DOCSLIB.ORG

Box Turtle Mycoplasma

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Box Turtle Mycoplasma SHORT COMMUNICATIONS DOI: 10.7589/2017-07-153 Journal of Wildlife Diseases, 54(2), 2018, pp. 000–000 Ó Wildlife Disease Association 2018 Identification of Hemotropic Mycoplasmas in an Eastern Box Turtle (Terrapene carolina carolina) and a Yellow-Bellied Slider (Trachemys scripta scripta) from North Carolina Jo Jarred,1 Gregory Lewbart,1,2 Kelsey Stover,1 Brittany Thomas,1 Ricardo Maggi,1 and Edward B. Breitschwerdt1 1Department of Clinical Sciences and the Comparative Medicine Institute, North Carolina State University College of Veterinary Medicine, Raleigh, North Carolina 27607, USA; 2Corresponding author: (email: [email protected]) ABSTRACT: Mycoplasma spp. are known from and infertility (Messick 2004). Although it has several chelonian and other reptilian species. We been determined that hemoplasmas share determined if turtles obtained by the Turtle phenotypic and genetic similarities with other Rescue Team at North Carolina State University are carriers of hemotropic Mycoplasma or Bar- Mycoplasma spp., variability in the genomes tonella spp. Spleen samples were collected at of these bacteria continue to complicate exact necropsy during May through July, 2014 from 53 classification at the species level (Guimaraes turtles of seven species. All turtles were dead or et al. 2014). Different hemoplasma species are were euthanized upon arrival due to severe traumatic injuries, or they died shortly after zoonotic and cause the same effects on red beginning treatment. We used PCR amplification blood cells in human patients as they do in for both bacterial genera; Bartonella spp. DNA other mammals (Sykes et al. 2010; Steer et al. was not amplified. Based upon sequencing of the 2011). Clinical signs and pathogenic proper- 16S rRNA subunit, one eastern box turtle ties (if any) associated with hemoplasmas in (Terrapene carolina carolina) and one yellow- bellied slider (Trachemys scripta scripta) were reptiles are unknown. infected with Mycoplasma spp. that have genetic The North Carolina State University Col- similarities to strains that infect other animals. lege of Veterinary Medicine Turtle Rescue Key words: Chelonian, hemoplasma, hemo- Team (TRT) is a student-run organization of tropic mycoplasma, PCR, wildlife. volunteers who rehabilitate wild reptiles (Lewbart et al. 2005). Between May and July Identification of vector-borne diseases in 2014, samples of 53 spleens were collected reptiles has largely been unexplored. Our from turtles admitted to the TRT that either project was inspired by the documentation of died or were euthanized, mostly due to Bartonella spp. in sea turtles in North trauma (mainly vehicular). The 53 specimens Carolina (Valentine et al. 2007), because included 23 eastern box turtles (Terrapene subsequent investigations of reptiles, includ- carolina carolina), 14 yellow-bellied sliders ing terrestrial turtles, as a possible reservoir (Trachemys scripta scripta), six river cooters host remained lacking. Various Bartonella spp. (Pseudemys concinna), five eastern painted have been identified in North Carolina turtles (Chrysemys picta), three common cetaceans (Harms et al. 2008; Maggi et al. snapping turtles (Chelydra serpentina), one 2008) and river otters (Chinnadurai et al., common mud turtle (Kinosternon subru- 2010). Also, known and novel Mycoplasma brum), and one common musk turtle (Sterno- spp. have been documented in reptiles, the therus odoratus). Turtles originated from majority of which are associated with clinical central North Carolina. After death, speci- signs involving the respiratory tract (Brown et mens were stored at 4 C for up to 2 d until al. 2001; Feldman et al. 2006; Ossiboff et al. tissue harvest. We performed necropsies with 2015). Hemotropic mycoplasmas (hemoplas- the guidance of a sea turtle necropsy manual mas) are small, epicellular, cell wall-deficient (Work 2000) using appropriate modifications bacteria encountered in the blood of a variety made for each species. If DNA extraction of animal species that can contribute to could not be performed immediately, spleen pathogenic outcomes such as anemia, ill-thrift, specimens (up to 5 g, depending on the size of 1 2 JOURNAL OF WILDLIFE DISEASES, VOL. 54, NO. 2, APRIL 2018 turtle) were harvested and stored frozen at 0 fications were performed in an Eppendorf C in 5 mL screw-cap centrifuge tubes. Mastercycler EPgradient St (Eppendorf, Spleen specimens were thawed or cut Hauppauge, New York, USA). directly after necropsy into small pieces using We used 2% agarose gel electrophoresis to a scalpel blade. Pathogen DNA extraction was analyze PCR products, with detection using performed with a standardized kit (DNeasy ethidium bromide under ultraviolet light. Blood & Tissue Kit; Qiagen, Valencia, Cal- Bartonella spp. DNA was not amplified from ifornia, USA), following the manufacturer’s any turtle spleen. Two turtle spleens con- instructions for DNA extraction from tissues. tained Mycoplasma spp. DNA. Amplicon Pathogen DNA concentrations and absor- products were sequenced by Genewiz (RTP, bance ratios at 260 nm and 280 nm were North Carolina, USA) to establish species determined using the Nanodropt ND-1000 strain identification using chromatogram and (Thermo, Wilmington, Delaware, USA). to alignment analysis (ContigExpresst and assess the concentration and purity of the AlignX software, Vector NTIt v10, Invitrogen, DNA samples collected. Repeated DNA Carlsbad, California, USA). After sequencing, extractions were performed in eight cases to phylogenetic and taxonomic comparisons ensure that yields were .15 ng/lL. were made using GenBank. The DNA se- We used pathogen DNA amplification, quence from the eastern box turtle number 24 through PCR, to detect the presence of (GenBank accession number MG649987) was Bartonella spp. and hemotropic Mycoplasma most similar to the following Mycoplasma spp. DNA in each sample. We amplified sequences: 87% (490/564 base pairs [bp]) hemotropic Mycoplasma by targeting a con- similar to Mycoplasmataceae bacterium served region of the 16SrRNA using oligonu- T2110, (GenBank: DQ318957.1), an unclassi- cleotides HemMycop16S-322s: 50 GCC CAT fied mycoplasma found in Atlantic Cod ATT CCT ACG GGA AGC AGC AGT 30 and (Gadus morhua); 87% (484/557 bp) similar HemMyco16S-938as: 50 CTC CAC CAC TTG to Candidatus Mycoplasma haemohominis, TTC AGG TCC CCG TC 30 as previously found in humans; and 92% (483/564 bp) described (Maggi et al. 2013). Detection of similar to Candidatus Mycoplasma haemomi- Bartonella DNA was performed by targeting nutum, found in cats (Fig. 1). The DNA the 16S–23S intergenic spacer region (ITS) sequence from yellow-bellied slider number using oligonucleotides 325s (50 CCTCAGAT 47 (GenBank accession number MG519832) GATGATCCCAAGCCTTTTGGCG 30) and was most similar to the following Mycoplasma 1000as (50 CTGAGCTACGGCCCCTAAAT sequences: 92% (514/557 bp) similar to CAGG 30) as forward and reverse primers, Mycoplasma insons, previously found in green respectively (Valentine et al. 2007). Amplifi- iguanas; 92% (514/557 bp) similar to Myco- cation for each genus was performed in a 25 plasma cavipharyngis, found in guinea pigs lL final volume reaction. The 25 lL reaction (Cavia porcellus); 92% (512/557 bp) similar to mix contained 12.5 lL of MyTaqe Red Mix Mycoplasma fastidiosum, found in equines (Bioline, Taunton, Massachusetts, USA), 0.2 (Fig. 2). lLof50lM of each forward and reverse Hemotropic Mycoplasma spp. have not primer (IDTt DNA Technologies, Coralville, previously been amplified from a reptile. Iowa, USA), 7.3 lL of molecular grade water, The potential clinical impact that hemotropic and 5 lL (75–150 ng total) of template DNA. Mycoplasma spp. have on reptiles is unknown We prepared positive controls using either 5 because their pathogenicity in reptile species lL Mycoplasma