US009 109232B2

(12) United States Patent (10) Patent No.: US 9,109,232 B2 Schwartz et al. (45) Date of Patent: Aug. 18, 2015

(54) ETS2 AND MESP1 GENERATE CARDIAC Islas et al., Transcription factors ETS2 and MESP1 transdifferentiate PROGENITORS FROM FIBROBLASTS human dermal fibroblasts into cardiac progenitors; PNAS, Published online before print Jul. 23, 2012, doi: 10.1073/pnas. 11202991.09, 2012.* (71) Applicants: University of Houston, Houston, TX Melotti et al., Ets-2 and c-Myb Act Independently in Regulating (US); Texas Heart Institute, Houston, Expression of the Hematopoietic StemCell Antigen CD34:JBC, vol. TX (US); The Texas A&M University 269, No. 41, pp. 25303-25309, 1994.* System, College Station, TX (US) Takahashi et al., Induction of pluripotent stem cells from adulthuman fibroblasts by defined factors; Cell, vol. 131, pp. 861-872, 2007.* Naldini et al. In vivo gene delivery and stable transduction of (72) Inventors: Robert J. Schwartz, Houston, TX (US); nondividing cells by a lentiviral vector; Science, vol. 272, pp. 263 Vladimir N. Potaman, Houston, TX 267, 1996.* (US); Jose Francisco Islas, Houston, TX European Patent Office; Office Action; European Application No. (US) 117114082; Jul 22, 2013. European Patent Office; Response to Office Action; European Appli (73) Assignees: University of Houston, Houston, TX cation No. 11711408.2; Aug. 30, 2013. Chinese Patent Office; Office Action; Chinese Patent Application No. (US); Texas Heart Institute, Houston, 2011800 19561.0; Sep. 18, 2013. TX (US); The Texas A&M University Chinese Patent Office; Office Action (English translation); Chinese System, College Station, TX (US) Patent Application No. 2011800 19561.0; Sep. 18, 2013. European Patent Office; International Search Report and Written (*) Notice: Subject to any disclaimer, the term of this Opinion; PCT Application No. PCT/US2011/027160; Jul. 6, 2011. patent is extended or adjusted under 35 Bondue A., et al.; Mesplacts as a Master Regulator of Multipotent Cardiovascular Progenitor Specification; Cell Stem Cell 3, 69-84, U.S.C. 154(b) by 0 days. Jul. 2008. Lindsley, R.C.. etal; Mespl Coordinately Regulates Cardiovascular (21) Appl. No.: 13/915,677 Fate Restriction and Epithelial-Mesenchymal Transition in Differen tiating ESCs: Cell Stem Cell 3, 55-68, Jul. 2008. (22) Filed: Jun. 12, 2013 Lie-Venema, H., et al.; Ets-1 and Ets-2 Transcription Factors are Essential for Normal Coronary and Myocardial Development in (65) Prior Publication Data Chicken Embryos; Circulaton Research, vol.92, No. 7,749-756, Apr. 18, 2003. US 2014/0004604 A1 Jan. 2, 2014 Bergmann, O. etal. Evidence for cardiomyocyte renewal in humans. Science 324: 5923, 98-102, 2009. Beh, J. et al. FoxF is essential for FGF-induced migration of heart progenitor cells in the ascidian Ciona intestinalis. Development 134: Related U.S. Application Data 3297-3305, 2007. (62) Division of application No. 13/040,611, filed on Mar. Davidson, B. Ciona intestinalis as a model for cardiac development. Semin. Cell Dev. Biol. 18:16-26, 2007. il. 4, 2011, now Pat. No. 8,486,701. Yu, J. Induced pluripotent stem cell lines derived from human (60) Provisional application No. 61/339,509, filed on Mar. somatic cells. Science 3 18:1917-1920, 2007. Davidson, B. and Levine, M. Evolutionary origins of the vertebrate 5, 2010. heart: Specification of the cardiac lineage in Ciona intestinalis. Proc. Natl. Acad. Sci. USA 100: 11469-11473. (51) Int. Cl. Imai, K.S., Satoh, N. and Satou, Y. A Twist-like bHLH gene is a CI2N 15/85 (2006.01) downstream factor of an endogenous FGF and determines CI2N 5/077 (2010.01) mesenchymal fate in the ascidian embryos. Development 130:4461 CI2N 5/074 (2010.01) 4472, 2003. Imai, K.S., Hino, K., Yagi, K., Satoh, N. and Satou, Y. Gene expres (52) U.S. Cl. sion profiles of transcription factors and signaling molecules in the CPC ...... CI2N 15/85 (2013.01); C12N5/0657 ascidian embryo: towards a comprehensive understanding of gene (2013.01); C12N5/0696 (2013.01); C12N networks. Development 131: 4047-4058, 2004. 2501/40 (2013.01); C12N 2501/60 (2013.01); Kitajima, S. et al. Mesp1 and Mesp2 are essential for the develop CI2N2506/1307 (2013.01); C12N 2510/00 ment of cardiac mesoderm. Development 127: 3215-3226, 2000. (2013.01) Moretti, A. et al. Multipotent embryonic isl+ progenitor cells lead to (58) Field of Classification Search cardiac, Smooth muscle and endothelial cell diversification. Cell 127: None 1151-1165, 2006. See application file for complete search history. (Continued) (56) References Cited Primary Examiner — Jennifer Dunston Assistant Examiner — Addison D Ault U.S. PATENT DOCUMENTS (74) Attorney, Agent, or Firm — Jackson Walker L.L.P. 2009/0227032 A1 9/2009 Yamanaka et al. (57) ABSTRACT A method for modulating cell differentiation capabilities FOREIGN PATENT DOCUMENTS using heterologous gene expression. Some embodiments of WO 2010017562 A2 2, 2010 the invention relate to a method for inducing a cardiac pro genitor cell by delivering a reprogramming factor to the cell, OTHER PUBLICATIONS wherein the reprogramming factor comprises ETS2 oracom Steinhauser et al., Regeneration of the heart; EMBO Molecular bination of ETS2 and Mesp1. Medicine, vol. 3,701-712, 2011.* 10 Claims, 13 Drawing Sheets US 9,109,232 B2 Page 2

(56) References Cited Chinese Patent Office; Response to Office Action; Chinese Patent Application No. 2011800 195610; Jan. 27, 2014. OTHER PUBLICATIONS European Patent Office; Response to Office Action; European Appli cation No. 11711408.2: Jun. 25, 2014. Park, I.H. et al. Reprogramming of human Somatic cells to Chinese Patent Office; Second Office Action (in Chinese); Chinese pluripotency with defined factors. Nature 451: 141-146, 2008. Patent Application No. 2011800 19561.0; Jun. 3, 2014. Saga, Y. et al. Mespl is expressed in the heart precursor cells and Chinese Patent Office; Second Office Action (in English); Chinese required for the formation of a single heart tube. Development Patent Application No. 2011800 19561.0; Jun. 3, 2014. 126:3437-3447, 1999. Chinese Patent Office; Response to Second Office Action; Chinese Saga, Y. Kitajima, S. and Miyagawa-Tomita, SMespl expression is Patent Application No. 2011800 19561.0; Aug. 15, 2014. the earliest sign of cardiovascular development. Trends Cardiovasc Chinese Patent Office; Third Office Action (in Chinese); Chinese Med. 10:345-352, 2000. Patent Application No. 2011800 19561.0; Dec. 8, 2014. Takahashi, K. et al. Induction of pluripotent stem cells from adult Chinese Patent Office; Third Office Action (in English); Chinese human fibroblasts by defined factors. Cell 131:861-872, 2007. Patent Application No. 2011800 19561.0; Dec. 8, 2014. European Patent Office; Written Opinion, PCT Application No. PCT/ Chinese Patent Office; Response to Third Office Action; Chinese US2011/027160; Feb. 7, 2012. Patent Application No. 2011800 19561.0; Feb. 11, 2015. European Patent Office; Office Action; European Application No. 11711408.2: Mar. 28, 2014. * cited by examiner U.S. Patent Aug. 18, 2015 Sheet 1 of 13 US 9,109,232 B2

CN V

aL . U.S. Patent Aug. 18, 2015 Sheet 2 of 13 US 9,109,232 B2

U.S. Patent Aug. 18, 2015 Sheet 3 of 13 US 9,109,232 B2

i

s

Y A. (f) ad s H O U.S. Patent Aug. 18, 2015 Sheet 4 of 13 US 9,109,232 B2

t IX L Xe 2 XOS % O SoueN pdeo

NA W

Od-O

398HWN SOONW/N U.S. Patent Aug. 18, 2015 Sheet 5 of 13 US 9,109,232 B2

9090n-longº-e-vass %,zº

OzT 0

„01golz01t01001

0 08 09 Oty

001 09 U.S. Patent Aug. 18, 2015 Sheet 6 of 13 US 9,109,232 B2

|0 09.T. 0

8

OZ

08 09 U.S. Patent Aug. 18, 2015 Sheet 7 of 13 US 9,109,232 B2

U.S. Patent Aug. 18, 2015 Sheet 8 of 13 US 9,109,232 B2

W/3TdS3WZSLEA

itviv? G“ZXXIN ITSI 0:2-HEUN SX81 £OHWN ZOTW St7XO ZSIB TdS3W U.S. Patent Aug. 18, 2015 Sheet 9 of 13 US 9,109,232 B2

