crossing the blood- brain-barrier (BBB). Activated T-cells express integrins that bind to adhesion molecules on the surface of the endothelium. Next, the T-cells secrete matrix metalloproteinases (MMPs), Fig. 2: Immune mediated demyelination in MS. Figure from Holmoy T. and Hestvik A.L. (2008) [15] enzymes that degrade the extracellular

matrix of the endothelium. The T-cells are then locally reactivated when they recognize their specific myelin epitope on the surface of APC’s. The TH1- and TH17-cells will now produce a range of pro-inflammatory cytokines (e.g. TNF-α, IFN-γ, IL17), that stimulate microglial cells, astrocytes, macrophages and CD8+ T- cells. Activated macrophages phagocyte pieces of the myelin sheath in inflammatory lesions. CD8+ T-cells will directly kill neurons by recognizing their antigen presented by HLA class I on neurons. CD4+ T-cells express the death molecule TRAIL (TNF-related apoptosis-inducing ligand) and may kill neurons by attaching to their TRAIL receptor. The TH2-cells activate B- cells into plasma cells, who will in turn produce myelin specific antibodies. Furthermore there is an up-regulation of HLA class II molecules on astrocytes and microglia and an upregulation

6 of adhesion molecules on the BBB endothelium. This in turn, leads to additional recruitment of inflammatory cells into the CNS. In progressive forms of MS, microglia and macrophages are chronically activated and produce reactive oxygen and nitrogen species (ROS, RNS), causing oxidative stress and associated axonal mitochondrial dysfunction. Together with glutamate excitotoxicity, due to excessive release of glutamate by activated lymphocytes, microglia and macrophages, this leads to axonal damage and oligodendrocyte degeneration. Normally, autoreactive T-cells are controlled by regulatory T-cells (Treg, TH3, Tr1 and CD56+ NK cells). But this immune regulation is disturbed in MS (fig. 2) [11,12,13,15,16].

Role of the locus coeruleus-noradrenaline system in MS Several studies report that NA levels are altered in the CNS of MS patients and rodents with EAE, which contributes to the pathology. EAE is the most frequently used animal model for MS and it is either induced by immunization with myelin peptides in Freuds adjuvant or by transfer of myelin specific CD4+ T-cells generated in donor animals, into recipient animals. The study of Polak P.E. and colleagues demonstrated that cortical and spinal cord levels of NA are significantly reduced in EAE mice, in comparison with control mice. These NA reductions were associated with neuronal damage of the LC, detected by a reduction of average cell size of TH stained neurons, and with astrocytic gliosis in the ventral portion of the LC. Furthermore, this study demonstrated that NA levels were also reduced in autopsied brain tissue samples from MS patients, in comparison with control samples. Immunohistochemical analysis showed presence of astrogliosis in the LC regions of these samples. However, damage of LC neurons could not be demonstrated in MS brain samples [17]. In fact, only one MRI study has been able to demonstrate axonal damage at the right LC of RRMS patients. This damage was correlated with impairment of auditive selective attention in MS [18].

Evidence that reduced NA levels contribute to EAE/MS pathogenesis is further supported by the study of Simonini M.V. et. al. Experimental lesioning of the LC in EAE mice with DSP4 (N- (2-chloroethyl)-N-ethyl-2-bromobenzylamine), a selective neurotoxin for the LC, caused aggravation of EAE symptoms. However, if these mice were treated with the NA precursor L- DOPS (L-Dihydroxyphenylserine) in combination with a NA reuptake inhibitor, there was an increase in NA levels and improvement of EAE symptoms [19]. Furthermore the study of

Chelmicka-Schorr E. et. al. showed that β2-AR activation suppressed EAE in rats. The intraperitoneal (IP) administration of the β2-AR agonist isoproterenol for 13 or 21 days post- immunization, suppressed clinical scores in EAE rats [20]. These findings suggest that selective elevation of CNS NA levels and increased β2-AR activation could provide benefit in EAE and MS, without influencing peripheral immune responses.

Research has demonstrated that NA induces anti-inflammatory effects, both in vitro and in vivo. NA exerts its effects through activation of adrenergic receptors. The β2-AR’s in particular, are involved in noradrenergic immunomodulation. β2-AR’s are present on different cells, including immune cells, astrocytes, microglia and neurons. In most cases, the activation of β2- AR’s leads to an increase in intracellular levels of cAMP, which is further linked to suppression of inflammatory transcription factor activities, including NFĸB (nuclear factor kappa-light-chain- enhancer of activated B-cells) dependent gene expression [21]. The study of Laureys G. et al. demonstrated that the immunomodulatory actions of NA are indeed mediated via β2-AR’s. The tumor necrosis factor alfa (TNF-α) -induced immune response was modulated in vivo by the β2-AR agonist clenbuterol. After intracerebroventricular (ICV) administration of clenbuterol and TNF-α in rats, an extensive flow cytometry analysis was performed, which showed that clenbuterol was able to modulate the TNF-α-induced brain inflammatory cell populations. There was a nonsignificant reduction in B-cell numbers. Within the T-cell population there was a significant increase in the CD4-CD8- double negative phenotype. Double negative T-cells are enigmatic cells found in rodents and humans and they make up about 1% to 3% of the total T-cell pool. They are thought to play a role as regulatory T-cells implicated in counteracting allograft rejection, graft-versus-host disease and autoimmune processes. The myeloid cells showed a significant decrease in the proportion of macrophages and an increase in neutrophils. They further demonstrated a nonsignificant reduction in TNF-α-induced expression levels of inflammatory target genes ICAM-1, VCAM-1 and the chemokine CCL5, after clenbuterol+TNF-α ICV co-administration [22]. The mechanisms behind these shifts in T- cell subsets and changes in mRNA expression levels are still unclear and require further investigation, but provide evidence for a role of NA in modulating the immune response via β2- AR’s.

Within the nervous system, these β2-AR’s are most abundantly expressed on astrocytes. Together with microglia, they are the main effectors of the innate immunity in the CNS. Astrocytes respond to CNS insults by a process called astrogliosis [21]. This is associated with induction of pro-inflammatory cytokines. In vitro, NA reduces the LPS (lipopolysaccharide)- induced expression of nitric oxide synthase (NOS2), TNF-α, IL-6 and NO generation in astrocytes, mediated through β2-AR’s, which is in line with the proposed anti-inflammatory action of NA via β2-AR’s [23,24]. Intriguingly, a loss of β2-AR’s expression on astrocytes has been documented in MS and EAE. NA normally suppresses the INF-γ-induced MHC class-II expression on astrocytes, via activation of β2-AR’s, leading to inhibition of CIITA (class-II major histocompatibility complex transactivator). CIITA is a transcription factor that is required for the transcription of MHC class-II mRNA. Since CIITA is blocked, astrocytes cannot operate as

APCs, therefore the inflammatory response is suppressed. Thus, a loss of β2-AR’s can explain

8 the presence of MHC class-II on astrocytes in MS. Therefore astrocytes can function as APCs and initiate the inflammatory reaction, which leads to relapses in MS patients [25]. Taken together, these studies provide evidence that perturbations of the noradrenergic system occur during MS, although it remains unclear what the underlying causes of the observed perturbations are. The pathophysiological basis of MS is still not entirely understood, but methods that raise NA levels may be beneficial in MS, and other diseases with an inflammatory component.

Chemogenetics A recent technology that allows stimulation of the activity of certain neurons in vivo, is chemogenetics. It is a technology by which macromolecules are engineered to interact with previously unrecognized small molecules. These engineered macromolecules are G-protein coupled receptors (GPCRs) [26]. The first generation of GPCR based chemogenetic tools were the “allele-specific GPCRs”. These were designed mutant β2-AR’s that were unable to bind the native ligand adrenaline, but could be activated with low potency by 1-(3’,4’-dihydroxyphenyl)- 3-methyl-L-butanone. The second generation were the “receptors activated solely by synthetic ligands” (RASSLs). The initial RASSL was an engineered k-opioid receptor (KOR) that was insensitive to native ligands, but could be activated potently by the synthetic agonist spiradoline. However, the engineered receptors of these two generations occasionally had high levels of constitutive activity and their ligands were found to have effects on native receptors. To overcome these problems, a third generation was developed, the “designer receptors exclusively activated by designer drugs” (DREADDs). DREADDs are selectively activated by clozapine-N-oxide (CNO). CNO is a metabolite of the drug clozapine [27]. In this project, noradrenergic neurons of the LC will be genetically manipulated via viral transfection with an AAV2/7-PRSx8-hM3Dq-mCherry vector. The binding of CNO to the hM3Dq DREADD activates the Gq mediated intracellular signalization cascade, leading to activation of neurons. This upregulation of LC neurons should lead to an increased NA release.

1.4.1 Development of DREADDs DREADDs were developed from directed molecular evolution of a modified rat muscarinic receptor expressed in Saccharomyces cerevisiae yeast. These receptors were subjected to random mutagenesis with polymerase chain reaction, to create a large library of mutant rat muscarinic receptors. These mutant receptors were then screened for activation by clozapine and CNO and unresponsiveness to acetylcholine. The selected clones from this initial screening were then remutagenized for subsequent rounds of selection, to yield receptors with higher potency for CNO. Eventually two clones were found that were potently activated by CNO and unresponsive for acetylcholine. Later on, a mutant human muscarinic receptor with

9 high affinity for CNO, that was suitable for expression in mammalian cells, was developed. Human muscarinic 3 (hM3) receptors expressed in human HEK T cells (human embryonic kidney strain) were subjected to random mutagenesis. After several cycles of selection and mutagenesis, they found that the double mutant Y149C3.33/A239G5.46 was the best possible combination of mutations to generate a hM3 DREADD (hM3D) that was potently activated by CNO and had minimal constitutive activity. And so the first DREADD (hM3D) was developed. Later it became clear that the introduction of the two mutations in the other human muscarinic receptors hM1, hM2, hM4 and hM5, also transformed these receptors into CNO-activated DREADDs [28].

CNO was chosen as the synthetic ligand for the hM3D because it was already known that its parent compound clozapine had high affinity for M3 receptors, therefore only a few mutations were required to make CNO a potent agonist [28]. Second, CNO appeared to be pharmacological inert in rodents and could penetrate into the CNS. However, some studies have raised a concern that some of the effects of CNO are mediated by the conversion of CNO to clozapine. Indeed, a small fraction of CNO is metabolized to clozapine in humans, nonhuman primates and guinea pigs. If DREADDs are used in these species, it is important to keep the dose of CNO as low as possible, to avoid clozapine induced side effects such as hypotension, sedation and anticholinergic syndrome [29]. Moreover, a recent study provided evidence that this back-metabolization might also occur in rodents. And that clozapine, rather than CNO, would be the actual in vivo DREADD activator [30]. The latter is currently being investigated. Other DREADD agonists have also been investigated. Compound 13 and 21 are derivates of the CNO compound. Both are potent full agonists of hM3Dq, but do not activate the native hM3 [31]. Compound 21 likely cannot be metabolized via normal routes to clozapine or any related compound and thus represents an alternative to CNO. Another potent hM3Dq agonist is perlapine, which is a 10 000 fold more selective for hM3Dq over the native hM3. Perlapine can be useful for translational studies in humans, because it has already been approved as a medicine for insomnia in Japan [26].

1.4.2 Classification of DREADDs DREADDs can be classified according to the GPCR signaling cascades they induce after activation by their ligand: DREADDs coupled to Gq, Gi, Gs and β-arrestin [29] (fig. 3).

Gq DREADD: The hM3 receptor with the Y3.33C and A5.46G mutations was called the hM3Dq (human muscarinic 3 receptor DREADD coupled to Gq). After activation by CNO, this DREADD couples to the Gq pathway in many cells, in vitro and in vivo, including transiently transfected HEK cells, neurons, astrocytes, hepatocytes and pancreatic β-cells. There are

10 three Gq coupled DREADDs, each of them is based on a different human muscarinic receptor: hM1Dq, hM3Dq and hM5Dq. Activation of the hM3Dq in neurons leads to a mobilization of calcium, causing depolarization and increased excitability, which can induce burst-like firing. Therefore, the hM3Dq is frequently used as a tool to enhance neuronal firing [26,29].

