DOCSLIB.ORG

Gene Section Review

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Gene Section Review Atlas of Genetics and Cytogenetics in Oncology and Haematology INIST -CNRS OPEN ACCESS JOURNAL Gene Section Review CELF2 (CUGBP, Elav-like family member 2) Satish Ramalingam, Shrikant Anant Department of Molecular and Integrative Physiology, Kansas University Medical Center, Kansas City, KS, USA (SR, SA) Published in Atlas Database: May 2014 Online updated version : http://AtlasGeneticsOncology.org/Genes/CELF2ID52815ch10p14.html DOI: 10.4267/2042/56292 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2015 Atlas of Genetics and Cytogenetics in Oncology and Haematology Abstract Location: 10p14 Note: Size: 331416 bases. Orientation: plus strand. CELF2 belongs to the family of RNA binding This gene is encoded by a gene located on proteins implicated in mRNA splicing, editing, chromosome 10p13-p14 between Généthon stability and translation. markers D10S547 and D10S223 (Li et al., 2001). This gene is encoded in a single large gene spanning over 159 kilo bases located on DNA/RNA chromosome 10 p13-p14 (between D10S547 and D10S223). Description This gene has 14 transcripts (splice variants) and The human CELF2 gene contains 14 exons the 3 major splice variants have distinct exon 1. spanning over approximately 159 kb of the This is an evolutionarily conserved ubiquitously genomic DNA. expressed protein. The members of the CELF protein family contain two N-terminal RNA Transcription recognition motif (RRM) domains and one C- Alternative promoters usage of CELF2 gene results terminal RRM domain, and a divergent segment of in three transcript variants, where the variants 2 and 160-230 amino acids between second and third 3 proteins have distinct exon 1 resulting in different RRM domains. This divergent domain is unique to 5' untranslated region (UTR) and have extended N- CELF2 proteins and has been shown to contain one terminal sequences (Ramalingam et al., 2008). or more activation molecules required for splicing There are totally 14 transcripts (splice variants) activity. CELF2 has been shown to bind to the reported so far. CUG and Au-rich element (ARE) in the target mRNA and shown to be implicated in muscular Protein dystrophy and cancer. Keywords Description RNA binding protein, mRNA stability, splicing, This is an evolutionarily conserved protein. The apoptosis, translation inhibition, muscular members of the CELF protein family contain two dystrophy, cancer N-terminal RNA recognition motif (RRM) domains and one C-terminal RRM domain, and a divergent Identity segment of 160-230 amino acids between second and third RRM domains. This divergent domain is Other names: BRUNOL3, CUGBP2, ETR-3, unique to CELF2 proteins and has been shown to ETR3, NAPOR contain one or more activation molecules required HGNC (Hugo): CELF2 for splicing activity (figure 1). Atlas Genet Cytogenet Oncol Haematol. 2015; 19(2) 93 CELF2 (CUGBP, Elav-like family member 2) Ramalingam S, Anant S Figure 1. RRM position of CELF2 protein variants. Expression untranslated region (3' UTR) of the target mRNAs. Upon binding to the AU-rich sequences in CELF2 is a ubiquitously expressed protein. cyclooxygenase-2 (COX-2) 3' UTR, CELF2 According to the NCBI Entrez GEO profiles the enhances the stability of COX-2 mRNA. However, CELF2 is expressed in brain, heart, thymus, spleen, CUGBP2 binding also results in the inhibition of its bone, tongue, stomach, intestine, pancreas, liver, translation (Murmu et al., 2004). In our earlier breast, lung, kidney, testis, ovary, prostate, placenta studies we have demonstrated that CELF2 can and skin. In addition, according to expression atlas interact with HuR, a key inducer of RNA stability brain, bone marrow, heart, spleen, lymph node, and translation, and competitively inhibit HuR ovary and adipose tissue has more expression of function (Sureban et al., 2007). Recently, platelet CELF2. derived growth factor was shown to enhance Localisation CELF2 binding to COX-2 mRNA through CELF2 variant 1 is predominantly nuclear, while increased phosphorylation of a tyrosine