£OHWN ZOTIVN U.S. Patent Aug. 18, 2015 Sheet 10 of 13 US 9,109,232 B2

U.S. Patent Aug. 18, 2015 Sheet 11 of 13 US 9,109,232 B2

XIT00800900t?00Z

8Post

XIT00800900?700Z

OZI 06 09 08 U.S. Patent Aug. 18, 2015 Sheet 12 of 13 US 9,109,232 B2

V U.S. Patent Aug. 18, 2015 Sheet 13 of 13 US 9,109,232 B2

zgi requinulº,seosvoºzoszowoezo

3. anuu red Saeeg US 9,109,232 B2 1. 2 ETS2 AND MESP1. GENERATE CARDAC ited number of transcriptional factors important for maintain PROGENITORS FROM FIBROBLASTS ing self renewal and pluripotency has been reported by Yamanaka's, Thomson's and Daley's groups (Takahashi et This application claims priority to U.S. Provisional Patent al., 2007;Yu et al., 2007: Parket al., 2008). One aspect of the Application Ser. No. 61/339,509, filed on Mar. 5, 2010, 5 present invention provides a means of reprogramming the entitled ETS2 AND MESP1. GENERATE CARDIAC PRO Somatic cells and directed differentiation into cardiac pro GENITORS FROM FIBROBLASTS, the entire content of genitor cells. Therefore, one embodiment of this application which is hereby incorporated by reference. provides a way to test a unique regulatory paradigm that ETS2 and Mesp1 are transformative, and unlike NKX2.5 and FIELD OF THE INVENTION 10 ISL1, convert non-embryonic normal human dermal fibro blasts (NHDFs) into primary cardiac progenitors. Another One aspect of the present invention relates generally to the aspect of the present application was to elucidate the role of field of cell differentiation, and more specifically to a strategy Mesp1 in the regulatory hierarchy directing the appearance of for cardiovascular tissue regeneration via the isolation, cardiac progenitors. renewal, and directed differentiation, of fibroblasts into spe 15 cific mature cardiac, pacemaker, Smooth muscle, and endot SUMMARY helial cell types. One embodiment of the present invention relates to the BACKGROUND modulation of cell differentiation capabilities using heterolo gous gene expression. Some embodiments of the invention Damage to mammalian heart tissue frequently results in relate to a method for inducing a cardiac progenitor cell by the loss of large numbers of cardiac cells, including mature delivering a reprogramming factor to the cell, wherein the cardiac cells, pacemaker cells, Smooth muscle, and endothe reprogramming factor comprises ETS2 or a combination of lial cells. Although there is some indication that cardiac cells ETS2 and Mesp1. can be regenerated in humans (Bergmann et al., 2009), the 25 A further embodiment of the present invention provides a mechanism is not well understood and the process does not cardiac progenitor cell which has been induced by repro appear to proceed rapidly enough to repair common types of gramming a Somatic cell, wherein reprogramming comprises cardiac damage such as ischemia, infarction, trauma, or delivery of a reprogramming factor comprising the ETS2 injury due to toxins or viral infections. Therefore, a central gene to the Somatic cell. The Somatic cell may be a normal goal of experimental cardiac medicine has been the develop 30 human dermal fibroblast (NHDF), and the reprogramming ment of a means for regenerating cardiac cells which have factor may be ETS2 or Mesp1, or a combination thereof. been lost due to cardiac damage. Studies of the mechanisms Still a further embodiment of the present invention pro behind the embryonic cardiogenesis have been conducted, vides a method of reprogramming a somatic cell to produce a with the aim of replicating cardiogenesis in vitro or in vivo for cardiac progenitor cell, wherein reprogramming comprises the purposes of regenerating damaged tissue. 35 delivery of a reprogramming factor comprising the ETS2 Recent research has identified multipotent (Isl1+) cardio gene to the somatic cell. The somatic cell may be an NHDF, vascular progenitor (MICP) cells, which are capable of dif and the reprogramming factor may be ETS2 or Mesp1, or a ferentiating to form mature cardiac tissue. MICP cells derived combination thereof. from embryonic stem (ES) cells which can give rise to endot helial, cardiac, and Smooth muscle cells, have been isolated 40 BRIEF DESCRIPTION OF THE DRAWINGS (Moretti et al., 2006). Genetic studies have shown that these MICP cells express Isl1, Nkx2.5 and Flk1. The following drawings form part of the present specifica Model systems for investigating cardiogenesis include the tion and are included to further demonstrate certain aspects of ascidian Ciona intestinalis (Behet al., 2007). Lineage studies the present invention. The invention may be better understood have shown that the adult Ciona heart is derived from two 45 by reference to one or more of these drawings in combination founder cells that express Ci-Mesp, a basic helix-loop-helix with the detailed description of specific embodiments pre (bHLH) transcription factor, and also Ci-Ets1/2 (Imai et al., sented herein. 2004; Satou et al., 2004). In addition, ascidian orthologs of FIG. 1 shows a schematic map of lentivirus with the inser the conserved heart specification genes NK4 (tinman tion of ETS2 and ELK4 full length DNA coding sequences. NkX2.5), GATAa (pannier/GATA475/6), Hand and Hand-like 50 Functional elements and abbreviations: constitutive Ef-1 al (Imai ct al., 2003; Davidson, 2007: Davidson and Levine, pha promoter, multiple cloning sites (MCS), independent 2003; Satou et al., 2004) are expressed. Ci-Mesp-knockdown ribosome entry site (IRES) from human polio virus, coding embryos did not develop heart primordia, and target inhibi sequence for enhanced green fluorescence protein (eGFP), tion of Ets1/2 activity also blocked heart specification and the Woodchuck Hepatitis Virus Posttranscriptional Regulatory expansion of the heart field. Similarly, murine homologues of 55 Element (WPRE), activation domain (AD), DNA-binding Ci-Mesp, Mesp1 and Mesp2 are expressed in the early meso ETS domain. These plasmids were generated by standard derm fated to become cranio-cardiac mesoderm (Saga et al., recombinant DNA cloning techniques and then used to make 2000). Only the Mesp1/Mesp2 double-knockout mouse lentiviruses to infect normal human dermal fibroblasts lacked any cardiac mesoderm (Saga et al., 1999; Kitajima et (NHDFs): al., 2000), indicating a role for these genes in directing the 60 FIG. 2 shows (top panel) NHDFs treated with empty len appearance of cardiac progenitors in higher vertebrates. tivirus (pWPI-GFP), pWPI-ELK4-GFP lentivirus, or pWPI Redundancies of Mesp genes have made further study in ETS2-GFPlentivirus, and (bottom panel) expression levels of embryos a daunting task. GAPDH, NANOG, OCT3/4, SOX2 in cells infected with What is needed in the art is a method of inducing cardio empty virus, virus carrying ETS2, virus carrying ELK4, or genesis for the purpose of regenerating cardiac cells for the 65 uninfected NHDF passage 3 (NHDF-P3); use in the treatment of damaged cardiac tissue. Reprogram FIG.3 shows immunofluorescence staining with antibody ming of human Somatic cells into pluripotent cells by a lim to a stem cell marker NANOG in NHDF-P3 cells infected US 9,109,232 B2 3 4 with lentivirus carrying ETS2, but not ELK4 or empty vector then multiplied by 3, resulting in beats per one minute. Three (top panel). A protein blot using anti-ETS2 antibody revealed separate measurements were done per aggregate in a tissue expression of ETS2 in NHDFs infected with lentivirus carry culture dish or well. ing ETS2 for 4 weeks, while NHDFs infected with empty lentivirus showed no expression (bottom left panel). Immu 5 DETAILED DESCRIPTION OF PREFERRED nofluorescence staining with anti-ETS2 antibody confirmed EMBODIMENTS the induced expression in the cells infected with ETS2 len tivirus (bottom right panel); One embodiment of the present invention relates to the FIG. 4 shows induction of stem cell markers NANOG, modulation of cell differentiation using heterologous gene OCT3/4, SOX2, REX1 and c-MYC in stem cell-like colonies 10 expression. Some embodiments of the invention relate to a after 4 weeks in culture. The fluorescent colors (colors not method for inducing a cardiac progenitor cell by delivering a shown in the figures) are as follows: DAPI (blue), GFP reprogramming factor to the cell, wherein the reprogramming (green), NANOG and OCT3/4 (red), a mixture of all three factor comprises ETS2 or a combination of ETS2 and Mesp1. colors is observed in the “merge’ panels. Color fluorescent An embodiment of the present invention provides a method images are available upon request; 15 FIG. 5 shows flow cytometry demonstrating the percent of for inducing a cardiac progenitor cell by reprogramming a 119 human embryonic stem cells (A), uninfected NHDFs (B), Somatic cell, wherein reprogramming comprises delivery of a or ETS2-infected cells (C) that stained for the stem cell sur reprogramming factor comprising a single heterologous gene face marker SSEA-3. Negative controls, black lines; SSEA-3 to the somatic cell. The somatic cell may be a fibroblast, staining, gray lines: preferably a normal human dermal fibroblast. The heterolo FIG. 6 shows flow cytometry demonstrating the percent of gous gene may be ETS2. The heterologous gene may com H9 human embryonic stem cells (A), uninfected NHDFs (B), prise the human ETS2 coding sequence (SEQID NO:9) or the or ETS2-infected cells (C) that stained for the stem cell sur ETS2 gene (SEQ ID NO:7), or the heterologous gene may face marker Tra-1-81. Negative controls, black lines; Tra-1- encode the human ETS2 protein sequence (SEQ ID NO:8). 