Gi DREADD: The Gi DREADDs are generated by creating the same mutations in both the hM2 and hM4 receptors [25]. The hM2Di and hM4Di DREADDs can be activated by CNO, compound 21 and perlapine and couple to the Gi pathways in many cells. The hM4Di is more frequently used than hM2Di. A more recent Gi DREADD is the κ-opioid-derived DREADD (KORD). The KORD is activated by the pharmacologically inert compound salvinorin B (SALB), but not by its endogenous ligand dynorphin. Activation of hM4Di and KORD expressed in neurons, leads to silencing of neuronal firing. This happens via two mechanisms: the Gi- proteins activate G-protein inward rectifying potassium channels (GIRKs), which induces hyperpolarization. And they inhibit the presynaptic release of neurotransmitters (synaptic silencing). An advantage of the KORD is that it allows bidirectional chemogenetic modulation of neural activity: KORD may be expressed simultaneously with hM3Dq to allow for the sequential chemogenetic activation (with hM3Dq and CNO) and inhibition (with SALB and KORD) of neuronal activity [29].

Gs and β-Arrestin DREADDs: The Gs DREADD was created by interchanging the intracellular regions of the turkey erythrocyte β-AR, for equivalent regions of a rat M3 DREADD. Unlike the current Gq and Gi DREADDs, the Gs DREADD has a low degree of constitutive activity in transfected cells [31]. Gs DREADDs couple to both Gs- and Golf-proteins. The β-arrestin DREADD (Rq) was created by mutation of an amino acid required for G-protein signaling in hM3Dq. Activation of this DREADD by CNO leads to phosphorylation of the GPCR by G- protein coupled receptor kinases (GRK’s), followed by binding of β-arrestin, which leads to internalization of the GPCR and termination of signaling. This DREADD activates β-arrestin pathways in vitro, but has not yet been used in vivo because it requires high CNO concentrations for full activation [26,29].

Fig. 3: Some chemogenetic receptors signal through G-proteins (yellow box), while others have been engineered to signal through non G-protein pathways (green box). [32]

1.4.3 Cell specific expression of DREADDs In this project, cell specific expression of the hM3Dq into the noradrenergic neurons of the LC will be achieved by stereotactical injection of a virus derived vector containing the hM3Dq and a cell-type specific PRSx8 promotor (AAV2/7-PRSx8-hM3Dq-mCherry vector). For gene delivery to the brain, recombinant adeno-associated virus (rAAV) is mostly used, because it permits nontoxic transduction of post mitotic cells and long-term gene expression in neurons [33]. Moreover, AAVs have not been associated with any human diseases and require co- infection with a helper virus to replicate. In rAAV vectors, all the viral sequences are removed, except for the inverted terminal repeats, necessary for genome packaging into the AAV capsid. Therefore these vectors provoke minimal immune responses. The derived rAAV vector is non- integrative, meaning it persist in an extrachromosomic form in the nucleus of the target cell, which excludes the risk of insertional mutagenesis [34,35]. One limitation of using rAAVs is that due to the relatively small genome of wild type AAVs, only a transgene of up to 5 kilo base pairs (kbp) in length can be used to transduce cells [35]. Evidence from literature shows that the synthetic dopamine β-hydroxylase promotor, PRSx8, selectively targets the hM3Dq expression to noradrenergic neurons of the LC [36]. Three weeks after injection of the AAV2/7- PRSx8-hM3Dq-mCherry vector, the expression of the DREADD is maximal and an immunohistochemical staining against the fluorescent reporter gene of the vector (mCherry) will be performed to check the specificity of the DREADD expression.

If the use of the PRSx8 promotor does not lead to specific expression, alternative methods can be used. One of them is based on Cre-lox recombination. A viral vector is created by using the flip-excision (FLEX)-switch approach: this technique uses a viral vector in which the DREADD is orientated reversed and is flanked by two pairs of heterotypic antiparallel LoxP recombination sites (Lox2722 and LoxP). In the presence of CRE recombinase, the LoxP recombination sites undergo inversion of the coding sequence (DREADD) followed by the excision of two sites. The result is that each orthogonal recombination site is oppositely oriented and incapable of further Fig. 4: FLEX-Switch approach. recombination. The FLEX switch viruses that encode Figure from DJ. Urban (2015) [26] DREADDs are injected in rodents who express the

Cre recombinase under control of a cell type specific promoter [26] (fig.4).

Another transgenic approach uses the Tet-off system. The Tet-off system uses a tetracycline transactivator protein (tTA), that binds the tetracycline response element (TRE), which induces the expression of the transgene (hM3Dq) downstream of the promotor. But this Fig. 5: Tet-off system approach. Figure adapted from GM. Alexander and expression can be blocked when tetracycline or SC. Rogan (2009) [37] its analog doxycycline is administered, because this will bind to tTA, wherefore tTA cannot bind to TRE anymore. First, transgenic mice are generated, who express a tetracycline sensitive HA-tagged hM3Dq under control of a TRE promotor. This is done by pronuclear injection of TRE-hM3Dq-HA DNA in murine oocytes, which results in mouse pups carrying the transgene. After production of this Tet responsive mouse line, these mice are crossed with TH-promotor-tTA mice to achieve cell-specific expression of the hM3Dq in noradrenergic neurons. The TH-dependent promotor is specific for noradrenergic neurons and will drive expression of tTA in noradrenergic neurons. When crossed, the tTA protein stimulates the TRE promoter to induce transcription of HA-

13 hM3Dq, only in noradrenergic neurons, in this way cell-specific expression of the hM3Dq DREADD is achieved [37] (fig. 5).

Vagus nerve stimulation (VNS)

1.5.1 Principle VNS can be used as an alternative, but less specific technique than chemogenetics to stimulate the noradrenergic output from the LC. The left vagus nerve is electrically stimulated by a helical electrode that is wrapped around the mid-cervical vagus nerve and a pulse generator that is subcutaneously implanted in the left upper chest region. The electrode is connected to the pulse generator via a lead wire, which is subcutaneously tunneled (fig. 6).

Fig. 6: Vagus nerve stimulation. The pulse generator has four different programmable [39] stimulation parameters: the current charge (electrical stimulus intensity, measured in milliamperes), the pulse width (electrical pulse duration, measured in µs), the pulse frequency (measured in Hertz) and the on/off duty cycle (the stimulus on-time and off-time, measured in seconds or minutes) [38].

1.5.2 Vagus nerve: anatomy The vagus nerve (10th cranial nerve) is a major component of the autonomous nervous system. It is a mixed nerve composed of 20% efferent fibers and 80% afferent fibers. These fibers exit or enter the medulla on both sides and pass through the jugular foramen, to innervate all thoracic and abdominal organs. The cell bodies of the efferent fibers are located in the nucleus ambiguous and the dorsal motor nucleus of the vagus. Efferent fibers descend through the neck, thorax and diaphragm into the abdomen. During this course, several branches enervate various structures such as the larynx, pharynx, heart, lungs, liver and the gastrointestinal tract [40].

The afferent fibers carry information from the stomach, intestines, liver, pancreas, heart, trachea and spleen. The cell bodies of the afferent fibers are located in the ganglion nodosum and ganglion jugular. The majority of afferent fibers terminate predominantly in the nucleus tractus solitarius (NTS), but also the dorsal motor nucleus of the vagus, the area postrema, nucleus ambiguous and the spinal trigeminal nucleus are innervated by some afferent fibers. The NTS in turn, sends this information to other brain regions such as the dorsal raphe nuclei, LC, amygdala, hypothalamus, thalamus and orbitofrontal cortex [41].

There are three types of fibers in the vagus nerve, the big myelinated A-fibers, the medium myelinated B-fibers and the small unmyelinated C-fibers. The A-fibers have the lowest amplitude threshold required for VNS to excite action potentials (ranging from 0.02 to 0.2 mA). The B- and C-fibers have higher excitation thresholds (ranging from 0.04 to 0.6 mA and more than 2.0 mA, respectively). Suppression of epileptic seizures results from A- and B-fiber activation, because it has been shown that C-fiber destruction does not affect the VNS induced seizure suppression [42].

1.5.3 Mechanism of action (MOA) Although VNS is an approved therapy for refractory epilepsy and for treatment of depression, the MOA of VNS is still not known. VNS is currently being investigated for other indications, such as pain disorders and inflammatory disorders (rheumatoid arthritis, inflammatory bowel disease) [43]. VNS probably exerts its effects by raising NA concentrations in the brain. The NTS is primarily activated by VNS. The NTS in turn makes connection to the LC, which sends widespread projections to the brain and spinal cord. Several evidence indicates a role of the LC in the MOA of VNS. Electrophysiological studies have showed an increase in basal firing rate of LC neurons with unit recording after long term VNS treatment [44]. Moreover, a microdialysis study showed an increase in extracellular NA levels in the prefrontal cortex and hippocampus after long term VNS treatment in rats [45,46]. In addition, it has been shown that the increased extracellular concentration of NA in the hippocampus, induced by VNS, was correlated with a reduction in the duration and severity of pilocarpine induced limbic seizures [45]. Further evidence that the LC is indeed involved in the MOA of VNS was given by Krahl et. al. lesioning of the LC in the maximal electric shock rat model, blocked VNS induced seizure suppression [47].

VNS has further been found to attenuate peripheral inflammation. Rheumatoid arthritis (RA) patients who received VNS up to four times a day, showed a significant reduction in the levels of TNF-α production in peripheral blood. VNS also improved RA disease severity as measured by standardized clinical composite scores. In a study with epilepsy patients, VNS decreased the endotoxin-induced peripheral blood production of TNF-α, IL-1β and IL-6, in comparison with baseline levels before stimulation [48]. Another study demonstrated that VNS attenuated arthritic joint inflammation by increasing NA levels in the synovial fluid and thereby reduced synovial inflammatory cytokines and ICAM-1 expression [49]. Moreover, a recent study demonstrated that VNS also attenuates neuroinflammation in mice injected with LPS. The increased levels of pro-inflammatory cytokines in brain extracts induced by peripheral LPS injection, were significantly reduced after VNS treatment. The percentage of microglia (CD11b/CD45 ”low”) and macrophages (CD11b/CD45 ”high”) was also significantly reduced

15 after VNS in LPS-treated mice, as assessed by flow cytometry [50]. Although the MOA of VNS has not been completely elucidated, there is evidence that an increased noradrenergic output from the LC plays an important role. Since the current biological immunomodulatory drugs for MS are often expensive and have multiple side effects, methods that raise central NA levels, such as VNS, might be more beneficial in controlling aberrant immune responses.

Objectives of the project Evidence from literature shows that selective elevation of CNS NA levels, or increased stimulation of β2-AR’s can modulate immune responses within the CNS [20,22,50]. Therefore the main goal of this project is to investigate if increased central NA levels from the LC can modulate the immune response in the TNF-α-induced neuroinflammatory rat model. To achieve increased central NA levels, chemogenetics and VNS can be used. The first step of the project consists of validating the selective expression of the hM3Dq DREADD into the noradrenergic neurons of the LC. Correct expression of the DREADD will be validated by performing immunohistochemical double stainings against TH and mCherry. Furthermore, this project will investigate if clozapine can activate the DREADD in vivo. Because evidence from literature suggests that the mechanism of action of CNO at DREADDs is mediated by conversion into clozapine. Presumably, CNO does not enter the brain after systemic drug injections and shows low affinity for DREADDs, whereas clozapine, to which CNO rapidly converts in vivo, shows high DREADD affinity and potency [30]. To test the hypothesis that clozapine is able to activate the DREADD, the electrophysiological response of LC neurons will be measured after clozapine injection. The second step of this thesis consist of the validation of the TNF-α neuroinflammatory rat model. This means verifying if the intracerebroventricular (ICV) injection of TNF-α can indeed induce pro-inflammatory conditions in animals who have experienced a manipulation of the vagus nerve. The inflammatory conditions will be analyzed by measuring the expression levels of NFĸB target genes (IL-6, CXCL2, CXCL3, ICAM-1) with RT-qPCR. If the vagus manipulation does not influence the TNF-α-induced inflammation, the third step of the thesis will be performed. This will be investigating if chemogenetics or VNS can alter the immune response in the TNF-α neuroinflammatory rat model. This project will help to further understand the role of the LC-NA system in relation to neuroinflammation. In addition, this project will provide insight whether VNS can be used as a possible therapy for MS patients in the future.

