GENETIC ANALYSIS OF RARE EYE DISORDERS IN PAKISTANI FAMILIES
By
MUHAMMAD ARIF NADEEM SAQIB
Department of Biochemistry Faculty of Biological Sciences Quaid-i-Azam University Islamabad, Pakistan 2015 GENETIC ANALYSIS OF RARE EYE DISORDERS IN PAKISTANI FAMILIES
A thesis Submitted in the partial fulfillment of the Requirements for the degree of DOCTOR OF PHILOSOPHY In BIOCHEMISTRY/MOLECULAR BIOLOGY By
MUHAMMAD ARIF NADEEM SAQIB
Department of Biochemistry Faculty of Biological Sciences Quaid-i-Azam University Islamabad, Pakistan 2015
CERTIFICATE
A thesis submitted in the partial fulfillment of the requirements for the degree of the Doctor of Philosophy. We accept this dissertation as conforming to the required standard.
1 ______2______Dr. Muhammad Ansar External Examiner (Supervisor)
3 ______Dr. Muhammad Ansar (Chairperson)
Dated: February 09, 2015
DECLARATION
I hereby declare that the work presented in the following thesis is my own efforts and that the thesis is my own composition. No part of the thesis has been previously presented for any other degree.
Muhammad Arif Nadeem Saqib
Dedicated
To
Muhammad Romman Khan (Late) My Son, who died during the journey of my PhD
ACKNOWLEDGEMENT
All praise to Allah Almighty, the most beneficent, the most merciful, Who gave me strength and enabled me to undertake and execute this research task. Countless salutations upon the Holy Prophet Hazrat Muhammad (Sallallaho Allaihe Waalahe Wassalum), the city of knowledge for enlightening with the essence of faith in Allah and guiding the mankind, the true path of life.
I would like to extend my appreciation to those people, who helped me in one way or another to finish the thesis. It is a pleasure to convey my gratitude in my humblest acknowledgment to those people who contributed to make the thesis.
I feel highly privileged in taking the opportunity to express my deep sense of gratitude to the Dr. Muhammad Ansar, Chairperson and Associate Professor, Department of Biochemistry, Faculty of Biological Sciences, QAU, Islamabad, for his scholastic guidance and valuable suggestions throughout the study and presentation of this dissertation. I am thankful to him for his inspiration, reassurance, counseling from time to time and specially a friendly environment.
I am thankful to Dr. Carlo Rivolta, Assistant Professor, Department of Medical Genetics, University of Lausanne, Lausanne, Switzerland, who provided me opportunity to work in his lab under International Research Support Initiative Program of Higher Education Commission, Pakistan. He remained very kind and boosted my scientific skills.
I am obliged to Dr. Bushra Mirza, Ex-Chairperson, Department of Biochemistry, Faculty of Biological Sciences, Quaid-i-Azam University (QAU), Islamabad, for extending the research facilities of the department to accomplish this work.
I am also obliged to my all teachers who contributed a lot in my studies, especially to Dr. Azra Khanum, Prof of Biochemistry and Sir Sharif Amjad, Science Teacher, Government High School, Ghangwal.
Special thanks to Dr. Huma Qureshi, Executive Director, PMRC, Islamabad, Dr. Arif Munir, Principal Research Officer, PMRC, Islamabad and Ibrar Rafique, Research Officer, PMRC, Islamabad who provided a lot of scientific insights and help in learning the research writing. Heartiest and sincerest acknowledgement also goes to Higher Education Commission of Pakistan for granting me Indigenous as well as IRSIP (for foreign research support) scholarship, without which this achievement was not possible. We would like to particularly thank all members of the families that participated in this study for their invaluable participation and cooperation
I am also thankful to my lab fellows Dr. Muzamal Ahmad Khan, Falak Sher, Rani Sara, Noureen Aslam, Waleed Ahmed Khan, Naeem Ashraf, Madiha Amin, Neelum Shah, Jamil Iqbal, Sumaira Anjum, Nikhat Siddique, Muhammad Nawaz, Farah Fatima, Rabia, Mehwish, Benish, Jawad Akhtar, Kinza Makhdoom, Sundus Sajid, Khalid Khan, Afeefa Jarral, Noor Han, Zoma Khan, Zainab Akram, Riffat and Memoona Rasheed, who assist me in various ways during my research work
Thanks to all the colleagues in Carlo’s lab, especially Konstantinos Nikopoulos, Giulia Venturini, Hanna Koskiniemikundig, Alessandro DI Gioia, Paola Benaglio, Pietro Farinelli, Rosanna Pescini Gobert, Nicola Bedoni, and Beryl Royer-Bertrand for their support and company.
Thanks to my friends Ehsan Ullah, Ahmad Waqas, Muhammad Umair, Younus Khan, Haroon Khan, Safdar Abbas, Waqas Kayani for their company, encouragement, concern, laughters stories and for taking their time to listen to everything that I had to say. Special thanks to Dr. Rizwan Alam, Dr. Khalid Khan, Dr. Muhammad Jadoon Khan for their company and time to visit different cities of Europe. It was really pleasant to visit them and see the beauty of Europe.
I would like to acknowledge the clerical staff of the Department of Biochemistry especially to Mr. Tariq, Fayaz, Saeed and other staff members for their support and help. I would also like to thank Mr Saeed Ahmad Shahid, Hafiz Saqib, Junaid.
Last but not least all goes to my mother (late), who enlightened me and whose prayers still remained in search of my successes. She will remain always alive in my heart. My loving father, Hafiz Abdul Hameed, who remained a guide through my studies and provided me his best, my elder brother, Hafiz Ahmad Tariq, who gave me the strength and courage and provided all opportunities to achieve this task, my younger brother, Hafiz Atif Naveed, who is always a source of joy and provide his best for my leisure times, my all sisters who deserve special mention for their inseparable support and prayers throughout my life. It wouldn’t have been this bearable if I didn’t have these in my life. Thank you for your unconditional support with my studies. Thank you for giving me a chance to prove and improve myself through all walks of my life. Bundle of thanks to my uncle, Abdul Waheed Zafar, and Mian Mehboob ur Rasool (Late), brother in laws (Bhai Ihsan, Bhai Akhtar, Qamar Bhai, Bhai Sohail, Bhai Waqas, Mustansar, Sohaib and Yasir Din) and cousins for providing their continuous support. Special thanks to my beloved wife for her love, devotion and constantly reminding me to take care of myself. Special thanks to Khans (my sons: Muhammad Somaan Khan and Muhammad Affan Khan and my nephews: Muhammad Sinnan Khan and Muhammad Siban Khan) who provides joy by their naughtiest actions. Finally, I would like to thank everybody who was important to the successful completion of the thesis, as well as expressing my apology that I could not mention personally one by one.
Muhammad Arif Nadeem Saqib
______Contents
TABLE OF CONTENTS Pages List of Figures ii List of Tables iv List of Abbreviations vi Abstract xi
CHAPTER 1 1
1.0 Introduction 2
1.1 Rare Eye Disorders 2
1.2 Inherited Retinal Disorders 4
1.3 Rod Associated Retinal Disorders 4
1.3.1 Congenital Stationary Night Blindness 7
1.3.1.1 Genetics of CSNB 7
1.3.1.1.1 Genes Responsible for Complete CSNB 8
1.3.1.1.2 Genes Responsible for Incomplete CSNB 9
1.3.2 Retinitis Pigmentosa 10
1.3.2.1 Genetics of Retinitis Pigmentosa 11
1.3.2.1.1 RP Genes of Phototransduction Cascade 11
1.3.2.1.2 RP Genes of Splicing and Transcription 12
1.3.2.1.3 Ciliary Gene 13
1.4 Cone Associated Retinal Disorders 14
______Genetic Analysis of Rare Eye Disorders in Pakistani Families ______Contents
1.4.1 Achromatopsia 14
1.4.1.1 Genetics of Achromatopsia 15
1.4.2 Cone and Cone Rod Dystrophies 17
1.4.2.1 Genetics of Cone and Cone Rod Dystrophies 17
1.5 Syndromic Retinal Dystrophies 19
1.5.1 Bardet-Biedl Syndrome 19
1.5.2 Usher Syndrome 20
1.5.3 Cohen Syndrome 20
Genetic Analysis of Retinal Dystrophies in Pakistani 1.6 21 Families
1.7 Objectives 24
CHAPTER 2 25
2.0 Materials and Methods 26
2.1 Families Studied 26
2.1.1 Clinical and Ophthalmologic Examination 26
2.2 Blood Sampling 27
2.3 Extraction of Genomic DNA from Human Blood 27
2.3.1 DNA Extraction by Organic Method 27
2.3.1.1 Composition of Solutions 28
2.3.2 DNA Extraction by Commercially Available Kit 28
______Genetic Analysis of Rare Eye Disorders in Pakistani Families ______Contents
2.4 Genetic Analysis of Families with Retinal Dystrophies 29
2.4.1 Homozygosity Mapping Using Microsatellite Markers 29
2.4.1.1 Polymerase Chain Reaction (PCR) and Genotyping 30
2.4.1.2 Composition of 8 % Polyacrylamide Gel (50 mL) 30
2.4.2 Homozygosity Mapping using SNPs 31
2.5 DNA Sequencing 32
2.5.1 Amplification of PCR Product 32
2.5.2 Purification of PCR Product 32
2.5.3 Sequencing PCR 33
2.5.4 Purification of Sequencing Reaction 34
2.6 Mutation Analysis 34
2.6.1 Bioinformatics Analysis of Novel Mutations 35
2.6.2 In vitro Analysis of Splice Site Variant 35
2.6.2.1 Amplification of Targeted Exon and its adjacent Regions 35
2.6.2.2 T/A Cloning 36
2.6.2.3 Transformation 36
2.6.2.4 Plasmid Extraction 37
2.6.2.5 Hela Cell Transfection 37
2.6.2.6 RNA Extraction 38
______Genetic Analysis of Rare Eye Disorders in Pakistani Families ______Contents
2.6.2.7 cDNA Synthesis and RT-PCR 39
2.7 Deletion Breakpoint Mapping of VPS13B/COH1 39
CHAPTER 3 55
3.0 Achromatopsia 56
3.1 Description of Families 57
3.2 Clinical Presentation of Families 57
3.3 Homozygosity Mapping and Genetic Analysis 58
3.4 DNA Sequencing and Bioinformatic Analysis of Variants 59
3.5 Discussion 61
CHAPTER 4 82
4.0 Retinitis Pigmentosa 83
4.1 Description of Families 84
4.2 Clinical Presentations of RP Families 84
Homozygosity Mapping and Linkage Analysis of RP 4.3 85 Families
4.4 DNA Sequencing and Bioinformatics Analysis of Variants 86
4.5 In vivo Splicing Analysis of CNGB1 Mutation 87
4.6 Discussion 88
CHAPTER 5 106
5.0 Cone Rod Dystrophies 107
______Genetic Analysis of Rare Eye Disorders in Pakistani Families ______Contents
5.1 Description of Families 108
5.2 Clinical Presentation of Families 108
5.3 Homozygosity Mapping and Linkage Analysis of Families 108
5.4 DNA Sequencing and Bioinformatic Analysis of Variant 109
5.5 Discussion 110
CHAPTER 6 121
6.0 Syndromic Retinal Dystrophies 122
6.1 Description of Families 123
6.2 Clinical Description of Families 123
Homozygosity mapping and Linkage analysis of the 6.3 124 Families
6.4 DNA Sequencing and Bioinformatics Analysis 124
6.4.1 Deletion Break Point Mapping 125
6.5 Discussion 126
CHAPTER 7 139
7.0 Conclusion 140
CHAPTER 8 142
8.0 References 143
9.0 APPENDIX 167
______Genetic Analysis of Rare Eye Disorders in Pakistani Families ______List of Figures
LIST of FIGURES
S. No Title Page No
Figure 1.1 Schematic cross section of retina 5
Figure 1.2 Schematic presentation of three major vision processes 6
Figure 2.1 Schematic presentation of workflow 41
Figure 3.1 Pedigrees of five ACHM families 65
Figure 3.2 Fundus photographs of ACHM probands 66
Image of SNP data analyzed by homozygositymapper Figure 3.3 68 of family A
Figure 3.4 Haplotype of family A 71
Image of SNP data analyzed by homozygositymapper Figure 3.5 72 of family B Image of SNP data analyzed by homozygositymapper Figure 3.6 74 of family C
Figure 3.7 Haplotype of family D 76
Figure 3.8 Haplotype of family E 77
Electropherograms of mutations identified in CNGA3 Figure 3.9 78 in ACHM families
Figure 3.10 Alignment of CNGA3 with orthologous proteins 79
Figure 3.11 Predicted 3D structure of CNGA3 (240–460 AA) 80
Figure 3.12 Electropherograms of mutation identified in CNGB3 81
Figure 4.1 Pedigrees of four RP families 92
Figure 4.2 Fundus appearance of probands of RP Families 93
______Genetic Analysis of Rare Eye Disorders in Pakistani Families ii
______List of Figures
Image of SNP data analyzed by homozygositymapper Figure 4.3 95 of family F Image of SNP data analyzed by homozygositymapper Figure 4.4 98 of family G Image of SNP data analyzed by homozygositymapper Figure 4.5 100 in family H Image of SNP data analyzed by homozygositymapper Figure 4.6 102 of family I Electropherograms of mutations identified in RP Figure 4.7 104 families Agarose gel electrophoresis and schematic presentation Figure 4.8 105 of new splice site
Figure 5.1 Pedigrees of two CRD families 113
Figure 5.2 Fundus photographs of CRD probands 115
Image of SNP data analyzed by homozygositymapper Figure 5.3 116 of family J Image of SNP data analyzed by homozygositymapper Figure 5.4 118 of family K
Figure 5.5 Electropherograms of mutation identified in family J 119
Sequence alignment of RPGRIP1 with other Figure 5.6 120 orthologous proteins
Figure 6.1 Pedigrees of two syndromic retinal dystrophy families 129
Computed tomographic images of proband V-1 of Figure 6.2 130 family L
Figure 6.3 Fundus appearance of family M 133
Figure 6.4 Haplotype of family L 135
The gel photograph of multiplex PCR product of Figure 6.5 137 family M Ideogram of chromosome 8, indicating location of Figure 6.6 138 VPS13B at 8q22
______Genetic Analysis of Rare Eye Disorders in Pakistani Families iii
______List of Tables
LIST of TABLES
S. No Title Page No
Table 2.1 List of microsatellite markers used for ACHM families 42
List of primers used for the amplification and Table 2.2 43 sequencing of CNGB1 List of primers used for the amplification and Table 2.3 44 sequencing of CNGB3 List of primers used for the amplification and Table 2.4 45 sequencing of PDE6A List of primers used for the amplification and Table 2.5 46 sequencing of RHO List of primers used for the amplification and Table 2.6 46 sequencing of KCNV2 List of primers used for the amplification and Table 2.7 47 sequencing of CNGA3 List of primers used for the amplification and Table 2.8 48 sequencing of RPGRIP1 List of primers used for the amplification and Table 2.9: 49 sequencing of VPS13B List of primers used for the amplification and Table 2.10 51 sequencing of DNM1L List of primers used for the amplification and Table 2.11 52 sequencing of ATP1A List of primers used for the amplification and Table 2.12 53 sequencing of SLC19A List of primers used for the amplification and Table 2.13 53 sequencing of KCNJ10 List of primers used for the amplification and Table 2.14 54 sequencing of CRYAA List of primers used for the identification of deletion Table 2.15 54 breakpoint in VPS13B
Table 3.1 Clinical description of ACHM families 67
Description of homozygous regions identified in Table 3.2 69 ACHM families
______Genetic Analysis of Rare Eye Disorders in Pakistani Families iv ______List of Tables
Two-point and multipoint LOD scores for several Table 3.3 70 markers on chromosome 1in family A Two point and multipoint LOD score for several Table 3.4 73 markers on chromosome2 in family B Two-point and multipoint LOD scores for several Table 3.5 75 markers on chromosome 8 in family C