81 staining, gray lines; 25 The induced stem-like cell may exhibit cardiogenesis or other FIG. 7 shows images of EPS cells after infection with characteristics of cardiac progenitor cells as a result of pro Mesp1 lentivirus. Cells were stained with DAPI to visualize gramming, including the expression of cardiac progenitor nuclei (left panels) and with specific antibodies to ISL1, factors such as NKX2.5, ISL1, MEF2C, dHAND and NKX2.5, GATA4, MEF2C, TNT and MHC3 to visualize GATA4, or rhythmic beating. indicated cardiac progenitor proteins (right panels). Panels in 30 Another embodiment of the present invention provides a the middle show phase contrast images of cells. The fluores method for inducing a cardiac progenitor cell by reprogram cent colors areas follows: DAPI (blue), protein-specific stain ming a somatic cell, wherein reprogramming comprises ing (red). Color fluorescent images are available upon delivery of a reprogramming factor comprising two heterolo request; gous genes to the Somatic cell. The Somatic cell may be a FIG. 8 shows that expression of NKX2.5, ISL1, GATA4, 35 MEF2C, TBX5, MHC3, TNT, MLC2, CX43 and CX45, fibroblast, preferably a normal human dermal fibroblast. The detected using RT-PCR, was only induced by the combina heterologous genes may be ETS2 and Mesp1. The heterolo tion of ETS2 and Mesp1. Neither ETS2 or Mesp1 alone are gous genes may comprise the human ETS2 coding sequence capable of inducing these cardiogenic genes in NHDFs; (SEQ ID NO:9), the ETS2 gene (SEQ ID NO:7), or a DNA FIG. 9 shows induction of sequential de novo cardiac pro 40 sequence encoding the human ETS2 protein sequence (SEQ genitor program. NHDFs were infected with ETS2 lentivirus, ID NO:8) and the mouse Mesp1 coding sequence (SEQ ID grown for 4 weeks, infected with Mesp1 lentivirus and cul NO:6), the mouse Mesp1 gene (SEQ ID NO:4), or a DNA tured for 7 days, then aggregated by the hang-drop procedure sequence encoding the mouse Mesp1 protein sequence (SEQ and plated on a gelatin-coated dish; ID NO:5). The induced stem-like cell may exhibit cardiogen FIG. 10 shows activation of cardiac progenitor program 45 esis or other characteristics of cardiac progenitor cells as a gene expression, measured by fluorescence of the reporter result of programming, including the expression of cardiac protein Red-Tomato which is expressed only when the car progenitor factors such as NKX2.5, ISL1, MEF2C, dHAND diac progenitor factor NKX2.5 is expressed. The fluorescent and GATA4, or rhythmic beating. colors (colors not shown in the figures) areas follows: GFP Yet another embodiment of the present invention, repro (green), Red (red), a mixture of the two colors is observed in 50 gramming of a Somatic cell, may be accomplished by deliv the “merge’ panel; ering a reprogramming factor to the Somatic cell using a FIG. 11 shows flow cytometry of cardiac progenitor cells recombinant vector. The reprogramming factor may also be obtained from NHDFs by infection with ETS2 and Mesp1 delivered using a lentiviral transduction system to express the lentivectors and sorted for either GFP or GFP and reporter reprogramming factor in the Somatic cell. In these embodi protein Red-Tomato; 55 ments, the reprogramming factor may be ETS2 and Mesp1. FIG. 12 shows display of endothelial and cardiac cell sur A further embodiment of the present invention provides a face markers CD31, CD34 and CD144 in cardiac progenitor Somatic cell which has been reprogrammed, wherein repro cells after 9 days in culture; and gramming comprises delivery of a reprogramming factor FIG. 13 shows the data on rhythmic beating in repro comprising a single heterologous gene or multiple heterolo grammed cardiac progenitor cells. EPS cells were infected 60 gous genes to the Somatic cell. The Somatic cell may be a with Mesp1 lentivirus, as well as with virus carrying a myosin fibroblast, preferably a normal human dermal fibroblast. The heavy chain promoter driving the puromycin resistance gene. heterologous genes may be ETS2 or the multiple heterolo To select cardiac progenitor cells resistant to antibiotic, cells gous genes may be ETS2 and Mesp1. The induced stem-like were treated with 50 ug/ml puromycin. After 9 days, rhythmic cell may exhibit cardiogenesis or or other characteristics of beating in the cell cultures was observed and captured by 65 cardiac progenitor cells as a result of programming, including video microscopy and converted into MPEG videos. Beats the expression of cardiac progenitor factors such as NKX2.5, per cultured aggregate per dish were counted for 20 sec and ISL1, MEF2C, dHAND and GATA4, or rhythmic beating. US 9,109,232 B2 5 6 EXAMPLE1 vector psPAX2 and 1.9 ug of envelope vector pMD2.G for 25 min at room temperature. Afterwards the mix was added to Selection of a Reprogramming Factor 293FT cells grown in DMEM, phenol red-free (Invitrogen) supplemented with 10% FBS (heat-inactivated), 0.1 mM 5 MEM non-essential amino acids, 1 mM sodium pyruvate and It was noted that the ETS domain (FIG. 1), a highly con 6 mM L-glutamate. After 24-26 hrs in culture, medium with served DNA-binding domain, is capable of binding to a viral particles was collected for 3 days and used for infection. 5'-GGA(A/T)-3' DNA core motif found on the promoters of Collected medium was used to infect NHDFs grown in many stem cell marker genes. The expression of ETS2 is Fibroblast Basal Medium (FBM, Lonza) until 80% conflu linked to immortalization of cells, mediation of oncogenesis, ency. Before transfection, cells were reseeded in 6-cm Petri and enhancement of telomerase activity. 10 dishes at a density of 2.5x10° cell/dish, the medium was ETS2 and ELK4, an ETS family gene homologous to ETS2 changed to StemPro and the viral paricles and polybrene (8 in its DNA-binding region, were transduced using lentiviral ug/ml final concentration) were added. To increase the effi vectors into NHDF-P3. Within one week, fibroblasts trans ciency of infection, the procedure was repeated within 48 duced with lentiviral vectors containing ETS2 were replaced hours. All cells were grown at 37° C. and 5% CO. with highly proliferative small rounded cells. These highly 15 proliferative cells were not observed in controls transduced EXAMPLE 3 with empty lentivirus, or in the fibroblasts transduced with lentiviral vectors containing ELK4 (FIG. 2-3). Gene Expression in Reprogrammed Cells EXAMPLE 2 FIG. 2 shows that ETS2 lentivirus but not ELK4 lentivirus induced stem cell appearance and the induction of stem cell Lentiviral Transduction System marker proteins, NANOG, OCT3/4 and SOX2 within 7 days of culture. The top panel of FIG. 2 shows NHDFs (Lonza, FIG. 1 shows a schematic map of lentivirus with the inser USA, cc-2509) grown under FBM, supplemented (supple tion of ETS2 (SEQIDNO:9) and ELK4 (SEQIDNO:3) DNA 25 ments provided by Lonza) with hFGF-beta, insulin, gentamy coding sequences. Note that only ETS2 has a pointed domain. cin/amphotericin and 2% FBS, to a confluence of ca. 80% These plasmids were used to make lentiviruses to infect before viral infection. Empty pWPI-cGFP and pWI-ELK4 NHDFs. The ETS2 full-length sequence (SEQ ID NO:7) eGFP and pWPI-ETS2-eGFP lentiviruses were used to sepa comprises an ETS2 coding sequence (SEQID NO:9) encod rately infect NHDF-P3. Infected and non-infected NHDF-P3 ing an ETS2 protein sequence (SEQ ID NO:8). The ELK4 30 cells were grown under human induced pluripotent medium full-length sequence (SEQ ID NO: 1) comprises an ELK4 StemPro hESSFM (Invitrogen) over collagen-coated Petri coding sequence (SEQ ID NO:3) encoding a protein dishes for 7 days. The green fluorescent protein cloned into sequence (SEQID NO:2). the lentiviral vectors was expressed in the infected cells, as The empty lentivirus vector pWPI-eGFP was a gift from revealed by the green fluorescence microscopy. During this Dr. D. Trono (Ecole Polytechnique Fédérale de Lausanne, 35 culture period, morphological changes were observed in Switzerland). cDNA for cloning the human ETS2 and ELK4 which ETS2-infected NHDFs changed their appearance from genes (Clone IDs 3852274 and 4364006) were obtained from elongated pleomorphic fibroblastic shapes to rounded “stem Open Biosystems, whereas the Mesp1 cDNA was a gift from like cells”. In comparison, NHDFs infected with an empty or Dr. Y. Saga (National Institute of Genetics, Mishima, Japan). ELK4 lentiviral vectors did not alter cell shape. The consensus Kozak sequence for initiation of protein trans 40 The bottom panel of FIG.2 shows the reverse transcription lation and the epitope HA-tag were added respectively to the PCR (RT-PCR) analysis of reprogrammed cells. Cells were 5'- and 3'-ends of ETS2, ELK4 and Mesp1 coding sequences washed in chilled PBS and RNA was isolated with Qiagen by PCR cloning. RNeasy Kit. RNA was transcribed using MMLV reverse tran Lentivirus packing and infection proceeded as follows: scriptase (Invitrogen), and PCR amplification (30 cycles) was Seeded 293FT cells in 6-cm dishes were transfected with 45 performed for GAPDH, NANOG, OCT3/4, SOX2 (refer to either pWPI-eGFP, or pWPI-ELK4-eGFP (human ELK4 Table 1 for primer sets) using LA16 polymerase mix. This coding sequence, SEQID NO:3), or pWPI-ETS2-eGFP (hu enzyme mix was prepared using 15ul of KlenTaq1 (25 units/ man ETS2 coding sequence, SEQ ID NO:9), or pWPI ul, Ab Peptides, St Louis, Mo.) and 1 ul Pfu (2.5 units/ul, Mesp1-eGFP (mouse Mesp1 sequence, SEQ ID NO:6), or Stratagene, La Jolla, Calif.). Amplified DNA samples were SMPU-alphaMHC/puro-Rex 1/Blast (gift from Dr. M. Mer 50 then electrophoresed on 2% agarose gel and ethidium bro cola, Burnham Institute for Medical Research, La Jolla, mide staining revealed the induced expression of stem cell Calif.). 4.5 ug of either construct was mixed in a solution of marker genes NANOG, OCT3/4 and SOX2 in ETS2-infected 458 ul of serum-free Dulbecco-modified Eagle medium cells but not in NHDF-P3 or cells infected with either ELK4 (DMEM) and 27.5ul of Fugene (Roche), 2.8 ug of packing or empty lentiviruses. TABLE 1. Primers for Cardiac Progenitor Study