2. Materials & methods

Laboratory animals Male Sprague-Dawley rats with a weight of 260-320g were used. Animals were housed in the animalarium of the laboratory for clinical and experimental neurophysiology (LCEN). Food and water was offered ad libitum. The housing temperature was kept at 20-23° and the humidity between 40-55%. The rooms had a controlled 12h/12h light/dark cycle.

Stereotactical surgery: injection of vector To induce the expression of the hM3Dq DREADD or the green fluorescent protein (GFP) reporter, a AAV2/7-PRSx8-hM3Dq-mCherry vector or AAV2/7-PRSx8-GFP vector was bilaterally injected into the LC. Rats were anesthetized with isoflurane in medical oxygen (for induction 5% isoflurane, for maintenance 2% isoflurane). The head-neck region was shaved and animals were placed in the stereotactic frame. Body temperature was continuously monitored via a rectal probe. The skin of the head was disinfected and a subcutaneous injection of metacam (dose 0.1 mg/kg) was given. An incision along the midline was made and periosteum was pushed away to expose the skull. Afterwards, the stereotactic coordinates of lambda and bregma were determined. Bregma is the intersection of the sutura sagittalis and the sutura coronalis. Lambda is the intersection of the sutura lambdoidea and the sutura sagittalis (fig. 7). Lambda is used as a reference point to determine the coordinates of the two LC’s: AP = - 3.9 mm, ML: +/- 1.15 mm with respect to lambda. Next, a craniotomy was made at the LC positions. Because the LC is positioned ventrally of the sinus sagittalis, the viral vector is injected at an angle of 15 degrees. By making this angle, there is less risk of penetrating a dural sinus. Therefore bregma is placed 2 mm lower than lambda by manipulation of the stereotactic framework. A Hamilton syringe was brought to a depth of 5.7 mm relative to the dura mater and a volume of 10 nl of the AAV2/7-PRSx8-hM3Dq-mCherry vector or the control vector solution (PRSx8-GFP) was injected by a Stoelting Quintessential Injector (QSI) pump connected to the Hamilton syringe with a flow rate of 2 nl/min. After the injection of the vector, the needle of the syringe was kept in place for 10 min before pulling up, to prevent outflow of the vector. Finally, the skin was stitched with double knot sutures. To minimize postoperative pain, a subcutaneous injection with Metacam (dose 0.1 mg/kg) was given. Xylocaine gel was also applied directly to the incision wounds.

Fig. 7: Shows the skull surface sutures (coronal suture, sagittal suture, lambdoid suture) and reference points (bregma and lambda) and interaural line (red line). Lambda is defined as the intersection of the sagittal suture with the interaural line. The true lambda is usually located 0,3 mm anterior of the interaural line (defined by the intersection of the sagittal suture with the lambdoid suture). In stereotactical surgery, the true lambda is usually taken as reference point. [51]

Unit recording Unit recording is a technique in which the electrophysiological response of one or a few neurons can be measured by using a microelectrode system. Rats were anesthetized with isoflurane in medical oxygen and placed into the stereotactical frame. Two Tungsten microelectrodes were placed in the stereotactic arms and positioned at the coordinates for the LC’s. The microelectrodes were then lowered alternatively into the brain, to measure activity of LC neurons. Signals were filtered (< 300 Hz - > 3 kHz) , amplified (10 000x), digitized and recorded using Spike2 software for online visualization and stored for ofﬂine analysis. Spikes are detected as input signals that cross two trigger levels (positive and negative trigger level). For each spike a waveform is extracted in the template set-up window. If two templates look very similar, they can be merged into one, because they usually belong to the same neuron. Usually a couple layers of cerebellum neurons are first crossed before reaching the LC neurons. LC neurons are identified by several characteristics: 1) the typical positive-negative waveform with a notch on the ascending phase of the action potential (fig. 8), 2) spontaneous ﬁring rates of 0–5.0 Hz, 3) a biphasic excitation-inhibition response to a painful foot pinch contralateral, 4) the typical “popcorn” sound of firing LC neurons. After identification of an LC neuron, a baseline measurement of 5 min was registered. Then clozapine was injected subcutaneous in a dose of 0.01 mg/kg. After 15 to 30 min of waiting a second clozapine injection was given in a dose of 0.1 mg/kg. The administration of clozapine normally should

18 induce an increase in firing rate of LC neurons in DREADD animals, but should not have an effect in non-DREADD animals. After another 15 to 30 min of waiting, clonidine was injected in a dose of 40 µg/kg. This is an α2-adrenergic agonist, which will decrease LC activity. Unit recording is a terminal experiment for the animal.

Fig. 8: The typical positive-negative waveform of an LC noradrenergic neuron. The arrow indicates the notch on the ascending phase of the action potential. [52]

Perfusion and immunohistochemistry (IHC) The animals were euthanized with an overdose of dolethal which was given IP (dose 200 mg/kg). After ±10 min, the transcardial perfusion with phosphate buffered saline (PBS) and paraformaldehyde (PFA) was started. The head was removed and fixated overnight in PFA. The following day the brain was isolated and cryoprotected for several days, by storing it in sucrose-PBS solution with increasing concentrations of sucrose (10-20-30%). Next, the tissue was snap frozen in isopentane immerged in liquid nitrogen. Coronal sections of 40µm were made on a cryostat. To confirm the selectivity of the DREADD expression, an immunohistochemical double staining was performed against the fluorescent mCherry reporter protein and TH. The sections were treated while free floating. On day one of the staining, sections were first rinsed in distilled water, followed by incubation in 0.5% and 1.0% H2O2, to block endogenous peroxidase activity. Next, they were rinsed again in distilled water, followed by incubation with blocking buffer (PBS with 0.4% Fish skin Gelatin, 0.2% TritonX) to block non-specific antibody binding sites. Next they were incubated with the primary antibodies dissolved in blocking buffer. Primary antibodies were rabbit anti-red fluorescent protein (anti- RFP) and mouse anti-TH (dilutions 1/1000). Rabbit anti-RFP is directed against mCherry (i.e. against all neurons expressing the hM3Dq) and mouse anti-TH is directed against the noradrenergic neurons of the LC. Sections were kept overnight at 4°C. On day two, sections were first washed in blocking buffer, followed by incubation in secondary antibodies dissolved in blocking buffer, from this step sections were processed in the dark. The secondary antibodies were respectively alexa fluor 594 goat anti-rabbit and alexa fluor 488 goat anti- mouse. Alexa Fluor 594 is a red-fluorescent dye that can be excited using the 561 nm or

594 nm laser lines. Alexa Fluor 488 is a green-fluorescent dye with excitation suited to the 488 nm laser line. Alexa fluor 594 goat anti-rabbit is used for visualization of mCherry (red) and alexa fluor 488 goat anti-mouse is used for visualization of TH (green). In addition, a nuclear staining with DAPI was performed. Positive controls are anti-neuronal marker (anti- NeuN) and anti-glial fibrillary acidic protein (anti-GFAP). The negative control consists of blocking buffer. Finally, the sections were mounted on carrier glass and covered with mounting medium (Vectashield) to prevent photobleaching. Sections were kept in the dark until they were visualized with a fluorescence microscope.

Design of the pilot experiment The study protocol for step two and three of this project (validation of the TNF-α neuroinflammatory rat model and investigating the effect of VNS on TNF-α-induced neuroinflammation) was approved by the animal experimental ethical committee of Ghent University hospital on 12/03/18. The same laboratory animals and environmental conditions as described in 2.1 were applied.

Pilot experiment: The purpose of the pilot experiment is to investigate if ICV injection of TNF-α can induce pro- inflammatory conditions and to investigate if the manipulation of the vagus nerve and presence of a VNS electrode does not influence these inflammatory conditions. Therefore, four experimental groups were created, each of them containing 5 animals.

Table 1: experimental animal groups of the pilot experiment. VNS electrode TNF-α injection Ringer’s injection Sham VNS surgery TNF-α injection Ringer’s injection

Research experiment: Due to a limited amount of time, the third step of this project could not be carried out. The purpose of the research experiment would be to investigate the effects of VNS on TNF-α- induced neuroinflammation.

Validation of stereotactical coordinates of the left lateral ventricle The stereotactical coordinates for the left lateral ventricle were based on the study of G. Laureys [21]. These coordinates were based on male Wistar rats. To validate if these coordinates were the same for male Sprague-Dawley rats, Evans blue dye was stereotactically injected into the left lateral ventricle at 1.4 mm lateral and 0.9 mm posterior to bregma and a depth of 3.5 mm (starting from the dura mater). 2 µl of 1% Evans blue dye solution (100 mg in

10 ml of saline) was injected in one animal at a flow rate of 1 µl/min by means of a 10 µl Hamilton syringe connected to a Stoelting Quintessential Injector (QSI) pump. The needle was filled with: 2 μl denaturized water – 2 μl air – 2 μl Evans blue dye – 2 μl air – 2 μl denaturized water. The location and spreading of the Evans blue dye throughout the ventricular system was examined in unstained sections using a fluorescence microscope based on the auto- fluorescence of the Evans blue dye.

Implantation of a VNS-electrode and stereotactical placement of a cannula Anesthetizing the animals happened in the same way as described in 2.2. First, the ventral side of the neck and the head region between both ears was cleaned and shaven. Next, the skin was disinfected. The rat was placed on the back and a medial incision of 1 cm was made from the sternum to the anterior neck region. Next, the left vagus nerve, located between the carotid artery and the internal jugular vein, was dissected. A round cuff-electrode is wrapped around the vagus nerve. The ends of the cuff-electrode are tunneled subcutaneously behind the left ear to the head and are led out through an incision made in the disinfected scalp. In this project, only sham VNS surgeries were performed, in which the vagus nerve was only isolated and the tunneling was done without electrode leads. Next, the wound at the level of the anterior neck was stitched. The animal was placed in the stereotactic frame and a CMA/12 guide cannula (Harvard Apparatus, France) was stereotactically placed in the left lateral ventricle for the prospective ICV injection of TNF-α or Ringer's solution. The stereotactic coordinates for the left lateral ventricle are: 1.4 mm lateral, 0.9 mm posterior of bregma and a depth of 3.5 mm relative to dura. To strengthen the cannula, 4 anchor screws were placed around the cannula. The anchor screws together with the cannula were fixed on the skull with dental cement. To minimize postoperative pain, Metacam (1 mg/kg) was administered IP and xylocaine gel was applied on the incision wounds.

ICV injection of TNF-α or Ringers’ solution Pro-inflammatory conditions were generated by ICV injection of TNF-α. Prior to injection, the metallic guide of the cannula was removed and a microdialysis probe was placed on the cannula. The TNF-α dissolved in ringer’s solution (0.2 µg/ 2 µl) was administered at a rate of 1 µl/min via the microdialysis set up, in freely moving animals. Or 2 µL ringer’s solution was administered at the same flow rate in control animals. 24h after the ICV injection, the animals were euthanized as described in 2.4. This time is chosen because migration of inflammatory cells has occurred after 24h.

