DOCSLIB.ORG

EHD) Protein Function

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
EHD) Protein Function University of Nebraska Medical Center DigitalCommons@UNMC Theses & Dissertations Graduate Studies Summer 8-18-2017 Molecular mechanisms of C-terminal Eps15 Homology Domain containing (EHD) protein function Kriti Bahl University of Nebraska Medical Center Follow this and additional works at: https://digitalcommons.unmc.edu/etd Part of the Biochemistry Commons, Cell Biology Commons, Molecular Biology Commons, and the Structural Biology Commons Recommended Citation Bahl, Kriti, "Molecular mechanisms of C-terminal Eps15 Homology Domain containing (EHD) protein function" (2017). Theses & Dissertations. 213. https://digitalcommons.unmc.edu/etd/213 This Dissertation is brought to you for free and open access by the Graduate Studies at DigitalCommons@UNMC. It has been accepted for inclusion in Theses & Dissertations by an authorized administrator of DigitalCommons@UNMC. For more information, please contact [email protected]. Molecular mechanisms of C-terminal Eps15 Homology Domain containing (EHD) protein function By Kriti Bahl A DISSERTATION Presented to the Faculty of The Graduate College in the University of Nebraska In Partial fulfillment of Requirements For the degree of Doctor of Philosophy Department of Biochemistry and Molecular Biology Under the Supervision of Professor Steve Caplan University of Nebraska Medical Center Omaha, Nebraska June, 2017 Supervisory Committee: Richard MacDonald, Ph.D. Justin Mott, M.D., Ph.D. Laurey Steinke, Ph.D. I TITLE Molecular mechanisms of C-terminal Eps15 Homology Domain containing (EHD) protein function BY Kriti Bahl APPROVED DATE Steve Caplan, Ph.D. June 23rd 2017 Richard MacDonald, Ph.D. June 23rd 2017 Justin Mott, M.D., Ph.D. June 23rd 2017 Laurey Steinke, Ph.D. June 23rd 2017 SUPERVISORY COMMITTEE GRADUATE COLLEGE UNIVERSITY OF NEBRASKA II Molecular mechanisms of C-terminal Eps15 Homology Domain containing (EHD) protein function Kriti Bahl, Ph.D. Advisor: Steve Caplan, Ph.D. Endocytic trafficking is not only an essential process for the maintenance of cellular homeostasis but also plays a vital role in regulating diverse cellular processes such as signaling, migration and cell division. The C-terminal Eps 15 Homology Domain proteins (EHD1-4) play pivotal roles in regulating distinct steps of endocytic trafficking. Among the EHDs, EHD2 is disparate both in terms of sequence homology (70%) and its subcellular localization at the caveolae. The crystal structure of EHD2 has been solved and it contains an unstructured loop consisting of two proline-phenylalanine (PF) motifs: KPFRKLNPF. However, the other paralogs EHD1, EHD3 and EHD4 contain a single KPF or RPF motif, but no NPF motif. In this study, we sought to elucidate the precise role of the two PF motifs of EHD2 in homo-dimerization, binding with the protein partners, and subcellular localization. We demonstrated that an EHD2 NPF-to-NAF mutant that mimics the homologous sequences of EHD1 and EHD3, lost its ability to dimerize and bind to Syndapin2. However, it continues to localize primarily to the cytosolic face of the plasma membrane. On the other hand, EHD2 NPF-to-APA mutants maintained their ability to dimerize and bind to Syndapin2, but exhibited markedly increased nuclear localization and decreased association with the plasma membrane. Hence, the EHD2 NPF phenylalanine residue is crucial for EHD2 localization to the plasma membrane, whereas the proline residue is essential for EHD2 dimerization and binding. These studies also support the recently proposed model in which the EHD2 N- terminal region may regulate the availability of the unstructured loop for interactions with neighboring EHD2 dimers, thus promoting oligomerization. We further hypothesized that the single PF motif of EHD1 might be responsible for both binding and localization III functions of EHD1. Indeed, the EHD1 RPF motif was required for dimerization, interaction with MICAL-L1 and Syndapin2, as well as localization on tubular recycling endosomes. Moreover, recycling assays demonstrated that EHD1 RPF-to-APA was incapable of supporting normal receptor recycling. The biogenesis of tubular recycling endosomes (TRE), their role in cargo-sorting and subsequently their vesiculation are essential for receptor recycling. EHD proteins have been implicated in the bending and fission of TRE, thus regulating endocytic recycling. Recent studies from our lab have demonstrated that asparagine-proline-phenyalanine (NPF)-containing binding partners of EHD1 and EHD3, such as molecules interacting with CasL-like1 (MICAL-L1) and Syndapin2, are indispensable for TRE biogenesis. Also vital for TRE biogenesis is the generation of phosphatidic acid (PA), an essential lipid component of TRE that serves as a docking point for MICAL-L1 and