hematoparvum 16SrRNA or remains undetermined. Many turtles enter a Bartonella henselae ITS plasmid vectors rehabilitation facility already in compromised (pGEM-T Easy Vector Systems, Promega, health, and stresses associated with trauma Madison, Wisconsin, USA) at a final concen- and rehabilitation can exacerbate what would tration of five copies per microliter, for both otherwise be nonclinical or minor health Mycoplasma and Bartonella detection. Ampli- issues. If hemotrophic Mycoplasma spp. are SHORT COMMUNICATIONS 3 FIGURE 1. Sequencing results highlighting the similarities between the Mycoplasma spp. identified in turtle number 24 (eastern box turtle, Terrapene carolina carolina) and turtle number 47 (yellow-bellied slider, Trachemys scripta scripta) to each other as well as to species of Mycoplasma found in canines and felines. normally nonpathogenic in chelonian species, Although we did not amplify DNA from a hemoplasmosis could have a negative impact Bartonella spp. from terrestrial turtles in this on an animal’s recovery and chance for study, a negative PCR result does not rule out ultimate release for those animals in rehabil- a potential Bartonella spp. infection. In non- itation facilities where concurrent diseases can reservoir hosts, Bartonella spp. are most often exacerbate nonpathogenic conditions. found in very low concentrations in blood and We do not know if the Mycoplasma spp. in splenic tissues, which could result in false chelonians are contagious to humans or to negative PCR amplification. The role, if any, other animal species. Hemotrophic Mycoplas- which reptiles play in transmission of Myco- plasma is unknown, and further investigation ma spp. amplified from reservoir hosts, into hemotropic Mycoplasma and other blood including
Load more

Recommended publications
  • The Role of Earthworm Gut-Associated Microorganisms in the Fate of Prions in Soil
    THE ROLE OF EARTHWORM GUT-ASSOCIATED MICROORGANISMS IN THE FATE OF PRIONS IN SOIL Von der Fakultät für Lebenswissenschaften der Technischen Universität Carolo-Wilhelmina zu Braunschweig zur Erlangung des Grades eines Doktors der Naturwissenschaften (Dr. rer. nat.) genehmigte D i s s e r t a t i o n von Taras Jur’evič Nechitaylo aus Krasnodar, Russland 2 Acknowledgement I would like to thank Prof. Dr. Kenneth N. Timmis for his guidance in the work and help. I thank Peter N. Golyshin for patience and strong support on this way. Many thanks to my other colleagues, which also taught me and made the life in the lab and studies easy: Manuel Ferrer, Alex Neef, Angelika Arnscheidt, Olga Golyshina, Tanja Chernikova, Christoph Gertler, Agnes Waliczek, Britta Scheithauer, Julia Sabirova, Oleg Kotsurbenko, and other wonderful labmates. I am also grateful to Michail Yakimov and Vitor Martins dos Santos for useful discussions and suggestions. I am very obliged to my family: my parents and my brother, my parents on low and of course to my wife, which made all of their best to support me. 3 Summary.....................................................………………………………………………... 5 1. Introduction...........................................................................................................……... 7 Prion diseases: early hypotheses...………...………………..........…......…......……….. 7 The basics of the prion concept………………………………………………….……... 8 Putative prion dissemination pathways………………………………………….……... 10 Earthworms: a putative factor of the dissemination of TSE infectivity in soil?.………. 11 Objectives of the study…………………………………………………………………. 16 2. Materials and Methods.............................…......................................................……….. 17 2.1 Sampling and general experimental design..................................................………. 17 2.2 Fluorescence in situ Hybridization (FISH)………..……………………….………. 18 2.2.1 FISH with soil, intestine, and casts samples…………………………….……... 18 Isolation of cells from environmental samples…………………………….……….