RT-qPCR Sham VNS animals injected with TNF-α (n=3) or Ringer’s solution (n=3) were euthanized as described in 2.4. After perfusion with ice cold PBS, brain tissue was harvested as quickly as

21 possible and immediately snap frozen in liquid nitrogen and stored in -80° to avoid denaturation of RNA. Total RNA of rat brain tissue (left hemisphere) was isolated using an RNeasy Lipid Tissue Mini Kit (Qiagen). Briefly, the brain tissue was homogenized in 1 ml QIAzol Lysis Reagent using the TissueRuptor®. Total RNA was isolated from these homogenates according to the manufacturer’s instructions. The concentration of RNA was determined by measuring the absorbance at 260 nm in a spectrophotometer. The ratio between the absorbance values at 260 and 280 nm gave an estimate of the RNA purity. Next, cDNA was synthesized from the RNA for real-time PCR. Reverse transcription was performed on 500 ng of mRNA using the Takara PrimeScript™ Reagent mix and PrimeScript reverse transcriptase enzyme in a final volume of 20 µL. For real-time cDNA amplification the Lightcycler 480 SYBR Green I Mastermix was used and the primers as stated in table 2. The samples were ran in triplicate and analyzed using the LightCycler® 480 Instrument and software. Generation of PCR products was detected by measurement of the SYBR Green I fluorescence signal: SYBR Green intercalates into the DNA helix, unbound dye exhibits very little fluorescence, however, fluorescence is greatly enhanced upon DNA binding. Amplification- and melting curves were obtained and specificity of the amplified PCR product was assessed by performing a melting curve analysis. The resulting melting curves allow discrimination between primer dimers and specific product. Primer dimers will have a lower melting temperature (Tm) than the specific product, because they are shorter in length. The occurrence of more than one peak in the melting curve is an indication that primer dimers are present. The presence of primer dimers leads to inaccurate quantification of the transcript of interest. The obtained cycle threshold (CT)-values for each gene were normalized to those of hypoxanthine guanine phosphoribosyl transferase (HPRT) or glyceraldehyde-3-phosphate dehydrogenase (GAPDH) using the delta delta CT (ΔΔ CT) method. The average CT-values of each sample, per gene of interest (GOI) and reference gene (REF), were calculated from the obtained CT-values (raw data) of the LightCycler® 480. Afterwards Δ CT- and ΔΔ CT-values were calculated as: Δ CT= av CT (GOI) - av CT (REF) ΔΔ CT = sample Δ CT - av control group Δ CT Finally, the ratio of our GOI in the treated samples (TNF) and untreated samples relative to the reference gene was calculated by taking 2^-(ΔΔCT).

Table 2: primer sequences used for RT-qPCR. Gene Forward primer Reverse primer IL-6 GGAGTGCTAAGGACCAAGACCA AGGTTTGCCGAGTAGACCTCA CXCL2 TTCTCGGGGCTTACAGAAAA AGGGGGAGTTGGGTACTGAC CXCL3 TCACTTCCATTCTGTTGCAG CCTCCCTGTGACACTGAAGA ICAM-1 CTCCGTGGGAATGAGACACT TTGAACAGTGACAGCCCTTG HPRT CTCATGGACTGATTATGGACAGGAC GCAGGTCAGCAAAGAACTTATAGCC GAPDH GCAAGTTCAACGGCACAG GCCAGTAGACTCCACGACAT

Statistics SPSS 24 software was used for statistical analysis of all data. Data from the unit recording was normalized in order to fix mean baseline frequency to 1 Hz. At the unit level, one sample T-test were performed to investigate if there was a significant difference in firing frequency after injections of clozapine compared to the normalized baseline frequency. The threshold for significance was set at >10% increase in firing frequency. At the global level, a linear mixed model was designed to investigate the effect of group, dose, and the interaction of group*dose on the mean firing frequency after clozapine injections of control and hM3Dq transduced units. A linear mixed model was designed with group, dose and the group*dose interaction as fixed factors and AR1 as repeated covariance type. A Mann-Whitney U test was performed to investigate if there was a significant difference in relative expression level of target genes (IL- 6, CXCL2, CXCL3, ICAM-1) between the control and TNF-treated samples. The significance level for all tests was taken at 0,05.

3. Results

Validation of stereotactical coordinates of the left lateral ventricle Microscopic investigation of Evans blue auto fluorescence (excitation at 470 nm and 540 nm, emission at 680 nm) in unstained brain sections, was used to validate the stereotactical coordinates of the left lateral ventricle. While making the cryostat sections, correct spreading of the dye throughout the ventricular system could already be visualized (fig. 9). Visualization of unstained sections with a fluorescence microscope at the Alexa 594 channel (red channel), showed that the fluorescence of the dye correctly lined the walls of the entire ventricular system (fig. 10). A confirmation that the stereotactical coordinates for the left lateral ventricle are correct.

Fig. 9: Spread of the dye in cryostat sections: in the fourth ventricle (1st up), aqueduct (2nd up), third and lateral ventricles (3rd up, 1st down) and lateral ventricles (2nd down).

Fig. 10: Pictures taken with the Zeiss fluorescence microscope at the Alexa 594 channel showed that the Evans blue fluorescence was visible at the walls of the lateral ventricles.

Immunohistochemistry: validation of vector expression Specific expression of the vector was evaluated by immunohistochemical double staining for TH and mCherry for hM3Dq transduced animals (DREADD animals) and TH and GFP for control animals. For DREADD animals, the noradrenergic cells of the LC stain positive for TH (green). Cells expressing the vector stain positive for mCherry (red). For control animals, the noradrenergic cells of the LC stain positive for TH (red). Cells expressing the control vector stain positive for GFP (green). DAPI stains the nuclei of cells blue.

1) Control animals (n=6): Injection of 10 nl of the AAV2/7-PRSx8-GFP vector in 3 control animals leads to very few GFP expression, both in the left and right LC. In 3 other control animals, the GFP expression is mostly located in the upper part of the left LC, while very little GFP expression is seen in the

24 right LC.

Control animal DLC1: GFP expression is limited to a few cells. (left LC)

Control animal LSH6: Co-localization of GFP and TH is mostly localized in the upper part of the LC region. (left LC)

An intracerebral bleeding (orange) due to the unit recording is visible on the right.

Control animal LSH3: Co-localization of GFP and TH in the upper part of the LC region. (left LC)

The injection tract of the Tungsten micro-electrode is visible (arrow). An intracerebral bleeding in the LC region due to the unit recording is also visible (orange).

Control animal LSH4: Again, co-localization of GFP and TH in the upper part of the LC region. (left LC)

Control animal LSH3: Very few GFP expression is seen in the right LC region. (right LC)

2) DREADD animals (n=5): Two animals, injected with 10 nl of the AAV2/7-PRSx8-hM3Dq-mCherry vector, showed no co- localization in the left LC. The expression of mCherry was aspecifically located lateral to the left LC region. In three other DREADD animals, some co-localization was seen in the left LC, with sometimes aspecific expression of mCherry around the left LC region. In the right LC of these animals, there was either no mCherry expression visible or some co-localization with aspecific expression of mCherry anterior and lateral to the LC region.

DREADD animal LCH5: No co-localization of TH and mCherry in the left LC. mCherry expression is located lateral to the left LC region and is mostly located in axons.

(left LC)

DREADD animal LSH1: Some co-localization of TH and mCherry is seen in the left LC. But aspecific expression of mCherry is also seen caudal to the LC region. (left LC)

DREADD animal LSH1: Expression of mCherry is mostly aspecifically located medial to the left LC region. Very few co-localization in the LC is seen. (left LC)

DREADD animal LSH2: Expression of mCherry is aspecifically located anterio-medial to the left LC. Very few colocalization in the LC is seen. (left LC)

DREADD animal LSH5: Aspecific expression of mCherry above the left LC region. (left LC)

(Picture with only TH and mCherry staining, no DAPI staining)

DREADD animal LCH4: Some co- localization of TH and mCherry is seen in the right LC. But aspecifc expression of mCherry is also seen lateral to the right LC region. (right LC)

DREADD animal LSH1: Very few co-localization of TH and mCherry in the upper part of the LC, together with aspecific expression of mCherry above the right LC. (right LC)

DREADD animal LSH2: No expression of mCherry was seen in the right LC region. (right LC)

To estimate the percentage of co-localized cells throughout the entire LC, 7 sections along the anterior-posterior axis of the LC were selected. The TH+ cells, mCherry+ cells and TH+/mcherry+ cells were counted manually in each section, with Fiji software (see addendum 1). A DREADD animal with both expression of mCherry in the left and right LC was selected. In the left LC 133 TH+ cells (with an error rate of ± 10 cells), 69 mCherry+ cells and 43 TH+/mCherry+ cells were counted. Only 32,33% of all TH+ cells were also mCherry+ cells. In the right LC, 110 TH+ cells (with an error rate of ± 10 cells), 59 mCherry+ cells and 30 TH+/mCherry+ cells were counted. Only 27,27% of all TH+ cells were also mCherry+ cells.

Because co-localization was frequently located in the upper part of the LC region, 10 nl of the AAV2/7-PRSx8-hM3Dq-mCherry vector was injected (n=3) at two different dorsoventral coordinates into the left LC, to investigate if this would lead to a better colocalization of TH and

29 mCherry in the entire LC and not only in the upper part of the LC. A first injection was given at a depth of 5,7 mm relative to dura and a second injection was given at a depth of 5,9 mm relative to dura. In the right LC, only one injection at a depth of 5,7 mm was given. Furthermore, the syringe was test runned between the two injections to investigate if this would lead to a better bilateral expression. In one DREADD animal, this led to a better colocalization of TH and mCherry, but with overexpression of mCherry surrounding the LC region. Overexpression is undesirable. In the right LC, there was more mCherry expression visible, but it was aspecifically located lateral to the LC region. In the two other DREADD animals, there was very little co-localization in the left LC. The expression of mCherry was again located in areas surrounding the LC. In the right LC, there was also more mCherry expression visible, but it was located medial to the LC region.

DREADD animal HLS1: Co-localization of TH and mCherry in the left LC with overexpression of mCherry surrounding the LC region. (left LC)

DREADD animal HLS1: More expression of mCherry in the right LC was visible, but it was aspecifically located in axons lateral to the LC region. (right LC)

DREADD animal HLS3: Very few co-localization between TH and mCherry in the left LC. Together with aspecific expression of mCherry caudal and lateral to the left LC region. (left LC)

Unit recording In hM3Dq transduced animals (n=3) and control animals (n=4), the electrophysiological activity of LC neurons was registered with unit recording. First a baseline period of 5 min was registered, afterwards two injections of clozapine in a dose of 0.01 mg/kg and 0.1 mg/kg were given subcutaneous with a waiting interval of 15-30 min in between. LC neurons were identified by the typical firing frequency of 0-5 Hz and the typical waveform as described in 2.3. Moreover, the typical response of LC neurons to a painful foot pinch was another indication that an LC neuron was measured (fig. 11). A total of 8 units was measured, all units responded to a foot pinch. Normally, the administration of clozapine should induce an increase in firing frequency of LC neurons in DREADD animals, but has no effect in control animals. 50% of control units showed a significant increase in firing frequency (>10% increase) after the first (0,01 mg/kg) clozapine injection in comparison with baseline frequency. All control units showed a significant increase in firing frequency after the second (0,1 mg/kg) clozapine injection in comparison with baseline frequency. 75% of hM3Dq transduced units showed a significant increase in firing frequency after the first (0,01 mg/kg) clozapine injection in comparison with baseline frequency. And 75% of the hM3Dq units showed a significant increase in firing frequency after the second (0,1 mg/kg) clozapine injection in comparison with baseline frequency (fig.12 + addendum 2: fig. 13→19). The linear mixed model showed a significant group*dose effect (F(8)= 6.497, p= 0,034). The effect of the dose was different for the two groups. In control units, a significant dose effect was seen. There was a significant increase in firing frequency after the second clozapine injection compared to the first clozapine injection. This dose effect was not seen in hM3Dq transduced units (fig. 20). All units showed a decrease in firing frequency after clonidine injection in comparison with baseline, another indication that LC neurons were measured.

phasic burst inhibition

Fig. 11: Identification of an LC neuron by giving a painful foot pinch contralateral. The foot pinch (p) leads to a phasic burst activity of a few potentials followed by a refractory period without activity.

HLC3: unit 2 clozapine 0,01 mg/kg clozapine 0,1 mg/kg clonidine 40 µg/kg 3,5

2,5

1,5

Frequency(Hz)/10s 1

0,5

0 0 1000 2000 3000 4000 5000 6000 Time (s)

Fig. 12: Effect of clozapine injections on the firing frequency of 1 unit in a DREADD animal. There is a significant increase in firing frequency (>10% increase) after the first clozapine injection (1.98 ± 0.24 Hz) in comparison with baseline frequency (1.00 ± 0.13 Hz; p= 6.2446E-39, one sample T- test). There is also a significant increase in firing frequency after the second clozapine injection (1.88 ± 0.19 Hz) in comparison with baseline frequency (1.00 ± 0.13 Hz; p= 4.3181E-42, one sample T-test). Injection of clonidine, an α2- antagonist, leads to a decrease in firing frequency (0.52 ± 0.11 Hz).