residue at variants 2 and 3 are predominantly cytoplasmic position 39 in the protein (Xu et al., 2007). These (Ramalingam et al., 2008). CELF2 variant 1 data suggest that posttranscriptional control accumulates in the cytoplasm following radiation mechanisms are in place to modulate the CELF2 exposure (Mukhopadhyay et al., 2003a). The C function as a regulator of stability and translation of terminus of CELF2 transcript variant 1 is rich in AU-rich transcripts. arginine and lysine residues 13 amino acids Homology (KRLKVQLKRSKND) 467 - 480, which is common for NLS elements recognized by importin According to GeneCards, the CELF2 has orthologs proteins. Ladd and Cooper, has reported that the C- in 72 species including much lower organisms such terminus of CELF2 contains a strong nuclear as Danio rerio, Drosophila melanogaster, localization signal overlapping the third RRM Caenorhabditis elegans, Xenopus tropicalis and (Ladd and Cooper, 2004). However, our Oryza sativa. Furthermore, in humans it has 6 unpublished data suggests that nuclear localization paralogs from CELF1 to CELF6. signal extends to the RNA recognition motif 1 and 2 domains. Finally, CELF2 has several leucine-rich Mutations motifs that resembles nuclear export signals Note recognized by the export protein CRM1. According to GeneCards, there is 7518 single Function nucleotide polymorphism. However, Ensembl CELF2 is an RNA-binding protein implicated in the reports that CELF2 has 7768 SNPs. In addition, the regulation of several post-transcriptional events. It Database of Genomic Variants shows that CELF2 has been shown to regulate pre-mRNA splicing has 18 structural variations. (Faustino and Cooper, 2005), mRNA editing (Anant et al., 2001), mRNA translation and Implicated in stability. CELF2 has been shown to be involved in alternative splicing of muscle specific genes Colon cancer including exon 5 of cardiac troponin T (Ladd et al., Note 2001), exon 11 of insulin receptor, intron 2 of Putative tumor suppressor CELF2 expression is chloride channel 1, exons 5 and 21 of NMDAR-1, consistently reduced during neoplastic and the muscle-specific exon of α-actinin (Gromak transformation suggesting that it might play a et al., 2003). Another function for CELF2 relates to crucial role in tumor initiation and progression of its ability to bind to AU-rich sequences in 3' colon cancer. In addition, CELF2 has been shown Atlas Genet Cytogenet Oncol Haematol. 2015; 19(2) 94 CELF2 (CUGBP, Elav-like family member 2) Ramalingam S, Anant S to induce mitotic catastrophic cell death in colon muscular atrophy (Anderson et al., 2004). Spinal cancer (Ramalingam et al., 2012). and bulbar muscular atrophy (SBMA) is an Pancreatic cancer inherited neurodegenerative disorder caused by the expansion of the polyglutamine (polyQ) tract of the Note androgen receptor (AR-polyQ). It has been shown Curcumin inhibits the pancreatic cancer growth by that miR-196a enhanced the decay of the AR inducing the expression of CELF2 thereby mRNA by silencing CUGBP, Elav-like family regulating the levels of cyclooxygenase 2 and member 2 (CELF2). CELF2 shown to directly act vascular endothelial growth factor expression on AR mRNA and enhance the stability of AR (Subramaniam et al., 2011). mRNA (Miyazaki et al., 2012). Myotonic Breast cancer dystrophy (DM) is a neuromuscular disorder associated with CTG triplet repeat expansion in the Note myotonin protein kinase gene (DMPK). It has been Breast cancer cells underwent apoptotic cell death suggested that the expanded CUG repeats sequester in response to radiation injury and this was reversed specific RNA-binding proteins and that such a by knockdown of CELF2 using specific siRNA sequestration results in abnormal RNA processing (Mukhopadhyay et al., 2003b). of several RNAs containing CUG repeats in Neuroblastoma multiple tissues affected in patients with DM. One Note of the members of the CUG-binding proteins, Colchicine treatment of neuroblastoma cells CUG-BP, has been identified previously (Lu et al., resulted in apoptotic cell death and CELF2 has been 1999). shown to be involved in the process