    [Show full text]
  • Mycoplasmosis and Upper Respiratory Tract Disease of Tortoises: a Review and Update Elliott R
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector The Veterinary Journal 201 (2014) 257–264 Contents lists available at ScienceDirect The Veterinary Journal journal homepage: www.elsevier.com/locate/tvjl Review Mycoplasmosis and upper respiratory tract disease of tortoises: A review and update Elliott R. Jacobson a,*, Mary B. Brown b, Lori D. Wendland b, Daniel R. Brown b, Paul A. Klein c, Mary M. Christopher d, Kristin H. Berry e a Department of Small Animal Medicine, College of Veterinary Medicine, University of Florida, Gainesville, FL 32610, USA b Department of Infectious Disease and Pathology, College of Veterinary Medicine, University of Florida, Gainesville, FL 32610, USA c Department of Pathology, Immunology, and Laboratory Medicine, College of Medicine, University of Florida, Gainesville, FL 32610, USA d Department of Pathology, Microbiology and Immunology, School of Veterinary Medicine, University of California-Davis, Davis, CA 95616, USA e US Geological Survey, Western Ecological Research Center, Riverside, CA 92518, USA ARTICLE INFO ABSTRACT Article history: Tortoise mycoplasmosis is one of the most extensively characterized infectious diseases of chelonians. Accepted 30 May 2014 A 1989 outbreak of upper respiratory tract disease (URTD) in free-ranging Agassiz’s desert tortoises (Gopherus agassizii) brought together an investigative team of researchers, diagnosticians, pathologists, immunolo- Keywords: gists and clinicians from multiple institutions and
    [Show full text]
  • The Slow Dynamics of Mycoplasma Infections in a Tortoise Host Reveal
    Epidemiology and Infection The slow dynamics of mycoplasma infections in a tortoise host reveal heterogeneity cambridge.org/hyg pertinent to pathogen transmission and monitoring Original Paper 1,2 1 3 2 2 Cite this article: Aiello CM, Esque TC, Nussear C. M. Aiello , T. C. Esque , K. E. Nussear , P. G. Emblidge and P. J. Hudson KE, Emblidge PG, Hudson PJ (2019). The slow 1 dynamics of mycoplasma infections in a US Geological Survey, Western Ecological Research Center, Las Vegas Field Station, Henderson, NV 89074, USA; tortoise host reveal heterogeneity pertinent to 2Department of Biology, Center for Infectious Disease Dynamics, Pennsylvania State University, University Park, PA pathogen transmission and monitoring. 16802, USA and 3Department of Geography, University of Nevada, Reno, NV 89557, USA Epidemiology and Infection 147,e12,1–10. https://doi.org/10.1017/S0950268818002613 Abstract Received: 11 April 2018 The epidemiology of infectious diseases depends on many characteristics of disease progres- Revised: 29 June 2018 sion, as well as the consistency of these processes across hosts. Longitudinal studies of infec- Accepted: 25 August 2018 tion can thus inform disease monitoring and management, but can be challenging in wildlife, Key words: particularly for long-lived hosts and persistent infections. Numerous tortoise species of con- Chronic infection; Gopherus agassizii; host servation concern can be infected by pathogenic mycoplasmas that cause a chronic upper resistance; infectiousness; reptile pathogens respiratory tract disease (URTD). Yet, a lack of detailed data describing tortoise responses Author for correspondence: to mycoplasma infections obscures our understanding of URTDs role in host ecology. We C. M. Aiello, E-mail: christinamaiello@gmail.
    [Show full text]
  • Upper Respiratory Pathogens of Chelonians: a Snotty Turtle
    8/21/15 Upper Respiratory Pathogens of Chelonians: A Snotty Turtle Matt Allender, DVM, MS, PhD, Dipl. ACZM University of Illinois Illinois Fall Conference 2015 Pathogens o Ranavirus o Herpes o Mycoplasma General Host Type Species Iridovirus Insects Tipula iridescent virus Chloriridovirus Insects Mosquito iridescent virus Lymphocystivirus Fish Lymphocystivirus disease virus 1 Ranavirus Fish, Amphibians, Reptiles Frog Virus 3 Megalocystivirus Fish Infectious spleen and kidney necrosis virus 1 8/21/15 Ranavirus: Chelonian Significance o Emerging disease in wild and captive chelonia around the world. o Clinical signs include dyspnea, ocular, nasal and oral discharges, and death. 2 8/21/15 Prevalence 20032004 2015 Numerous cases State Species Reference Florida Gopher tortoise Westhouse et al. Florida Box turtle Johnson et al. North Carolina Eastern box turtle DeVoe et al., Allender et al. Tennessee Eastern box turtle Allender et al. Pennsylvania Eastern box turtle Johnson et al. Snapping turtle USGS Maryland Eastern box turtle USGS, Mao? Tortoise Mao? Rhode Island Painted turtle USGS Kentucky Eastern box turtle Ruder et al. Georgia Burmese Star tortoise Johnson et al. New York Eastern Box turtle Johnson et al. Texas Eastern box turtle Johnson et al. Massachusetts Eastern box turtle Allender Virginia Eastern box turtle Allender et al. Indiana Eastern box turtle Johnson pers. comm. Alabama Eastern box turtle Allender et al. Ranavirus: Clinical Signs o Present with sudden onset of severe illness or sudden death with no signs o Rhinitis, conjuctivitis,