Fig. 20: Effect of clozapine and clonidine injections on the mean firing frequency of all measured LC units. Dotted lines indicate control units, full lines indicate hM3Dq transduced units. In control units, a significant dose effect was seen (F(8)= 6.497, p= 0,034). There was a significant increase in firing frequency after the second clozapine injection compared to the first clozapine injection. This dose effect was not seen in hM3Dq transduced units.

RT-qPCR analysis Quantification of RNA in sample homogenates and evaluation of RNA purity: a ratio of ~2.0 is generally accepted as pure for RNA. The minimal threshold for RNA purity is set at 1.70. All samples had a sufficient purity to start the RT-qPCR analysis.

Table 3: Measured concentration and purity of RNA in samples homogenates. Sample Quantity Purity 1 (DVN1) control 58,1 ng/µl 2,06 2 (DVN4) control 114,8 ng/µl 1,96 3 (DVN5) TNF-α 176,5 ng/µl 2,00 4 (DVN6) control 125,4 ng/µl 2,02 5 (DVN7) TNF-α 88,3 ng/µl 2,05 6 (DVN8) TNF-α 54,4 ng/µl 1,78

Obtained 2^-(ΔΔ CT) values for each GOI normalized to reference gene HPRT:

Table 4: 2^-(ΔΔ CT) values for each GOI normalized to HPRT. Sample 2^-(ΔΔ CT) IL-6 2^-(ΔΔ CT) CXCL2 2^-(ΔΔ CT) CXCL3 2^-(ΔΔ CT) ICAM-1 1 (control) 1,129399232 2,015462738 0,28475198 1,246409192 2 (control) 1,546373574 0,44579256 2,363805139 0,960003194 3 (TNF-α) 0,750308369 4,125143894 0,593688379 0,935911775 4 (control) 0,572582529 1,112992942 1,485667337 0,835731321 5 (TNF-α) 0,148880037 0,098148574 0,27441751 0,318149725 6 (TNF-α) 0,304719885 0,048286971 0,480001597 0,701141618

Specificity of the amplified PCR product was assessed by performing a melting curve analysis. The melting curves of all samples of all animals were grouped per target gene in one graph. No primer dimers were observed in the melting curves of IL-6, CXCL2, ICAM-1, HPRT and GAPDH. Only in the melting curves of CXCL3, primer dimers were present. (fig. 21 and 22 + addendum 3: fig. 23→26)

Fig. 21: Melting curves of target gene CXCL2. Blanco samples (B) have a lower Tm (±75°C) than target samples (±80°C). Curves of blanco samples are wide and show multiple peaks. In blanco samples primer dimers formed because no template is available. Since only one peak is visible for all target samples, no primer dimers are formed in these samples, indicating reliable amplification data.

Fig. 22: Melting curves of target gene CXCL3. Primer dimers are visible in blanco samples, but also in some target samples (1-1, 1-3, 2-1, 2-2). Melting curves of these samples show multiple peaks, indicating non reliable amplification data and a non-accurate analysis of this target gene.

abbreviations: 1-1: replicate 1 of control animal 1 1-3: replicate 3 of control animal 1 2-1: replicate 1 of control animal 2 2-2: replicate 2 of control animal 2

The expression levels of each target gene in TNF-α and control samples, normalized to the expression levels of reference gene HPRT, are presented in fig. 27.

Relative expression levels of target genes in TNF/control samples 4,5

3,5

2,5

1,5

0,5 Expression of target gene/HPRT 0 control TNF control TNF control TNF control TNF IL-6 CXCL2 CXCL3 ICAM-1

Fig. 27: Expression levels of target genes (IL-6, CXCL2, CXCL3, ICAM-1) in TNF samples and control samples relative to the expression levels of reference gene HPRT. The blue dots indicate 2^-(ΔΔ CT) values of each control sample replicate. The red dots indicate 2^- (ΔΔ CT) values of each TNF sample replicate. Variation between the 2^-(ΔΔ CT) values of replicates is seen in both groups.

The mean relative expression level of IL-6 is higher in the control group (1,08) compared to the TNF-α group (0,40). However, no significant difference in mRNA levels of IL-6 could be demonstrated between the two groups (Mann-Whitney U =1 ; p=0,127). The mean relative expression level of CXCL2 is higher in the TNF-α group (1,42) compared to the control group (1,19). However, no significant difference in mRNA levels of CXCL2 could be demonstrated between the two groups (Mann-Whitney U =3 ; p=0,513). The mean relative expression level of CXCL3 is higher in the control group (1,37) compared to the TNF-α group (0,45). However, no significant difference in mRNA levels of CXCL3 could be demonstrated between the two groups (Mann-Whitney U =2 ; p=0,275). It is important to note that the mean relative expression level of CXCL3 in the control group is not reliable, since the melting curves for CXCL3 showed the presence of primer dimers. The measured fluorescence here is the result of PCR product + primer dimers, leading to a higher expression level in the control group. The mean relative expression level of ICAM-1 is higher in the control group (1,01) compared to the TNF-α group (0,65). However, no significant difference in mRNA levels of ICAM-1 could be demonstrated between the two groups (Mann-Whitney U =1 ; p=0,127).

4. Discussion

Immunohistochemistry: validation of vector expression This project investigated if stereotactical injection of the AAV2/7-PRSx8-hM3Dq-mCherry vector in a dose of 10 nl and with a viral titer of 5.99^7 GC/ml into the LC, was able to specifically transduce noradrenergic neurons of the LC. Afterwards the effect of clozapine administration was investigated at the electrophysiological level. The expression of the vector was analyzed by an immunohistochemical double staining for TH and mCherry, which showed that expression of mCherry is not 100% specific for the LC and is also visible in areas surrounding the noradrenergic nucleus. In addition, no expression of the vector was seen in the right LC of some animals. The colocalization of TH and GFP was mostly seen in the upper part of the left LC region. By using a viral vector with the PRSx8 promotor, only noradrenergic neurons should be transduced in theory. This has been demonstrated by Vazey E.M. et. al. In this study an AAV2/9 vector containing the synthetic PRSx8 promoter was used to restrict expression of the hM3Dq DREADD with an HA tag, to noradrenergic neurons of the LC. The DREADD was well expressed in the LC region, with expression highly colocalized to TH expressing neurons: 97 ± 1.0% colocalized cells for animals that were injected with the AAV2/9-PRSx8-hM3Dq-HA vector and 97 ± 0.6% colocalized cells for animals that were injected with the control vector AAV2/9-PRSx8-mCherry [36]. This is in contrast with our findings that only 32,33% of TH+ cells were colocalized with mCherry+ cells in the left LC and only 27,27% of all TH+ cells were colocalized with mCherry+ cells in the right LC.

A difference with the study of Vazey E.M. et. al. is that another vector serotype was used in this study. Optimal transduction depends on the efficiency of a particular virus serotype for transducing a particular cell type. There are many different AAV serotypes, each serotype differs in capsid protein sequence and is recognized by different cell surface receptors. Therefore the serotypes have a different cell type selective infectivity (tropism), which results in different transduction efficiencies [33]. Numerous studies have previously reported that the degree of viral spread and transduction within particular brain regions and cells can vary depending on AAV serotype [53,54,55]. For example, rAAV2/2 has been shown to transduce neurons in the substantia nigra effectively, about 80% of neurons in the pars compacta of the substantia nigra are targets for rAAV2/2 infection. On the other hand, pyramidal neurons in the CA1-CA3 pyramidal layers of the hippocampus have remained refractory to AAV2/2 transduction [53]. The transduction characteristics of these different AAV serotypes in the LC region have not yet been described in literature, still, the results of the study of Vazey E.M. et. al. in comparison with the results of this project, indicate that the use of the AAV2/9 serotype instead of the AAV2/7 serotype, might be a more optimal serotype for transducing the LC

36 region. The choice of virus serotype is very important since all AAV serotypes may not necessarily transduce the intended target cell/tissue in the same way.

It has been demonstrated that AAV vectors can undergo axonal transport after brain injection. This leads to transduction of brain regions not within the proximity of the injection site [56]. This might explain the aspecific expression of mCherry outside of the LC region. Axonal transport of the vector can occur in anterograde or retrograde direction. During retrograde transport, virions are taken up at the axonal projections and are transported to the neuronal cell body (soma), where the virus enters the nucleus to perform transduction. Anterograde transport requires virions to enter the neuronal soma and travel along the length of the axon to ﬁnally get released at the projections. The released virions are then free to transduce new cellular subpopulations in the region [57]. Only a small volume of 10 nl of the AAV vector solution was injected, therefore diffusion of the vector solution is assumed to be very restricted. Thus, anterograde transport can be a possible mechanism for the AAV2/7 vector to infect other brain regions who have connectivity with the injected site. The aspecific expression of mCherry was mostly seen lateral and ventral to the LC region. In a lesser extent also medial and dorsal. The area located medioventral to the LC is the parvocellular part of the medial vestibular nucleus (MvePC). The area located ventrolateral to the LC is the magnocellular part of the medial vestibular nucleus (MveMC) (fig. 28). The medial vestibular nucleus is part of the vestibular nuclei complex, which further consists of the descending vestibular nucleus, lateral vestibular nucleus and superior vestibular nucleus. The medial vestibular nucleus is implicated in vestibular compensation, coordination of head, eye and neck movements and is also considered to be primarily associated with the reﬂex that controls gaze [58]. A selective projection of TH and dopamine β-hydroxylase (DBH)-immunoreactive fibers from the LC to the vestibular nuclear complex in Sprague-Dawley rats has been described [59]. Since the LC has a projection to the medial vestibular nucleus, anterograde transport of the vector along these projection fibers might explain the presence of mCherry expression medioventral and ventrolateral to the LC region. Furthermore, a connection between the LC and the mesencephalic trigeminal nucleus (Me5) (fig. 28) has been described, by labeling noradrenergic axons in the LC with a neuronal tracer, biotinylated dextran amine. The Me5 is located lateral to the LC. It plays a role in processing proprioceptive signals from the masticatory muscles and the periodontal ligaments and is considered to regulate the rhythm of biting and bite strength. The labeled single axons were traced from the labeled LC neuronal somata to the ipsilateral Me5 region where they produced terminal like swellings. Some of these swellings appeared to make synapse like contact with the ganglion cells of the Me5 [60]. Since there is a connection between the LC and the Me5, anterograde transport of the vector along these axons might explain the presence of mCherry expression lateral to the LC region.

This is inconsistent with the specificity of the PRSx8 promotor. The PRSx8 promotor is a synthetic DBH promotor which consist of eight copies of a promoter sequence from the cis - regulatory region of the DBH gene that binds the Phox2a/b transcription factors. This promoter sequence is thought to drive gene expression specifically in neurons expressing the Phox2a/b transcription factors. These Phox2a/b transcription factors are present in catecholaminergic neurons. After delivery to the brain, the AAV vector should only express hM3Dq in cells containing the Phox2a/b transcription factors, which bind to the PRSx8 promoter [61]. Since mCherry+ cells were found in the MVeMC and Me5, both regions containing non- catecholaminergic neuron types, it might indicate that the PRSx8 promotor is not as specific for catecholaminergic neurons as described in literature. The MVeMC consists of cholinergic and glutaminergic neuron types. The Me5 predominantly consists of glutaminergic neuron types. An explanation for mCherry expression in non-noradrenergic neurons is the fact that Phox2 transcription factors might also be present in some non-noradrenergic cell groups. One study has been able to demonstrate the presence of Phox2 in non-noradrenergic cell groups. These include cholinergic neurons in the vestibular efferent nucleus (Eve) (fig.28), the facial nucleus, the nucleus ambiguous, and the neurons of the dorsal motor nucleus of the vagus [61]. However, there is no evidence from literature that Phox2 is present in glutaminergic neurons of the Me5 region.