Table 4.1 Description of clinical presentation of RP families 94
Description of homozygosity regions identified in RP Table 4.2 96 families Two-point and multipoint LOD scores for several Table 4.3 97 markers on chromosome 12 in family F Two-point and multipoint LOD scores for several Table 4.4 99 markers on chromosome 16 in family G Two-point and multipoint LOD scores for several Table 4.5 101 markers on chromosome 5 in family H Two-point and multipoint LOD scores for several Table 4.6 103 markers on chromosome 3 in family I
Table 5.1 Clinical description of CRD families 115
Description of homozygous regions identified in CRD Table 5.2 117 families
Table 6.1 Clinical features of affected members of family L 131
Table 6.2 Clinical features of affected members of family M 132
Description of homozygous regions identified in Table 6.3 134 families L and M Two-point and multipoint LOD scores for several Table 6.4 136 markers on chromosome 21 in family L
______Genetic Analysis of Rare Eye Disorders in Pakistani Families v ______List of Abbreviations
LIST of ABBREVIATIONS
µg Micro gram µL Micro litre µM Micro molar ABCA4 ATP-Binding cassette, subfamily A, member 4 ACHM Achromatopsia adCORD Autosomal dominant cone and rod dystrophy adRP Autosomal dominant retinitis pigmentosa AIPL1 Arylhydrocarbon-interacting receptor protein-like 1 ARL6 ADP-ribosylation factor-like 6 arRP Autosomal recessive retinitis pigmentosa ATP1A2 ATPase, Na+/K+ transporting, alpha 2 polypeptide ATPase Adenosine Triphosphate BBS Bardet Biedl Syndrome bCNGA3 Bovine cyclic nucleotide gated channel protein alpha 3 CABP4 Calcium binding protein 4 CACNA1F Calcium channel, voltage-dependent, alpha 1F subunit CACNA2D4 Calcium channel, voltage-dependent, alpha 2/delta subunit 4 cAMP Cyclic adenosine monophosphate CDH23 Cadherin-related 23 cDNA Complementary deoxyribonucleic acid CDs Cone disorders CEP290 Centrosomal protein, 290 KD CERKL Ceramide kinases-like cGMP Cyclic guanosine monophosphate cGTP Cyclic gaunosine triphosphate CHX10 Homeo domain-containing homolog CLRN1 Clarin 1 cM Centi Morgan CNG Cyclic nucleotide gated channel CNGA1 Cyclic nucleotide gated channel protein alpha 1 CNGA2 Cyclic nucleotide gated channel protein alpha 2
______Genetic Analysis of Rare Eye Disorders in Pakistani Families vi ______List of Abbreviations
CNGA3 Cyclic nucleotide gated channel protein alpha 3 CNGB1 Cyclic nucleotide gated channel protein beta 1 CNGB3 Cyclic nucleotide gated channel protein beta 3 COH1 Cohen syndrome 1 CRB1 Crumbs drosophila homolog 1 CRD Con rod dystrophy CRD Cone rod dystrophy CRX Cone rod homobox protein CRYAA Crystallin alpha A CS Cohen syndrome CSNB Congenital stationary night blindness DMEM Dulbecco`s modified eagle medium DNA Deoxyribonucleic acid DNM1L dynamin 1-like dNTP Deoxyribonucleotide triphosphate DTCS Dye termination cycle sequencing EDTA Ethylene-diamine-tetra-acetic acid ERG Electroretinography FCS Fetal calf serum FSCN2 Fascin actin-bundling protein 2 GDP Guanosine diphosphate GNAT1 Guanine nucleotide-binding protein, alpha-transducing activity polypeptide 1 GNAT2 Guanine nucleotide-binding protein G(t) subunit alpha-2 GPR179 G protein-coupled receptor 179 GRK1 G protein-coupled receptor kinase 1 GRM6 Glutamate receptor, metabotropic GTP Guanosine triphosphate GUCA1A Guanylate cyclase activator 1A GUCA1B Guanylate cyclase activator 1B GUCY2D Guanyalte cyclase 2D HEK293 Human embryonic kidney cells293 HPRP3 PRP3 pre-mRNA processing factor 3 homolog
______Genetic Analysis of Rare Eye Disorders in Pakistani Families vii ______List of Abbreviations
IMPDH1 Inosine -5-Prime monophospate dehyrogenase K+ Potassium ion Kb Kilo bases KCl Potassium chloride KCNJ10 Potassium channel, inwardly rectifying subfamily J 10 LCA Leber congenital amaurosis LCA5 Leber congenital amaurosis 5 LRAT Lecithin retinol acyl transferase LRIT3 leucine-rich repeat, immunoglobulin-like and transmembrane domains 3 MAK Male germ cell-associated kinase MERTK c-mer proto-oncogene tyrosine kinase
MgCl2 Magnesium chloride mL Milli litre mM Milli molar mRNA Messenger RNA N- Terminus Amino terminus Ng Nano gram NR2E3 Nuclear receptor subfamily 2, group E, member 3 NRL Neural retina leucine zipper NYX Nyctalopin PAHX Phytanoyl-CoA dioxygenase, peroxisomal PBS Phosphate buffer saline PCDH15 Protocadherin-15 PCDH21 Protocadherin-21 PCR Polymerase chain reaction PDE Photodiesterase PDE6 Phosphodiesterase 6 PDE6A Phosphodiesterase 6 alpha PDE6B Phosphodiesterase 6 beta PDE6C Phosphodiesterase 6C, cGMP-specific, cone, alpha- prime pH -log[Hydrogen]
______Genetic Analysis of Rare Eye Disorders in Pakistani Families viii ______List of Abbreviations
PROM1 Pominin 1 PRPC8 pre-mRNA processing factor 8 homolog PRPF31 Pre-mRNA processing factor 31 PRPF8 Pre-mRNA processing factor 31 PRPH2 Peripherin 2 PRPH2 Pre-mRNA processing factor 2 RD Retinal dystrophy RDH12 Retinol dehydrogenase 12 RDH5 Retinol dehydrogenase 5 RDS Retinal degeneration slow gene RHO Rhodopsin RID RPGR interacting domain RIM1 Mitochondrial single-stranded DNA binding protein Rim1 RLBP1 Retinaldehyde binding protein 1 RNA Ribonucleic acid ROL Retinaol ROM1 Rod outer segment protein 1 RORB RAR-related orphan receptor beta RP Retinitis pigmentosa RP1 Retinitis pigmentosa 1 RP2 Retinitis pigmentosa 2 RP25 Retinitis pigmentosa 25 RP3 Retinitis pigmentosa 3 RPE Retinal pigment epithelium RPE65 Retinal pigment epithelium specific 65 kDa Protein RPGR Retinitis pigmentosa GTPase regulator RPGRIP1 Retinitis pigmentosa GTPase regulator interacting protein 1 Rpm Revolutions per minute RXR Retinoid X receptor SAG S-antigen SDS Sodium dodecyl sulphate
______Genetic Analysis of Rare Eye Disorders in Pakistani Families ix ______List of Abbreviations
SEMA4A Semaphorin 4A SLC19A2 Solute carrier family 19, member 2 SLC24A1 Solute carrier family 24, member 1 SNP Single nucleotide polymorphism snRNAs Small nuclear ribonucleic acids STGD Stargardt disease T Thymine Taq Thermus aquaticus TBE Tris borate EDTA TE Tris- EDTA TEMED Tetra methyl ethylene diamine TRB2 Telomere repeat binding factor 2 TRPM1 Transient receptor potential cation channel, subfamily M, member 1 TTC8 Tetratricopeptide repeat domain 8 TULIP1 Tubby like Protein 1 TULIP1 Ral GTPase-activating protein, alpha subunit 1 UCSC University of California Santa Cruz UK United Kingdom USA United States of America USH Usher syndrome USH1C Usher syndrome type 1C USH1D Usher syndrome type 1D USH1F Usher syndrome type 1F USH1G Usher syndrome type 1G USH2D Usher syndrome type 2D USH3A Usher syndrome type 3A UV Ultraviolet XLCORD X-linked cone-rod dystrophy XLRP X-Linked retinitis pigmentosa
______Genetic Analysis of Rare Eye Disorders in Pakistani Families x Abstract
ABSTRACT
Rare diseases affect a few individuals of the population and generally have an incidence of about 0.65-1% of the total population. Most of these rare diseases are genetic in nature and about 6000-7000 different rare genetic disorders have been documented. Among them, the inherited retinal dystrophies (both syndromic and non syndromic) are more frequent and affect thousands of individuals worldwide. In order to provide clinical intervention for these inherited retinal diseases, detailed information of disease-causing genetic defects and their pathophysiologic mechanism(s) is mandatory. This is only possible by knowing disease-causing genes and mutations along with their impact on the functionality and survival of the affected cells. The clinical and genetic description of retinal dystrophies is very heterogeneous and many causative genes are still unknown in a significant number of patients/families. With this in mind, this study was planned to explore the genetic defects causing rare eye diseases in 13 Pakistani families.
A total of 13 families (A-M) presenting different kinds of inherited retinal dystrophies were explored in clinical and genetic analysis. The detailed clinical data along with fundus examination of the proband from each family was carried out to conclude initial diagnosis. The DNA samples of affected and normal individuals of 11 families were subjected to homozygosity mapping using whole genome single nucleotide polymorphism (SNP) analysis, while two families were analyzed using STS markers. The identified regions of homozygosity were explored for known retinal phenotype causative genes which were then subjected to Sanger sequencing. Similarly, the identified variants were analyzed for their pathogenicity using in silico and in vitro approaches.
The clinical presentations of five families (A-E) were consistent to achromatopsia which include photophobia, nystagmus, color vision defects and onset before the age of two years. The fundus examination of the proband of each family also supported this initial diagnosis. Homozygosity mapping using whole genome SNP analysis revealed co-segregation of a novel region of homozygosity of 15.12-Mb on chromosome 1q23.1-q24.3 in family A with a statistically significant LOD score of 3.6. However, the sequencing of candidate genes (ATPIA2, SLC19A2, and KCNJ10) did not identify any pathogenic variant. The remaining three families (B, D and E)
Genetic Analysis of Rare Eye Disorders in Pakistani Families xi Abstract were linked to CNGA3 gene and Sanger sequencing identified two novel homozygous mutations, i.e. c. 937G>C and c. 827A>G in family B and D respectively, and a recurrent mutation c. 1306C>T in family E. The family C was linked to CNGB3 and sequence analysis in this family revealed a known mutation c.646C>T. All mutations show segregation in respective families and were absent in the public databases.
The clinical examination of affected individuals in four families (F-I) showed night blindness, gradual day vision loss and fundus examination revealed presence of retinal pigmentation along with attenuated retinal vessels and were diagnosed with retinitis pigmentosa. In family F, the whole genome SNPs analysis identified single peak of homozygosity on chromosome 12. The detailed analysis revealed co-segregation of a 2.98 Mb homozygous region in all affected individuals, however sequencing of candidate gene (DNM1L) did not identify any pathogenic variant. In the remaining three families G, H and I, the homozygosity mapping showed autozygous regions which harbor the known RP genes, i.e. CNGB1, PDE6A and RHO, respectively. Sequencing of CNGB1 revealed presence of a novel pathogenic variant c.413-1G>A (IV6-1G>A) in family G. However, sequencing of PDE6A and RHO led to identification of recurrent mutations, i.e. c. 1407-2 A>G (IVS10-2A>G) and c. 448G>A (p. Glu150Lys) in families H and I, respectively. The in vitro analysis of novel splice variant c. 413-1G>A, identified in family G, was carried out using minigene assay, which revealed the creation of a new splice site resulting in frameshift mutation and a premature stop codon (C139Afs*132X).
The analysis of clinical presentation of patients from families L and M showed the segregation of syndromic forms of retinal dystrophy. The affected individuals from family L presented night blindness since early childhood, progressive day vision loss and abnormal fundus. Besides retinal degeneration, these affected individuals also presented intellectual disability which was apparent from the lack of qualitative and learning abilities, absence of self caring and depend on parents for routine action. Their clinical presentation was similar to the Joubert syndrome, but due to the absence of molar tooth sign in brain images, the phenotype in family L was categorized as retinitis pigmentosa intellectual disability. The whole genome SNP mapping showed co-segregation of a novel homozygous region of 3.22 Mb on chromosome 21. The linkage analysis showed a significant LOD score of 3.46 indicating the potential involvement of a novel gene in this family. However, sequencing a candidate gene,
Genetic Analysis of Rare Eye Disorders in Pakistani Families xii Abstract i.e. CRYYA, related to the retinal phenotype, did not identify any pathogenic variant. The clinical presentation of patients from family M was consistent with Cohen syndrome. The whole genome SNP analysis showed an autozygous region harboring the known Cohen gene, i.e. VPS13B. Later, chromosomal walking and DNA sequencing identified a 51,027 bp deletion between g.100,728,884 to g.100,779,911 (hg19:g.chr8:100728884_chr8:100779911 del) which probably results in a truncated protein, i.e., p.Gly2177Alafs*16.
Overall, homozygosity mapping of 13 retinal dystrophies families revealed autozygous regions harboring known retinal dystrophy genes in 10 families. Pathogenic genetic variants were identified in 09 families, indicating a success rate of 69%. Similarly, in 03 families, novel homozygous regions have been identified which co-segregate in the respective families and probably indicate the involvement of additional genes for non syndromic and syndromic retinal dystrophies. In brief, identification of pathogenic genes and variants provides a strong evidence for the application of homozygosity based mapping and screening of known genes in retinal dystrophy patients having a history of consanguinity. Identification of disease genes or mutations in unsolved families will eventually elucidate new disease mechanisms.
The work presented in thesis has resulted in the following publications:
1. Saqib MA, Awan BM, Sarfraz M, Khan MN, Rashid S, Ansar M. Genetic analysis of four Pakistani families with achromatopsia and a novel S4 motif mutation of CNGA3. Jpn J Ophthalmol. 2011; 55(6):676-680.PMID: 21912902. 2. Saqib MA, Nikopoulos K, Ullah E, Khan FS, Iqbal J, Bibi R, Jarral A, Sajid S, Nishiguchi K, Venturini G, Ansar M, Rivolta C. Homozygosity mapping as a means to reveal novel and known mutations in Pakistani families with inherited retinal dystrophies. Sci Rep. 2015 6; 5:9965. PMID: 25943428. 3. Rafiq MA, Leblond LS, Saqib MA, Vincent Ak, Ambalavanan A, Khan FS, Ayaz M, Shaheen N, Spiegelman D, Ali G, Amin-ud-din M, Laurent S, Mahmood H, Christian M, Ali N, Fennell A, Nanjian Z, Egger G, Caron C, Waqas A, Ayub M, Rasheed S, Forgeot d'Arc B, So J, Brohi MQ, Mottron L, Ansar M, Vincent JB and Xiong L. Novel VPS13B Mutations in Three Large Pakistani Cohen Syndrome Families Suggests a Baloch Variant with Autistic- Like Features. BMC Med Genet. 2015, 25; 16:41. PMID: 26104215.