Product Primer SEQ ID NO Seq size

GapdhFP crtl exp 11 TGTTGCCATCAATGACCCCTT 2O2 GapdhRP ctrl exp 12 CTCCACGACGTACTCAGCG

hNanogFP ctrl exp 13 CAGAAGGCCTCAGCACCTAC 225 hNanogRP ctrl exp 14 TATAGAAGGGACTGTTCCAGGC

US 9,109,232 B2 9 10 TABLE 1 - continued Primers for Cardiac Procenitor Study Product - Primer SEQ ID NO Seq size hCGTAT2 F 65 GGCCCACTCTCTGTGTACC 243 hCGATA2 R 66 CATCTTCATGCTCTCCGTCAG

TBX3-1 F 67 GTGTCTCGGGCCTGGATTC 164 TBX3-1, R 68 ACGTGTAGGGGTAAGGGAACA

TBX3-2 F 69 TTAAAGTGAGATGTTCTGGGCTG 298 TBX3-2 R 70 ACTATAATTCCCCTGCCACGTA

TBX4 F 71. TGACCATCGCTACAAGTTCTGT 163 TBX4 R 72 GGTGGTTGTTTGTCAGCTTCAG

TBX6 F 73 ACACCCCTAAACTGGATTGCT 229 TBX6 R 74 CCTCCCAGCTTTGGTGATGAT

TBX1 O F 7s CCTCGGCATACTTGCACCC 2O8 TBX1 O R 76 ATTCCTCCCACAGAGGCTTCA

TBX18 F 77 GCCCCTGCTGACTATTCTGC 227 TBX18 R 78 CTGCATGGATAAGCTGGTCTG

TBX19 F 79 AAGAATGGCAGACGGATGTTT 2O4. TBX19 R 8O CCGGGTGAATGTAGACGCAG

RUNX2 F 81 CGGCAAAATGAGCGACGTG 268 Runx2 R 82 CACCGAGCACAGGAAGTTG

LMO2 F 83 GGCCATCGAAAGGAAGAGCC 221 LMO2 R 84 GGCCCAGTTTGTAGTAGAGGC

TAU F 85 CCCCTGGAGTTCACGTTTCAC 24 O TAU R 86 GCGAGCTTTGAGTTGAGGGA

EXAMPLE 4 35 EXAMPLE 5

Characteristics of Cells Transduced with ETS2 StemCell Marker Proteins in Reprogrammed Cells FIG.5 shows that approximately 97% of H9 human embry FIG. 3 shows immunofluorescence staining of infected 40 onic stem cells stained for the stem cell Surface marker NHDF-P3 with antibody to the stem cell marker NANOG. SSEA-3 (Panel A). Over 60% of ETS2-infected cells also Induced NANOG staining is revealed in ETS2-infected cells displayed surface marker SSEA-3 (Panel C), in comparison but not in ELK4- or empty vector-infected cells. Also, a to less than 2% staining of the NHDFs infected with empty protein blot using ETS2-specificantibody revealed its expres lentivirus (Panel B). Thus, ETS2 efficiently converted Sion in cells infected with ETS2 lentivirus but not in NHDFs 45 NHDFs into cells with the SSEA-3 surface marker resem infected with empty lentivirus. bling human embryonic stem cells. FIG. 4 shows ETS2 lentivirus-induced stem cell-like colo Flow cytometry was done using a BD Biosciences LSR II nies and the induction of stem cell marker proteins NANOG, analyzer. Confluent colony-forming cells were dissociated by OCT3/4, SOX2, REX1 and c-MYC after 4 weeks in culture. trypsin, washed with PBS and diluted to a concentration of 50 5x10° cells/ml PBS in 8 samples (100 ul each). Thereafter 10 The top left panel shows that NHDFs infected with ETS2 ul of normal human serum was used for blocking for 5 min. virus converted to colonies of small rounded cells highly Antibodies to SSEA-3-PE (Becton Dickinson) were diluted reminiscent of cultured murine and human embryonic stem and added according to manufacturer's specifications, and cells. Note that colonies were GFP-labeled through the infec incubated for 1 hr at 4°C. Then 400 ul PBS was added and the tion with ETS2 lentivirus. Non-infected fibroblasts failed to 55 mixture was spun down and half of the Supernatant was round and did not stain for GFP or form cellular colonies. removed and 200 ul PBS was added and assayed by flow The right top panel of FIG. 4 shows the expression of stem cytometry. cell marker genes NANOG, OCT3/4, SOX2, REX1, KLF4 FIG. 6 shows flow cytometry of cells stained for the stem and c-MYC in ETS2-induced cellular colonies analyzed by cell surface marker Tra-1-81 performed as for SSEA-3. RT-PCR. Underneath is graphic representation of quantita 60 Approximately 45% of H9 human embryonic stem cells stained for Tra-1-81 (Panel A). No Tra-1-81 staining (Panel tive RT-PCR for NANOG, OCT3/4, SOX2 and c-MYC in B) was detected for NHDFs infected with empty lentivirus ETS2-infected cells. (not carrying a heterologous gene). Infection with ETS2 virus The lower panels of FIG. 4 confirm the presence of gave rise to approximately 39% cells displaying embryonic NANOG and OCT3/4 proteins in ETS2-induced cellular 65 stem cell marker Tra-1-81 (Panel C). This indicates that ETS2 colonies by immunofluorescence staining with specific anti efficiently converted NHDFs into cells with the Tra-1-81 bodies. Surface marker resembling human embryonic stem cells. US 9,109,232 B2 11 12 OCT3/4, NANOG and SOX2 gene transcripts were rus, grown for 4 weeks, then infected with Mesp1 lentivirus, observed only after NHDF-P3 were transduced with lentiviral aggregated and plated for 7 days. RNA was isolated daily and vector containing ETS2 but not after transduction with empty analyzed by RT-PCR for expression of cardiogenic genes. lentivector or vector containing ELK4. OCT3/4, NANOG FIG. 10 shows that the MesP1 infection of EPS cells and SOX2 transcripts were visualized (FIG. 2) and NANOG induced de novo cardiac program gene expression as shown induction was visualized using immunofluorescence (FIG. by the appearance of Red Tomato fluorescence staining from 3). the reporter construct NKX2.5-Rcd Tomato. NKX2.5/Smad/ Lentiviral transduction of HNDF-P3 cells with ETS2 GATA enhancer, which is activated in cardiac progenitors, resulted in whole populations which showed robust ETS2 was linked to the minimal HSP68 promoter adjacent to the expression over 4 weeks visualized by protein blots (FIG.3). 10 puromycin resistance gene and an IRES sequence and the These ETS2-transduced cells formed large green fluorescent powerful reporter td-Tomato (cDNA was a gift from Dr. R. colonies similar to those of pluripotent ES and/or induced Tsien, University of California, San Diego). As shown above, pluripotent stem (iPS) cells. GFP staining resulted from ETS2 and Mesp1 lentivirus infec Reprogramming of fibroblasts with ETS2 resulted in tion of NHDFs. The Red Tomato fluorescence is consistent strong expression of the pluripotent marker genes NANOG, 15 with the ETS2/Mesp1 driven conversion to cardiac progeni OCT3/4, SOX2 and c-MYC measured by both RT-PCR and tors by the induction of NKX2.5 gene expression. Note the quantitative PCR and immunostaining. Additionally, flow appearance of many triangular and rectangular appearing cytometry shows that ETS2 efficiently converted NHDFs into cells that are highly similar in shape to cardiac myocytes. cells with surface markers SSEA-3 and Tra-1-81 resembling FIG. 11, Panel A shows a summary of FACS sorting of human embryonic stem cells. Thus, these ETS2-treated cardiac progenitor cells obtained from sequential treatment of human fibroblast cells resemble iPS cells in their ability to NHDFS with ETS2 lentivirus and then of the resultant EPS express pluripotent stem cell marker proteins. These cells cells with Mesp1 lentivirus. Flow cytometry was done using were therefore named “EPS cells. a BD Biosciences LSR II analyzer. Confluent colony-forming cells were dissociated by trypsin, washed with PBS and EXAMPLE 6 25 diluted to a concentration of 5x10° cells/ml PBS in 8 samples. Panel A shows GFP stained cells accounting for the total Combination of ETS2 and Mesp1 Induces De Novo lentivirus infection, since each virus is GFP-tagged. Panel B Cardiac Progenitor Program in Fibroblasts shows that approximately 19% of the ETS2 and Mesp1 infected cells were both stained by GFP and Red-Tomato Next, EPS cells were subjected to lentiviral transduction 30 (shaded area). As evidenced by activation of a key cardio with mouse Mesp1. The resulting EPS cells expressing genic reporter NKX2.5 Red-Tomato, ETS2 and Mesp1 effi Mespl could be induced to form embryoid bodies using pro ciently convert NHDFs into cells with characteristics resem tocols for forming embryoid bodies from ES cells. Plated bling cardiac progenitors. cellular aggregates were further treated with activin and FIG. 12 shows that approximately 10 to 40% of ETS2 and BMP4 for 4 days and then examined at 10 days. Constitutive 35 Mesp1 infected NHDF cells display endothelial and cardiac expression of stem cell markers continued even after the cell surface markers, CD31, CD34 and CD144 after 9 days in transduction with Mesp1 and addition of growth factor mor culture. This is an additional line of evidence that ETS2 and phogens. Mesp1 efficiently converted NHDFs into cells with charac Robust induction of the cardiac progenitor factors ISL1, teristics resembling embryonic endothelial and cardiac myo NKX2.5, GATA4, MEF2C, TNT and MHC was observed by 40 cytes. immunostaining only in the EPS cells infected with lentivirus expressing Mesp1. FIG. 7 shows cells stained with DAPI to EXAMPLE 7 visualize nuclei (left panels), phase contrast images (middle) and cells stained with specific antibodies to visualize indi Cardiac Properties of Reprogrammed Cells cated proteins (right panels). 45 FIG. 8 shows that the MesP1 infection of EPS cells induces Lentiviral transduction of a puromycin selectable system de novo cardiac progenitor program in cell that were origi using a lentiviral cardiac-specific alpha-myosin heavy chain nally NHDFS. Cardiac progenitor cells post-aggregation (alpha-MHC) promoter and enhancer linked to the puromy were plated for a week and then taken for RNA isolation. cin resistance gene resulted in enrichment of the cardiac RNA was transcribed using MMLV reverse transcriptase, and 50 progenitor cells and Subsequent observation of a rhythmic PCR amplification for 30 cycles was performed for GAPDH, beating of the transduced cells, similar to that observed in NKX2.5, ISL1, GATA4, MEF2C, TBX5, MHC3, TNT, cardiac myocytes. MLC2, CX43 and CX45 (refer to Table 1 for primer sets), A myosin heavy chain prometer driving the puromycin using LA-16 polymerase mix. selectable gene construct was transduced into NHDFs which FIG. 8 shows that in EPS cells grown for 4 weeks, aggre 55 were then sequentially transduced with ETS2 and Mesp1. gated and plated for 7 days, no transcripts were observed for Cellular aggregates obtained during hang-drop embryoid markers of early heart development by RT-PCR. Similarly, no body formation were then treated with 50ug/ml puromycinto appreciable expression of the early heart development mark select cells resistant to puromycin and therefore having the ers was detected after infection of NHDFs with Mesp1 alone. active cardiac specific alpha-MHC promoter. However, Mesp1 addition to EPS cells induced robust expres 60 After 9 days beating in the cell cultures was observed and sion of cardiac mesoderm progenitor markers including captured using video microscopy and converted into MPEG NKX2.5, ISL1, GATA4, MEF2C, TBX5, and cardiac con Videos. Beating per cultured aggregate per dish was counted tractile protein gene expression including alpha MHC and for 20 sec and then multiplied by 3 for heats per one minute troponin T. (FIG. 13). Three separate measurements were done per aggre FIG.9 shows that the MesP1 infection of EPS cells induced 65 gate in a tissue culture dish or well. sequential de novo cardiac progenitor program as determined Reprogramming of EPS cells with Mesp1 resulted in by RT-PCR. NHDF-P3 cells were infected with ETS2 lentivi strong expression of cardiac progenitor genes as determined US 9,109,232 B2 13 14 by RT-PCR and immunostaining. Additionally, flow cytom Imai, K. S., Satoh, N. and Satou, Y. A Twist-like bHLH gene etry showed that Mesp1 efficiently converted EPS cells into is a downstream factor of an endogenous FGF and deter cells with surface markers CD31, CD34 and CD144 resem mines mesenchymal fate in the ascidian embryos. Devel bling human cardiac cells. Finally, rhythmic beating was opment 130: 4461–4472, 2003. observed in the cell cultures. This completed the conversion from SK1nkin fibroblastsII problasts to terminally d1IIerenuateddifferentiated card1ogen1ccardi " 5 Imai,expression K. S., Hino, profiles K., Yagi,of transcription K., Satoh, N.factors and Satou, and signaling Y. Gene cells. molecules in the ascidian- 0 embryo: towards a comprehen REFERENCES CITED sive understanding of gene networks. Development 131: 4047-4058, 2004. The following references, to the extent that they provide " Kitajima, S. et al. MesP1 and MesP2 are essential for the exemplary procedural or other details Supplementary to those development of cardiac mesoderm. Development 127: set forth herein, are specifically incorporated herein by refer- 3215-3226, 2000. CCC. Moretti, A. et al. Multipotent embryonic isl+ progenitor cells U.S. Patent D t 15 lead to cardiac, smooth muscle and endothelial cell diver S. at OCUS sification. Cell 127: 1151-1165, 2006. U.S. Patent publication No. 2009/0227032 to S. Yamanaka. Park, I. H. et al. Reprogramming of human somatic cells to pluripotency with defined factors. Nature 451: 141-146, Non-Patent References 2008. 20 Saga, Y. et al. MesP1 is expressed in the heart precursor cells Bergmann. O. et al. Evidence for cardiomyocyte renewal in and required for the formation of a single heart tube. Devel lysis 324: E. d migrati f opment 126:3437-3447, 1999. Beh, J. et al. FoxF is essential for FGF-in uced migration o Saga, Y. Kitajima, S. and Miyagawa-Tomita, SMespl heart progenitor cells in the ascidian Ciona intestinalis. expression is the earliest sign of cardiovascular develop Development 134; 3297-3305, 2007. 25 t. Trends Cardi Med. 10:345-352, 2000 Davidson, B. Ciona intestinalis as a model for cardiac devel- C. ren S a Iovasc CC. ------, opment. Semin. Cell Dev. Biol. 18:16-26, 2007. Takahashi, K. et al. Induction of pluripotent stem cells from Davidson, B. and Levine, M. Evolutionary origins of the adult human fibroblasts by defined factors. Cell 131:861 vertebrate heart: Specification of the cardiac lineage in 872, 2007. Ciona intestinalis. Proc. Natl. Acad. Sci. USA 100: 11469- Yu, J. Induced pluripotent stem cell lines derived from human 11473. somatic cells. Science 3 18:1917-1920, 2007.