Syndapin2. EHD1 and EHD3 have 86% amino acid identity; they homo-and heterodimerize and partially co-localize to TRE. Despite remarkable identity between EHD1 and EHD3, they have disparate mechanistic functions. EHD1 induces membrane vesiculation, whereas EHD3 supports TRE generation and/or stabilization by an unknown mechanism. While using phospholipase D inhibitors (which block the conversion of glycerophospholipids to PA) to deplete cellular TRE, we observed that, upon inhibitor washout, there was a rapid and dramatic regeneration of TRE, as observed by immunostaining with MICAL-L1 antibodies. This “synchronized” TRE biogenesis system has enabled us to determine that EHD3 is involved in the stabilization of TRE rather than in their biogenesis. Moreover, we have identified residues Ala-519/Asp-520 in the EH domain of EHD1 and Asn-519/ Glu-520 in the EH domain of EHD3 as being important for that dictating the preference of these two paralogs for NPF-containing binding partners. Overall, we have delineated a model to explain the atomic basis for understanding the differential roles of EHD3 and EHD1 in stabilization and vesiculation of TRE, respectively. IV Table of Contents Title Page .........................................................................................................................I Abstract ...........................................................................................................................I I Table of Contents .......................................................................................................... IV Table of Figures ............................................................................................................ IX List of Tables ................................................................................................................ XII Abbreviations ............................................................................................................... XIII Acknowledgements ..................................................................................................... XIX CHAPTER I .....................................................................................................................1 Introduction ..................................................................................................................1 1. Endocytic Trafficking .............................................................................................2 1.1 Overview ........................................................................................................2 2. Routes of Internalization ........................................................................................3 2.1 Clathrin-Mediated Endocytosis (CME) ........................................................... 6 2.2 Clathrin-Independent Endocytosis (CIE) ........................................................ 8 2.2.1 Caveolae-mediated pathway ................................................................... 8 2.2.2 Clathrin-Independent Carriers/GPI-AP-enriched early endosomal compartment CLIC/GEEC………………………………………………………….9 2.2.3 Arf6 Associated Pathway ...................................................................... 10 2.2.4 Flotillin Dependent Pathway ................................................................. 11 2.2.5 Other routes .......................................................................................... 11 3. Sorting of Cargo at EE/ SE .................................................................................. 11 3.1 Sorting to the lysosomes for degradation ....................................................... 12 3.2 Sorting for Recycling ...................................................................................... 14 3.2.1 Significance of TREs in Recycling ......................................................... 15 V 3.3 Sorting for TGN .............................................................................................. 16 4. Regulators of Endocytic Trafficking ................................................................... 18 4.1 Regulation by Rab GTPases........................................................................... 19 4.1.1 Rab5 and the early endosome ................................................................ 23 4.1.2 Rab7and the maturation of the late endosome ........................................ 26 4.1.3 Rabs in Fast Recycling ........................................................................... 27 4.1.4 Rab11 and Slow Recycling ..................................................................... 28 4.2 Arf GTPases ...................................................................................................... 29 4.3 SNAREs ...........................................................................................................