Genetic Analysis of Rare Eye Disorders in Pakistani Families xiii Abstract
Genetic Analysis of Rare Eye Disorders in Pakistani Families xiv Introduction Chapter 1
CHAPTER 1
INTRODUCTION
Genetic Analysis of Rare Eye Disorders in Pakistani Families 1 Introduction Chapter 1
1. INTRODUCTION
The diseases that affect few individuals of the population are known as rare diseases. However, there is no specific guideline to define a disease as rare because certain diseases may be rare in one community or region but common in other regions or communities. According to the World Health Organization (WHO), any disease which has an incidence of about 0.65-1% of the entire population will be considered as a rare disease. However, the definition of rare disease varies in different countries and depends upon their population size and disease occurrence. In the United States (US), the disease that affects less than 200,000 which is approximately 0.75% of the population is defined as a rare disease, but in Japan, a rare disease is defined which inflicts less than 50,000 individuals, i.e. 0.4% of the Japanese population. Despite the facts that rare diseases affect few individuals, the overall diseased cases make a major proportion worldwide. It has been reported that only in the US and European Union, about 30 million individuals had rare diseases in each of these regions, while in China, the estimated prevalence is over 10 million. These figures indicate the severity and overall occurrence of rare diseases in the world (Tang and Makuuchi, 2012; Song et al., 2012; Gao et al., 2013).
About 75% of rare diseases affect children resulting in a huge burden on the well- being of families. About 30% of these children die within 5 years of age, which poses a significant burden on the health care system. Majority of the rare diseases are genetic and about 6000-7000 different rare genetic disorders have been documented to date. The molecular bases of the majority of these diseases have been identified using linkage mapping and candidate gene analysis. However, the invention of new gene identification approaches like microarray based whole genome analysis and next generation sequencing have accelerated the pace and helped in solving the molecular etiology of many unresolved rare genetic diseases. The causative genetic agent of >3,500 rare diseases has been identified while it is being predicted that the genetic etiology of all these rare defects will be solved till 2020 (Dodge et al., 2011; Boycott et al., 2013).
1.1 Rare Eye Disorders
The human eye is a more sophisticated and complex organ which consists of different components having a unique and collaborative function. Among these, the retina is
Genetic Analysis of Rare Eye Disorders in Pakistani Families 2 Introduction Chapter 1 the most specialized component, consisting of multiple layers of specialized cells, including photoreceptors, i.e. rod and cone cells (Figure 1.1). Each photoreceptor is made up by synaptic region, cell body and inner and outer segments. The rod photoreceptors work in dim light while cone photoreceptors work in light and perceive different colors. Rod photoreceptors are abundant and constitute 20 times more than a cone. The cones are more concentrated near the central part of the retina. The integrity and metabolic needs of photoreceptors are maintained through the microvilli like process which establishes a contract between the retinal pigment epithelium (RPE) and photoreceptor outer segment. Both neural retina and RPE collectively work in order to process a light induced signal to brain (Masland, 2001; Schulz et al., 2004; Masland, 2012).
At the molecular level, different pathways are involved in the photoreceptors including the three major pathways, i.e. retinoid cycle, phototransduction cascade and ciliary transport (Figure 1.2). The retinoid cycle involves photoisomerization of 11- cis-retinal in photoreceptors and enzymatic regeneration in RPE. The phototransduction cascade also takes place in photoreceptors in which amplification of signal is carried out by transducin and phosphodiesterases by hyper-polarization of the membrane. Similarly, the cilium transport of the cells along the connective tissue from the outer segment to inner segment also occurs in the photoreceptors. These pathways are complex, involving a number of interconnected proteins which perform intricate and precise function within the photoreceptors. Along with these activities, there is a continuous replenishing of photoreceptor disk in the retina, which requires a high protein turn over along with increased metabolic demands and is regulated by a vigilant quality control and maintenance system (den Hollander et al., 2010; Athanasiou et al., 2013).
Besides the strong adaptive system of retina to cope different insults, it is always under continuous stress and is vulnerable to damages due to its structural and functional complexity. Different rare inherited retinal dystrophies have been reported which include retinitis pigmentosa, congenital stationary night blindness, achromatopsia, cone dystrophies, cone rod dystrophies etc. Although these retinal dystrophies belong to rare eye defects, but these are more prominent affecting more than two million peoples in the world (Berger et al., 2010). Few other rare eye disorders have been described which include the anterior segment conditions
Genetic Analysis of Rare Eye Disorders in Pakistani Families 3 Introduction Chapter 1
(aniridia, axenfeld-rieger malformation and peters anomaly), corneal dystrophies (βig- h3 and meesmann dystrophy), lens disorders (cataract), glaucoma, developmental disorders (anophthalmia, microphthalmia) and eye optic nerve diseases (dominant optic atrophy and leber hereditary optic atrophy) (Ian et al.,2004; Li et al., 2010).
1.2 Inherited Retinal Disorders
Inherited retinal disorders (RDs) are Mendelian degenerative conditions which result due to degeneration of either cone or rod cells or both cone and rod cells and RPE of the retina. These disorders are genetically and phenotypically heterogeneous and most of them lead to progressive visual loss eventually resulting in legal blindness (Martínez-Gimeno et al., 2003; Hamel, 2013).
These may be mild or severe, syndromic or non syndromic, progressive or non- progressive and the onset of these disorders may be at infancy, early childhood, adulthood or later (Hernan et al., 2012). Genetically, these may be either monogenic or digenic with different mode of inheritance, i.e. autosomal recessive, autosomal dominant, X linked or mitochondrial (Kim et al., 2012). Similarly, clinical presentation of these disorders is very diverse and sometimes overlapping, which makes it impossible to differentiate between different types (Bareil et al., 2001).
Retinal molecular genetics have flourished a lot in the last decade due to the availability of advanced molecular techniques and about 190 genes responsible for retinal disorders have been characterized (Becirovic et al., 2010). These disorders are classified either on the basis of sign and symptoms (retinitis pigmentosa) or disease progression (congenital stationary night blindness) or its onset (Leber congenital amaurosis). Similarly, these disorders are also classified on the basis of degeneration of photoreceptors, i.e. rod photoreceptors or cone photoreceptors (Berger et al., 2010).
1.3 Rod Associated Retinal Disorders
Rod photoreceptors are light sensitive cells of the retina and are responsible for low light vision. These are more common than cone photoreceptors (Tsang et al., 2008). Night blindness is primary symptoms of rod associated retinal dystrophies and has been classified as stationary and progressive, i.e. congenital stationary night blindness and retinitis pigmentosa respectively (Estrada-Cuzcano et al., 2012; Siemiatkowska et al., 2012).
Genetic Analysis of Rare Eye Disorders in Pakistani Families 4 Introduction Chapter 1
Figure 1.1: Schematic cross section of the retina showing the 05 layers of the retina and location of different retinal cells (Adapted from Athanasiou et al., 2013).
Genetic Analysis of Rare Eye Disorders in Pakistani Families 5 Introduction Chapter 1
Figure 1.2: Schematic presentation of three major vision processes along with the role of different proteins (Adapted from den Hollander et al., 2010).
Genetic Analysis of Rare Eye Disorders in Pakistani Families 6 Introduction Chapter 1
1.3.1 Congenital Stationary Night Blindness
Congenital stationary night blindness (CSNB) is a non progressive retinal dystrophy in which patients have night blindness and the day vision remains intact. The clinical picture of CNSB includes non-progressive nyctalopia, normal fundus and without the pigmentation of the retina. In few patients the fundus may be pale or tilted (Moradi and Moore, 2007). Other symptoms include decreased visual acuity, strabismus and myopia, but are rare (Bech-Hansen, 1998). Recently it has been reported that poor visual acuity is one of the major complaint of CSNB (Li et al., 2012). It was also reported that X linked and autosomal recessive CSNB patients might have nystagmus, myopia, decreased central vision and strabismus along with a paradoxical pupil response as compared to autosomal dominant cases in which patients normally have nyctalopia with normal visual acuity (Moradi and Moore, 2007).
The CSNB is diagnosed on the basis of electroretinography (ERG) response in which patients have an electronegative response to a bright white flash of a dark adapted eye. On the basis of ERG responses, CSNB has been divided into complete CSNB and incomplete CSNB. In complete CSNB, the b-wave of rod specific ERG is not detectable while longer flashed photopic ERG shows attenuated b-wave amplitude and normal d-wave amplitude. Patients with incomplete CSNB show reduced and attenuated b-wave and d-wave, respectively (Audo et al., 2008).
1.3.1.1 Genetics of CSNB
The genetic of CSNB is heterogeneous and mode of inheritance can be either autosomal recessive, autosomal dominant or X linked. The pathogenicity of CSNB includes defect in signal transmission between photoreceptors and bipolar cells as well as constitutive activation of the visual signal cascade (Singhal et al., 2013; Bijveld et al., 2013). About 17 different genes which include GRM6, TRPM1, GPR179, NYX CACNA1F, CABP4, RHO, GNAT1, PDE6B, LRIT3, RDH5, SAG, SLC24A1, CACNA2D4, RLBP1, GRK1 and RPE65 have been implicated to date, with 360 different mutations with more than 670 affected alleles (Zeitz et al., 2014).
Mutations in GRM6, TRPM1, GPR179 and NYX were reported to be responsible for complete CSNB. These genes are located and expressed in ON bipolar cells and are involved in mGluR6 signaling pathway. Similarly CACNA1F and CABP4 were implicated in incomplete CSNB which are involved in releasing glutamate from
Genetic Analysis of Rare Eye Disorders in Pakistani Families 7 Introduction Chapter 1 photoreceptors. RHO, GNAT1 and PDE6B belong to phototransduction cascade and mutations in these genes have been reported in autosomal dominant CSNB patients (Godara et al., 2012; Lodha et al., 2012).
1.3.1.1.1 Genes Responsible for Complete CSNB
In complete CSNB, the rod specific ERG is not detectable while cone ERG show slight variation than normal indicating involvement of ON pathway. It has been reported that mutations in genes involved in retinal depolarization process of bipolar cells result in complete CSNB. The depolarization cascade in depolarizing bipolar cells is originated by glutamate receptor, metabotropic 6 (GRM6) which modulate transient receptor potential cation channel, subfamily M, member 1 (TRPM1). This process is dependent on nyctalopin (NYX) which is an auxiliary protein and also uses Gαo1 and Gβ5. It has been reported that G protein-coupled receptor 179 (GPR179) is essential for the high sensitivity of the mGluR6 signaling cascade in depolarizing bipolar cells (Ray et al., 2014). Therefore, mutations in genes encoding these proteins have been implicated in complete CSNB.
GRM6 encodes GRM6 which belongs to G protein coupled metabotropic glutamate receptors and are mainly expressed on ON bipolar cells. Mutations in GRM6 resulted in dysfunctional receptors and resulted in complete CSNB. Zeitz et al. (2005) reported both compound and homozygous mutations in GRM6 from three families. Similarly Dryja et al. (2005) also reported mutations in GRM6 in three unrelated patients, which were homozygous nonsense (c. 1861C-T; CGA to TGA), compound heterozygous (c.2122C-T; CAG to TAG) and homozygous missense (c.2341G-A; GAG to AAG) mutations. Wang et al. (2012) screened 24 unrelated CSNB patients for known CSNB genes and reported two mutations in GRM6. One mutation c.1267T>C (p.Cys423Arg) was novel while the second was a known heterozygous variation c.1537G>A (p.Val513Met). Similarly, Bijveld et al. (2013) screened 101 Dutch CSNB patients and reported 5 different mutations in GRM6.
NYX is most commonly associated with X linked CSNB. NYX encodes a proteoglycan known as nyctalopin which has leucine rich repeats. This protein is involved in retinal protein interaction along with structural and developmental role in ON pathway. During screening of 101 Dutch CSNB patients, Bijveld et al. (2013) identified mutations in a NYX gene in 20 male patients. Similarly mutation screening of different
Genetic Analysis of Rare Eye Disorders in Pakistani Families 8 Introduction Chapter 1
CSNB genes led to the identification of three novel hemizygous mutations in NYX which includes c. 92G>A (p. Cys31Tyr), c. 149G>C (p. Ary50Pro), and c. 272T>A; 1429G>C (p. Leu91Gln; Gly477Arg) (Wang et al., 2012).
TRPM1 belongs to the vertebrate TRP channel encoding genes and play important role in the visual transduction in retinal ON bipolar cells. Nakamura et al. (2010) reported 05 mutations in TRPM1 from three patients in a compound heterozygous state which includes IVS2–3C>G, IVS8+3_6delAAGT, R624C (c.187>T), S882X (c.2645C>A), and F1075S (c.3224T>C). Fundus was normal in all patients except little myopic variations while ERG revealed “negative-type” pattern with normal a- wave and decreased b-wave response. Recently, molecular profiling of Indian CSNB families showed TRPM1 as a major genetic player (Malaichamy et al., 2014).
Mutations in GPR179 have also been reported in complete CSNB patients. Audo et al. (2012) reported a missense mutation (c.1807C>T) that resulted in a p.His603Tyr change in a consanguineous family. They also found a frameshift mutation (c.278delC) which created a stop codon, i.e. p.Pro93Glnfs*57 in a single CSNB case. Further screening of 40 unrelated cases of complete CSNB also led to the identification of 03 mutations in this gene. Similarly, Peachey et al. (2012) reported two mutations in complete CSNB patients. One patient had a compound heterozygous frameshift mutation (c.187delC and c.984delC) resulting in a truncated protein. The second patient also had a frameshift mutation (c.984delC) along with a missense mutation (c.659A>G) replacing tyrosine with cysteine (p.Tyr220Cys).
1.3.1.1.2 Genes Responsible for Incomplete CSNB
In incomplete CSNB, rod specific ERG is detectable while cone ERG is abnormal which indicates problem in both ON and OFF bipolar pathways. This assumption is supported by the fact that most of the genes implicated in incomplete CSNB encode proteins with an obvious role in both ON and OFF bipolar pathways.
CACNA1F is expressed in inner and outer nuclear layers as well as in the ganglion cell layer. This encodes α1F subunit of voltage gated L type calcium channel which is a retina specific protein and responsible for Ca influx which help in releasing neurotransmitter from pre-synaptic terminal (McRory et al., 2004). Majority of CACNA1F mutation results in protein truncation leading to the loss of function. This disrupts the transmembrane polarization and retina remains in light stimulated state
Genetic Analysis of Rare Eye Disorders in Pakistani Families 9 Introduction Chapter 1 making patients unable to adjust in the dark (An et al., 2012; Hauke et al., 2013). Lodha et al. (2012) screened 199 CSNB patients and reported 69 mutations in the CACNA1F gene. In a Dutch study, CACNA1F mutations were identified in 55 patients from 37 families making this gene as the hot spot for incomplete CSNB.
CABP4 belongs to a family of calcium-binding proteins of the retina, which is present at the synaptic terminal of photoreceptors and plays a key role in photoreceptor synaptic function. Zeitz et al. (2006) reported two mutations in two families suffering from autosomal recessive incomplete CSNB. In one family there was a homozygous deletion of two nucleotides (c.800_801delAG) which either resulted in a translational frameshift or splice site variation. Recently, genetic screening of several Dutch families showed a homozygous mutation in the CABP4 gene (Bijveld et al., 2013).
1.3.2 Retinitis Pigmentosa
Retinitis pigmentosa (RP) is a common hereditary eye defect which results in progressive degeneration of the retina (Petrs-Silva and Linden, 2014). Almost two million people are suffering from RP worldwide with a proportion of 1 in 3000 individuals (Shintani et al., 2009; Roska et al., 2013). This disease is both phenotypically and genetically heterogeneous in nature. RP is progressive and degenerative in nature. Initially patients suffer from night blindness but due to pigmentary changes in the retina, there is gradual and slow day vision loss. In mid- life, patients either go completely blind or have some central vision. The fundoscopy of the retina usually shows bone spicule along with pigment deposition. Likewise, the ERG also has major changes (Rivolta, 2002). However, the clinical presentation of RP varies from patient to patient.