of cell death Development (Li et al., 2001). Note Alzheimer's disease Overexpression of CELF2 by RNA microinjection Note resulted in severe defects in nervous system and It has been shown that variants in CUGBP2 on gastrulation, suggesting the need for tight control of chromosome 10p, are associated with AD in those napor gene regulation during embryo development highest-risk APOE e4 homozygotes. This (Choi et al., 2003). CELF2 appears to be an interaction observation is replicated in independent important factor for thymus development and is samples. CELF2 has one isoform that is expressed therefore a candidate gene for the thymus predominantly in neurons, and identification of hypoplasia/aplasia seen in partial monosomy 10p such a new risk locus is important because of the patients (Lichtner et al., 2002). severity of AD (Wijsman et al., 2011). References Heart disease Lu X, Timchenko NA, Timchenko LT. Cardiac elav-type Note RNA-binding protein (ETR-3) binds to RNA CUG repeats Arrhythmogenic right ventricular dysplasia is the expanded in myotonic dystrophy. Hum Mol Genet. 1999 most common cause of sudden cardiac death in the Jan;8(1):53-60 young in Italy and the second most common cause Anant S, Henderson JO, Mukhopadhyay D, Navaratnam in the United States. One of the genes that was N, Kennedy S, Min J, Davidson NO. Novel role for RNA- mapped to this is in the vicinity of chromosome binding protein CUGBP2 in mammalian RNA editing. CUGBP2 modulates C to U editing of apolipoprotein B 10p12-p14 and it is CELF2 (Li et al., 2001). mRNA by interacting with apobec-1 and ACF, the apobec- Ischemia 1 complementation factor. J Biol Chem. 2001 Dec 14;276(50):47338-51 Note Ladd AN, Charlet N, Cooper TA. The CELF family of RNA The transient global ischemia induces the binding proteins is implicated in cell-specific and translational inhibition of genes with increased developmentally regulated alternative splicing. Mol Cell expression in normothermic mice.
Load more

Recommended publications
  • NIH Public Access Author Manuscript Pharmacogenet Genomics
    NIH Public Access Author Manuscript Pharmacogenet Genomics. Author manuscript; available in PMC 2012 September 01. NIH-PA Author ManuscriptPublished NIH-PA Author Manuscript in final edited NIH-PA Author Manuscript form as: Pharmacogenet Genomics. 2011 September ; 21(9): 607–613. doi:10.1097/FPC.0b013e3283415515. PharmGKB summary: very important pharmacogene information for PTGS2 Caroline F. Thorna, Tilo Grosserc, Teri E. Kleina, and Russ B. Altmana,b aDepartment of Genetics, Stanford University Medical Center, Stanford, California bDepartment of Bioengineering, Stanford University Medical Center, Stanford, California cInstitute for Translational Medicine and Therapeutics, University of Pennsylvania, Pennsylvania, USA Keywords cyclooxygenase-2; coxibs; non-steroidal anti-inflammatory drugs; pharmacogenomics; PTGS2; rs20417; rs5275; rs689466 Very important pharmacogene: PTGS2 This PharmGKB summary briefly discusses the PTGS2 gene and current understanding of its function, structure, regulation, and pharmacogenomic relevance. We also present three variants with pharmacogenomic significance and highlight the gaps in our knowledge of PTGS2-drug interactions. Overview The PTGS2 gene codes for prostaglandin G/H synthase-2, which catalyses the first two steps in the metabolism of arachadonic acid. Prostaglandin G/H synthase-2 has two active sites, a hydroperoxidase and a cyclooxygenase (COX) site, and is colloquially termed COX-2. The bifunctional enzyme performs the bis-dioxygenation and reduction of arachadonic acid to form prostaglandin (PG)G2 and H2. PGH2 is then converted to other PGs that modulate inflammation, including PGD2, PGE2, PGF2α, PGI2, and thromboxane A2 (This pathway is shown in the Lipid maps database at http://www.lipidmaps.org/data/IntegratedPathways Data/SetupIntegratedPathways.pl? imgsize=730&Mode=RAW2647&DataType=FAEicosanoidsMedia). COX-2 is the target for nonsteroidal anti-inflammatory drugs (NSAIDS) including those that were purposefully designed (pd) to be selective for COX-2 (pdNSAIDs or coxibs).