SEQUENCE LISTING

<16 Os NUMBER OF SEO ID NOS: 86

<21 Os SEQ ID NO 1 &211s LENGTH: 182O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: human ELK4 gene sequence <4 OOs SEQUENCE: 1 ggagcc.ccgc gcgcggcgt.c gct cattgct atggacagtg ct at Caccct gtggcagttc 60 cittcttcagc tic ctdcagaa goctoragaac aagcacatga totgttggac ct ctaatgat 12O

gggcagttta agcttittgca ggcagaa.gag gtggct Ct c totgggggat tcgcaagaac 18O

aagcc talaca tdaattatga caaacticago cqagcc.ctica gatact atta totaaagaat 24 O

atcatcaaaa aagtgaatgg to agaagttt gtgtacaagt ttgtct citta to cagagatt 3 OO ttgaacatgg at CCaatgac agtgggcagg attgagggtg actgtgaaag tittaaact tc 360 agtgaagttca gcagcagttc caaagatgtg gagaatggag ggaaagataa accacct cag 42O

cctggtgcca agacctic tag cc.gcaatgac tacatacact ctdgcttata ttct tcattt 48O

act ct caact ctittgaactic ct coaatgta aagcttittcaaattgataaa gact gagaat 54 O

ccago cqaga aactggcaga gaaaaaatct cotcaggagc ccacac catc tdt catcaaa 6 OO

tttgtcacga cacct tccaa aaag.ccaccg gttgaacct g ttgctgccac catttcaatt 660 gg.cccaagta tttct coat c tt cagaagaa act atccaag ctittggagac attggtttico 72O

ccaaaactgc ct tcc ct gga agc.ccca acc totgccticta acgtaatgac togcttittgcc 78O

accacaccac cc attitcgt.c cataccc cct ttgcaggaac ct cocagaac acct tcacca 84 O US 9,109,232 B2 15 - Continued c cactgagtt ctic acccaga catcgacaca gacattgatt Cagtggctt C to agccalatg 9 OO gaact tccag agaatttgtc actggagc ct aaagaccagg att cagt citt gctagaaaag 96.O gacaaagtaa ataatt Catc. aagat.ccaag aaacccaaag ggittagaact ggcacccacc cittgttgat ca cgagcagtga tccaag.ccca Ctgggaatac tgagcc catc tict coctaca gcttct citta caccagcatt tttitt cacag gtagcttgct cgctic tittat gigtgtcacca 14 O ttgctitt cat ttatttgc cc ttittaa.gcaa atccagaatt tatacactica agtttgctitt 2OO ctgttactta ggtttgtc.tt agaaaggitta tgttgttgactg t catgtgaaa gttaccc cat 26 O ttct catct t aattaggatt gctaaaatag aaagtttgga gtattitt citt aaaaaattica 32O ttgttctaca agtaaataaa tattittgatt titt citat it to ctic ctaaaga aagtacacac actic to tcgc t ct ct citcgg tottataaaa. Ctcgttggtg t cittataaaa caaac agtga 44 O taatct caag ttagaaaa.ca gtaggtoctg agaac cataa gaaaaatgac tigtgtgatg SOO ttgagtaa.ca agttgg taca gttactittag Ctatt tatta acttgct cat ct catagaac 560 attittaatag atttitt Caca Cacct Catta ttaaaaaaaa. acaaacatgc tiggtgtc.ttg gttacc catt att cottctgt acctgaattic aggttggittt ttctatttgg aaaag actitt ataaatgttg gcttaaaaag aggttgagca ccagaat citc agaatttaccaccaaagaac 74 O t catccatgt aac Caaaaac cacttgtacc CCCaaaaact attgaaataa aaatttaaaa aattaaaaaa. aaaaaaaaaa.

SEQ ID NO 2 LENGTH: 405 TYPE : PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: human ELK4 protein sequence SEQUENCE: 2

Met Asp Ser Ala Ile Thr Lieu. Trp Glin Phe Lieu. Lell Glin Lieu. Lieu. Glin 1. 1O 15

Lys Pro Glin Asn Llys His Met Ile Cys Trp Thr Ser Asn Asp Gly Glin 25 3O

Phe Luell Lieu. Glin Ala Glu Glu Val Ala Arg Lell Trp Gly Ile Arg 35 4 O 45

Lys Pro Asn Met Asn Tyr Asp Llys Lieu. Ser Arg Ala Lieu. Arg 55 6 O

Tyr Val Lys Asn. Ile Ile Llys Llys Val Asn Gly Gln Llys Phe 65 70 7s 8O

Wall Phe Val Ser Tyr Pro Glu Ile Lieu. Asn Met Asp Pro Met 85 90 95

Thir Wall Gly Arg Ile Glu Gly Asp Cys Glu Ser Lell Asn Phe Ser Glu 105 11 O

Wall Ser Ser Ser Ser Lys Asp Wall Glu Asn Gly Gly Lys Asp Llys Pro 115 12 O 125

Pro Glin Pro Gly Ala Lys Thir Ser Ser Arg Asn Asp Ile His Ser 13 O 135 14 O

Gly Luell Tyr Ser Ser Phe Thir Lieu. Asn. Ser Luell Asn Ser Ser Asn. Wall 145 150 155 160

Luell Phe Llys Lieu. Ile Llys Thr Glu Asn. Pro Ala Glu Llys Lieu Ala 1.65 17O 17s

Glu Ser Pro Glin Glu Pro Thir Pro Ser Wall Ile Llys Phe Val 18O 185 19 O US 9,109,232 B2 17 18 - Continued

Thir Thir Pro Ser Llys Lly s Pro Pro Wall Glu Pro Wall Ala Ala Thir Ile 195 2OO

Ser Ile Gly Pro Ser Il e Ser Pro Ser Ser Glu Glu Thir Ile Glin Ala 21 O 215

Lell Glu Thir Lieu Wal Se r Pro Llys Leul Pro Ser Lell Glu Ala Pro Thir 225 23 O 235 24 O

Ser Ala Ser Asn. Wal Me t Thir Ala Phe Ala Thr Thir Pro Pro Ile Ser 245 250 255

Ser Ile Pro Pro Leul G in Glu Pro Pro Arg Thr Pro Ser Pro Pro Leu 26 O 265 27 O

Ser Ser His Pro Asp I e Asp Thr Asp Ile Asp Ser Wall Ala Ser Glin 27s 28O 285

Pro Met Glu Leul Pro G ul ASn Luell Ser Lieu. Glu Pro Asp Glin Asp 29 O 295 3 OO

Ser Wall Luell Lieu. Glu, Lly Asp Llys Wall Asn. Asn Ser Ser Arg Ser Lys 3. OS 315 32O

Pro Gly Lieu G u Lieu Ala Pro Thir Lieu. Wall Ile Thir Ser Ser 3.25 330 335

Asp Pro Ser Pro Lieu. Gly Ile Lieu Ser Pro Ser Lell Pro Thir Ala Ser 34 O 345 35. O