The mode of inheritance of RP is complex, which is either autosomal recessive RP (arRP) or autosomal dominant RP (adRP) or X- linked RP (XLRP). In addition, rare mitochondrial and digenic forms also exist. Mostly RP is inherited as an autosomal recessive trait (Buch et al., 2004). In general, monogenic mutations are responsible for RP, but in a few cases, digenic-diallelic and digenic-triallelic forms of RP are also reported (Kajiwara et al., 1994). The most notable syndromes associated with RP are Usher and Bardet-Biedl syndrome (Prokudin et al., 2014). There is no uniform classification for RP, however this may be classified based on the type of retinal involvement (central, pericentral, sector, or peripheral), age of onset (juvenile or late
Genetic Analysis of Rare Eye Disorders in Pakistani Families 10 Introduction Chapter 1 stage), involvement of body organs, i.e. syndromic or non syndromic and mode of inheritance (arPR, adRP, XLRP) (Shintani et al., 2009).
1.3.2.1 Genetics of Retinitis Pigmentosa
About 56 genes have been implicated in non syndromic RP while 30 genes were reported in syndromic RP, i.e. 12 genes for Usher syndrome and 18 for Bardet- Biedl syndrome (BBS). About 3100 disease causing mutations have been identified in non syndromic RP only (Daiger, 2013). Mutations in about 22 genes have been implicated in autosomal dominant RP (adRP) cases and the majority of these mutations was identified in RHO which accounts for 26.5%, followed by PRPH2 (5-9.5%), PRPF31 (8%) and RP1 (3.5%). In autosomal recessive RP (arRP), 30 genes or loci were reported and the most common variant was identified in RPE65, PDE6A, PDE6B and RP25. Similarly in X linked RP, 06 gene/loci have been identified. The RPGR is the most common variant of X linked RP with an estimated frequency of 30-60%, while RP2 mutations constitute about 10-15% of all X linked RP cases (Ferrari et al., 2011). These genes are very diverse in functionality and are responsible for phototransduction, retinal metabolism, development, maintenance and structural stability of the retina. Similarly, few genes have a key role in transcription and splicing while genes encoding ciliary proteins have also been implicated (Korir et al., 2014).
1.3.2.1.1 RP Genes of Phototransduction Cascade
Phototransduction is the central step in which light waves are changed into electrical signals in rod and cone photoreceptors of the retina. Mutations in genes responsible for normal phototransduction have been implicated in RP including RHO, PDE6A, PDE6B, CNGA1, CNGB1, GUCA1B, RDH12 and SAG.
RHO is an important player in the phototransduction cascade and is the most prominent RP gene with about 161 mutations reported to date and the majority of RHO mutations is responsible for autosomal dominant RP (30-40% of all RP cases) while in few families autosomal recessive RP was also reported. It has been described that the Pro23His variant alone accounts for 10% of all American adRP cases (Ferrari et al., 2011). The severity of the disease in RHO mutation varied from mild to severe and depends on the location and nature of the mutation (Athanasiou et al., 2013).
Genetic Analysis of Rare Eye Disorders in Pakistani Families 11 Introduction Chapter 1
Schuster et al. (2005) reported that mutations in the intradiscal / extracellular (p. Val20Gly) and cytoplasmic domains of RHO result in a mild drop while transmembrane domain mutations (p.Pro215Leu and p.Thr289Pro) lead to severe phenotype.
PDE6A and PDE6B encode rod photoreceptor cGMP phosphodiesterases (PDE6) which are key effector enzyme of the phototransduction cascade in both rod and cone photoreceptors. These are multi subunit enzymes and reduce intracellular cytoplasmic cGMP levels during phototransduction. Kim et al. (2012) reported that the p. H557Y mutation in the PDE6B was most common and responsible for 2.5% of Korean RP cases. Another study conducted on 40 RP patients using gene specific microarray chip, reported mutations in the PDE6A and PDE6B genes (Tsang et al., 2008).
CNGA1 and CNGB1 encode retinal cyclic nucleotide-gated (CNG) channels which are specific for rod cells. These are in fact ion channels which depend upon cGMP or cAMP for their activation and act as cellular switches. They have a critical role in phototransduction process (Schön et al., 2013) and are thus critical for normal vision. Mutations in these cyclic nucleotide-gated channel encoding genes have been implicated in autosomal recessive RP like CNGA1 and CNGB1 and are estimated to be responsible for 1% and 4% of all arRP cases respectively (Hartong et al., 2006; Simpson et al. 2011). Majority of the CNGA1 mutations resulted in the loss of protein function due to truncation or abnormal protein trafficking (Biel and Michalakis 2007).
1.3.2.1.2 RP Genes of Splicing and Transcription
Splicing is a crucial cellular process that occurs in every cell including photoreceptor cells. Tanackovic et al. (2011) reported that mutations in splicing genes affect splicing process by disrupting the stoichiometry of spliceosomal small nuclear RNAs (snRNAs) and its kinetics. They also showed that the level of snRNA and pre mRNA was highest in the retina, which showed increased activity of splicing in retinal cells and was important for retinal survival. Although these mutations have widespread impact on splicing machinery, but may be tolerated by other tissues. Approximately 10% of RP genes are related to splicing, including PRPF3, PRPF31, PRPF8, PAP (Berger et al., 2010). Mutations in PRPF3, PRPF31 and PRPF8 were reported in Spanish families suffering from arRP (Martínez-Gimeno et al., 2003). It was reported
Genetic Analysis of Rare Eye Disorders in Pakistani Families 12 Introduction Chapter 1 that mutations in PRPF31 were responsible for 5% of mixed cohort of adRP cases from the United Kingdom (Waseem et al., 2007).
Photoreceptors are highly specialized cells in the body which are responsible for phototransduction in the eye and have a vigilant gene expression regulation system. This regulatory system involves a number of transcription factors which are centered on the CRX, an Otx-like homeo domain transcription factor. This network is governed by transcription factors which are specifically expressed either in rods, cones or both cells. The rod determining factors includes the neural retina leucine zipper protein (NRL) and the orphan nuclear receptor NR2E3 while the majority of the cone- determining factors belong to nuclear receptor family members such as the thyroid hormone receptor beta2 (TRβ2), the retinoid related orphan receptor (RORβ), and retinoid X receptor (RXR) (Hennig et al 2008). Mutations in the genes CRX, NRL and NR2E3 encoding these factors have been implicated in different types of RP. Hernan et al., (2012) reported that a missense variant (c.287T>C) in NRL which causes adRP in a Spanish family. The functional analysis of this variant along with the cone-rod homeobox (CRX) showed gains of function resulting in an up regulation of RHO promoter.
1.3.2.1.3 Ciliary Gene
The cilia have an important role in every cell and work as antennae of the cell to transfer sensory information. The outer segment and inner segment of photoreceptors are connected via a connecting cilium, which acts as a bridge for phototransducing proteins. It has been estimated that 36% of RP genes belongs to ciliary genes such as ARL6, MAK, RP1, RP2, TTC8, TULP1 etc. (Estrada-Cuzcano et al., 2012). A nonsense mutation c.1012C>T (p.R338*) was identified in exon 4 of RP1 in an Indonesian family suffering from arRP (Siemiatkowska et al., 2012). Similar genetic analysis of 244 Spanish families suffering from arRP showed four novel mutations. Among these mutations, p.Ser542Stop was identified in 11 (4.5%) families, indicating a founder effect (Avila-Fernandez et al., 2012). Abbasi et al. (2008) reported a splice mutation (c.1495+2_1495+3insT) in exon 14 of the TULP1 gene and showed that this mutation results in alternative splicing.
Besides the involvement of genes responsible for the phototransduction cascade, splicing, ciliary transport and transcription factors, mutations in genes involved in
Genetic Analysis of Rare Eye Disorders in Pakistani Families 13 Introduction Chapter 1 retinal metabolism have also been reported in RP like IMPDH1, RGR, LRAT, RPB3, RLBP1 and RPE65. Similarly genes responsible for retinal development, cellular structure and maintenance have been implicated in RP including ROMI, FSCN2, PRPH2, SEMA4A, CERKL, CRB1, and PROM1.
1.4 Cone Associated Retinal Disorders
Cone cells represent only 5% of retinal photoreceptors and are responsible for day vision and instrumental for color discrimination. These cells have high spatial resolution but are less sensitive to light. Cone photoreceptors are divided into three classes on the basis of their sensitivity to photon which are low frequency L (555-565 nm), middle frequency M (530-537 nm) and supra frequency S (415-430 nm) cones. The concentration of these different types of cone photoreceptors varies with L cones is twice than M while S cones are only 5% of all cone photoreceptors. In the retina, cone distribution is not uniform as macula and fovea contains entirely cones cells (Roorda et al., 2001).
The inherited cone dystrophies result due to defects in cone photoreceptors of the eye and are more severely affected than rod (Sergouniotis et al., 2014). These includes achromatopsia (ACHM), cone dystrophy (COD) and cone-rod dystrophy (CRD) and current estimates show the involvement of about 42 genes in these disorders (Roosing et al., 2014). Cones associated retinal disorders are also classified into stationary like ACHM or progressive cone dysfunctions such as COD or CRD (Kohl, 2009).
1.4.1 Achromatopsia
ACHM is non progressive cone retinal disorder in which patients have photophobia, nystagmus, reduce visual acuity and inability to discriminate colors. The fundus is usually normal (Moradi and Moore 2007), but patients have abnormal ERG. Achromatopsia is normally congenital and is classified into complete and incomplete forms. All three types of cone cells, i.e. L. M and S are defective in complete ACHM which is usually infantile and affected infants have photophobia, nystagmus and poor visual acuity. However, in incomplete ACHM cases, one or more cone cells may be functioning and affected individuals may have some residual color vision (Thiadens et al., 2009). Similarly the visual acuity is also good as compared of complete ACHM.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 14 Introduction Chapter 1
Incomplete ACHM is less severe and rare as compared to complete ACHM (Rojas et al., 2002, Rosenberg et al., 2004).
1.4.1.1 Genetics of Achromatopsia
About 93% of the ACHM cases have been genetically characterized in which mutations in 05 genes have been identified (Roosing et al., 2014). These genes (CNGA3, CNGB3, GNAT2, PDE6C and PDE6H) encode proteins important for the phototransduction process, i.e. depolarization and hyperpolarization of the membrane. The light induced photopigment interact with GNAT2 resulting in the release of guanosine diphosphate (GDP) to guanosine triphosphate (GTP). This activates a G protein cascade which induces enhanced PDE activity of the PDE complex (composed of PDE6H and PDE6C) in the outer segment of cone photoreceptors. The activation of PDE6C hydrolyzes cGMP and decreases its concentration resulting in closure of CNG channels, i.e. CNGA3/CNGB3 (Kohl et al., 2012).
Both CNGA3 and CNGB3 encode components of cyclic nucleotide-gated (CNG) channels which are critical components of the phototransduction cascade. It has been proposed that CNGA3 conferred the basic channel properties while CNGB3 provide proper localization of these channels in the outer segment of the retina (Dai et al., 2013). The CNGA3 is a highly conserved protein and the majority of variations in CNGA3 is missense mutations and has been implicated in complete and incomplete ACHM (Wissinger et al., 2001). Although mutations in CNGA3 have been identified throughout the gene, but four mutations, i.e. Arg277Cys, Phe547Leu, Arg436Trp and Arg283Trp are implicated in about 40 % of ACHM cases (Wissinger et al., 2001).
Lam et al. (2011) reported a compound heterozygous mutation (c.829C>T p.R277C and c.1580T>G p.L527R) in a single ACHM patient. Zelinger et al. (2010) reported that c.1585G>CNGA3 mutation had founder effect and was shared by Arab Muslims and Oriental Jewish patients. In another study, three missense mutations (p.G367V, p.L363P, and p.E376K) were reported in the pore forming region of CNGA3. The functional analysis of these mutations along with two other mutations (p.S341P and p.P372S) in HEK293 cell expression system showed impaired surface expression along with decreased macroscopic current (Koeppen et al., 2010). Similar genetic analysis of two families from United Arab Emirates showed two novel mutations p.Arg283Trp and p.Gly397Val in CNGA3 (Ahuja et al., 2008).
Genetic Analysis of Rare Eye Disorders in Pakistani Families 15 Introduction Chapter 1
CNGB3 has been implicated in only complete ACHM cases. The frequency of CNGB3 mutations in Western population is very high and is estimated to be 50% of all cases. A study on 341 unrelated ACHM patients revealed several homozygous (105 cases) and heterozygous (44 cases) mutations. They also reported that c.1148delC mutation was found in 70% cases (Kohl et al., 2005). Wiszniewski et al. (2007) screened 16 ACHM families and identified p.T383fsX mutation in CNGB3 in 75% cases. Bright et al. (2005) analyzed 03 CNGB3 mutations (p.F525N, p.R403Q, and p.T383fsX) and reported that CNGB3 mutations resulted in a gain of function in CNG channels. In another study, the functional analysis of p.F525N and p.T383fsX mutations also showed that these mutations were responsible for cytotoxicity in photoreceptor cells (Liu et al., 2013).
GNAT2 encodes the alpha subunit of transducin which is a cone specific protein that interacts with light activated photopigment and help in mutual exchange of GDP to GTP. Mutations in GNAT2 are implicated in both incomplete and complete ACHM cases. Kohl et al. (2002) reported mutations in GNAT2 from five different families. Recently, genetic analysis of a Tunisian family showed a novel p.R313X mutation (Ouechtati et al., 2011).
Photoreceptor phosphodiesterases (PDE6) have important function in phototransduction cascade and are specific to the type of photoreceptors. Mutations in both cone specific phosphodiesterase genes, i.e. PDE6C and PDE6H have been implicated for autosomal recessive ACHM. PDE6C encodes α subunit of guanosine monophosphate phosphodiesterase in cone cells. Thiadens et al. (2009) reported compound heterozygous mutations in PDE6C which include a frameshift mutation, a splice defect and a missense mutation in two families. Similarly, in another study, homozygosity mapping showed segregation of PDE6C in five families, while subsequent sequencing and mutation screening revealed homozygous as well as compound heterozygous mutations in 04 families. Overall 16 different mutations have been reported in PDE6C (Grau et al. 2011). PDE6H encodes an inhibitory g subunit of guanosine monophosphate phosphodiesterase in cone cells. Recently, a homozygous missense (c.35C>G) mutation in PDE6H has been identified in two independent families during genetic screening of 611 ACHM cases (Kohl et al., 2012).
Genetic Analysis of Rare Eye Disorders in Pakistani Families 16 Introduction Chapter 1
1.4.2 Cone and Cone Rod Dystrophies
Cone dystrophy (COD) and cone-rod dystrophy (CRD) are both clinically and genetically very heterogeneous retinal disorders. These are more common in children and adults. The frequency of these retinal disorders is about 1 in 30,000 worldwide (de Hollander et al., 2010, Roosing et al., 2014). The common symptoms include visual and visual field loss, defects in color vision, nystagmus and photophobia. In a few cases, night blindness is also seen in later stages of disease. Both COD and CRD are different clinically as well as genetically (Hamel, 2007).
In COD, there is degeneration of cone cells and function of rod cells remains relatively intact. In fundoscopy, there is pigment deposition along with retinal atrophy of the macula. Similarly ERG examination of COD cases showed reduced cone response with normal rod function. In CRD initially there is progressive loss of cone cells which later involve degeneration of rod cells. The ERG response of both cone and rod are decreased. In the beginning, affected individuals have day vision problem, but at a later stage, night blindness also occurred (Berger et al., 2010).