    [Show full text]
  • Molecular Genetic Analysis of Rbm45/Drbp1: Genomic Structure, Expression, and Evolution Lauren E
    Journal of Student Research (2018) Volume 7, Issue 2, pp 49-61 Research Article Molecular Genetic Analysis of Rbm45/Drbp1: Genomic Structure, Expression, and Evolution Lauren E. Pricea,f, Abigail B. Loewen Faulb,f, Aleksandra Vuchkovskaa, Kevin J. Lopeza, Katie M. Fastb, Andrew G. Ecka, David W. Hoferera,e, and Jeffrey O. Hendersona,b,c,d,g RNA recognition motif-type RNA-binding domain containing proteins (RBDPs) participate in RNA metabolism including regulating mRNA stability, nuclear-cytoplasmic shuttling, and splicing. Rbm45 is an RBDP first cloned from rat brain and expressed spatiotemporally during rat neural development. More recently, RBM45 has been associated with pathological aggregates in the human neurological disorders amyotrophic lateral sclerosis, frontotemporal lobar degeneration, and Alzheimer’s. Rbm45 and the neural developmental protein musashi-1 are in the same family of RDBPs and have similar expression patterns. In contrast to Musashi-1, which is upregulated during colorectal carcinogenesis, we found no association of RBM45 overexpression in human colon cancer tissue. In order to begin characterizing RNA-binding partners of Rbm45, we have successfully cloned and expressed human RBM45 in an Intein fusion-protein expression system. Furthermore, to gain a better understanding of the molecular genetics and evolution of Rbm45, we used an in silico approach to analyze the gene structure of the human and mouse Rbm45 homologues and explored the evolutionary conservation of Rbm45 in metazoans. Human RBM45 and mouse Rbm45 span ~17 kb and 13 kb, respectively, and contain 10 exons, one of which is non-coding. Both genes have TATA-less promoters with an initiator and a GC-rich element.
    [Show full text]
  • CELF RNA Binding Proteins Promote Axon Regeneration in C. Elegans and Mammals 1 Through Alternative Splicing of Syntaxins 2 Lizh
    1 CELF RNA binding proteins promote axon regeneration in C. elegans and mammals 2 through alternative splicing of Syntaxins 3 Lizhen Chen1,2,§, Zhijie Liu3, Bing Zhou4, Chaoliang Wei4, Yu Zhou4, Michael G. Rosenfeld2,3, 4 Xiangdong Fu4, Andrew D. Chisholm1,*, Yishi Jin1,2,4,* 5 6 1 Section of Neurobiology, Division of Biological Sciences, University of California, San Diego, 7 La Jolla, CA92093 8 2 Howard Hughes Medical Institute, University of California, San Diego, La Jolla, CA 9 92093 10 3 Department of Medicine, School of Medicine, University of California, San Diego, La Jolla, CA 11 92093 12 4 Department of Cellular and Molecular Medicine, School of Medicine, University of California, 13 San Diego, La Jolla, CA 92093 14 15 * to whom correspondence should be addressed 16 § Current address: Barshop Institute for Longevity and Aging Studies, Department of Cellular 17 and Structural Biology, University of Texas Health Science Center San Antonio, San Antonio, 18 Texas 78245 19 With 7 Figures, 3 Videos, 9 figure supplements, 7 Supplementary Files 20 Key words: UNC-75, CLIP-seq, alternative splicing, SNARE, DRG, CUGBP, ETR3 21 1 22 Abstract 23 Axon injury triggers dramatic changes in gene expression. While transcriptional regulation 24 of injury-induced gene expression is widely studied, less is known about the roles of RNA 25 binding proteins (RBPs) in post-transcriptional regulation during axon regeneration. In C. 26 elegans the CELF (CUGBP and Etr-3 Like Factor) family RBP UNC-75 is required for axon 27 regeneration. Using crosslinking immunoprecipitation coupled with deep sequencing (CLIP-seq) 28 we identify a set of genes involved in synaptic transmission as mRNA targets of UNC-75.