Lell Thir Pro Ala Phe Ph.e Ser Glin Val Ala Cys Ser Lell Phe Met Wall 355 360 365

Ser Pro Luell Lieu. Ser Ph.e Ile Cys Pro Phe Lys Glin Ile Glin Asn Luell 37 O 375

Tyr Thir Glin Val Cys Ph. e Luell Luell Lieu. Arg Phe Wall Lell Glu Arg Lieu. 385 39 O 395 4 OO

Wall Thir Wal Met 4 OS

SEQ ID NO 3 LENGTH: 1218 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: human ELK4 coding sequence

<4 OOs, SEQUENCE: 3 atggacagtig citat cacc ct gtggcagttc cittcttcago tcc tigcagaa gcct cagaac 6 O alagcacatga tctgttggac ctictaatgat gggcagttta agcttittgca ggCagaa.gag 12 O gtggct citc tctgggggat tcgcaagaac aagcc talaca tgaattatga caaacticago 18O cgagcc ct ca gatact atta tgtaaagaat atcatcaaaa. aagtgaatgg t cagaagttt 24 O gtgtacaagt ttgtct citta tccagagatt ttgaacatgg atccaatgac agtgggCagg 3OO attgagggtg actgttgaaag tittaaact to agtgaagttca gcagoagttc caaagatgtg 360 gagaatggag ggaaagataa accacct cag Cctggtgc.ca agacctic tag cc.gcaatgac taCatacact ctggcttata t tott cattt act. Ct. Caact ctittgaactic ctic caatgta 48O aagcttitt ca aattgataaa gactgagaat Ccagcc.gaga aactggcaga gaaaaaatct 54 O

Ccticaggagc CCaCaC catc. tgtcatcaaa tttgtcacga Cacct tccala aaagccaccg gttgaacctg ttgctgccac cattt Caatt ggcc.caagta titt ct coat c ttcagaagaa 660 actato caag Ctttggagac attggittt co c caaaactgc citt coctdga agc.ccca acc 72 O tctgcct cita acgtaatgac tgcttittgcc a CCaCaCCaC c catttcqtc Catac CoCCt

US 9,109,232 B2 21 22 - Continued

Ser Pro Ala Trp Ser Ser Asp Pro Trp Asp Gly Ala Glin Ala Ser Ser 35 4 O 45

Pro Ala Pro Pro Cys Ala Arg Pro Ala Arg Arg Ala Gly Thir Pro Gly SO 55 6 O

Arg Arg Gly Thr His Gly Ser Arg Lieu. Gly Ser Gly Glin Arg Glin Ser 65 70 7s 8O

Ala Ser Glu Arg Glu Lys Lieu. Arg Met Arg Thr Lell Ala Arg Ala Lieu 85 90 95

His Glu Luell Arg Arg Phe Lieu Pro Pro Ser Wall Ala Pro Thir Gly Glin 105 11 O

Asn Luell Thir Lys Ile Glu Thir Lieu Arg Lieu Ala Ile Arg Ile Gly 115 12 O 125

His Luell Ser Ala Val Lieu. Gly Lieu. Ser Glu Asp Asn Lell Arg Arg Glin 13 O 135 14 O

Arg His Ala Val Ser Pro Arg Gly Cys Pro Leu Pro Asp Ser Asp 145 150 155 160

Lell Ala Glin Ser Glin Ser Lieu. Gly Pro Gly Lieu. Ser Pro Ala Val Cys 1.65 17O 17s

Ser Gly Wall Ser Trp Gly Ser Pro Pro Ala Tyr Pro Arg Pro Arg Val 18O 185 19 O

Ala Ala Glu Ser Trp Asp Pro Ser Phe Glin Tyr Ala Glu Thir Ala Ser 195

Glin Glu Arg Glin Glu Met Glu Pro Ser Pro Ser Ser Pro Luell Phe Ser 21 O 215 22O

Ser Asp Met Lieu Ala Lieu. Lieu. Glu Thir Trp Thr Pro Pro Glin Glu Trp 225 23 O 235 24 O

Pro Pro Ala

SEQ ID NO 6 LENGTH: 732 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: mouse MesP1 coding sequence <4 OOs, SEQUENCE: 6 atggcc.ca.gc ccctgtgcga gagt cctgga tcc tigagt cc cgctggtC9g 6 O

Cagccaccga tgcct tcc.ga tgggalacagc gtctgct coc Cagcctggit c Ctcggaccc.g 12 O tgggacggtg CCC aggc.cag cagcc ctdca ccaccctg.cg cc.cgc.ccggc ccggcgtgct 18O ggga CCCC99 gtaggcgcgg gacgcacggit agcc.gc.ctgg gtagcggaca gcggcagagc 24 O gccagdgagc gggaga agct acg tatgcgc acact cqccc cgagctg.cgc 3OO cgctitc.ttgc cgc catcc.gt ggcaccalacc ggc.ca.galacc tgacCaagat cgagacgctg 360

tcc.gctacat tggccacctg tcggctgtgc tgggact cag cgaggacaac

Ctc.cggcgac agcggcacgc ggtgtcacct cgaggctgcc cgacagcgac 48O

Ctggcgcagt cgcagt cact cggtcCtggit ttaa.gc.ccgg cc.gtctgcag cggggtgtcg 54 O tggggat.ccc cgc.ctgccta c cc tag accc cgagt cqc.cg Cagaatcgtg ggacc catcg titccagtacg Cagaaa.ca.gc atcc.caggaa aggcaggaaa tggagcc.ca.g t cc ct catct 660 cc.gct citt.ca gcagogacat gctggctcitt ctagaaacct gCaggagtgg 72 O

ga 732

US 9,109,232 B2 25 26 - Continued tittaaaataa. ttatataact gtatttgaaa taagaattica gacatctgag gttittatttic 216 O atttitt Caat agcacatatg gaattittgca aagatttaat Ctgccaaggg ccgactalaga 222 O gaagttgtaa agtatgtatt atttacattt aatagacitta Cagggataag gcctgttgggg 228O ggtaatcc ct gcttitttgtg tttittttgtt tgtttgtttg tttgtttittg gggggittitt C 234 O ttgccttggit tgtctggcaa. ggactttgta catttgggag ttitt tatgag aaact talaat 24 OO gttatt at ct gggctt at at Ctggc Ctctg citt to tcc tt taattgtaaa gtaaaagcta 246 O taalagcagta tttittcttga Caaaaaaaaa. aaaaaaaaaa. 2500

SEQ ID NO 8 LENGTH: 46.9 TYPE : PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: human ETS2 protein sequence <4 OOs, SEQUENCE: 8

Met Asn Asp Phe Gly Ile Lys Asn Met Asp Glin Wall Ala Pro Wall Ala 1. 5 1O 15

Asn Ser Tyr Arg Gly. Thir Lieu Lys Arg Glin Pro Ala Phe Asp Thir Phe 25

Asp Gly Ser Lieu. Phe Ala Wall Phe Pro Ser Lieu. Asn Glu Glu Gn. Thir 35 4 O 45

Lell Glin Glu Val Pro Thr Gly Lieu Asp Ser Ile Ser His Asp Ser Ala SO 55 6 O

Asn Glu Lieu Pro Leu Lleu. Thr Pro Cys Ser Ala Wall Met Ser 65 70 7s 8O

Glin Ala Luell Lys Ala Thr Phe Ser Gly Phe Lys Glu Glin Arg Arg 85 90 95

Lell Gly Ile Pro Lys Asn Pro Trp Lieu. Trp Ser Glu Glin Glin Val Cys 105 11 O

Glin Trp Luell Lieu. Trp Ala Thr Asn Glu Phe Ser Lell Wall Asn Wall Asn 115 12 O 125

Lell Glin Arg Phe Gly Met Asn Gly Gln Met Lieu. Cys Asn Luell Gly Lys 13 O 135 14 O

Glu Arg Phe Lieu. Glu Lieu. Ala Pro Asp Phe Val Gly Asp Ile Lieu. Trp 145 150 155 160

Glu His Luell Glu Gln Met Ile Llys Glu Asn. Glin Glu Thir Glu Asp 1.65 17O 17s

Glin Glu Glu Asn. Ser His Lieu. Thir Ser Wall Pro His Trp Ile Asn 18O 185 19 O

Ser Asn Thir Leu Gly Phe Gly Thr Glu Glin Ala Pro Tyr Gly Met Glin 195

Thir Glin Asn Tyr Pro Lys Gly Gly Lieu. Lieu. Asp Ser Met Pro Ala 21 O 215 22O

Ser Thir Pro Ser Wall Leu Ser Ser Glu Glin Glu Phe Glin Met Phe Pro 225 23 O 235 24 O

Ser Arg Lieu. Ser Ser Wal Ser Val Thr Tyr Ser Wall Ser Glin 245 250 255

Asp Phe Pro Gly Ser Asn Lieu. Asn Lieu. Lieu. Thir Asn Asn Ser Gly Thr 26 O 265 27 O

Pro Asp His Asp Ser Pro Glu Asin Gly Ala Asp Ser Phe Glu Ser 27s 28O 285

Ser Asp Ser Lieu. Lieu. Glin Ser Trip Asn Ser Glin Ser Ser Luell Lieu. Asp US 9,109,232 B2 27 28 - Continued

29 O 295 3 OO

Wall Glin Arg Wall Pro Ser Phe Glu Ser Phe Glu Asp Asp Ser Glin 3. OS 310 315 32O

Ser Luell Lieu. Asn Llys Pro Thr Met Ser Phe Lys Asp Ile Glin 3.25 330 335

Glu Arg Ser Asp Pro Val Glu Glin Gly Llys Pro Wall Ile Pro Ala Ala 34 O 345 35. O

Wall Luell Ala Gly Phe Thr Gly Ser Gly Pro Ile Glin Lell Trp Glin Phe 355 360 365

Lell Luell Glu Lieu Lleu Ser Asp Llys Ser Cys Glin Ser Phe Ile Ser Trp 37 O 375

Thir Gly Asp Gly Trp Glu Phe Lys Lieu Ala Asp Pro Asp Glu Wall Ala 385 390 395 4 OO