1.4.2.1 Genetics of Cone and Cone Rod Dystrophies
The genetics of COD and CRD is also heterogeneous like other retinal disorders. Mutations in 25 genes have been implicated which includes 17 COD and 08 CRD genes and only 25% of CRD and 21% of COD cases have been resolved so far (Roosing et al., 2014). All modes of inheritance, i.e. autosomal recessive, autosomal dominant and X- linked have been reported, but X linked and autosomal dominant COD are more common as compared to autosomal recessive.
ABCA4 seems to be the most prominent gene as mutations in 24%–65% cases have been identified (Thiadens et al., 2012). Mutations in GUCA1A have been implicated in CRD, which encodes guanylate cyclase activating protein 1 (GCAP1). This protein regulates membrane bound guanylate cyclases of both rod and cone cells in retina by Ca2+ dependent negative feedback regulation (Jiang and Baehr, 2010). Kitiratschky et al. (2009) reported missense mutations, i.e. c.265G>A (p.Glu89Lys), c.300T>A (p.Asp100Glu), c.476G>T (p.Gly159Val) and c.451C>T (p.Leu151Phe) in GUCA1A gene from 07 unrelated CD and CRD patients. Another study reported the splice site mutation in a CDHR1 gene in an Israeli Christian Arab family with CRD (Cohen et al., 2012).
Genetic Analysis of Rare Eye Disorders in Pakistani Families 17 Introduction Chapter 1
PCDH21 encodes protocadherin 21 which is a cell surface protein belonging to Cadherin superfamily. Mutation in PCDH21 is implicated in autosomal recessive cone-rod dystrophy in a family of the Faroe Islands. Mutation screening showed a 1-bp duplication (c.524dupA) resulting in a premature stop codon (p.Q175QfsX47) (Ostergaard et al., 2010).
GUCY2D is expressed in both rod and cone cells and mutations in this gene have been implicated in COD or CRD. This is seen as a major culprit of autosomal dominant cone disorders. Sequencing of 27 patients with autosomal COD and CRD resulted in the identification of mutations in 11 (40%) patients. These all mutations were clustered to codon 838 of GUCY2D (Kitiratschky et al., 2008). Small et al. (2008) reported a novel GUCY2D variant from autosomal dominant family. This mutation p.P575L was present in 12 affected individuals of this family. Ugur Iseri et al. (2010) reported involvement of GUCY2D in the autosomal recessive CRD. They identified a homozygous mutation c.2846T4C which replaced isoleucine with threonine (p.Ile949Thr) in the catalytic domain of GUCY2D.
Recently implication of GUCY2D in Chinese families has been reported in three consecutive studies. Xiao et al. (2011) reported a recurrent mutation, i.e. c.2513G>A (p.Arg838His) in GUCY2D from a Chinese family with autosomal dominant CRD. Xu et al. (2013) characterized the phenotype of the patients of another family with GUCY2D mutation (c.2513G>A). A third study from China reported a novel mutation (p.T849A) in GUCY2D causing dominant COD (Zhao et al., 2013).
Littink et al. (2010) did homozygosity mapping of 108 CRD patients and sequenced the known gene in homozygous regions. They identified a homozygous mutation in 08 families in known retinal genes which were ABCA4, CABP4, CERKL, EYS, KCNV2, and PROM1. The clinical presentation of patients in which mutations were detected in ABCA4, CERKL, and PROM1 had typical CRD but retinal appearance varied among others. In another study genetic analysis of 84 Japanese families suffering from retinal dystrophies was done in which 24 had CRD (Ogino et al., 2013). Huang et al. (2013) sequenced 20 CRD genes in 130 unrelated patients and identified one novel and three know mutations in 04 patients indicating the involvement of several unknown genes. Recently, genetic screening of a German family suffering from autosomal recessive CRD showed a homozygous nonsense
Genetic Analysis of Rare Eye Disorders in Pakistani Families 18 Introduction Chapter 1 mutation (c.565C>T) resulting in a premature codon (p.Glu189*) in RAB28 (Roosing et al., 2013).
KCNV2 is expressed in rod and cone photoreceptors and encodes a voltage-gated potassium channel subunit, Kv8.2. This subunit assembles with other K+ channel subunits like KCNB1, KCNC1, and KCNF1 and form functional heteromeric channels. This complex then alters the potassium current in the cell affecting its excitability potential (Czirják et al., 2007). Mutation in KCVN2 has been implicated in autosomal recessive COD. About 35 disease causing mutations have been described which includes insertion, small and large deletion resulting in a truncated protein (Wissinger et al., 2011).
1.5 Syndromic Retinal Dystrophies
Syndromic retinal dystrophies are characterized by involving any other organ of the body along with retinal degeneration. A number of syndromic retinal dystrophies have been characterized in which few are common like Bardet-Biedl Syndrome and Usher syndromes while others are less common such as Cohen Syndrome.
1.5.1 Bardet-Biedl Syndrome
Bardet–Biedl syndrome (BBS) is a rare autosomal recessive inherited disorder. The major clinical features include retinal degeneration, polydactyly, obesity, mental retardation, renal anomalies, and hypogenitalism. The other associated symptoms of BBS include speech and hearing problems, metabolic/hepatic defects, cardiovascular anomalies and hypertension. The association of diabetes mellitus with BBS is also reported (Agha et al., 2013).
The genetics of BBS is very heterogeneous and mutations in about 80% cases have been identified while 20% cases are still undiagnosed. Cilium dysfunction is taken as the underlying defect in BBS and mutations in 18 genes have been reported (Scheidecker et al., 2013). The seven BBS genes (BBS1, 2, 4, 5, 7, 8, and 9) encode proteins that interact with each other making a complex along with BBIP1/BBIP10 which is known as the BBSome, that is responsible for ciliary membrane biogenesis. The BBS6, BBS10 and BBS12 encoded proteins form a complex by interacting with BBS7 and CCT/TRiC proteins. This complex is known as BBS-chaperonin complex which play important role in making the BBSome assembly. The BBS3/ARL6 is involved in recruiting the BBSome complex to cell membranes while
Genetic Analysis of Rare Eye Disorders in Pakistani Families 19 Introduction Chapter 1
BBS17/LZTFL1 regulates the functioning of BBSome. Recently mutation in BBIP1/BBIP10 was reported and designated as BBS18 which is also a component of BBSome (Scheidecker et al., 2014).
1.5.2 Usher Syndrome
Usher syndrome (USH) is typically characterized by RP and hearing impairment phenotypes. This has been categorized into three sub type on the basis of disease severity and onset. The type I is most severe subtype in which affected individual has congenital deafness, vestibular dysfunction with early onset of RP. Type II is moderate to severe, in which there is hearing impairment, but onset of RP is late. The vestibular function is normal in Type II (Cohen et al., 2007). Type III is less severe in which there is a progressive hearing loss with or without vestibular impairment. The onset of RP is also variable (Ebermann et al., 2009; Eisenberger et al., 2012). The prevalence of USH is approximately 2 to 2.6 in 100000.
Genetics of USH is also heterogeneous. About 16 loci have been reported in all three types of USH while mutations in 12 genes were identified (Mathur and Yang, 2014). Further, it has been shown that mutations in 5 USH genes which include MYO7A/ USH1D, Harmonin/USH1C, CDH23/USH1D, PCDH15/USH1F, sans/USH1G resulted in type I while 03 genes, i.e. Usherin/USH2A, VLGR1b/USH2C, and Whirlin/USH2D were implicated in type II. However, mutations in Clarin- 1/USH3A were implicated in type III only (Lifeng and Mingjie, 2012).
1.5.3 Cohen Syndrome
Cohen syndrome (CS) is an autosomal recessive hereditary disorder in which affected individuals have mental retardation, facial dysmorphisms, microcephaly and retinal dystrophy along with short stature and obesity. However, the clinical symptoms of CS vary from patient to patient belonging to a different ethnic background (Douzgou and Petersen et al., 2011). Rim et al. (2009) characterized the ocular finding in CS from a Brazalian identical twin. They reported the presence of down slanting eyelids, high- grade myopia, small cortical lens opacities and mild ptosis along with posterior subcapsular cataracts.
VPS13B/COH1 is the only known gene, which has been implicated in CS patients from different regions and belonging to different ethnic groups. Majority of VPS13B mutations are deletion along with point and duplication mutations. In 70% CS cases,
Genetic Analysis of Rare Eye Disorders in Pakistani Families 20 Introduction Chapter 1 these mutations were identified on both alleles whereas in 30% cases, mutations were seen on either single allele or no mutation was detected. VPS13B encodes a peripheral protein of Golgi membrane which is needed for proper assembly and integrity of Golgi and is co-localized with a cis-Golgi matrix protein GM130. The fibroblast analysis of a Cohen patient showed disruption in Golgi organization which might be the possible cause of developing these symptoms (Seifert et al., 2011).
1.6 Genetic Analysis of Inherited Retinal Dystrophies in Pakistani Families
There are no exact data about the prevalence of retinal inherited dystrophies in Pakistan but it was reported that out of 132 known genes responsible for non syndromic RD, mutations in 35 different genes responsible for RP, CSNB, ACHM, COD have been reported from Pakistani families. RP is the most common retinal disorder in the world and this seems also common in Pakistan constituting 59% of all RD cases (Khan et al., 2014).
Hameed et al. (2001) mapped a locus (RP29) on chromosome 4q32-q34 in a Pakistani family suffering from autosomal recessive RP. Later Khaliq et al. (2003) screened several Pakistani families suffering from arRP and reported missense mutations in CRB1 in 02 families. The first mutation involved a G to A transversion in one family resulting in the substitution of glycine with arginine. In second family there was a T to C substitution which replaced leucine with proline. The fundus examination of these patients indicated a high degree of pigmentation distributed throughout the retina.
Zhang et al. (2004) reported a novel CNGA1 mutation, i.e. 2 bp deletion in exon 8: c. 626_627delTA from a Pakistani family suffering from RP. This mutation resulted in a frameshift p.Ser209fsX26 in the translated protein and eventual deletion of the COOH terminal of CNGA1. The fundoscopy of affected individuals showed typical changes of RP. Later, Khaliq et al. (2005) reported mutations in RP1 from 03 Pakistani families with arRP. These include a homozygous missense mutation (ACA to ATA) in two families resulting in amino acid substitution, i.e. T373I while a 4 bp insertion was identified in 3rd family at nucleotide 1461 adding a termination codon after codon 487 resulting in early termination of protein. They also screened 150 unrelated RP patients for RP1 and reported a missense mutation (GCC to ACC) in one patient. Subsequently, another group reported implication of RP1 in autosomal recessive RP in 03 Pakistani families. The sequencing of RP1 in these families showed 02 single
Genetic Analysis of Rare Eye Disorders in Pakistani Families 21 Introduction Chapter 1 base deletions (c.4703delA and c.5400delA) and one 04 bp deletion in affected individuals resulting in premature termination (Riazuddin et al., 2005).
A novel mutation (c.1726C>T) in PROM1 was reported in a family with severe RP. This mutation was identified in exon 15 resulting in amino acid replacement in the translated product, i.e. p.Gln576X (Zhang et al., 2007). Azam et al. (2009) reported homozygous mutation, i.e. c.448G>A in RHO from 02 Pakistani families.
Naz et al. (2010) reported a new locus of RP on chromosome 2p in a Pakistani family. Fundus examination of affected individuals from this study, showed the presence of typical RP signs, but both cone and rod responses were absent on ERG. In another study, a missense mutation in EYS was reported from a Pakistani family, which was located at 4th and the 5th laminin AG like domain of the EYS protein (Khan et al., 2010). Additionally, novel missense mutations (p.Pro31Leu and p.Leu154Trp) in CLRN1 were reported in 02 Pakistani families. The clinical picture of affected individuals from both families was consistent to RP (Khan et al., 2011). Homozygosity mapping of 05 RP families showed involvement of TULP1. Further screening of a cohort of RP families showed linkage of TULP1 in four families in which a missense mutation replacing lysine to arginine was identified, which also showed the common founder effect in these families (Iqbal et al., 2011). Later Ajmal et al. (2012) screened two families suffering from RP and reported segregation of a known mutation (c.1138A>G; p.Thr380Ala) in one family and a novel mutation (c.1445G>A; p.Arg482Gln) in the second family.
The implication of MERTK was observed in another Pakistani RP family in which a mutation, c.718G→T was identified in exon 4. This mutation resulted in a premature termination of translation (p.E240X). Fundoscopy of patients from this family showed the appearance of RP symptoms like vascular attenuation, bony spicule along with atrophic maculopathy (Shahzadi et al., 2010).
The homozygosity analysis of 23 families having retinal dystrophies showed linkage to 09 known genes in 11 families. Further analysis showed genetic variation in 09 families in know genes and among them 04 were novel mutations which include one in CRBI (c.3296C_A, p.T1099K), two in CNGB1 (c.2284C_T, p.R762C and c.412- 1G_A ) and one in PDE6B (c.1722_1G_A) (Azam et al., 2011).
Genetic Analysis of Rare Eye Disorders in Pakistani Families 22 Introduction Chapter 1
The data of CSNB from Pakistani families are scanty and only few studies are available. Riazuddin et al (2010) reported a 2 bp deletion (c.1613_1614del) in exon 2 of SLC24A1 from a large CSNB family having 05 affected individuals. Similarly genome wide scanning of another family showed a homozygous region on chromosome 1 and sequencing of the candidate gene, i.e. GANT1 showed a missense mutation (p.D129G) in this family. There was no bone spicule or retinal artery attenuation on fundus while the pattern of ERG was consistent with CSNB (Naeem et al. 2012).
Regarding the presence of cone associated disorders in Pakistani population, Khaliq et al. (2000) reported a novel locus, CORD8, which was mapped on chromosome 1q12- q24 in a family with autosomal recessive cone-rod dystrophy. They reported a region of 21cM between D1S442 and D1S2681 which co-segregated in the family. Later they refined this region from 21cM to 11.53 cM by using new markers (Ismail et al., 2006), but could not succeed to find the causative gene. Similarly Azam et al (2010) reported mutations in CNGA3 and CNGB3 from two Pakistani families. The genetic screening showed a missense mutation c.822G>T; p.R274S in CNGA3 in the first family while a frameshift mutation (c.1825delG; p.V609WfsX9) in CNGB3 in the second family.
Few studies reported BBS in Pakistani families. Pawlik et al. (2010) reported a novel homozygous nonsense mutation (p.S701X) in BBS12 which was associated with a mild phenotype. In another study, genetic analysis of two families suffering from BBS showed implication of ARL6 and BBS10 and sequencing showed novel homozygous missense mutation (c.281T>C, p.Ile94Thr) in ARL6 in one family while in second family a nonsense mutation (c.1075C>T, p.Gln359*) was identified in BBS10 (Khan et al., 2013). Similarly Ajmal et al. (2013) reported a novel and recurrent mutations in BBS1.
The Pakistani society is much conserved and consanguinity is common phenomena. It was reported that about 60% of marriages in Pakistan are consanguineous and 80% of them are between first cousins (Hussain and Bittles, 1998). A recent study reported that customary consanguinity results in a high ratio of autosomal recessive diseases in Pakistan and showed that about 97% of all reported retinal dystrophies cases were autosomal recessive (Khan et al., 2014). Further, it has been shown that the offspring
Genetic Analysis of Rare Eye Disorders in Pakistani Families 23 Introduction Chapter 1 of consanguineous couples had a higher risk of blinding diseases as compared to other genetic defects (Nishiguchi and Rivolta, 2012).