    [Show full text]
  • Supplementary Tables S1-S3
    Supplementary Table S1: Real time RT-PCR primers COX-2 Forward 5’- CCACTTCAAGGGAGTCTGGA -3’ Reverse 5’- AAGGGCCCTGGTGTAGTAGG -3’ Wnt5a Forward 5’- TGAATAACCCTGTTCAGATGTCA -3’ Reverse 5’- TGTACTGCATGTGGTCCTGA -3’ Spp1 Forward 5'- GACCCATCTCAGAAGCAGAA -3' Reverse 5'- TTCGTCAGATTCATCCGAGT -3' CUGBP2 Forward 5’- ATGCAACAGCTCAACACTGC -3’ Reverse 5’- CAGCGTTGCCAGATTCTGTA -3’ Supplementary Table S2: Genes synergistically regulated by oncogenic Ras and TGF-β AU-rich probe_id Gene Name Gene Symbol element Fold change RasV12 + TGF-β RasV12 TGF-β 1368519_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 42.22 5.53 75.28 1373000_at sushi-repeat-containing protein, X-linked 2 (predicted) Srpx2 19.24 25.59 73.63 1383486_at Transcribed locus --- ARE 5.93 27.94 52.85 1367581_a_at secreted phosphoprotein 1 Spp1 2.46 19.28 49.76 1368359_a_at VGF nerve growth factor inducible Vgf 3.11 4.61 48.10 1392618_at Transcribed locus --- ARE 3.48 24.30 45.76 1398302_at prolactin-like protein F Prlpf ARE 1.39 3.29 45.23 1392264_s_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 24.92 3.67 40.09 1391022_at laminin, beta 3 Lamb3 2.13 3.31 38.15 1384605_at Transcribed locus --- 2.94 14.57 37.91 1367973_at chemokine (C-C motif) ligand 2 Ccl2 ARE 5.47 17.28 37.90 1369249_at progressive ankylosis homolog (mouse) Ank ARE 3.12 8.33 33.58 1398479_at ryanodine receptor 3 Ryr3 ARE 1.42 9.28 29.65 1371194_at tumor necrosis factor alpha induced protein 6 Tnfaip6 ARE 2.95 7.90 29.24 1386344_at Progressive ankylosis homolog (mouse)
    [Show full text]
  • (CELF1), an RNA Binding Protein
    ROLES OF CUG-BP, ELAV-LIKE FAMILY MEMBER 1 (CELF1), AN RNA BINDING PROTEIN, DURING VERTEBRATE HEART DEVELOPMENT by YOTAM N. BLECH-HERMONI Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Advisor: Dr. Andrea N. Ladd Program in Cell Biology, Department of Molecular Biology and Microbiology, School of Medicine CASE WESTERN RESERVE UNIVERSITY January 2015 CASE WESTERN RESERVE UNIVERSITY SCHOOL OF GRADUATE STUDIES We hereby approve the dissertation of Yotam N. Blech-Hermoni Candidate for the degree of Doctor of Philosophy*. Committee Chair Dr. Donna M. Driscoll Committee Member Dr. Alan M. Tartakoff Committee Member Dr. Hua Lou Date of Defense November 20, 2014 *Published material is included in accordance with contracts and stipulations set forth by the publishers. i Table of Contents List of Tables ........................................................................................................................... vii List of Figures ........................................................................................................................ viii Acknowledgements ................................................................................................................. x List of Abbreviations ............................................................................................................. xi Abstract ................................................................................................................................... xiv Chapter 1: Introduction .......................................................................................................
    [Show full text]
  • Micrornas Coordinate an Alternative Splicing Network During Mouse Postnatal Heart Development
    Downloaded from genesdev.cshlp.org on October 4, 2021 - Published by Cold Spring Harbor Laboratory Press RESEARCH COMMUNICATION genes are alternatively spliced, and more than half of alter- MicroRNAs coordinate an native splicing events differ between tissues, revealing an alternative splicing network extensive level of regulation (Castle et al. 2008; Pan et al. 2008; Wang et al. 2008). during mouse postnatal heart The mammalian heart undergoes a period of dramatic remodeling during the first 3 wk after birth that requires development transcriptional and post-transcriptional regulatory pro- Auinash Kalsotra,1 Kun Wang,2 Pei-Feng Li,2 grams not yet fully understood (Xu et al. 2005; Olson 1,3,4 2006). We recently identified a conserved set of alternative and Thomas A. Cooper splicing transitions during mouse heart development, and 1Department of Pathology and Immunology, Baylor College demonstrated that nearly half are responsive to the CUGBP of Medicine, Houston, Texas 77030, USA; 2Division of and ETR-3-like factor (CELF) family of splicing regulators Cardiovascular Research, National Key Laboratory of (Kalsotra et al. 2008). Two CELF proteins, CUGBP1 and Biomembrane and Membrane Biotechnology, Institute of CUGBP2, are highly expressed in the fetal heart, but are Zoology, Chinese Academy of Sciences, Beijing 100101, down-regulated >10 fold within 3 wk after birth without People’s Republic of China; 3Department of Molecular and a change in mRNA levels. Cellular Biology, Baylor College of Medicine, Houston, Texas Here we used targeted deletion of the Dicer gene 77030, USA specifically in adult mouse myocardium to test the role of miRNAs in the mechanism of CELF protein down- Alternative splicing transitions have been identified re- regulation during postnatal development.