Load more

Recommended publications
  • VAMP3 and VAMP8 Regulate the Development and Functionality of 5 Parasitophorous Vacuoles Housing Leishmania Amazonensis
    bioRxiv preprint doi: https://doi.org/10.1101/2020.07.09.195032; this version posted July 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 2 3 4 VAMP3 and VAMP8 regulate the development and functionality of 5 parasitophorous vacuoles housing Leishmania amazonensis 6 7 8 Olivier Séguin1, Linh Thuy Mai1, Sidney W. Whiteheart2, Simona Stäger1, Albert Descoteaux1* 9 10 11 12 1Institut national de la recherche scientifique, Centre Armand-Frappier Santé Biotechnologie, 13 Laval, Québec, Canada 14 15 2Department of Molecular and Cellular Biochemistry, University of Kentucky College of 16 Medicine, Lexington, Kentucky, United States of America 17 18 19 *Corresponding author: 20 E-mail: [email protected] 21 22 23 24 Short title: SNAREs and Leishmania-harboring communal parasitophorous vacuoles 25 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.09.195032; this version posted July 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 26 ABSTRACT 27 28 To colonize mammalian phagocytic cells, the parasite Leishmania remodels phagosomes into 29 parasitophorous vacuoles that can be either tight-fitting individual or communal. The molecular 30 and cellular bases underlying the biogenesis and functionality of these two types of vacuoles are 31 poorly understood.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Fluorescence Lifetime Imaging Microscopy Reveals Rerouting Of
    RESEARCH ARTICLE Fluorescence Lifetime Imaging Microscopy reveals rerouting of SNARE trafficking driving dendritic cell activation Danie¨ lle Rianne Jose´ Verboogen, Natalia Gonza´ lez Mancha, Martin ter Beest, Geert van den Bogaart* Department of Tumor Immunology, Radboud Institute for Molecular Life Sciences, Radboud University Medical Center, Nijmegen, Netherlands Abstract SNARE proteins play a crucial role in intracellular trafficking by catalyzing membrane fusion, but assigning SNAREs to specific intracellular transport routes is challenging with current techniques. We developed a novel Fo¨ rster resonance energy transfer-fluorescence lifetime imaging microscopy (FRET-FLIM)-based technique allowing visualization of real-time local interactions of fluorescently tagged SNARE proteins in live cells. We used FRET-FLIM to delineate the trafficking steps underlying the release of the inflammatory cytokine interleukin-6 (IL-6) from human blood- derived dendritic cells. We found that activation of dendritic cells by bacterial lipopolysaccharide leads to increased FRET of fluorescently labeled syntaxin 4 with VAMP3 specifically at the plasma membrane, indicating increased SNARE complex formation, whereas FRET with other tested SNAREs was unaltered. Our results revealed that SNARE complexing is a key regulatory step for cytokine production by immune cells and prove the applicability of FRET-FLIM for visualizing SNARE complexes in live cells with subcellular spatial resolution. DOI: 10.7554/eLife.23525.001 *For correspondence: geert. [email protected] Introduction Competing interests: The One of the central paradigms in cell biology is that all intracellular membrane fusion, except for authors declare that no mitochondrial fusion, is catalyzed by soluble NSF (N-ethylmaleimide-sensitive fusion protein) attach- competing interests exist. ment protein receptor (SNARE) proteins (Hong, 2005; Jahn and Scheller, 2006).
    [Show full text]
  • Human VAMP3 Suppresses Or Negatively Regulates Bax Induced Apoptosis in Yeast
    biomedicines Article Human VAMP3 Suppresses or Negatively Regulates Bax Induced Apoptosis in Yeast Damilare D. Akintade 1,2,* and Bhabatosh Chaudhuri 2 1 School of Life Sciences, Medical School, University of Nottingham, Nottingham NG7 2UH, UK 2 Leicester School of Pharmacy, De Montfort University, Leicester LE1 9BH, UK; [email protected] * Correspondence: [email protected] Abstract: Apoptosis is an essential process that is regulated genetically and could lead to a serious disease condition if not well controlled. Bax is one of the main proapoptotic proteins and actively involved in programmed cell death. It has been suggested that Bax induced apoptosis in yeast could be obstructed by enhancing vesicular membrane trafficking. Plasma membrane proteins and lipid oxidation were reduced by a vesicle-associated membrane protein (VAMP) when expressed in yeast, suggesting its potential role in repairing membranes. Membrane integrity is crucial, as the loss of membrane integrity will result in the leakage of ions from mitochondria, and ultimately cell death due to overproduction of reactive oxygen species (ROS). Expression of Arabidopsis’ VAMP has been linked to antiapoptosis activity. Since plant VAMP has been associated with antiapoptotic activities, this study investigates the possible participation of human VAMP3 in blocking human Bax mediated apoptosis. Some novel genes were identified to rescue Bax’s proapoptotic effects, in a yeast-based human hippocampal cDNA library screen. VAMP3 (a gene code for proteins involved in protein secretion) gene was chosen for further study to confirm its role in inhibiting apoptosis. VAMP3 was coexpressed with a chromosomally integrated Bax gene expression cassette driven by the GAL1 promoter.