1.7 Objectives
This study was planned to analyze several families with rare eye diseases with following objectives;
1. To identify the causative genetic defects in a number of families with different forms of rare retinal dystrophies
2. To correlate the genotypes and phenotypes of these families
3. To determine the utility of SNP based arrays to solve clinically indistinguishable families
4. To offer evidence based genetic counseling to the respective families
Genetic Analysis of Rare Eye Disorders in Pakistani Families 24 Materials and Methods Chapter 2
CHAPTER 2
MATERIALS AND METHODS
Genetic Analysis of Rare Eye Disorders in Pakistani Families 25 Materials and Methods Chapter 2
2. MATERIALS AND METHODS
2.1 Families Studied
This study was designed in compliance with the tenets of the Declaration of Helsinki and was approved by the Institutional Review Boards of the Quaid-i-Azam University, Islamabad. Written informed consent for providing medical information and blood samples was obtained from each participant. Families suffering from different types of retinal dystrophies (RDs) were mostly ascertained from the rural areas of Pakistan through field visits. Families with a history of consanguinity and multiple affected (at-least two affected individuals with similar phenotype) individuals were further selected for detailed genetic investigations. For this purpose, a detailed history was collected from elders of each family and pedigrees were drawn by following the recommendations described by Bennett et al. (1995). Mode of inheritance was inferred by observing the segregation of RD within each family. Finally, 13 families with autosomal recessive RDs were selected (labeled as A-M) for subsequent genetic analysis.
2.1.1 Clinical and Ophthalmologic Examination
A structured patients’ questionnaire was used to collect information including the family history, visual complaints, pattern of the disease and assessment of additional problems/diseases like polydactyly, male infertility, renal and hearing impairment (Annex I). In order to get precise clinical information for families with multiple RD patients, proband from each family was examined by an ophthalmologist to establish initial diagnosis. The ophthalmologic examination included external examination of eyes, assessment of best-corrected visual acuity and fundus depending on the facilities available at nearby hospitals. Families were then classified into different retinal dystrophies like achromatopsia (ACHM), retinitis pigmentosa (RP), cone rod dystrophy (CRD) etc. based on their clinical presentation, disease history and routine ophthalmological tests. Five families (A-E) were classified as ACHM, four (F-I) as RP and two (J and K) as CRD while the remaining two families (L and M) exhibit syndromic forms of RD with additional clinical features. For the last two families, additional clinical tests were also carried out to capture the detailed clinical spectrum.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 26 Materials and Methods Chapter 2
2.2 Blood Sampling
Blood samples were collected from RD patients and available healthy individuals of each family, by following established procedures to ensure patient safety. Blood samples were drawn with sterile 10 mL syringes and immediately transferred into standard potassium ethylene diamine tetra acetate (EDTA) vacutainer tubes (BD Vacutainer K3 EDTA, Franklin Lakes). Samples were transported to a laboratory in Department of Biochemistry, Quaid-i-Azam University, Islamabad and kept at 4°C till further processing.
2.3 Extraction of Genomic DNA from Human Blood
Total genomic DNA was extracted from blood samples of each individual by using standard phenol-chloroform extraction method and commercially available DNA extraction kit depending on the sample volume.
2.3.1 DNA Extraction by Organic Method
In a 1.5 mL microcentrifuge tube 750 µL of blood was mixed with equal volume of solution A and incubated at room temperature for 5-10 minutes. Tubes were centrifuged for 1 minute (min) in a microcentrifuge at 13,000 rpm (Model 5417C Eppendorf, Germany) and supernatant were discarded carefully. By gentle shaking, the pellet was resuspended in 400 µL of solution A and again centrifuged at 13,000 rpm for 1 min. After discarding the supernatant, the pellet was resuspended in 500 µL Solution B, 12 µL of 20% SDS and 20 µL of proteinase K (20mg/mL). The mixture was kept at 37°C overnight in incubator (Model B28; Binder, Germany). Next day 500 µL of fresh mixture consisting of an equal volume of phenol and solution C was added and samples were centrifuged for 10 min at 13,000 rpm. The aqueous phase was carefully transferred into the new microfuge tube and centrifugation step was repeated. Again aqueous phase (upper layer) was transferred into a new tube and total genomic DNA was precipitated out by adding 55 µL 3M sodium acetate (pH 6) and equal volume (500 µL) of isopropanol. Finally, the DNA was precipitated, washed with 200 µL of chilled 70% ethanol, dried in the incubator and dissolved in appropriate quantity (150-200 µL) of Tris-EDTA (TE) buffer.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 27 Materials and Methods Chapter 2
2.3.1.1 Composition of Solutions
Solution A
Sucrose 0.32 M
Tris (pH 7.5) 10 mM
MgCl2 5 mM
1% (v/v) Triton X-100
Solution B
Tris (pH 7.5) 10 mM
NaCl 400 mM
EDTA (pH 8.0) 2 mM
Solution C
Chloroform 24 volumes
Isoamylalcohol 1 volume
Tris EDTA Buffer (TE)
Tris (pH 8.0) 10 mM
EDTA 0.1 mM
2.3.2 DNA Extraction by Commercially Available Kit
For low volume blood samples, DNA extraction was also done with a commercially available kit (Ultra Gene, USA) by following protocol recommended by the manufacture with few modifications and is summarized below.
In a 1.5 mL microcentrifuge tube, 900 µL of DRL buffer and 300 µL of blood was added. After gently vortexing for 10 seconds (secs), mixture was incubated at room temperature for 3 minutes and centrifuged for 30 secs to pellet white blood cells. Later the supernatant was discarded, the pellet was resuspended and 300 µL of DCL buffer was added. After mixing for 5 secs, the mixture was incubated at 65°C for 15 min and cooled at room temperature. DPP buffer (100 µL) was added and vortexed gently for 10 secs. Proteins were precipitated out after placing on ice for 5 min and then centrifugation for 5 min at high speed. Supernatant was transferred to a 1.5 mL
Genetic Analysis of Rare Eye Disorders in Pakistani Families 28 Materials and Methods Chapter 2 microfuge tube containing 300 µL of 100% isopropanol and centrifuged for 5 min at high speed. The pellet was carefully drained by inverting microfuge tube on a clean paper towel after discarding the supernatant. Finally, DNA pellet was washed by adding 300 µL of 70% ethanol and centrifuging for 1 min. Again supernatant was discarded and the pellet was air dried. DRD buffer (50 µL) was added and DNA was resuspended by incubating at 65°C for 10 min. Finally, integrity of DNA was confirmed by running on 1% agarose gel and samples were subsequently diluted to 40-50 ng/µL for PCR amplification.
2.4 Genetic Analysis of Families with Retinal Dystrophies
Different genotyping strategies/approaches were employed to identify the underlying genes/mutations in 13 RD families included in this study. As these families present autosomal recessive mode of inheritance, therefore were subjected to homozygosity mapping to detect homozygous regions shared by the affected individuals of respective families. Majority of the RD families (A-C, F-M) were subjected to whole genome SNP microarray except two families (D, E) which were analyzed by using microsatellite markers flanking known RD candidate genes. The schematic representation of the workflow is summarized in figure 2.1.
2.4.1 Homozygosity Mapping using Microsatellite Makers
Two ACHM families (D and E) were mapped by using microsatellite markers listed in table 2.1. For this purpose, each marker was PCR amplified from DNA samples of all available members of both families and products were resolved on 8% standard non-denaturing polyacrylamide gel. The ethidium bromide stained gels were documented by the Gel Doc system (Syngene, UK) and acquired images were analyzed to score allele pattern in affected and normal individuals of both families. A locus showing homozygosity in all affected individuals for testing markers was further confirmed by genotyping additional markers to establish distal and proximal boundaries of the identified homozygous regions. Finally, known RD gene present in the homozygous region identified in these families was sequenced in the proband of each family to identify the underlying pathogenic variation.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 29 Materials and Methods Chapter 2
2.4.1.1 Polymerase Chain Reaction (PCR) and Genotyping
Genomic DNA was amplified by polymerase chain reaction (PCR) using site specific markers. A 25 μL PCR reaction mixture was prepared in 0.2 mL tubes (Axygen, USA) with below mentioned reagents;
1 μL sample DNA (40 ng)
2.5 μL 10 X buffer (100 mMTris-HCl, pH 8.3, 500 mMKCl)
1.5 μL MgCl2 (25 mM)
0.5 μL dNTPs (10 mM, Fermentas, UK)
0.3 μL of each forward and reverse primer (0.1 μM)
0.2 μL Taq DNA polymerase (5 U/μL, Fermentas, UK)
18.7 μL PCR water
All ingredients were thoroughly mixed by short spin in centrifuge and placed in Gene Amp PCR system 9700 (Applied Biosystems, Singapore) or T1 thermocycler (Biometra, Germany) for amplification. Amplification conditions include preheating for 5 min at 95°C, followed by 40 cycles of amplification, each consisting of 3 steps: one min denaturation at 95°C, one min primer hybridization at 50-57°C and one min extension at 72°C. Amplified product was given 10 min at 72°C for final extension.
The amplified PCR products were resolved on 8% non-denaturing polyacrylamide gel in a vertical electrophoresis apparatus (Life Technologies, USA). Electrophoresis was performed at 120 volts for approximately two hours. The images of ethidium bromide stained gels were documented by the Gel Doc system (Syngene, UK) to score allele pattern for the available members of both families.
2.4.1.2 Composition of 8 % Polyacrylamide Gel (50 mL)
13.5 mL 30% Acrylamide solution (29 g polyacrylamide, 1 g NN’- Methylene- bisacrylamide)
350 μL 10% Ammonium persulphate (APS)
17.5 μL TEMED (N, N, N’, N’-Tetra Methyl Ethylene Diamine)
5 mL 10 X TBE and 31.13 mL distilled water
Genetic Analysis of Rare Eye Disorders in Pakistani Families 30 Materials and Methods Chapter 2
2.4.2 Homozygosity Mapping using SNPs
Eleven families were subjected to genome-wide homozygosity mapping using the HumanCytoSNP-12v2.1 SNP array (Illumina, Santa Clara, CA, USA), containing ~300,000 markers at the NCCR Genomics Platform of the University of Geneva, Switzerland. These genotyping experiments were performed during a six month internship at University of Lausanne, Switzerland. The DNA was purified using ethanol precipitation method and dissolved in deionized water. The quantity and quality of the DNA were checked using Nanodrop 2000 (Thermo scientific, Wilmington, DE. USA). Based on the measured quantity, the DNA was normalized to 50 ng/μL using TE buffer and 5-10 μL of this was added to 96 well AB800 plate which was analyzed using infiniumR HD assay (Illumina, San Diego, CA, US).
The DNA samples were denatured, neutralized and amplified isothermally overnight. The amplified products were fragmented using endpoint fragmentation to avoid over fragmentation by a controlled enzymatic process which was then precipitated using isopropanol precipitation and centrifuged at 4°C. The pelleted DNA samples were resuspended in hybridization buffer and applied on the BeadChip which was prepared in a capillary flow-through chamber and divided by an IntelliHyb® seal (or gasket). The loaded BeadChip were incubated overnight in the Illumina Hybridization oven to anneal the amplified and fragmented DNA samples to locus-specific 50-mers (covalently linked to one of up to 300,000 bead types). The unhybridized and non- specifically hybridized DNA was washed and the BeadChip was prepared for staining and extension.
Single-base extension of the oligos was done using the captured DNA, which incorporated the detectable labels on the BeadChip. The BeadChip was then laser scanned by the Illumina iScan or BeadArray Reader, which recorded the high- resolution images as an intensity data file (idat file). The data were then extracted from these idat files using the Genome Studio Genotyping module and analyzed with homozygositymapper (Seelow et al., 2009) to identify homozygous regions shared by affected individuals of each family.
Because the mode of disease was autosomal recessive, therefore all regions having continuous stretches of homozygous SNPs with identical haplotype in affected individuals were considered as potential homozygous regions. The genotype table of
Genetic Analysis of Rare Eye Disorders in Pakistani Families 31 Materials and Methods Chapter 2 these selected homozygous stretches was explored and regions containing more than 300 consecutive homozygous SNPs, on average corresponding to a genomic size of 1Mb or larger, were prioritized and assessed to explore the involvement of known RD genes in the studied families. Later, Sanger sequencing was performed to identify the pathogenic variant in families mapped to genomic regions containing known RD genes.
2.5 DNA Sequencing
DNA sequence of genes, i.e. CNGB1 (NM_001135639.1), CNGB3 (NM_019098.4), PDE6A (NM_000440.2), RHO (NM_000539.3), KCNV2 (NM_133497.3), CNGA3 (NM_001079878.1), RPGRIP1 (NM_020366.3), VPS13B (NM_015243.2), DNM1L (NM_001278463.1), ATP1A2 (NM_000702.3), SLC19A2 (NM_006996.2), KCNJ10 (NM_002241.4) and CRYAA (NM_000394.3), present in the homozygous regions identified in various families, was downloaded from the Ensemble (http://www.ensembl.org/index.html) genome browser and primers (Table 2.2-2.14) for all coding exons including splice signals were designed by using Primer 3.0 (Untergasser et al., 2012) and purchased either from Gene link (USA) or Sigma- Aldrich (Taufkirchen, Germany).
2.5.1 Amplification of PCR Product
Amplification of target exons was done in 0.2 mL PCR tubes (Axygen, USA). A 50 μL PCR reaction was prepared by adding double amount of all PCR ingredients as mentioned under 2.4.1.1. PCR conditions were modified for amplification of exons as, the preheating of template DNA was done for 5 min at 95°C which was followed by 30 cycles of amplification, each consisting of 3 steps: 30 seconds denaturation at 95°C, 30 seconds primer hybridization at 55-57°C and final extension at 72°C for 30 seconds. Amplified product was given 6 min at 72°C for final extension. The amplified products were subjected to 2% agarose gel to confirm the presence of amplified product using the Gel Doc system (Syngene, UK).
2.5.2 Purification of PCR product
In order to remove the primers and extra dNTPs, the PCR products were purified using Gene JETTM PCR Purification Kit (Fermentas, London, UK) or treated enzymaticaly with ExoSAP-it reagent (Affymetrix, Inc. Santa Clara, CA, USA).
Genetic Analysis of Rare Eye Disorders in Pakistani Families 32 Materials and Methods Chapter 2
Binding buffer provided in kit was added in 1:1 ratio of completed PCR product and mixed thoroughly. This mixture was transferred into a Gene JET purification column, which was centrifuged for 1 min at high speed. After discarding flow through, 700 μL of wash buffer was added in Gene JET purification column and centrifuged for 1 minute. Flow through was discarded and empty column was re-centrifuged for 1 minute to completely remove all residual wash buffer. The gene JET purification column was then transferred into a 1.5 mL microcentrifuge tube and 50 μL of elution buffer was added in center of column membrane. The whole assembly was then centrifuged at high speed for 1 min and purified product was stored at -20°C.
Similarly for ExoSAP-IT treatment, 2 µL of enzyme was added in 10 µL of PCR product. The mixture was incubated at 37°C for 30 minutes and then at 80°C for 15 minutes to inactivate the enzyme.