    [Show full text]
  • Chromosome Instability, Chromosome Transcriptome, and Clonal Evolution of Tumor Cell Populations
    Chromosome instability, chromosome transcriptome, and clonal evolution of tumor cell populations ChongFeng Gao*, Kyle Furge†, Julie Koeman‡, Karl Dykema†, Yanli Su*, Mary Lou Cutler§, Adam Werts*, Pete Haak¶, and George F. Vande Woude*ʈ Laboratories of *Molecular Oncology, †Computational Biology, ‡Germline Modification, and ¶Microarray Technology, Van Andel Research Institute, 333 Bostwick Avenue, N.E., Grand Rapids, MI 49503; and §University Services University of the Health Sciences, 4301 Jones Bridge Road, Bethesda, MD 20814 Edited by Janet D. Rowley, University of Chicago Medical Center, Chicago, IL, and approved March 29, 2007 (received for review January 23, 2007) Chromosome instability and aneuploidy are hallmarks of cancer, Phenotypic switching is fundamental for malignant progression but it is not clear how changes in the chromosomal content of a cell (6), and therefore it is important to understand the responsible contribute to the malignant phenotype. Previously we have shown mechanisms. that we can readily isolate highly proliferative tumor cells and their Glioblastomas characteristically show extensive regional cytoge- revertants from highly invasive tumor cell populations, indicating netic heterogeneity (10, 11), and this diversity may be responsible how phenotypic shifting can contribute to malignant progression. for tumor evolution and progression (10, 12). Here we show that Here we show that chromosome instability and changes in chro- distinct changes in karyotype from chromosome instability accom- mosome content occur with phenotypic switching. Further, we pany phenotypic switching. These changes, in turn, dictate changes show that changes in the copy number of each chromosome in the chromosome transcriptome that provide the expression of quantitatively impose a proportional change in the chromosome individual genes that are necessary for the conversion between the transcriptome ratio.
    [Show full text]
  • Curcumin Modulates the Apolipoprotein B Mrna Editing By
    Korean J Physiol Pharmacol 2019;23(3):181-189 https://doi.org/10.4196/kjpp.2019.23.3.181 Original Article Curcumin modulates the apolipoprotein B mRNA editing by coordinating the expression of cytidine deamination to uridine editosome components in primary mouse hepatocytes Pan He and Nan Tian* Institute of Molecular Medicine, Life Science College, Zhejiang Chinese Medical University, Hangzhou 310053, Zhejiang, China ARTICLE INFO ABSTRACT Curcumin, an active ingredient of Curcuma longa L., can reduce the Received June 23, 2018 Revised August 14, 2018 concentration of low-density lipoproteins in plasma, in different ways. We had first Accepted September 12, 2018 reported that curcumin exhibits hypocholesterolemic properties by improving the apolipoprotein B (apoB) mRNA editing in primary rat hepatocytes. However, the role *Correspondence of curcumin in the regulation of apoB mRNA editing is not clear. Thus, we investigat- Nan Tian ed the effect of curcumin on the expression of multiple editing components of apoB E-mail: [email protected] mRNA cytidine deamination to uridine (C-to-U) editosome. Our results demonstrated that treatment with 50 μM curcumin markedly increased the amount of edited apoB Key Words mRNA in primary mouse hepatocytes from 5.13%–8.05% to 27.63%–35.61%, and sig- APOBEC-1 nificantly elevated the levels of the core components apoB editing catalytic polypep- Curcumin tide-1 (APOBEC-1), apobec-1 complementation factor (ACF), and RNA-binding-motif- Hepatocytes RNA editing protein-47 (RBM47), as well as suppressed the level of the inhibitory component glycine-arginine-tyrosine-rich RNA binding protein. Moreover, the increased apoB RNA editing by 50 μM curcumin was significantly reduced by siRNA-mediated APO- BEC-1, ACF, and RBM47 knockdown.