Another phenomenon which might explain the presence of mCherry in non-noradrenergic neurons near the LC, is the occurrence of transactivator activity in the AAV2 inverted terminal repeats in the CNS. The study of Haberman R. P. et. al. previously demonstrated an expression of GFP (both in vitro and in vivo in the brain) by using a rAAV virus carrying only the terminal repeat (TR) elements without a cell specific promotor. An AAV-TR-GFP vector was injected into the inferior colliculus and the hypothalamus of rats. Two weeks later, the brains were sectioned and analyzed for GFP ﬂuorescence by ﬂuorescent microscopy. This analysis showed that injection of the AAV-TR-GFP vector induced 2-5% of the GFP expression that was seen when an AAV-TR-CMV-GFP vector was injected. The latter vector contained the CMV promotor. Since the AAV TRs contain all the cis-acting sequences necessary for replication and packaging of recombinant DNA, they cannot be deleted. Transcriptional activity within terminal repeat sequences of AAV viruses can influence the tissue specific expression of a cell type selective promotor [62].

Fig. 28: Stereotactical location of the LC and surrounding structures. Figure from the Rat brain atlas, Paxinos and Watson, 2007 [63]

The use of a specific system for controlling gene expression such as Cre-lox, may be sufficient to overcome the transport issues. The study of Janitsky K. et. al. previously demonstrated that TH+ neurons of the LC can be targeted in a highly specific manner by using TH-CRE mice. Male B6.Cg-Tg (Th-cre) 1Tmd/J hemizygous mice were used. These mice express Cre- recombinase under the control of the tyrosine hydroxylase (TH) promoter and therefore in the noradrenergic neurons of the LC. These mice were injected with the AAV2-Ef1a-DIO- eNpHR3.0-EYFP vector unilateral into the LC to express the halorhodopsin eNpHR 3.0. The double-floxed inverse open reading frame (DIO) construct comprises inverted terminal repeats (ITR), the EF1a promoter, an eYFP reporter protein and the halorhodopsin eNpHR 3.0 gene surrounded by a pair of LoxP sites and a pair of Lox2722 sites oriented inward. The eNpHR 3.0 gene starts in an inverted, inactive orientation. Expression of Cre recombinase will cause serial recombination resulting in the active, fixed orientation of the transgene. Immunohistochemical analysis showed that expression of the halorhodopsin was restricted to the noradrenergic cells of the LC. Labeled cell bodies outside the LC region were not observed (fig. 29) [64]. The use of TH-CRE rats might be an alternative strategy to specifically target the hM3Dq DREADD to noradrenergic neurons of the LC. A disadvantage however, is the high cost price of TH-CRE rats, one SD- Th-cre tm1sage rat costs €396.

Fig. 29: Red staining indicates TH positive neurons, green staining indicates eNpHR 3.0 opsin expression (through eYFP reporter). Depending on the level of opsin expression, the color of individual cells co-expressing TH and eNpHR 3.0 varies from orange to yellow. Figure from Janitzky K. (2015) [64]

There is no explanation for the difference in expression pattern of the vector between the left and right LC region. But since the injection was first given into the left LC, followed by injection into the right LC without test running the syringe between the two injections, it is possible that the Hamilton syringe could be obstructed after the first intracerebral injection and therefore could not inject the full dose of 10 nl into the right LC region. This might explain the absence of DREADD expression in the right LC of some animals. A higher expression of mCherry was indeed visible in the right LC region of 3 animals injected with the AAV2/7-PRSx8-hM3Dq- mCherry vector, when the syringe was test runned between the two injections. There is no explanation for the little GFP expression seen in 3 animals injected with the AAV2/7-PRSx8- GFP vector. But it can be related with a decreased quality of the secondary antibody.

Unit recording The study of Gomez et. al. reported new details on the mechanism of action of CNO at DREADDS. As previously, they demonstrated that clozapine more rapidly penetrates the BBB and more potently binds DREADDs than CNO. And that clozapine back-metabolized from CNO is likely to be a major contributing factor for DREADD activation after systemic administration of CNO [30,65]. Therefore clozapine was systemically administered to investigate if it could stimulate hM3Dq receptors and activate LC noradrenergic neurons in vivo. A significant dose effect was demonstrated in control units with a linear mixed model, all control units showed an increase in firing frequency after the second clozapine injection in comparison with the first clozapine injection. This dose effect was not demonstrated for hM3Dq units. Normally, clozapine should not induce effects in control animals, since they do not express the hM3Dq DREADD. However, it has been known that clozapine binds to several endogenous receptors, such as serotonin, dopamine and GABA receptors [66]. Moreover, a previous study showed that systemically administered clozapine can increase the neuronal activity of LC noradrenergic neurons by interaction with the glycine site of the NMDA receptor. The excitatory effect of clozapine at LC neurons was blocked when rats were pretreated with

L-701.324, a selective antagonist at the glycine site of the NMDA receptor [67]. This might explain the fact that an increase in firing frequency of LC units is seen in control animals after clozapine injection. 75% of the hM3Dq units show an increase in firing frequency, after both the first and second clozapine injection, compared to their baseline frequency. But since clozapine is able to increase the firing frequency of LC units by interacting with the endogenous NMDA-receptor, it is possible that the observed effects of clozapine in hM3Dq units are attributed to concurrent effects on the hM3Dq DREADD and the endogenous NMDA-receptor. Therefore one cannot conclude with 100% certainty that the effect of clozapine in hM3Dq units is solely due to activation of the hM3Dq DREADD. An explanation for the fact that not all hM3Dq units responded to clozapine injections might be that they have not expressed the hM3Dq DREADD, since results from the immunohistochemistry showed that only a small percentage of LC neurons were transduced with hM3Dq. The pretreatment of rats with a selective antagonist at the glycine site of the NMDA receptor prior to giving the clozapine injection can be an alternative strategy for additional experiments and will provide more reliable insight into the effects of clozapine administration at the electrophysiological level in hM3Dq transduced and control animals.

If CNO is indeed back metabolized to clozapine in vivo, than it is important to find a concentration of CNO whereby clozapine levels can remain in the range of specificity for DREADDs, but below the threshold for altering signaling at endogenous receptors. One method to sidestep the liver metabolization of systemically administered CNO to clozapine, is intracranial injection of CNO. But this would limit the clinical translation of the chemogenetic technology. Alternative DREADD agonist such as compound 13 and compound 21 both have significant functional effects at DREADDs in vitro [31]. However, neither of these compounds have yet been screened for use with DREADDs in vivo, because key pharmacokinetic/pharmacodynamic profiling and characterization of potentially active metabolites are not available yet [65].

RT-qPCR analysis Due to the late approval by the animal experimental ethical committee of Ghent University hospital, only half of the intentional pilot experiment could be carried out. Only the experimental animal groups who underwent a sham VNS surgery were carried out. Sham VNS animals were either injected with 2µL TNF-α (n=3) or Ringer’s solution (n=3) and a RT-qPCR analysis was performed on isolated brain tissue to investigate if ICV injection of TNF-α could induce pro- inflammatory conditions. Results showed that the mean relative expression levels of IL-6, CXCL3 and ICAM-1 were higher in the control group compared to the TNF-α group. While the mean relative expression level of CXCL2 was higher in the TNF-α group compared to the

41 control group. However, no significant differences in mRNA expression levels of target genes could be demonstrated between the two groups. The expectation was to see an upregulation of all target genes in the TNF-α group compared to the control group, since this was previously demonstrated by Laureys G. et. al [23]. Since CXCL2 and CXCL3 are powerful chemo- attractants that draw leukocytes towards the CNS and IL-6 is a pro-inflammatory cytokine which is upregulated during immune responses, it is logical that they would be upregulated after the induction of pro-inflammatory conditions by ICV injection of TNF-α. An increase of the adhesion molecule ICAM-1 promotes transmigration of leukocytes into tissues, therefore it is logical that it’s mRNA would be upregulated after ICV injection of TNF-α.

The findings from the study of Laureys G. et. al could not been reproduced. In this study a qPCR gene expression analysis was performed on complete rat hemispheres after ICV injection of TNF-α/Ringer’s/clenbuterol/TNF-α+clenbuterol. The latter two groups are complementary with the VNS+Ringer’s/VNS+TNF-α groups of the research experiment, which was not carried out due to limited amount of time. The qPCR gene analysis of the study showed a significant upregulation of ICAM-1 and CXCL3 in the TNF-α group compared to the control group and a nonsignificant upregulation of CXCL2 and IL-6 in the TNF-α group compared to the control group. However, CXCL2 and IL-6 were significantly upregulated in the TNF- α+clenbuterol group compared to the control group [23].

An important consideration to take into account is the fact that in the study of Laureys G. et. al rats were euthanized 3h after the ICV injection of TNF-α, while in this project rats were euthanized 24h after the ICV injection. mRNA’s of inflammatory genes are quickly upregulated and usually have a short half-life, therefore it is possible that mRNA levels of inflammatory genes might be largely normalized to their baseline levels after 24h. This time point was chosen because it had already been demonstrated that 24h after the ICV injection of TNF-α, inflammatory cell migration had occurred and had induced cerebrospinal fluid leukocytosis and a perivascular infiltrate [23,68]. Since the analyzed target genes all play a role in leukocyte chemotaxis, and cerebrospinal fluid leukocytosis had occurred after 24h, this time point seemed reasonable for brain isolation after the ICV injection. However, a recent study demonstrated that macrophages induce gene expression of pro-inflammatory cytokines at 2h following LPS exposure, achieve a peak inflammatory phase at 6h and a resolution phase at 24h post-stimulation with LPS [69]. Therefore a time point of 3h after ICV injection might overcome the resolution of mRNA expression levels of inflammatory genes after 24h.

Since the stereotactical coordinates for the left lateral ventricle were validated and the micro dialysis set-up was rinsed and test runned before each ICV injection, it is unlikely that the low

2^-(ΔΔ CT) values in the TNF-α samples are attributed to errors in the stereotactical coordinates or the ICV injection set-up. Therefore the resolution of mRNA expression levels of inflammatory genes that can occur after 24h, might explain the low 2^-(ΔΔ CT) values seen in TNF-α treated samples. But on the other hand, this does not explain the high 2^-(ΔΔ CT) values in the control samples, which were sometimes more than the twofold than those of the TNF-α samples. This might be related with the vagus nerve manipulation. To isolate the vagus nerve, the carotid sheath was opened and the common carotid arteria and surrounding nerves were separated from the vagus nerve. Since the surgical skills of the surgeon were intermediate, it is possible that unnecessary damage has been induced to the vagus nerve or surrounding tissues in certain animals, causing underlying inflammation which might have influenced the results of the qPCR reaction. It is also important to note that the transcardial perfusion of control animal DVN1 was not fully succeeded. The presence of cytokines in “contaminating” blood might have influenced the measured tissue cytokine levels and therefore influenced the outcome of the qPCR reaction. Furthermore, primer dimers were detected in sample replicates of control animal 1 and 2. Primer dimers and other nonspecific PCR products also generate a fluorescent signal, which leads to non-reliable expression levels, as previously reported in 3.4. The variation that is seen between technical replicates of sample homogenates might be related to inaccuracies when pipetting the 384-well plate. Recommendations for further experiments would be to isolate the brain 3h after the ICV injection and to set up stricter inclusion criteria (e.g. not include animals with faulty perfusions) and to use a bigger sample size.

5. Conclusion The chemogenetic modulation of the LC by using DREADDs still requires some optimization. Viral expression in non-noradrenergic regions around the LC indicates that the PRSx8 promotor might not be as specific for noradrenergic neurons as described in literature. The lack of viral transduction in the right LC region still requires further investigation. The choice of the right AAV serotype, cell-specific promotor and the correct stereotactical coordinates are of great importance for the chemogenetic technology. The “claimed” DREADD actuator clozapine both increases the firing frequency of LC neurons in control and hM3Dq animals. Therefore no conclusion could be made that clozapine selectively activates the hM3Dq DREADD in vivo. The TNF-α neuroinflammatory rat model could not be validated. No significant differences in mRNA expression levels of target genes could be demonstrated between TNF-α treated and control animals. A greater sample size and stricter inclusion criteria might lead to validation of this model in future experiments.