2.5.3 Sequencing PCR
The sequencing was performed using two different dye termination chemistries, i.e. DTCS Quick Start Kit (CEQ8800, Beckman Coulter, High Wycombe, UK) and Big Dye Terminator Cycling Sequencing Kit v3.1 (Applied Biosystem, Life technology, Foster City, CA, USA). Composition of reaction mixture (10 μL) was as follows;
3 μL DTCS quick start kit or 4 μL Terminator ready reaction mix v3.1
1 μL Sequencing buffer
1 μL of primer (0.1 μM)
1-2 μL purified PCR product (3-10 ng)
PCR water (as needed)
After thoroughly mixing all ingredients, reaction was performed by means of T1 thermocycler (Biometra, Germany) under the following conditions. An initial denaturation of template DNA was done at 96°C for 1 min which was followed by 25 cycles of amplification. Each cycle consisting of 3 steps: denaturation at 96°C for 10 secs, annealing of primer to complementary sequences at 50°C for 10 secs and extension at 60 for 4 min. Amplified product was finally extended at 72°C for 10 min.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 33 Materials and Methods Chapter 2
2.5.4 Purification of Sequencing Reaction
The sequencing PCR reaction was purified to remove excess salts, unincorporated dyes, primers etc. using ethanol precipitation method or Sigma Spin™ Post-Reaction Clean-Up plates/columns (Sigma-Aldrich, St. Louis, MO, USA). For ethanol precipitation, the PCR product was transferred to 1.5 mL eppendrof and immediately 2.5 μL of freshly prepared stop solution [1 μL 3M sodium acetate (pH 5.2), 1 μL 100 mM sodium EDTA (pH 8.0), and 0.5 μL Glycogen (20 mg/ml)] were added. Amplified product was precipitated out by centrifugation at high speed for 20 min after adding chilled 70 μL of 100% ethanol. Supernatant was carefully removed with P200 pipette and 150 μL 70 % ethanol (-20°C) was added. Centrifugation step was repeated and supernatant was carefully discarded. The pellet was dried at room temperature to remove all residual ethanol and resuspended in 30 μL of sample loading solution (SLS). For sequencing, the mixture was transferred to the sample plate (CEQ8899, Beckman, UK) and a drop of mineral oil was added to each sample which was finally sequenced on an automated DNA sequencer (CEQ8800, Beckman, UK).
For purification with the clean-up plates or column, an equal volume of PCR water was added to the reaction mixture. The plate or column was pre-spinned for two minutes at 750 g followed by the addition of the reaction mixture and centrifugation at 750 g to collect the purified DNA. The samples were mixed with injection buffer and sequenced on ABI 3130xl Genetic Analyzer (PE Applied Biosystems, Foster City, CA, USA).
2.6 Mutation Analysis
BioEdit software, version 7.0.9.0 (Hall, 1999) was used for mutation analysis of sequenced data. For this purpose, reference gene sequence was taken from Ensembl Gene Sequence view (http://www.ensembl.org/index.html) and aligned with sequenced data in BioEdit (Version 7.0.9.0) using the Clustal W tool to identify variations in the sequenced DNA sample. If the nucleotide change was identified in an affected individual, then DNA samples from remaining family members were screened for respective variation to confirm its segregation with the disease phenotype in the entire family. The identified variants were also screened in 100 healthy Pakistani individuals and checked for pathogenicity by using different bioinformatics
Genetic Analysis of Rare Eye Disorders in Pakistani Families 34 Materials and Methods Chapter 2 tools. Finally the novel pathogenic variations were compared with public databases, i.e. exome variant server (http://evs.gs.washington.edu/EVS/), 1000 genomes (http://www.1000 genomes.org) and dbSNP (http://www.ncbi.nlm.nih.gov/SNP/).
2.6.1 Bioinformatics Analysis of Novel Mutations
The putative pathological nature of identified novel missense variants was confirmed using three different in silico tools including Polymorphism Phenotyping v2 (Adzhubei et al., 2010), Sorting Intolerant from Tolerant (Kumar et al., 2009) and Mutation Taster (Schwarz et al., 2010). Similarly the amino acid conservation analysis of novel mutated amino acids was also done by aligning protein sequences of the respective proteins from different species using the online tool, i.e. Homologene (http://www.ncbi.nlm.nih.gov/homologene) or CLC Genomics Workbench (CLC bio, Qiagen, Boston, USA). The species include human (H. sapiens) macaque (M. mulatta) mouse (M. musculus), cow (B. taurus), wolf (C. lupus) and Xenopus (X. tropicalis). For novel splice site variation, analysis was performed by using web based tools like MutPred Splice (v1.3.2) (Mort et al., 2014), Human splice finder (v2.4.1) (Desmet et al., 2009) and SKIPPY (Woolfe et al., 2010).
2.6.2 In vitro Analysis of Splice Site Variant
The impact of the splice site variant identified in CNGB1 was confirmed in vitro by using minigene assay.
2.6.2.1 Amplification of Targeted Exon and its adjacent Regions
A set of primers (5ˊ-AAGGTACCGGGGAGACAGTGGTTTAGGA-3ˊ and 5ˊ- AATCTAGAACAGTCACTCCTCCCCATAGA-3ˊ) was designed to amplify the splice site variation containing exon along-with two flanking exons. These primers span a genomic region between g. 57994604 to 57997163 (hg.19) on chromosome 16. PCR was run from the genomic DNA of affected and normal individuals of the family using High Fidelity Phusion polymerase (Thermo Scientific, Pittsburgh PA, USA). The mixture was prepared as follows;
4 µL of 5x Phusion HF Buffer
0.4 µL of 10 mM dNTPs (200 µM each)
1 µL of each primer (0.5 µM)
Genetic Analysis of Rare Eye Disorders in Pakistani Families 35 Materials and Methods Chapter 2
0.5 µL of template DNA
0.2 µL of Phusion DNA Polymerase (0.02U/µL)
Two step PCR was used to amplify the target region, which consists of an initial denaturation at 98°C for 30 seconds, followed by 35 cycles of amplification at 95 for 10 seconds and both annealing and extension at 68°C for 10 minutes. A final extension of 10 minutes was given at 72°C and amplicons were confirmed on 2% agarose gel.
2.6.2.2 T/A Cloning
The amplified product was directly cloned in the pcDNA™ 3.1/V5-His TOPO® vector (Carlsbad, CA, USA) which was provided as linearized with single 3´ thymidine (T) overhangs and Topoisomerase was covalently bound to the vector (which is referred to as “activated” vector) for TA Cloning. The high fidelity Phusion polymerase produces a blunt ended PCR product and thus requires a poly A overhang. After the completion of amplification PCR, the vials were placed on ice and 0.7-1 unit of Taq polymerase was added per tube. After mixing, it was incubated at 72°C for 10 minutes and then again placed on ice and was then added to ligation mixture. The ligation mixture was prepared as follows.
2 µL of PCR product
1 µL of dilute salt solution
1 µL of TOPO® vector
2 µL sterile water making a final volume of 6 µL.
The ligation mix was incubated at room temperature for 5 minutes and processed for transformation.
2.6.2.3 Transformation
In a 0.1 cm cuvette, 2 μL of the TOPO® cloning reaction (ligation mixture) was added into 50 µL of One Shot® Top10 electro competent E. coli cells. After gentle mixing, cells were exposed to electric current by placing cuvette into the micro pulse electroporator (Bio Rad, UK). Later 900 μL of Luria-Bertani (LB) medium was added and the mixture was transferred into another sterile tube which was then placed in shaker for 1 hour at 37°C. About 50 μL of the mixture was inoculated on a pre-
Genetic Analysis of Rare Eye Disorders in Pakistani Families 36 Materials and Methods Chapter 2 warmed LB plate and incubated overnight at 37°C. The bacterial growth was checked next day and single colonies were inoculated in 5 mL of LB broth and incubated overnight at 37°C in shaker incubator. The growth was confirmed next day by visualizing the turbidity of the medium. Both the wild type and mutant were run parallel in these experiments.
2.6.2.4 Plasmid Extraction
The plasmid extraction was done using the QIAprep Spin Miniprep Kit (Qiagen, Valencia CA, USA). For this purpose 4 mL of overnight culture was centrifuged in a 1.5 mL tube and bacterial cells were resuspended in 250 µL Buffer P1. After complete re-suspension, 250 µL Buffer P2 was added and mixed by gently inverting the tube 4– 6 times. Then 350 µL Buffer N3 was added and the contents were mixed by inverting until the solution became cloudy. The solution was then centrifuged for 10 min at 13,000 rpm (~17,900xg) and the supernatant was transferred to the QIA prepspin column. After centrifugation flow through was discarded and the column was washed by adding 0.5 mL PB Buffer. The washing step was repeated again followed by the addition of 0.75 mL PE Buffer and finally the column was placed in a clean 1.5 mL tube. The bound plasmid was eluted with 40 µL of water and centrifugation for 1 minute. The eluted plasmid was quantified by using Nano drop 2000 (Thermo scientific, Wilmington, DE. USA) to determine the final yield.
2.6.2.5 Hela Cell Transfection
The recombinant plasmid of both mutant and wild type were sequenced bi- directionally to confirm the proper orientation as well as the absence and presence of the mutation in wild type and mutant clones, respectively. Transfection was done in 06 wells plate in which one row was used for wild type and one for mutant clones. In each row, one well represented negative control, second well represented a positive control (transfected with GFP plasmid) while third well was transfected with recombinant clone respectively.
The human derived Hela cells were seeded with Dulbecco modified eagle medium (DMEM) containing 10% fetal calf serum (FCS), 100 IU/mL penicillin, 100 µg/mL streptomycin and 1% Glutamax (Gibco) at 37°C in 5% CO2 in a tissue incubator. The growth was monitored and once the cells attained 70-90% of confluence, transfection was done using Lipofectamine 2000 (Invitrogen, USA). For this purpose, the plasmid
Genetic Analysis of Rare Eye Disorders in Pakistani Families 37 Materials and Methods Chapter 2
DNA (3 μg/μL) was diluted in serum free growth medium and added to diluted Lipofectamine 2000 (4 amount of reagent in serum free medium) with 1:1 ratio. The mixture was incubated at room temperature for 10 minutes to allow the formation of complexes. The old medium was removed and cells were washed with 0.7 mL PBS (phosphate buffer saline) and 0.5 mL of fresh cell growth medium containing serum and antibiotics. After washing, the transfection complexes were added to the cells and plates were swirled for even distribution of the complexes and incubated at 37°C and
5% CO2. The transfection was monitored by visualizing the expression of green fluorescent protein (GFP) in positive control under a fluorescent microscope (Nikon Eclipse E600, USA).
2.6.2.6 RNA Extraction
After 48 hours of incubation, culture medium was aspirated and the cells were washed with an equal amount of PBS. After washing, cells were detached from the dish surface by adding 1 mL of PBS containing 0.3% trypsin and incubated for 5 minutes. After cell detachment, the growth medium was added, mixed, transferred to falcon tube and centrifuged for 5 min at 300 g to pellet the cells. The pellet was then processed for total RNA extraction using a Nucleospin RNA extraction kit (MACHEREY-NAGEL, Germany).
The cells were lysed by adding 350 µL of buffer RA1 and 3.5 µL of β- mercaptoethanol and vortexed vigorously. The resultant lysate was filtered using Nucleospin filter by centrifugation at 11,000 g for 1 minute. The filter was discarded and 350 µL of 70% ethanol was added in the filtrate. After mixing, the filtrate was loaded on the NucleoSpin RNA column placed in a 2 mL collection tube and centrifuged for 1 minute at 11,000 x g. The column was then placed in a new 2 mL collection tube and 350 µL of membrane desalting buffer was added and centrifuged for 1 minute at 11,000 xg to dry the membrane. The DNA was digested by adding 95 µL of DNase reaction mixture onto the center of the column and incubated at room temperature for 15 minutes. After incubation, 200 µL of buffer RAW2 was added to the column and centrifuged for 1 minute at 11,000 xg. The column was placed in a new collection tube and 600 µL of buffer RA3 was added and centrifuged. The flow through was discarded and 250 µL of buffer RA3 were added again and centrifuged for 2 minutes at 11,000 g. The column was placed into a sterile nuclease free 1.5 mL tube and 60 µL of RNase free water was added in the center of the membrane. The
Genetic Analysis of Rare Eye Disorders in Pakistani Families 38 Materials and Methods Chapter 2
RNA was eluted by centrifuging the column for 1 minute at 11, 000 g and stored at - 80oC.
2.6.2.7 cDNA Synthesis and RT-PCR
RNA was reverse transcribed to synthesize cDNA using Revert Aid First Strand cDNA Synthesis Kit (Fermentas # K1622, USA). For this purpose, 1 µg of total RNA was mixed with 1 µL of oligo dT primer (100 µM) and the volume was made up to 12 µL with nuclease free water. The mixture was incubated at 70°C for 5 minutes and chilled on ice, followed by the addition of 4 µL reaction buffer, 1 µL RiboLockRNase inhibitor (20 u/µL), 2 µL dNTPs (10mM) and 1 µL RevertAid M-MuLV Reverse Transcriptase (200 u/µL). All ingredients were mixed gently and incubated at 42°C for 60 minutes and reaction was terminated by heating at 70°C for 5 minutes and stored at -70oC. Positive and negative controls were also processed in parallel. The cDNA obtained was directly amplified using specific PCR primer pair within exon 5 (5ˊ-AGGGTACTGACCTGGCTCAT-3ˊ) and exon 8 (Reverse 5ˊ- CAGATTCTGCTCCAGCCACA-3ˊ) of CNGB1 (NM_001135639.1). As described earlier, PCR amplified products were analyzed on 2% agarose gel to see the differences between wild and mutant alleles. The PCR products were also subjected to Sanger sequencing to confirm the sequence. These experiments were was run in duplicate.
2.7 Deletion Breakpoint Mapping of VPS13B/COH1
During the exon amplification of VPS13B for sequencing, it was observed that four consecutive exons, i.e. exon 37 to 40 did not amplify in the affected members of Family L which led us to hypothesize the presence of a large genomic deletion. In order to confirm this assumption and identify deletion breakpoint, different sets of primers (Table 2.15) were designed for genomic regions flanking the deleted SNPs by using Primer3 software (version 0.4.0). PCR was run for all set of primers covering both upstream and downstream genomic region using DNA of both normal and affected individuals of family L. The amplified products were separated on 2% agarose gel to finalize a primer pair that can amplify the junction fragment. This set of primer (forward primer 5'-TCCTAAAATGTGCCATTGGTT-3', reverse primer-R: 5'- TGCTGAAGAATAGATTGCTGAA-3') was then used to amplify the both ends of deletion junction and amplified product was then subjected to sequencing. The
Genetic Analysis of Rare Eye Disorders in Pakistani Families 39 Materials and Methods Chapter 2 sequenced data were analyzed for the identification of exact physical co-ordinates using the BLAT tool of UCSC Genome Browser (http://www.genome.ucsc.edu).