    [Show full text]
  • In Vivo Mapping of a GPCR Interactome Using Knockin Mice
    In vivo mapping of a GPCR interactome using knockin mice Jade Degrandmaisona,b,c,d,e,1, Khaled Abdallahb,c,d,1, Véronique Blaisb,c,d, Samuel Géniera,c,d, Marie-Pier Lalumièrea,c,d, Francis Bergeronb,c,d,e, Catherine M. Cahillf,g,h, Jim Boulterf,g,h, Christine L. Lavoieb,c,d,i, Jean-Luc Parenta,c,d,i,2, and Louis Gendronb,c,d,i,j,k,2 aDépartement de Médecine, Université de Sherbrooke, Sherbrooke, QC J1H 5N4, Canada; bDépartement de Pharmacologie–Physiologie, Université de Sherbrooke, Sherbrooke, QC J1H 5N4, Canada; cFaculté de Médecine et des Sciences de la Santé, Université de Sherbrooke, Sherbrooke, QC J1H 5N4, Canada; dCentre de Recherche du Centre Hospitalier Universitaire de Sherbrooke, Sherbrooke, QC J1H 5N4, Canada; eQuebec Network of Junior Pain Investigators, Sherbrooke, QC J1H 5N4, Canada; fDepartment of Psychiatry and Biobehavioral Sciences, University of California, Los Angeles, CA 90095; gSemel Institute for Neuroscience and Human Behavior, University of California, Los Angeles, CA 90095; hShirley and Stefan Hatos Center for Neuropharmacology, University of California, Los Angeles, CA 90095; iInstitut de Pharmacologie de Sherbrooke, Sherbrooke, QC J1H 5N4, Canada; jDépartement d’Anesthésiologie, Université de Sherbrooke, Sherbrooke, QC J1H 5N4, Canada; and kQuebec Pain Research Network, Sherbrooke, QC J1H 5N4, Canada Edited by Brian K. Kobilka, Stanford University School of Medicine, Stanford, CA, and approved April 9, 2020 (received for review October 16, 2019) With over 30% of current medications targeting this family of attenuates pain hypersensitivities in several chronic pain models proteins, G-protein–coupled receptors (GPCRs) remain invaluable including neuropathic, inflammatory, diabetic, and cancer pain therapeutic targets.
    [Show full text]
  • Identification of a Novel Autophagy-Related Gene Signature
    Identication of a novel autophagy-related gene signature for predicting metastasis and survival in patients with osteosarcoma Guangzhi Zhang Lanzhou University Second Hospital https://orcid.org/0000-0003-3193-0297 Yajun Deng Lanzhou University Second Hospital Zuolong Wu Lanzhou University Second Hospital Enhui Ren Lanzhou University Second Hospital Wenhua Yuan Lanzhou University Second Hospital Qiqi Xie ( [email protected] ) Lanzhou University Second Hospital https://orcid.org/0000-0003-4099-5287 Primary research Keywords: osteosarcoma, autophagy-related genes, signature, survival, metastasis Posted Date: March 26th, 2020 DOI: https://doi.org/10.21203/rs.3.rs-19384/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/20 Abstract Background: Osteosarcoma (OS) is a bone malignant tumor that occurs in children and adolescents. Due to a lack of reliable prognostic biomarkers, the prognosis of OS patients is often uncertain. This study aimed to construct an autophagy-related gene signature to predict the prognosis of OS patients. Methods: The gene expression prole data of OS and normal muscle tissue samples were downloaded separately from the Therapeutically Applied Research To Generate Effective Treatments (TARGET) and Genotype-Tissue Expression (GTEx) databases . The differentially expressed autophagy-related genes (DEARGs) in OS and normal muscle tissue samples were screened using R software, before being subjected to Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis. A protein-protein interaction (PPI) network was constructed and hub autophagy-related genes were screened. Finally, the screened autophagy-related genes were subjected to univariate Cox regression, Lasso Cox regression, survival analysis, and clinical correlation analysis.