    [Show full text]
  • Functional Requirements of AID's Higher Order Structures And
    Functional requirements of AID’s higher order PNAS PLUS structures and their interaction with RNA-binding proteins Samiran Mondala, Nasim A. Beguma, Wenjun Hua, and Tasuku Honjoa,1 aDepartment of Immunology and Genomic Medicine, Graduate School of Medicine, Kyoto University, Yoshida Sakyo-ku, Kyoto 606-8501, Japan Contributed by Tasuku Honjo, February 3, 2016 (sent for review October 27, 2015; reviewed by Atsushi Miyawaki and Kazuko Nishikura) Activation-induced cytidine deaminase (AID) is essential for the interaction, enabling AID to exert distinct physiological functions somatic hypermutation (SHM) and class-switch recombination (CSR) through its association with cofactors. Regrettably, however, there of Ig genes. Although both the N and C termini of AID have unique is little structural information available that can explain any of functions in DNA cleavage and recombination, respectively, during AID’s regulatory modes of action, including its cofactor association SHM and CSR, their molecular mechanisms are poorly understood. mechanisms, in the context of its physiological functions. Using a bimolecular fluorescence complementation (BiFC) assay Although a significant amount of structural information is available combined with glycerol gradient fractionation, we revealed that for a number of APOBEC family members, the 3D structures of A1 the AID C terminus is required for a stable dimer formation. Further- and AID are yet to be resolved (19, 20). The CDD family of enzymes more, AID monomers and dimers form complexes with distinct exists in nature in a variety of structural forms, including monomeric, dimeric, and tetrameric forms, and comparative structural modeling heterogeneous nuclear ribonucleoproteins (hnRNPs). AID monomers using the yeast CDD structure predicts a dimeric structure for both associate with DNA cleavage cofactor hnRNP K whereas AID dimers A1 and AID (21, 22).
    [Show full text]
  • Mrna Expression in Human Leiomyoma and Eker Rats As Measured by Microarray Analysis
    Table 3S: mRNA Expression in Human Leiomyoma and Eker Rats as Measured by Microarray Analysis Human_avg Rat_avg_ PENG_ Entrez. Human_ log2_ log2_ RAPAMYCIN Gene.Symbol Gene.ID Gene Description avg_tstat Human_FDR foldChange Rat_avg_tstat Rat_FDR foldChange _DN A1BG 1 alpha-1-B glycoprotein 4.982 9.52E-05 0.68 -0.8346 0.4639 -0.38 A1CF 29974 APOBEC1 complementation factor -0.08024 0.9541 -0.02 0.9141 0.421 0.10 A2BP1 54715 ataxin 2-binding protein 1 2.811 0.01093 0.65 0.07114 0.954 -0.01 A2LD1 87769 AIG2-like domain 1 -0.3033 0.8056 -0.09 -3.365 0.005704 -0.42 A2M 2 alpha-2-macroglobulin -0.8113 0.4691 -0.03 6.02 0 1.75 A4GALT 53947 alpha 1,4-galactosyltransferase 0.4383 0.7128 0.11 6.304 0 2.30 AACS 65985 acetoacetyl-CoA synthetase 0.3595 0.7664 0.03 3.534 0.00388 0.38 AADAC 13 arylacetamide deacetylase (esterase) 0.569 0.6216 0.16 0.005588 0.9968 0.00 AADAT 51166 aminoadipate aminotransferase -0.9577 0.3876 -0.11 0.8123 0.4752 0.24 AAK1 22848 AP2 associated kinase 1 -1.261 0.2505 -0.25 0.8232 0.4689 0.12 AAMP 14 angio-associated, migratory cell protein 0.873 0.4351 0.07 1.656 0.1476 0.06 AANAT 15 arylalkylamine N-acetyltransferase -0.3998 0.7394 -0.08 0.8486 0.456 0.18 AARS 16 alanyl-tRNA synthetase 5.517 0 0.34 8.616 0 0.69 AARS2 57505 alanyl-tRNA synthetase 2, mitochondrial (putative) 1.701 0.1158 0.35 0.5011 0.6622 0.07 AARSD1 80755 alanyl-tRNA synthetase domain containing 1 4.403 9.52E-05 0.52 1.279 0.2609 0.13 AASDH 132949 aminoadipate-semialdehyde dehydrogenase -0.8921 0.4247 -0.12 -2.564 0.02993 -0.32 AASDHPPT 60496 aminoadipate-semialdehyde
    [Show full text]
  • Coexpression Networks Based on Natural Variation in Human Gene Expression at Baseline and Under Stress