6. References 1. Feinstein DL, Kalinin S, Braun D (2016) Causes, consequences, and cures for neuroinflammation mediated via the locus coeruleus: noradrenergic signaling system. J Neurochem 139 Suppl 2: 154-178 2. Schwarz LA, Luo L (2015) Organization of the locus coeruleus-norepinephrine system. Current biology : CB 25: R1051-r1056 3. Higgins ES, George MS (2009) Brain Stimulation Therapies for Clinicians. American Psychiatric Pub., 4. Benarroch EE (2009) The locus ceruleus norepinephrine system: functional organization and potential clinical significance. Neurology 73: 1699-704 5. Samuels ER, Szabadi E (2008) Functional neuroanatomy of the noradrenergic locus coeruleus: its roles in the regulation of arousal and autonomic function part I: principles of functional organisation. Curr Neuropharmacol 6: 235-53 6. Aston-Jones G, Cohen JD (2005) An integrative theory of locus coeruleus- norepinephrine function: adaptive gain and optimal performance. Annual review of neuroscience 28: 403-50 7. Ramos BP, Arnsten AF (2007) Adrenergic pharmacology and cognition: focus on the prefrontal cortex. Pharmacology & therapeutics 113: 523-36 8. Giovannitti JA, Jr., Thoms SM, Crawford JJ (2015) Alpha-2 adrenergic receptor agonists: a review of current clinical applications. Anesthesia progress 62: 31-9 9. Cotecchia S (2010) The alpha1-adrenergic receptors: diversity of signaling networks and regulation. Journal of receptor and signal transduction research 30: 410-9 10. Vasudevan NT, Mohan ML, Goswami SK, Naga Prasad SV (2011) Regulation of beta- adrenergic receptor function: an emphasis on receptor resensitization. Cell cycle (Georgetown, Tex) 10: 3684-91 11. Hellings N, Raus J, Stinissen P (2002) Insights into the immunopathogenesis of multiple sclerosis. Immunologic research 25: 27-51 12. Rejdak K, Jackson S, Giovannoni G (2010) Multiple sclerosis: a practical overview for clinicians. British medical bulletin 95: 79-104 13. Dendrou CA, Fugger L, Friese MA (2015) Immunopathology of multiple sclerosis. Nature reviews Immunology 15: 545-58 14. Elenkov IJ, Wilder RL, Chrousos GP, Vizi ES (2000) The sympathetic nerve--an integrative interface between two supersystems: the brain and the immune system. Pharmacol Rev 52: 595-638 15. Holmoy T, Hestvik AL (2008) Multiple sclerosis: immunopathogenesis and controversies in defining the cause. Current opinion in infectious diseases 21: 271-8 16. Pérez-Cerdá F, Sánchez-Gómez MV, Matute C (2016) The link of inflammation and neurodegeneration in progressive multiple sclerosis. Multiple Sclerosis and Demyelinating Disorders 1: 9 17. Polak PE, Kalinin S, Feinstein DL (2011) Locus coeruleus damage and noradrenaline reductions in multiple sclerosis and experimental autoimmune encephalomyelitis. Brain 134: 665-677 18. Gadea M, Martinez-Bisbal MC, Marti-Bonmati L, Espert R, Casanova B, Coret F, Celda B (2004) Spectroscopic axonal damage of the right locus coeruleus relates to selective attention impairment in early stage relapsing-remitting multiple sclerosis. Brain 127: 89-98 19. Simonini MV, Polak PE, Sharp A, McGuire S, Galea E, Feinstein DL (2010) Increasing CNS noradrenaline reduces EAE severity. J Neuroimmune Pharmacol 5: 252-9 20. Chelmicka-Schorr E, Kwasniewski MN, Thomas BE, Arnason BG (1989) The beta- adrenergic agonist isoproterenol suppresses experimental allergic encephalomyelitis in Lewis rats. J Neuroimmunol 25: 203-7 21. Braun D, Madrigal JL, Feinstein DL (2014) Noradrenergic regulation of glial activation: molecular mechanisms and therapeutic implications. Curr Neuropharmacol 12: 342-52

22. Laureys G, Gerlo S, Spooren A, Demol F, De Keyser J, Aerts JL (2014) β2-adrenergic agonists modulate TNF-α induced astrocytic inflammatory gene expression and brain inflammatory cell populations. Journal of Neuroinflammation 11: 21 23. Dello Russo C, Boullerne AI, Gavrilyuk V, Feinstein DL (2004) Inhibition of microglial inflammatory responses by norepinephrine: effects on nitric oxide and interleukin-1beta production. J Neuroinflammation 1: 9 24. Nakamura A, Johns EJ, Imaizumi A, Abe T, Kohsaka T (1998) Regulation of tumour necrosis factor and interleukin-6 gene transcription by beta2-adrenoceptor in the rat astrocytes. J Neuroimmunol 88: 144-53 25. De Keyser J, Laureys G, Demol F, Wilczak N, Mostert J, Clinckers R (2010) Astrocytes as potential targets to suppress inflammatory demyelinating lesions in multiple sclerosis. Neurochem Int 57: 446-50 26. Urban DJ, Roth BL (2015) DREADDs (designer receptors exclusively activated by designer drugs): chemogenetic tools with therapeutic utility. Annual review of pharmacology and toxicology 55: 399-417 27. Sternson SM, Roth BL (2014) Chemogenetic tools to interrogate brain functions. Annual review of neuroscience 37: 387-407 28. Armbruster BN, Li X, Pausch MH, Herlitze S, Roth BL (2007) Evolving the lock to fit the key to create a family of G protein-coupled receptors potently activated by an inert ligand. Proceedings of the National Academy of Sciences of the United States of America 104: 5163- 8 29. Roth BL (2016) DREADDs for Neuroscientists. Neuron 89: 683-694 30. Gomez JL, Bonaventura J, Lesniak W, Mathews WB, Sysa-Shah P, Rodriguez LA, Ellis RJ, Richie CT, Harvey BK, Dannals RF, et al. (2017) Chemogenetics revealed: DREADD occupancy and activation via converted clozapine. Science (New York, NY) 357: 503-507 31. Chen X, Choo H, Huang XP, Yang X, Stone O, Roth BL, Jin J (2015) The first structure- activity relationship studies for designer receptors exclusively activated by designer drugs. ACS chemical neuroscience 6: 476-84 32. Hemmer B, Kerschensteiner M, Korn T (2015) Role of the innate and adaptive immune responses in the course of multiple sclerosis. Lancet Neurol 14: 406-19 33. Betley JN, Sternson SM (2011) Adeno-associated viral vectors for mapping, monitoring, and manipulating neural circuits. Human gene therapy 22: 669-77 34. Serguera C, Bemelmans AP (2014) Gene therapy of the central nervous system: General considerations on viral vectors for gene transfer into the brain. Revue Neurologique 170: 727-738 35. White E (2012) Molecular neurosurgery: vectors and vector delivery strategies. British journal of neurosurgery 26: 798-808 36. Vazey EM, Aston-Jones G (2014) Designer receptor manipulations reveal a role of the locus coeruleus noradrenergic system in isoflurane general anesthesia. Proceedings of the National Academy of Sciences of the United States of America 111: 3859-64 37. Alexander GM, Rogan SC, Abbas AI, Armbruster BN, Pei Y, Allen JA, Nonneman RJ, Hartmann J, Moy SS, Nicolelis MA, et al. (2009) Remote control of neuronal activity in transgenic mice expressing evolved G protein-coupled receptors. Neuron 63: 27-39 38. Howland RH (2014) Vagus Nerve Stimulation. Current behavioral neuroscience reports 1: 64-73 39. Amtul Z, Uhrig M, Rozmahel RF, Beyreuther K (2011) Structural Insight into the Differential Effects of Omega-3 and Omega-6 Fatty Acids on the Production of A beta Peptides and Amyloid Plaques. J Biol Chem 286: 6100-6107 40. Krahl SE (2012) Vagus nerve stimulation for epilepsy: A review of the peripheral mechanisms. Surgical neurology international 3: S47-52 41. Krahl SE, Clark KB (2012) Vagus nerve stimulation for epilepsy: A review of central mechanisms. Surgical neurology international 3: S255-S259 42. Ruffoli R, Giorgi FS, Pizzanelli C, Murri L, Paparelli A, Fornai F (2011) The chemical neuroanatomy of vagus nerve stimulation. Journal of chemical neuroanatomy 42: 288-96

43. Liu Y, Rui XX, Shi H, Qiu YH, Peng YP (2018) Norepinephrine Inhibits Th17 Cells via beta2-Adrenergic Receptor (beta2-AR) Signaling in a Mouse Model of Rheumatoid Arthritis. Medical science monitor : international medical journal of experimental and clinical research 24: 1196-1204 44. Dorr AE, Debonnel G (2006) Effect of vagus nerve stimulation on serotonergic and noradrenergic transmission. J Pharmacol Exp Ther 318: 890-8 45. Raedt R, Clinckers R, Mollet L, Vonck K, El Tahry R, Wyckhuys T, De Herdt V, Carrette E, Wadman W, Michotte Y, et al. (2011) Increased hippocampal noradrenaline is a biomarker for efficacy of vagus nerve stimulation in a limbic seizure model. J Neurochem 117: 461-9 46. Manta S, El Mansari M, Debonnel G, Blier P (2013) Electrophysiological and neurochemical effects of long-term vagus nerve stimulation on the rat monoaminergic systems. International Journal of Neuropsychopharmacology 16: 459-470 47. Krahl SE, Clark KB, Smith DC, Browning RA (1998) Locus coeruleus lesions suppress the seizure-attenuating effects of vagus nerve stimulation. Epilepsia 39: 709-14 48. Koopman FA, Chavan SS, Miljko S, Grazio S, Sokolovic S, Schuurman PR, Mehta AD, Levine YA, Faltys M, Zitnik R, et al. (2016) Vagus nerve stimulation inhibits cytokine production and attenuates disease severity in rheumatoid arthritis. Proceedings of the National Academy of Sciences 113: 8284-8289 49. Bassi GS, Dias DPM, Franchin M, Talbot J, Reis DG, Menezes GB, Castania JA, Garcia-Cairasco N, Resstel LBM, Salgado HC, et al. (2017) Modulation of experimental arthritis by vagal sensory and central brain stimulation. Brain Behav Immun 64: 330-343 50. Meneses G, Bautista M, Florentino A, Díaz G, Acero G, Besedovsky H, Meneses D, Fleury A, Del Rey A, Gevorkian G, et al. (2016) Electric stimulation of the vagus nerve reduced mouse neuroinflammation induced by lipopolysaccharide. Journal of Inflammation 13: 33 51. Benskey MJ, Manfredsson FP (2016) Intraparenchymal Stereotaxic Delivery of rAAV and Special Considerations in Vector Handling. Methods in molecular biology (Clifton, NJ) 1382: 199-215 52. Wang T, Zhang QJ, Liu J, Wu ZH, Wang S (2009) Firing activity of locus coeruleus noradrenergic neurons increases in a rodent model of Parkinsonism. Neuroscience bulletin 25: 15-20 53. Burger C, Gorbatyuk OS, Velardo MJ, Peden CS, Williams P, Zolotukhin S, Reier PJ, Mandel RJ, Muzyczka N (2004) Recombinant AAV viral vectors pseudotyped with viral capsids from serotypes 1, 2, and 5 display differential efficiency and cell tropism after delivery to different regions of the central nervous system. Molecular therapy : the journal of the American Society of Gene Therapy 10: 302-17 54. Cearley CN, Wolfe JH (2006) Transduction characteristics of adeno-associated virus vectors expressing cap serotypes 7, 8, 9, and Rh10 in the mouse brain. Molecular therapy : the journal of the American Society of Gene Therapy 13: 528-37 55. Scheyltjens I, Laramée ME, Haute CVd, Gijsbers R, Debyser Z, Baekelandt V, Vreysen S, Arckens L (2015) Evaluation of the expression pattern of rAAV2/1, 2/5, 2/7, 2/8, and 2/9 serotypes with different promoters in the mouse visual cortex. Journal of Comparative Neurology 523: 2019-2042 56. Castle MJ, Gershenson ZT, Giles AR, Holzbaur EL, Wolfe JH (2014) Adeno-associated virus serotypes 1, 8, and 9 share conserved mechanisms for anterograde and retrograde axonal transport. Human gene therapy 25: 705-20 57. Murlidharan G, Samulski RJ, Asokan A (2014) Biology of adeno-associated viral vectors in the central nervous system. Frontiers in molecular neuroscience 7: 76 58. Ayyildiz M, Kozan R, Agar E, Kaplan S (2008) Sexual dimorphism in the medial vestibular nucleus of adult rats: stereological study. Anatomical science international 83: 131- 9 59. Schuerger RJ, Balaban CD (1993) Immunohistochemical demonstration of regionally selective projections from locus coeruleus to the vestibular nuclei in rats. Experimental brain research 92: 351-9