    [Show full text]
  • Caveolae and Cancer: a New Mechanical Perspective
    Special Edition 367 Caveolae and Cancer: A New Mechanical Perspective Christophe Lamaze1,2,3, Stéphanie Torrino1,2,3 Caveolae are small invaginations of the plasma membrane in cells. In addition to their classically described functions in cell signaling and membrane trafficking, it was recently shown that caveolae act also as plasma membrane sensors that respond immediately to acute mechanical stresses. Caveolin 1 (Cav1), the main component of caveolae, is a multifunctional scaffolding protein that can remodel the extracellular environment. Caveolae dysfunction, due to mutations in caveolins, has been linked to several human diseases called “caveolinopathies,” including muscular dystrophies, cardiac disease, infection, osteoporosis, and cancer. The role of caveolae and/or Cav1 remains controversial particularly in tumor progression. Cav1 function has been associated with several steps of cancerogenesis such as tumor growth, cell migration, metastasis, and angiogenesis, yet it was observed that Cav1 could affect these steps in a Dr. Christophe Lamaze positive or negative manner. Here, we discuss the possible function of caveolae and Cav1 in tumor progression in the context of their recently discovered role in cell mechanics. (Biomed J 2015;38:367-379) Key words: cancer, caveolae, caveolin, cavin, mechanics aveolae (for “little caves”) are small (50–100 nm) caveolins may control intracellular signaling.[8] Cplasma membrane invaginations discovered by electron The modulation of cell signaling by caveolae and/or Cav1 microscopy in 1953.[1] Caveolin (Cav) and Cavin proteins are could be one of the mechanisms by which caveolae play a the key components of caveolae that are enriched in glyco‑ role in cell transformation and tumor progression.
    [Show full text]
  • Shiga Toxin Stimulates Clathrin-Independent Endocytosis Of
    © 2015. Published by The Company of Biologists Ltd | Journal of Cell Science (2015) 128, 2891-2902 doi:10.1242/jcs.171116 RESEARCH ARTICLE Shiga toxin stimulates clathrin-independent endocytosis of the VAMP2, VAMP3 and VAMP8 SNARE proteins Henri-François Renard1,2,3, Maria Daniela Garcia-Castillo1,2,3, Valérie Chambon1,2,3, Christophe Lamaze2,3,4 and Ludger Johannes1,2,3,* ABSTRACT existence of endocytic processesthat operate independentlyof clathrin Endocytosis is an essential cellular process that is often hijacked by (reviewed in Blouin and Lamaze, 2013; Doherty and McMahon, pathogens and pathogenic products. Endocytic processes can be 2009; Mayor et al., 2014; Sandvig et al., 2011), including the cellular classified into two broad categories, those that are dependent on uptake of the bacterial Shiga toxin (STx) (Renard et al., 2015; Römer clathrin and those that are not. The SNARE proteins VAMP2, VAMP3 et al., 2007). and VAMP8 are internalized in a clathrin-dependent manner. Shiga toxin is composed of two subunits, A and B (Johannes and However, the full scope of their endocytic behavior has not yet Romer, 2010). The catalytic A-subunit modifies ribosomal RNA in been elucidated. Here, we found that VAMP2, VAMP3 and VAMP8 the cytosol of target cells, leading to protein biosynthesis inhibition. are localized on plasma membrane invaginations and very early To reach the cytosol, the A-subunit non-covalently interacts with the uptake structures that are induced by the bacterial Shiga toxin, which homopentameric B-subunit (STxB). STxB binds to the cellular enters cells by clathrin-independent endocytosis. We show that toxin toxin receptor, the glycosphingolipid Gb3, and then shuttles the trafficking into cells and cell intoxication rely on these SNARE holotoxin through the retrograde route from the plasma membrane proteins.