    University of Pennsylvania ScholarlyCommons Publicly Accessible Penn Dissertations Fall 2010 Coexpression Networks Based on Natural Variation in Human Gene Expression at Baseline and Under Stress Renuka Nayak University of Pennsylvania, [email protected] Follow this and additional works at: https://repository.upenn.edu/edissertations Part of the Computational Biology Commons, and the Genomics Commons Recommended Citation Nayak, Renuka, "Coexpression Networks Based on Natural Variation in Human Gene Expression at Baseline and Under Stress" (2010). Publicly Accessible Penn Dissertations. 1559. https://repository.upenn.edu/edissertations/1559 This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/1559 For more information, please contact [email protected]. Coexpression Networks Based on Natural Variation in Human Gene Expression at Baseline and Under Stress Abstract Genes interact in networks to orchestrate cellular processes. Here, we used coexpression networks based on natural variation in gene expression to study the functions and interactions of human genes. We asked how these networks change in response to stress. First, we studied human coexpression networks at baseline. We constructed networks by identifying correlations in expression levels of 8.9 million gene pairs in immortalized B cells from 295 individuals comprising three independent samples. The resulting networks allowed us to infer interactions between biological processes. We used the network to predict the functions of poorly-characterized human genes, and provided some experimental support. Examining genes implicated in disease, we found that IFIH1, a diabetes susceptibility gene, interacts with YES1, which affects glucose transport. Genes predisposing to the same diseases are clustered non-randomly in the network, suggesting that the network may be used to identify candidate genes that influence disease susceptibility.
    [Show full text]
  • Computational Prediction of RNA-Binding Proteins and Binding Sites
    Review Computational Prediction of RNA-Binding Proteins and Binding Sites Jingna Si *, Jing Cui, Jin Cheng and Rongling Wu Received: 1 October 2015 ; Accepted: 23 October 2015 ; Published: 3 November 2015 Academic Editor: Tatyana Karabencheva-Christova Center for Computational Biology, National Engineering Laboratory for Tree Breeding, College of Biological Sciences and Technology, Beijing Forestry University, Beijing 100083, China; [email protected] (J.C.); [email protected] (J.C.); [email protected] (R.W.) * Correspondence: [email protected]; Tel.: +86-10-6233-6269; Fax: +86-10-6233-6269 Abstract: Proteins and RNA interaction have vital roles in many cellular processes such as protein synthesis, sequence encoding, RNA transfer, and gene regulation at the transcriptional and post-transcriptional levels. Approximately 6%–8% of all proteins are RNA-binding proteins (RBPs). Distinguishing these RBPs or their binding residues is a major aim of structural biology. Previously, a number of experimental methods were developed for the determination of protein–RNA interactions. However, these experimental methods are expensive, time-consuming, and labor-intensive. Alternatively, researchers have developed many computational approaches to predict RBPs and protein–RNA binding sites, by combining various machine learning methods and abundant sequence and/or structural features. There are three kinds of computational approaches, which are prediction from protein sequence, prediction from protein structure, and protein-RNA docking. In this paper, we review all existing studies of predictions of RNA-binding sites and RBPs and complexes, including data sets used in different approaches, sequence and structural features used in several predictors, prediction method classifications, performance comparisons, evaluation methods, and future directions.
    [Show full text]