    [Show full text]
  • LCR MSCP Species Accounts, 2008
    Lower Colorado River Multi-Species Conservation Program Steering Committee Members Federal Participant Group California Participant Group Bureau of Reclamation California Department of Fish and Game U.S. Fish and Wildlife Service City of Needles National Park Service Coachella Valley Water District Bureau of Land Management Colorado River Board of California Bureau of Indian Affairs Bard Water District Western Area Power Administration Imperial Irrigation District Los Angeles Department of Water and Power Palo Verde Irrigation District Arizona Participant Group San Diego County Water Authority Southern California Edison Company Arizona Department of Water Resources Southern California Public Power Authority Arizona Electric Power Cooperative, Inc. The Metropolitan Water District of Southern Arizona Game and Fish Department California Arizona Power Authority Central Arizona Water Conservation District Cibola Valley Irrigation and Drainage District Nevada Participant Group City of Bullhead City City of Lake Havasu City Colorado River Commission of Nevada City of Mesa Nevada Department of Wildlife City of Somerton Southern Nevada Water Authority City of Yuma Colorado River Commission Power Users Electrical District No. 3, Pinal County, Arizona Basic Water Company Golden Shores Water Conservation District Mohave County Water Authority Mohave Valley Irrigation and Drainage District Native American Participant Group Mohave Water Conservation District North Gila Valley Irrigation and Drainage District Hualapai Tribe Town of Fredonia Colorado River Indian Tribes Town of Thatcher The Cocopah Indian Tribe Town of Wickenburg Salt River Project Agricultural Improvement and Power District Unit “B” Irrigation and Drainage District Conservation Participant Group Wellton-Mohawk Irrigation and Drainage District Yuma County Water Users’ Association Ducks Unlimited Yuma Irrigation District Lower Colorado River RC&D Area, Inc.
    [Show full text]
  • General Microbiota of the Soft Tick Ornithodoros Turicata Parasitizing the Bolson Tortoise (Gopherus flavomarginatus) in the Mapimi Biosphere Reserve, Mexico
    biology Article General Microbiota of the Soft Tick Ornithodoros turicata Parasitizing the Bolson Tortoise (Gopherus flavomarginatus) in the Mapimi Biosphere Reserve, Mexico Sergio I. Barraza-Guerrero 1,César A. Meza-Herrera 1 , Cristina García-De la Peña 2,* , Vicente H. González-Álvarez 3 , Felipe Vaca-Paniagua 4,5,6 , Clara E. Díaz-Velásquez 4, Francisco Sánchez-Tortosa 7, Verónica Ávila-Rodríguez 2, Luis M. Valenzuela-Núñez 2 and Juan C. Herrera-Salazar 2 1 Unidad Regional Universitaria de Zonas Áridas, Universidad Autónoma Chapingo, 35230 Bermejillo, Durango, Mexico; [email protected] (S.I.B.-G.); [email protected] (C.A.M.-H.) 2 Facultad de Ciencias Biológicas, Universidad Juárez del Estado de Durango, 35010 Gómez Palacio, Durango, Mexico; [email protected] (V.Á.-R.); [email protected] (L.M.V.-N.); [email protected] (J.C.H.-S.) 3 Facultad de Medicina Veterinaria y Zootecnia No. 2, Universidad Autónoma de Guerrero, 41940 Cuajinicuilapa, Guerrero, Mexico; [email protected] 4 Laboratorio Nacional en Salud, Diagnóstico Molecular y Efecto Ambiental en Enfermedades Crónico-Degenerativas, Facultad de Estudios Superiores Iztacala, 54090 Tlalnepantla, Estado de México, Mexico; [email protected] (F.V.-P.); [email protected] (C.E.D.-V.) 5 Instituto Nacional de Cancerología, 14080 Ciudad de México, Mexico 6 Unidad de Biomedicina, Facultad de Estudios Superiores Iztacala, Universidad Nacional Autónoma de México, 54090 Tlalnepantla, Estado de México, Mexico 7 Departamento de Zoología, Universidad de Córdoba.Edificio C-1, Campus Rabanales, 14071 Cordoba, Spain; [email protected] * Correspondence: [email protected]; Tel.: +52-871-386-7276; Fax: +52-871-715-2077 Received: 30 July 2020; Accepted: 3 September 2020; Published: 5 September 2020 Abstract: The general bacterial microbiota of the soft tick Ornithodoros turicata found on Bolson tortoises (Gopherus flavomarginatus) were analyzed using next generation sequencing.