    [Show full text]
  • Sumoylation of EHD3 Modulates Tubulation of the Endocytic Recycling Compartment
    RESEARCH ARTICLE SUMOylation of EHD3 Modulates Tubulation of the Endocytic Recycling Compartment Or Cabasso☯, Olga Pekar☯¤, Mia Horowitz* Department of Cell Research and Immunology, Tel Aviv University, Ramat Aviv, Israel ☯ These authors contributed equally to this work. ¤ Current address: Skirball Institute of Biomolecular Medicine, New York University, New York New York, United States of America * [email protected] Abstract Endocytosis defines the entry of molecules or macromolecules through the plasma mem- brane as well as membrane trafficking in the cell. It depends on a large number of proteins that undergo protein-protein and protein-phospholipid interactions. EH Domain containing (EHDs) proteins formulate a family, whose members participate in different stages of endo- cytosis. Of the four mammalian EHDs (EHD1-EHD4) EHD1 and EHD3 control traffic to the endocytic recycling compartment (ERC) and from the ERC to the plasma membrane, while EHD2 modulates internalization. Recently, we have shown that EHD2 undergoes SUMOylation, which facilitates its exit from the nucleus, where it serves as a co-repressor. OPEN ACCESS In the present study, we tested whether EHD3 undergoes SUMOylation and what is its role Citation: Cabasso O, Pekar O, Horowitz M (2015) in endocytic recycling. We show, both in-vitro and in cell culture, that EHD3 undergoes SUMOylation of EHD3 Modulates Tubulation of the Endocytic Recycling Compartment. PLoS ONE 10(7): SUMOylation. Localization of EHD3 to the tubular structures of the ERC depends on its e0134053. doi:10.1371/journal.pone.0134053 SUMOylation on lysines 315 and 511. Absence of SUMOylation of EHD3 has no effect on Editor: Xiaochen Wang, National Institute of its dimerization, an important factor in membrane localization of EHD3, but has a dominant Biological Sciences, Beijing, CHINA negative effect on its appearance in tubular ERC structures.
    [Show full text]
  • Syntaxin 13 Mediates Cycling of Plasma Membrane Proteins Via Tubulovesicular Recycling Endosomes Rytis Prekeris,* Judith Klumperman,‡ Yu A
    Syntaxin 13 Mediates Cycling of Plasma Membrane Proteins via Tubulovesicular Recycling Endosomes Rytis Prekeris,* Judith Klumperman,‡ Yu A. Chen,* and Richard H. Scheller* *Howard Hughes Medical Institute, Department of Molecular and Cellular Physiology, Stanford University School of Medicine, Stanford, California 94305-5428; and ‡Medical School, University of Utrecht, Institute for Biomembranes, 3584CX Utrecht, The Netherlands Abstract. Endocytosis-mediated recycling of plasma oles, where it is often found in clathrin-coated mem- membrane is a critical vesicle trafficking step important brane areas. Furthermore, anti-syntaxin 13 antibody in- in diverse biological processes. The membrane traffick- hibits transferrin receptor recycling in permeabilized ing decisions and sorting events take place in a series of PC12 cells. Immunoprecipitation of syntaxin 13 re- heterogeneous and highly dynamic organelles, the en- vealed that, in Triton X-100 extracts, syntaxin 13 is dosomes. Syntaxin 13, a recently discovered member of present in a complex(es) comprised of bSNAP, VAMP the syntaxin family, has been suggested to play a role in 2/3, and SNAP-25. This complex(es) binds exogenously mediating endosomal trafficking. To better understand added aSNAP and NSF and dissociates in the presence the function of syntaxin 13 we examined its intracellu- of ATP, but not ATPgS. These results support a role lar distribution in nonpolarized cells. By confocal im- for syntaxin 13 in membrane fusion events during the munofluorescence and electron microscopy, syntaxin recycling of plasma membrane proteins. 13 is primarily found in tubular early and recycling en- dosomes, where it colocalizes with transferrin receptor. Key words: vesicular transport • endosomes • protein Additional labeling is also present in endosomal vacu- recycling • membrane trafficking • syntaxin iological membranes are used to establish func- dermal growth factor (38, 39, 59) become highly concen- tional compartments in eucaryotic organisms.