Arg Arg Trp Gly Lys Arg Lys Asn Llys Pro Llys Met Asn Glu Lys 4 OS 41O 415

Lell Ser Arg Gly Lieu. Arg Tyr Tyr Tyr Asp Llys Asn Ile Ile His Lys 425 43 O

Thir Ser Gly Lys Arg Tyr Val Tyr Arg Phe Val Asp Luell Glin Asn 435 44 O 445

Lell Luell Gly Phe Thr Pro Glu Glu Lieu. His Ala Ile Lell Gly Wall Glin 450 45.5 460

Pro Asp Thir Glu Asp 465

SEQ ID NO 9 LENGTH: 1410 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: human ETS2 coding sequence

<4 OOs, SEQUENCE: 9 atgaatgatt toggaatcaa gaatatggac Cagg tagcc.c Ctgtggctaa Cagittacaga 6 O ggga cactica agc ctittgac acctittgatg ggtcc ctgtt tgctgtttitt 12 O cott ct citaa. atgaagagca aac actgcaa gaagtgccaa Caggcttgga t to cattt ct 18O catgactic cq c caactgtga attgc ctittg tta accc.cgt. gcagdaaggc tgttgatgagt 24 O caagcc ttaa aagctacctt Cagtggct tc aaaaaggaac agcggcgc.ct gggcatt coa 3OO aagaac cc ct ggctgttggag tgagcaa.cag gtatgc.cagt ggctt Ctctg ggccaccaat 360 gagttcagtic tggtgaacgt. gaatctgcag aggttcggca tgaatggc.ca gatgctgtgt aaccttggca aggaacgctt tctggagctg gcacctgact ttgttgggtga cattct c togg gaac atctgg agcaaatgat caaagaaaac Caagaaaaga Cagaagat.ca atatgaagaa 54 O aatt Cacacc t cacct cogt t cct cattgg attaa.ca.gca atacattagg ttittggcaca gagc aggcgc cctatoggaat gCagacacag aattacCCCa aaggcggcct Cctggacagc 660 atgtgtc.cgg CCt CCaCaCC cagcgtactic agctctgagc aggagtttca gatgttc.ccc 72 O aagttct cqgc t cagotc.cgt. cagcgtcacc tactgct citg t cagt cagga citt cocaggc agcaacttga atttgct cac Caacaatt Ct gggacgcc.ca alagaccacga ctic ccct gag 84 O aacggtgcgg acagottcga gagct Cagac t cc ct cotcc. agt cctggaa Cagc.cagtcg 9 OO t ccttgctgg atgtgcaacg ggttcct tcc titcgaga.gct tcgaagatga Ctgcagc.ca.g 96.O totctotgcc t caataagcc aac catgtct ttcaaggatt a catccaaga gaggagtgac

US 9,109,232 B2 33 34 - Continued ttctgtgagt ataact cotg cagttccitat agcagataag atataagaaa gtgcct cota gtgctic ct co go.ccgcttgt ttgctaaaat to cotttctic tctaagt cca CCattitt Caa 414 O gatttgtaga tagtgt atta gttaalgacag Ctttgtcgat Ctggccagat gttttittct c 42OO

Ctttgtc.caa aggc.ca.gaga c catcc.cagg alaga.gtggtg ggtggittitat acactggaaa 426 O tgttgcgttt atgctttitta aaaacacacg tta actt cag aggaaggatg ggcaaatctg 432O gtctagotgg gtgaaaccct tattt tocca gagatgcctt aac Ctttgtt ggttittggct 438 O ttagggttca gag toactitt tgttccct tc tcc attctgg agagggactt CCCCtaCata 4 44 O gagg cctgat ttttgttggct gtggggattg gaggtag cat tcaaagat.ca gatgtgctitt 4500 t cct cactitt ggagatgaac actictgggtt ttacago att aacct gccta acctt catgg 456 O tgagaaatac accatctotc ttctagt cat cc.gct tactic tgttggggt C tatataaatt togttgaactic ttacctaCat tccaaagaag tittcaaggaa CCatalaatat 468O atgtatacat atacatatat aaaatatata tattaaaata aaattat cag gaatact gcc 474. O t cagittattgaacttitttitt tittaagaata cittitt tttitt aagctgagaa gtatagggat 48OO gaaaaagatgttatattgttg tittgactatt titccaacttg tatttitcata taatttatat 486 O tttittaaaag ctgaaaattit agaa.gcaaga tgaaaaaaag gaaaa.gcagg tgctttittaa 492 O aaat Cagaac taggtagct tagagatgta gcgatgtaag tgtcgatgtt tttittaaaaa. 498O aaaatgcaaa aaaatt citta tgg.cggagtt ttttgtttgt ttattittagt agctgatgct 5040 ggca catcat tittgctggag agttttitt at at actgtagc citgattt cat attgt attitt aaactgttgttgaaattaaaaa caaagaattit Catt cataat gct 5143

<210s, SEQ ID NO 11 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: GapdhFP crtl exp primer

<4 OOs, SEQUENCE: 11 tgttgc catc aatgaccc ct t 21

<210s, SEQ ID NO 12 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: GapdhRP ctrl exp primer

<4 OOs, SEQUENCE: 12 citccacgacg tacticagog 19

<210s, SEQ ID NO 13 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: hNanogFP ctrl exp primer

<4 OOs, SEQUENCE: 13

Cagaaggc ct cagcaccitac

<210s, SEQ ID NO 14 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence US 9,109,232 B2 35 36 - Continued

22 Os. FEATURE: <223> OTHER INFORMATION: hNanogRP ctrl exp primer

<4 OOs, SEQUENCE: 14 tatagaaggg actgttcCaggc 22

<210s, SEQ ID NO 15 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: hoct 3/4 FP ctrl exp primer <4 OOs, SEQUENCE: 15

CttgaatcCC gaatggaaag gg 22

<210s, SEQ ID NO 16 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: hoct 3/4 RP ctrl exp primer <4 OOs, SEQUENCE: 16 cct tcc caaa tagaac cc cc a 21

<210s, SEQ ID NO 17 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence & 22 O FEATURE; <223> OTHER INFORMATION: Sox2 HPB F primer <4 OOs, SEQUENCE: 17 tggacagtta cqcgcacat 19

<210s, SEQ ID NO 18 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Sox2 HPB R primer <4 OOs, SEQUENCE: 18 cgagtaggac atgctgtagg t 21

<210s, SEQ ID NO 19 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: hRex1FP ctrl exp primer <4 OOs, SEQUENCE: 19 gctgaccacc agcacactag gC 22

<210s, SEQ ID NO 2 O &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: hRex1RPctrl exp primer

<4 OOs, SEQUENCE: 2O tittctggtgt cittgtc.tttg ccc.g 24 US 9,109,232 B2 37 38 - Continued

<210s, SEQ ID NO 21 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: c-Myc HPB F primer

<4 OOs, SEQUENCE: 21 aggcgalacac acaacgt.ctt

<210s, SEQ ID NO 22 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: c-Myc HPB R primer

<4 OOs, SEQUENCE: 22 ttggacggac aggatgitatg C 21

<210s, SEQ ID NO 23 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: hKlf4FP ctrl exp primer <4 OOs, SEQUENCE: 23 atggctgtca gcgacgc.gct gctic 24

<210s, SEQ ID NO 24 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: hKlf4RP ctrl exp primer <4 OOs, SEQUENCE: 24 cgttgaactic ct cqgt ct ct citcc 24

<210s, SEQ ID NO 25 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Nkx 2.5 FP primer <4 OOs, SEQUENCE: 25 c cct gaccga t cocacctica ac 22

<210s, SEQ ID NO 26 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Nkx 2.5 RP primer

<4 OOs, SEQUENCE: 26 ggcggg.cgac gigcgagatag C 21

<210s, SEQ ID NO 27 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Mesp 1 FP primer US 9,109,232 B2 39 40 - Continued

<4 OOs, SEQUENCE: 27 tcgaagtggit to Cttggcag ac 22

<210s, SEQ ID NO 28 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Mesp 1 RP primer <4 OOs, SEQUENCE: 28 cctic ctdctt gcct caaagt gtc 23

<210s, SEQ ID NO 29 &211s LENGTH: 25 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Mesp 2 FP primer <4 OOs, SEQUENCE: 29 cgctg.cgc.ct ggc catcc.gc tacat 25

<210s, SEQ ID NO 3 O &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Mesp 2 RP primer

<4 OOs, SEQUENCE: 30 gcc.cca aggg gaccc.cgcga C 21

<210s, SEQ ID NO 31 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Mef2c FP primer <4 OOs, SEQUENCE: 31 gCaccagtgc agggalacggg

<210s, SEQ ID NO 32 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Mef2c RP primer <4 OOs, SEQUENCE: 32 gactgagc.cg actgggagtt a 21

<210s, SEQ ID NO 33 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Sox 17 FP primer

<4 OOs, SEQUENCE: 33 gC9g.cgcaag Caggtgaag 19

<210s, SEQ ID NO 34 US 9,109,232 B2 41 42 - Continued

LENGTH: 23 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: ACTCTGGCAGTCGCGGTAGTGGC

SEQUENCE: 34 actctggcag ticgcgg tagt ggc 23

SEO ID NO 35 LENGTH: 23 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: FoxA2 FP primer SEQUENCE: 35

Ctgaag.ccgg alacaccacta cqc 23

SEQ ID NO 36 LENGTH: 23 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: FoxA2 RP primer SEQUENCE: 36 tccaggc.ccg ttttgttcgt gac 23

SEO ID NO 37 LENGTH 22 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: FGF8 FP primer SEQUENCE: 37 agct cagc.cg cc.gc.ct catc cq 22

SEQ ID NO 38 LENGTH: 23 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: FGF8 RP primer SEQUENCE: 38 agcc ct cqta cittggcattctgc 23

SEO ID NO 39 LENGTH: 23 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: MyoD FP primer

SEQUENCE: 39 aggggctagg ttcagctttc. tcg 23

SEQ ID NO 4 O LENGTH: 23 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: MyoD RP primer

SEQUENCE: 4 O US 9,109,232 B2 43 44 - Continued citcc togct ct ggcaaa.gcaa citc 23

<210s, SEQ ID NO 41 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: BMP2 HBP FP primer <4 OOs, SEQUENCE: 41 acct titatgg agggaaac cc a 21