    [Show full text]
  • Presentation by Dr. Kristin H. Berry (U.S. Geological Survey, Biological
    Presentation by Dr. Kristin H. Berry (U.S. Geological Survey, Biological Resources Division): Field Evaluations of Desert Tortoises for Health and Disease; Effects of Diseases on Populations The Desert Tortoise and Upper Respiratory Tract Disease. (Jacobson, E. Prepared for the Desert Tortoise Preserve Committee, Inc., and the U.S. Bureau of Land Management. Revised November 1992) Mycoplasma agassizii Causes Upper Respiratory Tract Disease in the Desert Tortoise. (Brown, M.B., I.M. Schumacher, P.A. Klein, K. Harris, T. Correll, and E.R. Jacobson. Oct. 1994. Infection and Immunity, 62:4580-4586) Seroepidemiology of Upper Respiratory Tract Disease in the Desert Tortoise in the Western Mojave Desert of California. (Brown, M.B., K.H. Berry, I.M. Schumacher, K.A. Nagy, M.M. Christopher, and P.A. Klein. Oct. 1999. Journal of Wildlife Diseases. 35:716-727) Pathology of Diseases in Wild Desert Tortoises From California. (Homer, B.L., K.H. Berry, M.B. Brown, G. Ellis, and E.R. Jacobson. 1998. Journal of Wildlife Diseases. 35:508-523) Guidelines for the Field Evaluation of Desert Tortoise Health and Disease. (Berry, K.H. and Christopher, M.M. 2001. Journal of Wildlife Diseases. 37(3):427-450) The Desert Tortoise and Upper Respiratory Tract Disease By Elliott Jacobson, D.V.M., Ph.D. University of Florida Gainesville, FL 32510 BACKGROUND -- UPPER RESPIRATORY TRACTDISEASE IN CAPTIVE TORTOISES A disease characterized by a mild to severe nasal discharge 'has been seen for many yearsin captive: tortoises in Europe, England, and the United States: Although a complete list ofthe number of species of tortoises kDown to develop this disease is unavailable, it would be,fair to say th~t until proven otherwise, all species oftortoises should be considered susceptible.
    [Show full text]
  • Use of a Cardiac Access Port for Repeated Collection of Blood
    Use of a Cardiac Access Port for Repeated Collec- tion of Blood Samples from Desert Tortoises (Gopherus agassizii) J. WIMSATT, DVM, PHD, J. D. JOHNSON, DVM, AND B. A. MANGONE, DVM Abstract _ Repeated collection of blood samples may be required during pharmacokinetic studies and can be challenging in tortoises because of size and location of the major vessels. The technique described here is relatively safe, inexpensive, and potentially reversible. A sterile rubber stopper is surgically inserted into a hole drilled in the plastron over the heart to allow collection of multiple blood samples over a period of several days or weeks, using a 27-gauge needle. During surgical placement of the port, pericardial excision was performed on some tortoises, but not others, to assess the risk of cardiac tampanade when collecting samples. In 13 of 14 tortoises, the technique appeared to be well tolerated. Pericardiectomy did not appear to be neces- sary. Ports were left in 6 tortoises for 6 months without evidence of adverse effects. Ports were removed from 5 other tortoises, and the defect in the plastron was repaired; these tortoises appeared healthy 8 months later. Four months after removal of the port, 2 other tortoises were euthanatized as a result of advanced respiratory tract disease. Postmortem examination revealed that the plastron defects were completely filled with bone; however, they also had evidence of mild fibrotic myocardial changes that were attributed to repeated cardiocentesis. Repeated collection of blood samples in tortoises for the pur- considered to be carriers capable of spreading the Mycoplasma or- poses of research or clinical monitoring can be challenging.