60. Takahashi T, Shirasu M, Shirasu M, Kubo KY, Onozuka M, Sato S, Itoh K, Nakamura H (2010) The locus coeruleus projects to the mesencephalic trigeminal nucleus in rats. Neuroscience research 68: 103-6 61. Bruinstroop E, Cano G, Vanderhorst VG, Cavalcante JC, Wirth J, Sena-Esteves M, Saper CB (2012) Spinal projections of the A5, A6 (locus coeruleus), and A7 noradrenergic cell groups in rats. The Journal of comparative neurology 520: 1985-2001 62. Haberman RP, McCown TJ, Samulski RJ (2000) Novel transcriptional regulatory signals in the adeno-associated virus terminal repeat A/D junction element. J Virol 74: 8732-9 63. Paxinos G, Watson C (1986) The Rat Brain in Stereotaxic Coordinates. Academic Press, San Diego 64. Janitzky K, Lippert MT, Engelhorn A, Tegtmeier J, Goldschmidt J, Heinze HJ, Ohl FW (2015) Optogenetic silencing of locus coeruleus activity in mice impairs cognitive flexibility in an attentional set-shifting task. Frontiers in behavioral neuroscience 9: 286 65. Mahler SV, Aston-Jones G (2018) CNO Evil? Considerations for the Use of DREADDs in Behavioral Neuroscience. Neuropsychopharmacology : official publication of the American College of Neuropsychopharmacology 43: 934-936 66. Naheed M, Green B (2001) Focus on clozapine. Current medical research and opinion 17: 223-9 67. Nilsson LK, Schwieler L, Engberg G, Linderholm KR, Erhardt S (2005) Activation of noradrenergic locus coeruleus neurons by clozapine and haloperidol: involvement of glutamatergic mechanisms. The international journal of neuropsychopharmacology 8: 329-39 68. Seabrook TJ, Hay JB (2001) Intracerebroventricular infusions of TNF-alpha preferentially recruit blood lymphocytes and induce a perivascular leukocyte infiltrate. J Neuroimmunol 113 69. Tanaka A, To J, O'Brien B, Donnelly S, Lund M (2017) Selection of reliable reference genes for the normalisation of gene expression levels following time course LPS stimulation of murine bone marrow derived macrophages. BMC immunology 18: 43

Addendum

1. Immunohistochemistry: estimation of the amount of co-localized cells

Estimation of the percentage of co-localized cells throughout the left LC, DREADD animal LSH1: The green and red channel of the pictures were spilt, and TH+ cells and mCherry+ cells were counted manually in each LC region with Fiji software.

Section 1:

Number of TH+ cells: 5 Number of mCherry+ cells: 5 Number of TH+/mCherry+ cells: 4

Section 2:

Number of TH+ cells: 7 Number of mCherry+ cells: 8 Number of TH+/mCherry+ cells: 6

Section 3:

Number of TH+ cells: 15 Number of mCherry+ cells: 11 Number of TH+/mCherry+ cells: 7 section 4:

Number of TH+ cells: 25 Number of mCherry+ cells: 13 Number of TH+/mCherry+ cells: 2

Section 5:

Number of TH+ cells: 28 Number of mCherry+ cells: 12 Number of TH+/mCherry+ cells: 9 Section 6:

Number of TH+ cells: 31 Number of mCherry+ cells: 20 Number of TH+/mCherry+ cells: 10 Section 7:

Number of TH+ cells: 22 number of mCherry+ cells: 19 Number of TH+/mcherry+ cells: 5

Total number of TH+ cells throughout the left LC: 133 (with an error rate of ± 10 cells) Total number of mCherry+ cells throughout the left LC: 69 Total number of TH+/mCherry+ cells throughout the left LC: 43  Only 32,33% of TH+ cells are also mCherry+.

Estimation of the percentage of co-localized cells throughout the right LC, DREADD animal LSH1: Section 1:

Number of TH+ cells: 8 Number of mCherry+ cells: 5 Number of TH+/mCherry+ cells: 4 Section 2:

Number of TH+ cells: 5 Number of mCherry+ cells: 2 Number TH+/mCherry+ cells: 2

Section 3:

Number of TH+ cells: 15 Number of mCherry+ cells: 10 Number of TH+/mCherry+ cells: 5

Section 4:

Number of TH+ cells: 42 Number of mCherry+ cells: 14 Number of TH+/mCherry+ cells: 7

Section 5:

Number of TH+ cells: 37 Number of mCherry+ cells: 12 Number of TH+/mCherry+ cells: 6

Section 6:

Number of TH+ cells: 34 Number of mCherry+ cells: 11 Number of TH+/mCherry+ cells: 4

Section 7:

Number of TH+ cells: 3 Number of mCherry+ cells: 5 Number of TH+/mCherry+ cells: 2

Total number of TH+ cells throughout the right LC: 110 (with an error rate of ± 10 cells) Total number of mCherry+ cells throughout the right LC: 59 Total number of TH+/mCherry+ cells throughout the right LC: 30  Only 27,27% of TH+ cells are also mCherry+.

2. Unit recording Graphs showing the effect of clozapine and clonidine injections on the firing frequency at unit level in control and hM3Dq transduced animals.

Control animal DLC1:

DLC1: unit 1 clozapine 0,01mg/kg clozapine 0,1mg/kg clonidine 40µg/kg 3

2,5

1,5

1 Frequency(Hz)/10s 0,5

0 0 1000 2000 3000 4000 5000 6000 Time (s)

Fig. 13: This unit shows a significant increase in firing frequency (>10% increase) after both the first (1,30 ± 0,17 Hz) and second clozapine injection (2,14 ± 0,12 Hz) compared to baseline frequency (1 Hz, p1= 5.5897E-20, p2=3.4562E-60, one sample T-test). After clonidine injection, the unit decreases in firing frequency (0,39 ± 0,25 Hz).

Control animal HLU2:

HLU2: unit 1 clozapine 0,01mg/kg clozapine 0,1mg/kg clonidine 40µg/kg 4

3,5

2,5

1,5

Frequency(Hz)/10s 1

0,5

0 0 500 1000 1500 2000 2500 3000 3500 4000 4500

Time (s)

Fig. 14: This unit does not show a significant increase in firing frequency (>10% increase) after the first clozapine injection (1,05 ± 0,06 Hz). But it shows a significant increase in firing frequency after the second clozapine injection (2,92 ± 0,14 Hz) compared to baseline frequency (1 Hz, p=3.2897E-70, one sample T-test). After clonidine injection, the unit decreases in firing frequency (0,84 ± 0,07 Hz).

Control animal LSH3:

LSH3: unit 1 2 clozapine 0,01 mg/kg clozapine 0,1 mg/kg clonidine 40 µg/kg 1,8 1,6 1,4 1,2 1 0,8 0,6

Frequency(Hz)/10s 0,4 0,2 0 0 500 1000 1500 2000 2500 3000 3500 4000 Time (s)

Fig. 15: This unit shows a significant decrease in firing frequency (>10% decrease) after the first clozapine injection (0,83 ± 0,11 Hz) compared to baseline frequency (1 Hz, p= 1.4609E-15, one sample T-test). But it shows a significant increase in firing frequency (>10% increase) after the second clozapine injection (1,30 ± 0,25 Hz) compared to baseline frequency (1 Hz, p= 1.2126E-13, one sample T-test). After clonidine injection, the unit decreases in firing frequency (0,80 ± 0,38 Hz).

Control animal LSH6:

LSH6: unit 1 4,5 clozapine 0,01 mg/kg clozapine 0,1 mg/kg clonidine 40 µg/kg 4 3,5 3 2,5 2

1,5 Frequency(Hz)/10s 1 0,5 0 0 500 1000 1500 2000 2500 3000 3500 4000 4500

Time (s)

Fig. 16: This unit shows a significant increase in firing frequency (>10% increase) after both the first (1,20 ± 0,23 Hz) and second clozapine injection (1,62 ± 0,34 Hz) compared to baseline frequency (1 Hz, p1= 4.3944E-9, p2= 5.5913E-21, one sample T-test). After clonidine injection, the unit showed a decrease in firing frequency and eventually stopped firing.

hM3Dq transduced animal HLC3:

HLC3: unit 1 clozapine 0,01 mg/kg clozapine 0,1 mg/kg 1,8 clonidine 40 µg/kg 1,6 1,4 1,2 1 0,8 0,6

Frequency(Hz)/10s 0,4 0,2 0 0 1000 2000 3000 4000 5000 6000

Time (s)

Fig. 17: This unit shows a significant increase in firing frequency (>10% increase) after both the first (1,33 ± 0,12 Hz) and second clozapine injection (1,28 ± 0,12 Hz) compared to baseline frequency (1 Hz, p1= 3.1406E-30, p2= 1.9996E-26, one sample T-test). After clonidine injection, the unit decreases in firing frequency (0,44 ± 0,05 Hz).

hM3Dq transduced animal HLU15:

HLU15: unit 1

2,5 clozapine 0,01mg/kg clozapine 0,1mg/kg clonidine 40µg/kg

1,5

1 Frequency(Hz)

0,5

0 0 500 1000 1500 2000 2500 3000 3500 Time (s)

Fig. 18: This unit shows a significant increase in firing frequency (>10% increase) after both the first (1,20 ± 0,24 Hz) and second clozapine injection (1,69 ± 0,19 Hz) compared to baseline frequency (1 Hz, p1= 4.1538E-25, p2= 7.2985E-50, one sample T-test). After clonidine injection, the unit decreases in firing frequency (0,80 ± 0,25 Hz).

hM3Dq transduced animal LSH1:

LSH1: unit 1 clozapine 0,01 mg/kg clozapine 0,1 mg/kg clonidine 40 µg/kg 1,8 1,6 1,4 1,2 1 0,8

Frequency(Hz)/10s 0,6 0,4 0,2 0 0 1000 2000 3000 4000 5000 6000 Time (s)

Fig. 19: This unit shows a significant decrease in firing frequency (>10% decrease) after both the first (0,72 ± 0,07 Hz) and second clozapine injection (0,86 ± 0,11 Hz) compared to baseline frequency (1 Hz, p1,2=0, one sample T-test). After clonidine injection, the unit decreases in firing frequency (0,67 ± 0,13 Hz) and eventually stopped firing.

3. RT-qPCR analysis

Melting curve analysis

Fig. 23: Melting curves of target gene IL-6. Since only one peak is visible for all target samples, no primer dimers are formed in these samples, indicating reliable amplification data. Green lines indicates blanco samples in which no PCR product or no primer dimers are formed, which is expected.

Fig. 24: Melting curves of target gene ICAM-1. Since only one peak is visible for all target samples, no primer dimers are formed in these samples, indicating reliable amplification data. Green lines indicates blanco samples in which no PCR product or no primer dimers are formed, which is expected.

Fig. 25: Melting curves of reference gene HPRT. Since only one peak is visible for all target samples, no primer dimers are formed in these samples, indicating reliable amplification data. Green lines indicates blanco samples in which no PCR product or no primer dimers are formed, which is expected.

Fig. 26: Melting curves of reference gene GAPDH. Since only one peak is visible for all target samples, no primer dimers are formed in these samples, indicating reliable amplification data. One curve shows multiple peaks, this is the curve of a blanco sample in which primer dimers were formed. The other green lines indicate blanco samples in which no PCR product or no primer dimers are formed, which is expected.