<210s, SEQ ID NO 42 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: BMP2 HBP RP primer <4 OOs, SEQUENCE: 42 ccggatctgg ttcaag catg a 21

<210s, SEQ ID NO 43 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: hTert HBP FP primer <4 OOs, SEQUENCE: 43 aacct tcc to agctatgc cc

<210s, SEQ ID NO 44 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: hTert HBP RP primer <4 OOs, SEQUENCE: 44 gcgtgaalacc titacgc.ct 19

<210s, SEQ ID NO 45 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Islet-1 HPB F primer <4 OOs, SEQUENCE: 45 gtggagaggg Ccagtic tagg

<210s, SEQ ID NO 46 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Islet-1 HPB R primer

<4 OOs, SEQUENCE: 46 cc.gt catc to taccagttgc t 21

<210s, SEQ ID NO 47 &211s LENGTH: 19 &212s. TYPE: DNA US 9,109,232 B2 45 46 - Continued <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Troponin T HPB F primer

<4 OOs, SEQUENCE: 47 gagttgcagg cqctgattg 19

<210s, SEQ ID NO 48 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Troponin T HPB R primer

<4 OOs, SEQUENCE: 48 tctggatgta acc cccaaaa td 22

<210s, SEQ ID NO 49 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Dhand HPB F primer <4 OOs, SEQUENCE: 49 atgagt ctgg taggtggttt t cc 23

<210s, SEQ ID NO 50 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Dhand HPB R primer <4 OOs, SEQUENCE: 50

Catact cqgg gctgtaggac a 21

<210s, SEQ ID NO 51 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: T HPB F primer <4 OOs, SEQUENCE: 51 gat cacgcag Ctcaagattg C 21

<210s, SEQ ID NO 52 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: T HPB R primer <4 OOs, SEQUENCE: 52 tctctggtgt gttcct agac g 21

<210s, SEQ ID NO 53 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: T5 HPB F primer

<4 OOs, SEQUENCE: 53 cactitctic cq ct cactitcac c 21 US 9,109,232 B2 47 48 - Continued

<210s, SEQ ID NO 54 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: T5 HPB R primer <4 OOs, SEQUENCE: 54 tggcacgc.ca tagagtaga

<210s, SEQ ID NO 55 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: ETS-2 HPB F primer <4 OO > SEQUENCE: 55 aaagctacct tcagtggctt c 21

<210s, SEQ ID NO 56 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: ETS-2 HPB R primer <4 OOs, SEQUENCE: 56 aatgtcaccc acaaagttcag g 21

<210s, SEQ ID NO 57 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Dkk-1 FP primer <4 OO > SEQUENCE: 57 attic caacgc tat caagaac c 21

<210s, SEQ ID NO 58 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Dkk-1 RP primer <4 OOs, SEQUENCE: 58 c caaggtgct atgat catta cc 22

<210s, SEQ ID NO 59 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: TBX 20 FP primer

<4 OO > SEQUENCE: 59 tccagatt ct c ctitttaccg

<210s, SEQ ID NO 60 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: US 9,109,232 B2 49 50 - Continued

223 OTHER INFORMATION: TBX 20 RP primer

<4 OOs, SEQUENCE: 60 ttcagactitc aggttgagca

<210s, SEQ ID NO 61 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: SM actin HBP F primer <4 OOs, SEQUENCE: 61 cggtgctgtc. tctictatogcc

<210s, SEQ ID NO 62 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: SM actin HBP R primer <4 OOs, SEQUENCE: 62 cacgct cagt caggat ctitc a 21

<210s, SEQ ID NO 63 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: hdATA1 F primer <4 OOs, SEQUENCE: 63 agaa.gc.gc.ct gattgtcagt a 21

<210s, SEQ ID NO 64 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: hCGATA1 R primer <4 OOs, SEQUENCE: 64 agagacittgg gttgtc.ca.ga a 21

<210s, SEQ ID NO 65 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: hdTAT2 F primer <4 OOs, SEQUENCE: 65 ggcc cact ct ctdtgtacc 19

<210s, SEQ ID NO 66 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: hCGATA2 R primer

<4 OOs, SEQUENCE: 66 catctt catg ct citcc.gt ca g 21 US 9,109,232 B2 51 52 - Continued

<210s, SEQ ID NO 67 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: TBX3-1 F primer <4 OO > SEQUENCE: 67 gtgtct cigg cctggattic 19

<210s, SEQ ID NO 68 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: TBX3-1 R primer <4 OOs, SEQUENCE: 68 acgtgtaggg gta agggaac a 21

<210s, SEQ ID NO 69 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: TBX3-2 F primer <4 OOs, SEQUENCE: 69 ttaaagtgag atgttctggg Ctg 23

<210 SEQ ID NO 70 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: TBX3-2 R primer <4 OO > SEQUENCE: 7 O actataattic ccctgccacg ta 22

<210s, SEQ ID NO 71 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: TBX4 F primer <4 OOs, SEQUENCE: 71 tgac catcgc tacaagttct gt 22

<210s, SEQ ID NO 72 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: TBX4 R primer

<4 OOs, SEQUENCE: 72 ggtggttgtt tt cagct tc ag 22

<210s, SEQ ID NO 73 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: TBX6 F primer US 9,109,232 B2 53 54 - Continued

<4 OO > SEQUENCE: 73 acaccc ctaa actggattgc t 21

<210s, SEQ ID NO 74 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: TBX6 R primer <4 OOs, SEQUENCE: 74 cctic ccagct ttggtgatga t 21

<210s, SEQ ID NO 75 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: TBX10 F primer <4 OO > SEQUENCE: 75 cct cqg cata cittgcaccc 19

<210s, SEQ ID NO 76 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: TBX10 R primer < 4 OO SEQUENCE: 76 attic ct coca cagaggct to a 21

<210s, SEQ ID NO 77 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: TBX18 F primer <4 OO > SEQUENCE: 77 gcc cct gctg act attctgc

<210s, SEQ ID NO 78 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: TBX18 R primer <4 OO > SEQUENCE: 78

Ctgcatggat aagctggit ct g 21

<210s, SEQ ID NO 79 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: TBX19 F primer

<4 OO > SEQUENCE: 79 aagaatggca gacggatgtt t 21

<210s, SEQ ID NO 8O &211s LENGTH: 2O US 9,109,232 B2 55 56 - Continued

&212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: TBX19 R primer

<4 OOs, SEQUENCE: 80 ccgggtgaat gtagacgcag

<210s, SEQ ID NO 81 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: RUNX2 F primer

<4 OOs, SEQUENCE: 81 cggcaaaatg agcgacgtg 19

<210s, SEQ ID NO 82 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: RunX2 R primer <4 OOs, SEQUENCE: 82

Caccgagcac aggaagttg 19

<210s, SEQ ID NO 83 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: LMO2 F primer <4 OOs, SEQUENCE: 83 ggc.cat caa aggaagagcc

<210s, SEQ ID NO 84 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: LMO2 R primer <4 OOs, SEQUENCE: 84 ggcc cagttt gtagtagagg C 21

<210s, SEQ ID NO 85 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: TAU F primer <4 OOs, SEQUENCE: 85 cc cctdgagt toacgtttca c 21

<210s, SEQ ID NO 86 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: TAU R primer US 9,109,232 B2 57 58 - Continued

<4 OOs, SEQUENCE: 86 gcgagctttg agttgaggga

What is claimed: Mesp1 protein transforms the ETS2 treated cell into the car 1. An ETS2 treated cell obtained by a method comprising diac progenitor cell having levels of contractile protein gene the step of transducing a somatic cell with ETS2 to produce an 10 expression of alpha MHC and troponin T higher than those artificially increased first level of an ETS2 protein in the found in the ETS2 treated cell. somatic cell; wherein the artificially increased first level of 7. The cardiac progenitor cell of claim 6, wherein the ETS2 protein transforms the somatic cell into the ETS2 Mesp1 protein comprises the mouse Mesp1 protein sequence treated cell having surface marker protein levels of SSEA-3 or of SEQID NO:5 encoded on a DNA expression vector trans Tra-1-81 higher than those found in the somatic cell, wherein 15 duced in the ETS2 treated cells, wherein the mouse Mesp1 the somatic cell is a normal human dermal fibroblast cell. protein sequence is expressed in the ETS2 treated cells, 2. The ETS2 treated cell of claim 1, wherein the ETS2 whereby the first level of the Mesp1 protein is artificially protein comprises the human ETS2 protein sequence of SEQ increased. ID NO:8 encoded on a DNA expression vector transduced in 8. The cardiac progenitor cell of claim 7, wherein the DNA the somatic cell, wherein the human ETS2 protein sequence is expression vector comprises the Mesp1 DNA coding expressed in the somatic cell, whereby the first level of the sequence of SEQID NO:6. ETS2 protein is artificially increased. 9. The cardiac progenitor cell of claim 7, wherein the DNA 3. The ETS2 treated cell of claim 2, wherein the DNA expression vector comprises a lentiviral vector introduced expression vector comprises the ETS2 DNA coding sequence into the ETS2 treated cells by infection. of SEQ ID NO:9. 25 10. An induced cardiac progenitor cell obtained by a 4. The ETS2 treated cell of claim 1, wherein an artificially method comprising the steps of increased first level of an ETS2 protein in the somatic cell (a) transducing a somatic cell with an ETS2 reprogram transforms the somatic cell into the ETS2 treated cell express ming factor forming an ETS2 treated cell, wherein the ing pluripotent marker genes consisting of NANOG, OCT3/ ETS2 treated cell produces a pluripotent stem cell 4, SOX2 or c-MYC. 30 marker protein not present in the Somatic cell; and 5. The ETS2 treated cell of claim 2, wherein the DNA (b) transducing the ETS2 treated cell with a Mesp1 repro expression vector comprises a lentiviral vector introduced by gramming factor forming a cardiac progenitor cell. infection. wherein the cardiac progenitor cell produces a cardiac 6. A cardiac progenitor cell obtained by a method compris cell marker protein neither expressed in the Somatic cell ing the step of transducing the ETS2 treated cell of claim 1 35 nor in the ETS2 treated cell; with Mesp1 to produce an artificially increased first level of wherein the somatic cell is a normal human dermal fibro an Mesp1 protein; wherein the artificially increased first level blast cell. of ETS2 protein and the artificially increased first level of