    [Show full text]
  • Appendix 1. New and Emended Taxa Described Since Publication of Volume One, Second Edition of the Systematics
    188 THE REVISED ROAD MAP TO THE MANUAL Appendix 1. New and emended taxa described since publication of Volume One, Second Edition of the Systematics Acrocarpospora corrugata (Williams and Sharples 1976) Tamura et Basonyms and synonyms1 al. 2000a, 1170VP Bacillus thermodenitrificans (ex Klaushofer and Hollaus 1970) Man- Actinocorallia aurantiaca (Lavrova and Preobrazhenskaya 1975) achini et al. 2000, 1336VP Zhang et al. 2001, 381VP Blastomonas ursincola (Yurkov et al. 1997) Hiraishi et al. 2000a, VP 1117VP Actinocorallia glomerata (Itoh et al. 1996) Zhang et al. 2001, 381 Actinocorallia libanotica (Meyer 1981) Zhang et al. 2001, 381VP Cellulophaga uliginosa (ZoBell and Upham 1944) Bowman 2000, VP 1867VP Actinocorallia longicatena (Itoh et al. 1996) Zhang et al. 2001, 381 Dehalospirillum Scholz-Muramatsu et al. 2002, 1915VP (Effective Actinomadura viridilutea (Agre and Guzeva 1975) Zhang et al. VP publication: Scholz-Muramatsu et al., 1995) 2001, 381 Dehalospirillum multivorans Scholz-Muramatsu et al. 2002, 1915VP Agreia pratensis (Behrendt et al. 2002) Schumann et al. 2003, VP (Effective publication: Scholz-Muramatsu et al., 1995) 2043 Desulfotomaculum auripigmentum Newman et al. 2000, 1415VP (Ef- Alcanivorax jadensis (Bruns and Berthe-Corti 1999) Ferna´ndez- VP fective publication: Newman et al., 1997) Martı´nez et al. 2003, 337 Enterococcus porcinusVP Teixeira et al. 2001 pro synon. Enterococcus Alistipes putredinis (Weinberg et al. 1937) Rautio et al. 2003b, VP villorum Vancanneyt et al. 2001b, 1742VP De Graef et al., 2003 1701 (Effective publication: Rautio et al., 2003a) Hongia koreensis Lee et al. 2000d, 197VP Anaerococcus hydrogenalis (Ezaki et al. 1990) Ezaki et al. 2001, VP Mycobacterium bovis subsp. caprae (Aranaz et al.
    [Show full text]
  • Iridovirus Infections of Captive and Free-Ranging Chelonians in the United States
    IRIDOVIRUS INFECTIONS OF CAPTIVE AND FREE-RANGING CHELONIANS IN THE UNITED STATES By APRIL JOY JOHNSON A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2006 Copyright 2006 by April Joy Johnson ACKNOWLEDGMENTS Funding for this work was provided in part by the University of Florida College of Veterinary Medicine Batchelor Foundation, grant No. D04Z0-11 from the Morris Animal Foundation, and a grant from the Disney Conservation Fund. I also thank the University of Florida, College of Veterinary Medicine for awarding me an Alumni Fellowship for tuition and stipend over the first three years. I would like to thank the many people who helped collect and submit turtle and tortoise samples including Dr. William Belzer, Dr. Terry Norton, Jeffrey Spratt, Valorie Titus, Susan Seibert and Ben Atkinson. Also, I would like to thank all the pathologists who contributed to this work including Dr. Allan Pessier, Dr. Nancy Stedman, Dr. Robert Wagner and Dr. Jason Brooks. I thank Drs. Jerry Stanley and Kathy Goodblood for allowing me access to chelonian and amphibian populations at Buttermilk Hill Nature Sanctuary and to Drs. Mick Robinson and Ken Dodd for providing necropsy reports on archived cases. I would also like to thank the Mycoplasma Research Laboratory at the University of Florida including Dr. Mary Brown, Dr. Lori Wendland and Dina Demcovitz for providing access to their wild gopher tortoise plasma bank. I thank Yvonne Cates at the Zoological Society of San Diego for excellent histology support and Lynda Schneider from the University of Florida Electron Microscopy Core Laboratory.