    [Show full text]
  • Asna1/TRC40 Controls B-Cell Function and Endoplasmic Reticulum Homeostasis by Ensuring Retrograde Transport
    110 Diabetes Volume 65, January 2016 Stefan Norlin,1 Vishal S. Parekh,1 Peter Naredi,2 and Helena Edlund1 Asna1/TRC40 Controls b-Cell Function and Endoplasmic Reticulum Homeostasis by Ensuring Retrograde Transport Diabetes 2016;65:110–119 | DOI: 10.2337/db15-0699 Type 2 diabetes (T2D) is characterized by insulin re- and misfolded proteins accumulate within the ER, and ER sistance and b-cell failure. Insulin resistance per se, stress develops, leading to activation of the unfolded however, does not provoke overt diabetes as long as protein response (UPR). During the development of type 2 compensatory b-cell function is maintained. The in- diabetes (T2D), pancreatic b-cells initially compensate creased demand for insulin stresses the b-cell endo- for insulin resistance successfully by increasing insulin plasmic reticulum (ER) and secretory pathway, and ER biosynthesis and secretion. However, conditions that b stress is associated with -cell failure in T2D. The tail lead to sustained ER stress (i.e., prolonged and persistent recognition complex (TRC) pathway, including Asna1/ insulin resistance and/or failure to reestablish proper ER TRC40, is implicated in the maintenance of endomem- homeostasis) are implicated in the deterioration of b-cell brane trafficking and ER homeostasis. To gain insight function and the development of overt diabetes (1–3). into the role of Asna1/TRC40 in maintaining endomem- Thus, identification of key molecules and factors that en- brane homeostasis and b-cell function, we inactivated b2/2 fi ISLET STUDIES Asna1 b Asna1 sure proper membrane traf cking and ER homeostasis, in -cells of mice. We show that mice b develop hypoinsulinemia, impaired insulin secretion, and thereby -cell function and survival, is important to and glucose intolerance that rapidly progresses to overt gaining insight into the etiology of T2D.
    [Show full text]
  • GSE50161, (C) GSE66354, (D) GSE74195 and (E) GSE86574
    Figure S1. Boxplots of normalized samples in five datasets. (A) GSE25604, (B) GSE50161, (C) GSE66354, (D) GSE74195 and (E) GSE86574. The x‑axes indicate samples, and the y‑axes represent the expression of genes. Figure S2. Volanco plots of DEGs in five datasets. (A) GSE25604, (B) GSE50161, (C) GSE66354, (D) GSE74195 and (E) GSE86574. Red nodes represent upregulated DEGs and green nodes indicate downregulated DEGs. Cut‑off criteria were P<0.05 and |log2 FC|>1. DEGs, differentially expressed genes; FC, fold change; adj.P.Val, adjusted P‑value. Figure S3. Transcription factor‑gene regulatory network constructed using the Cytoscape iRegulion plug‑in. Table SI. Primer sequences for reverse transcription‑quantitative polymerase chain reaction. Genes Sequences hsa‑miR‑124 F: 5'‑ACACTCCAGCTGGGCAGCAGCAATTCATGTTT‑3' R: 5'‑CTCAACTGGTGTCGTGGA‑3' hsa‑miR‑330‑3p F: 5'‑CATGAATTCACTCTCCCCGTTTCTCCCTCTGC‑3' R: 5'‑CCTGCGGCCGCGAGCCGCCCTGTTTGTCTGAG‑3' hsa‑miR‑34a‑5p F: 5'‑TGGCAGTGTCTTAGCTGGTTGT‑3' R: 5'‑GCGAGCACAGAATTAATACGAC‑3' hsa‑miR‑449a F: 5'‑TGCGGTGGCAGTGTATTGTTAGC‑3' R: 5'‑CCAGTGCAGGGTCCGAGGT‑3' CD44 F: 5'‑CGGACACCATGGACAAGTTT‑3' R: 5'‑TGTCAATCCAGTTTCAGCATCA‑3' PCNA F: 5'‑GAACTGGTTCATTCATCTCTATGG‑3' F: 5'‑TGTCACAGACAAGTAATGTCGATAAA‑3' SYT1 F: 5'‑CAATAGCCATAGTCGCAGTCCT‑3' R: 5'‑TGTCAATCCAGTTTCAGCATCA‑3' U6 F: 5'‑GCTTCGGCAGCACATATACTAAAAT‑3' R: 5'‑CGCTTCACGAATTTGCGTGTCAT‑3' GAPDH F: 5'‑GGAAAGCTGTGGCGTGAT‑3' R: 5'‑AAGGTGGAAGAATGGGAGTT‑3' hsa, homo sapiens; miR, microRNA; CD44, CD44 molecule (Indian blood group); PCNA, proliferating cell nuclear antigen;
    [Show full text]