    [Show full text]
  • Characterizing the Health Status of the Louisiana Gopher Tortoise
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Louisiana State University Louisiana State University LSU Digital Commons LSU Master's Theses Graduate School 2005 Characterizing the health status of the Louisiana gopher tortoise (Gopherus polyphemus) Orlando Diaz-Figueroa Louisiana State University and Agricultural and Mechanical College, [email protected] Follow this and additional works at: https://digitalcommons.lsu.edu/gradschool_theses Part of the Veterinary Medicine Commons Recommended Citation Diaz-Figueroa, Orlando, "Characterizing the health status of the Louisiana gopher tortoise (Gopherus polyphemus)" (2005). LSU Master's Theses. 23. https://digitalcommons.lsu.edu/gradschool_theses/23 This Thesis is brought to you for free and open access by the Graduate School at LSU Digital Commons. It has been accepted for inclusion in LSU Master's Theses by an authorized graduate school editor of LSU Digital Commons. For more information, please contact [email protected]. CHARACTERIZING THE HEALTH STATUS OF THE LOUISIANA GOPHER TORTOISE (GOPHERUS POLYPHEMUS) A Thesis Submitted to the Graduate Faculty of the Louisiana State University and Agricultural and Mechanical College In partial fulfillment of the Requirements for the degree of Master of Science in The Interdepartmental Program in Veterinary Medical Sciences by Orlando Diaz-Figueroa B.S., Louisiana State University, 1997 D.V.M., Tuskegee University, 2001 May 2005 DEDICATION This thesis is dedicated to my wife, Melissa, and my parents who have encouraged and supported me as I continued with my academic endeavors. ii ACKNOWLEDGEMENTS I am greatly indebted to a number of individuals whose expertise and assistance have been instrumental in guiding me through the completion of my thesis research and in nurturing my career in veterinary medicine.
    [Show full text]
  • Diseases of the Head of Amphibians and Reptiles Robert E Schmidt, DVM, Phd, Dipl ACVP, and Drury Reavill, DVM, DABVP (Avian), DABVP (Reptile and Amphibian), Dipl ACVP
    Diseases of the Head of Amphibians and Reptiles Robert E Schmidt, DVM, PhD, Dipl ACVP, and Drury Reavill, DVM, DABVP (Avian), DABVP (Reptile and Amphibian), Dipl ACVP Session #175 Affiliation: From Zoo/Exotic Pathology Service, 6020 Rutland Drive #14, Carmichael, CA 95608, USA. Abstract: The gross and microscopic lesions of tissues making up the head of amphibians and reptiles are reviewed and described. Tissues from the integument, musculoskeletal system, nasal cavity and oropharynx, special senses (eye and ear) and central nervous system are included. Etiologic categories include infectious, noninfectious and neoplastic disease. Introduction Diseases of the head can affect a number of organ systems including skin, upper gastrointestinal and respiratory systems, musculoskeletal system, special senses, and central nervous system. A variety of infectious, noninfec- tious, and neoplastic causes are possible. This presentation will cover the gross and histologic features of common conditions seen in a diagnostic pathology practice. General disease categories are infectious, noninfectious, and neoplasia. Infectious disease may be due to viruses, bacteria, fungi, and parasites. Noninfectious conditions include trauma and toxins. Reported neoplasms include epithelial, mesenchymal, and melanomas/chromatophoromas. Skin Infectious disease Viral disease: A number of viral infections have been reported to involve the skin of amphibians and reptiles. These include herpesvirus in both, poxvirus in both, papillomavirus possibly in both and iridovirus/ranavirus in both amphibians and reptiles. Herpesvirus: Cutaneous herpes infection has been reported in Italian frogs.1 Grossly small variably-sized, white to gray vesicles are seen. Histologically there is epidermal hyperplasia, epithelial cell karyomegaly and intra- nuclear inclusion body formation. In reptiles, grey patch disease (Chelonid herpesvirus 1) affects cultured green turtle hatchlings.
    [Show full text]