Genetic Analysis of Rare Eye Disorders in Pakistani Families 40 Materials and Methods Chapter 2
Recruitment of Families (13)
Clinical Examination
ACHM RP CDs Syndromic (05) (04) (02) (02)
DNA Extraction
Homozygosity Mapping
SNPs Based Mapping STRs Based Mapping
Candidate Gene Analysis
Sanger Sequencing & Mutation Analysis
In vitro Analysis In vivo Analysis with Online Tools with Minigene
Pathogenic variant
Figure 2.1: Schematic Presentation of the steps for identification of pathogenic variants
Genetic Analysis of Rare Eye Disorders in Pakistani Families 41 Materials and Methods Chapter 2
Table 2.1: List of microsatellite markers used for mapping of ACHM families D and E
S. No Gene Markers Distance (cM)*
D2S2181 88,576,581-88,776,897
D2S2187 99,005,207-99,205,512
D2S2972 102,471,968-102,672,394 1 CNGA3 D2S1343 105,379,483-105,579,784
D2S1894 107,173,036-107,373,351
D2S1896 115,112,691-115,312,944
D8S1697 83,168,999-83,369,381
D8S1143 85,511,118-85,711,511 2 CNGB3 D8S1119 87,071,877-87,272,221
GATA8B01 91,923,060-92,123,405
D3S2384 4941808-49418207
3 GNAT1 D3S1621 50593931-50594294
D3S1573 51104746-51104947
D12S2210 14,775,414-14,975,868
4 PDE6H D12S62 15,228,103-15,428,406
D12S1728 16,236,213-16,436,526
D10S1755 94483363-94483759
5 PDE6C D10S200 95313680- 95313993
D10S1690 95994609- 95994958
Genetic Analysis of Rare Eye Disorders in Pakistani Families 42 Materials and Methods Chapter 2
Table 2.2: List of primers used for the amplification of exons of CNGB1
Exon Forward Primer (5ˊ to 3ˊ) Reverse Primer (5ˊ to 3ˊ)
2 GCTGATCTCAAACTCCTGGA GCCAACCTTTTCTGCTGTAG 3 CTTGAGGGAGAATCAGGCTG CCACCCTTAGCTTCTCTGAG 4 CTCTCCCCTGACTTGATCTC TCAAGGGGCTAACAGTCTAA 5-6 AGGGACAGAGACTCACCTAG CAGTCAGGTGAGAAGATCC 7 TGACCCTGCTTTGAACCTG AAACAGGCCCAGAAGAGAC 8 TGAGAGTTTCCAGGACAAGG AGTCACTCCTCCCCATAGAG 9 CGGGATTCAGAAGGAGAGAC TTACCCAAGACCCACAAGT 10 GGTCTGTTTGAGGATTGGGA GAAAATGTGGGAAAGGGCA 11 TTGTTTTCTGCCTTGGGAAC AGGGAGTGGGTGGAATGAA 12 AGGGACTCTCTTCTCCATCC CTACCTGGCTACCTGAACAG 13 ACTGCATGACTAAGCACTGA GGGAGAAGGATGGCTGTAT 14 CCTACAGAAAATAGAGGCAGG CAGCCTTACACAGCACAGAA 15 TTCTTGGGCATCTCTGTACC CCCTGTAAGCAAAGTGGACA 16 AAGGCAGATCTAACAGGAGC AAGGAGATGGAGGGAGAGG 17 CCCTCCAAACATGCTTTCTC CCAACTCGCTGTGTGATTTT 18 TGGCTCTAGATGATCTTTAGG CTCAGCCTCTCCTTCACAAG 19 TCCCGGACTGAATTTCCTTC GATCCCAAATCCAGAGAGTG 20 TCTCTCTGCATCCTCTACCT CAGGCAAGAAACTGTGGAA 21 AGTGCCACATGTAGTAGTTGA TATTGAACAAGCACAGCAGC 22 GATGGTCCTTGGGCTGTTAT CTTGTGGTTTGGAGGACACT 23 GAGGATAATGAAGCTGCCCT ATAAATGCATCTCCCCTCGG 24 GGGCTGAGGACTTCTGATAT TGTTGAATGTTGTGTGTGCA 25 GGTGCAATCTCAACAAAGCA CCTTGTCATGCCAGTGATTG 26 GGGTTTCTGTCTTTTGCACA GGTCTCTGCAGAAAACCATT 27 CCCGTCAGTAAAACTTTCTCTG TCAGAGACACAGAGGACGA 28- TGCACTACAAATCCAGAGTG CAGCTCAGTTCCTTGAAAGC 29 30 AGTCTACAGATGGGGTGACT CCCACACAGATGAGAACCTT 31 ACCACTGTCCTCCACACAT ATGATCACTCCACTGCACTC 32 AATCACCACCACTACACAGC CTTGCACTCTGTCACTGGTA 33 CACCCCACCCACTAGATTTC AAGCATCTTCTCTTGAGCCG
Genetic Analysis of Rare Eye Disorders in Pakistani Families 43 Materials and Methods Chapter 2
Table 2.3: List of primers used for the amplification and sequencing of CNGB3
Exon Forward Primer (5ˊ to 3ˊ) Reverse Primer (5ˊ to 3ˊ)
1 AGCTAAGGAGTTGCCTGTAG CAGATGGTGCCAGGTAAAACT 2 TGTGGAGGCTGAGGTTGATT TCATCAGACAGCACATTTCA 3 GCCTGAAGGTGTCTACCAGT AGCTAAAGGGGAGAGTGGAT 4 ATTCCACCAGCACTATTTCC CCTCAGCACTTCTTTCTTCC 5 GCGGTGTTTGGTTAAGAAAT CAGGGTTTCTTGGTGATAGC 6 GTCCAGAGGCAGAATGGTGT TTCTTGCAATTATCCATGCAG 7 GAACCAACCAAGAGAAACA AGTCAAAATGGTAATAGATCA 8 TGCAACGCCTAAGGAGAGAT AGCATTGATGAGGGCAGAAA 9 AAATGTACTGTCCAGAGGAA GGGTCATATCCCTGCCAAAT 10 TGGCACCATCACTTTGTACT AGCATTTACCAGCCATTGAAT 11 TTCTCCCAAGAATAGTGGTC CATCCTCCTTCAACTCATTAAA 12 TGAAAAGTTGTCTGGGCAAG TTCAACCTTTTGTTCAAATCCA 13 TGTTTGCATTTTGTTTCCTTT GGTTCTAAAGAATAAGCCGTT 14 CCATAGCCATTGGCAGTTA ATGTCCGAAATCCTCAAATG 15 TGTTCAACCCATGTCTGTAA AAATCTGAGCGGGAACTTATT 16 GCCATTTCTATTCCCACATC AAACCAACTCCATCCATCTC 17 CTTGATCACAGTGAGATATG GTCCAAATCATCCCAGTGTCT 18 GCCATTGCATGCTAATCAAA TGCATGAAATCACACTCTCAG
Genetic Analysis of Rare Eye Disorders in Pakistani Families 44 Materials and Methods Chapter 2
Table 2.4: List of primers used for the amplification and sequencing of PDE6A
Exon Forward Primer (5ˊ to 3ˊ) Reverse Primer (5ˊ to 3ˊ)
1 CTTAATCTCCCAAGCTTGCT TTGTCACCAGCCTTGTCTTG 2 GCCCCTGTTGAAGAGGAATA GAAAACTGAGGCCAGGTCAA 3 TTGTCTCTGATGAAGCTTTG TAGGCACCTTCATTCCCATC 4 TGGATTATTGTGAAGGGTAA GCCAAGACTCTAGCCGTCAG 5 TGTTAGCTGACTCATGGAGG TCCTTTAACAGGGTTTACTGTG 6 AGATCAAGCCATTGCACTCC TGCTTGTCTTTCTTCAGTCCTC 7 CCAACATTTTGGGTTTGGTC TCCTTCCACTCTTTCTTCCA 8 GACAAGAACATGGTGTTTCT CCCCATTTCCATTGGTACAG 9 TCTCAGCCAATCAGGGTCAT GCAGTGAGAGTGAAGAAAGT 10 TCAAACCCATTTTATAGCTG GCTAGGCAGGAAGGAACACA 11-12 GAGCTGGTGGTTCTGTTGC GCAAGCAAGAAAGAAAATTA 13 TCACCTCCTGGTCCAATGAT AGCCCGTACTGCTTTCACAT 14 TTTTAGTTCTGGGCCCTCCT AGACTTCCCTGTTGGCCAGT 15-16 TCACTTGTGGAGAAGGCTGA CCTGGGCAACAGAGTGAGAT 17 GCCTTGGCTCTTTCAACCTT TGAAGGCCTCCAAAATGAAA 18-19 GATGCAATGGGGGTGAGC CTGCATTAGGAAAAGGTCATC 20 AAGGAGCATACTGCCTCTGG GTTGTCTGGAAATCCCAGGT 21 GCTACTCCGAAGCAGCTCAT GCCTGAATGAGACTCCGTGT 22 TTTGCCTTCTGCATGTGTTG CAGGGAAGCCAAAAGATTGA
Genetic Analysis of Rare Eye Disorders in Pakistani Families 45 Materials and Methods Chapter 2
Table 2.5: List of primers used for the amplification and sequencing of RHO
Exon Forward Primer (5ˊ to 3ˊ) Reverse Primer (5ˊ to 3ˊ)
1 TGCAGCGGGGATTAATATGA ATTGACAGGACAGGAGAAG 2 CCTGGAATTTCTTTGCCCAG GATTCTGTTTGACATGGGGC 3 GAATGTGAAGCCCCAGAAAG CTGGTGGGTGAAGATGTAGA 4 TATGGGCAGCTCGTCTTCA CTGCATTTCTCACACACTCC 5 CAGTTCCAAGCACACTGT AAGGAGCCTATGTGACTTCG
Table 2.6: List of primers used for the amplification and sequencing of KCNV2
Exon Forward Primer (5ˊ to 3ˊ) Reverse Primer (5ˊ to 3ˊ)
1-1 CGAGGTTGACCGACATTTTT GCACCCAGGGAGCAAATG 1-2 TCCTCCTAGAGGCAGTGAGC GTAGACCAGCTGGAAGACG 1-3 CTAAGCCTGTGCGACGACTA GCAGGTACTCGAGCGTGAA 1-4 TTCTTCACGCTCGAGTACCTG TTTTGTTAGCTGTATGCGGC 2-1 TTCTTCTCCTCCCCGATCTT TCTAAGCTGTTGCTCCCCTC 2-2 TGGCCCAAACTCAGAATGTC CTCCCTCCCTCTGGAAAGTT
Genetic Analysis of Rare Eye Disorders in Pakistani Families 46 Materials and Methods Chapter 2
Table 2.7: List of primers used for the amplification and sequencing of CNGA3
Exon Forward Primer (5ˊ to 3ˊ) Reverse Primer (5ˊ to 3ˊ)
1 TGTGTGTGTCCCCACCTTTA CCAGCTCAAGAGCCCCTA 2 GATGAGCTGGGTTTGCAGTT GACCAGAGCCAGGCATAAAA 3 GGGCTTGAAATCAATTCTGC CCCCATCTAGCACTTTTTCC 4 TTCCTCTCCCTCTGGCTCA AACAGGATGGAGCAAAGCAC 5 CCCAAGGAATGGAAACAGAG TAAGGAGAGAGGCCAAGCTG 6 CAAAGCTACAGTCTTGGAGCA CCTGGTTTCCCCCTTTCC 7 CTCCAGAAACACACGCACAG TAATGTCCCATCCACCATGC 8a AAAAGTCAGCCTCTGTGATGC AGGCTCTTGAGCACCTCCTT 8b CCAACAAGAAGACGGTGGAT TGCTGCATTTTCACTGTTGTT
Genetic Analysis of Rare Eye Disorders in Pakistani Families 47 Materials and Methods Chapter 2
Table 2.8: List of primers used for the amplification and sequencing of RPGRIP1
Exon Forward Primer(5ˊ to 3ˊ) Reverse Primer(5ˊ to 3ˊ)
1 TGTCCACACTACCATGAGAAT CTGGGTGACAGAGCGAGACT 2 TGCTCTCTGGACAAGATGTGA GGCAGGAGAATTGCTTGAAT 3 TGTACTGGGGACAGAAGGCT AAACGTGGCTGGCACATC 4 AAGGGTTTCACCCAGGTCTC AAAATTAGCTGGGCATGGTG 5 TCCTCGACATGTACCAAGGTT CTCTGAGATGGAGGAAAGG 6 GTAAGACGGGAAGGCAAGAG TTGTGAGGCTTGGATTTGAA 8 TCCAGAGAAATGCTAGGGTG CTGCTAGGGAAGCAGCAAA 9 AGTTGGATGGCTTCTCAGAC GTGTCAAATTCCCTTCCAAA 10 TGGGAAATGGATATGACTTGG CCAAACCAGAGGTAGAGGA 11 CACTTGATCCAACTCTGACCA CAGCGAGACTCTGTCTCAAA 12 CCAACAACTGTTTTATGGAGA GGCATGTGTGAGTCCTCAAG 13 GGGTCTGCAAGGAAATCAAA ATGAGAGGCACCCTTCTTGA 14 TGGACTTCCACCATGTGTTT ACAGATGGTGTGGCAAGGA 15 TGTTCTTGATCCTTGCCACA CTCATGAGCTGTTTGGCTGA 16 GTTTGCAGGCAGGTGAAGAT CTGCTCTGTTGCTCTTGACA 17 TGCACTGCTGTTTGATTTTACT TGAGCCACTGCACCTACTTC 18 TCAGCTCCATGAGGAGAGAA CCCAAAGTGCTGGGATTACA 19 GCCTGAGTGACAGAGGGAGA GCTGCTCTTGAAAGCCTGAT 20 GATGTGTGTGCTGGGTCTTTT CATGACTGGCCACTGTCATT 21 TGCCAGTTTTACCTATAAAAG TGTTCATCAGACTTCCTCAC 22 AGACTGCGGTGAACCAAGAT GCATCAGCACAAAACCAAA 23 AGTGATTCAGAGAAGACGTT GTAGGGATAAGATTTCAATC 24 CCCAGTACCTAACCTGACAAA GCCTGGTAAAGTGCTAAGGT
Genetic Analysis of Rare Eye Disorders in Pakistani Families 48 Materials and Methods Chapter 2
Table 2.9: List of primers used for the amplification and sequencing of VPS13B
Exon Forward Primer(5ˊ to 3ˊ) Reverse Primer(5ˊ to 3ˊ)
1 CGTGGAGGGACAGTTTGTTT AGCTAGAAGACCTCCCGTCC 2 AACGAACGCTCTTTCCTTCA CCGTCTAAACAAGCTGAAAA 3 TCTCTGAATATTCTTGTGTTGG AACAGTTGGCATATTTGAAA 4 ATGATCGATGGTTTTCTTTTTC AGCACTGGGATTACAGGCAT 5 ACTGAGAGATTTGTGGCTAAT AACTCAGTTGGCCCAAAGAA 6 ATAGTTGCCTTTCCCCTGCT TGATTAGCATCCACAAGAGT 7 AAACATGCGTTTGTTGGTGT TTCCCAATGGTAAAACGTAA 8 TGGGAGGAAAAATTTTAAAGG GAGCACAGAAAGGAAACCGT 9 TGTTTTTGTTGCACCTGCTT GGGCCTATAAGACGAAAGGA 10 CAAGGAAAGCCTCTAACATTT CACTTCAGTAAGCACTTAATT 11 GGCTAATGGTTTTTCTTCCCA CAATGTGTCCACCCAAACAC 12 TCAAGCTTTAAACTCAAAAGT TCTGAGGAAGGCTTTGTTTCA 13 GCTATAAAAATGAGAGAAGA TCTCAAAACAAATGGCAAAA 14 TGGAGAACTAATTCATTTTTC AAAAATCCATATATGAGGGA 15 GCTTGCATAGAGGGAACTGC ATCTGATGATCCCAAAGCCA 16 CTTTGTCTGTGTGAACACTTGC GACAGATACATTTGGGGGTT 17 CTTCCCTTGCAACCTAAGTCA TGCCTCTAACACAAATTTTCC 18 GCTTCTTTACAGTAGATGGAC GAACCTACATCTCTTGTCCTT 19 TTTCCCATCCATGCTTTTTC GCAAAAGTGCACCATCCTTT 20 TTAAATGCCTTGGTGAAGGA TAAAACGCAAGGCCAATTCT 21 AACATTCTCAAGTGACTCATG CCAATTTTAAAAGCCTTTCTG 22 CGCTTGTTACTGTTTGTCTGTT GGTGGGGAGACAAAGGAAA 23 GTTATTAAGAAAACCATAAGG AAAAGGTACAACCAAGTTCA 24 CCTTTGCTGCTTAAGAAATAG AAATTGTGGATGCTAACTTG 25 GGATTACAACCCCTGCTTTTT CCTGCTTTCTCTTGTGAGCA 26 GGAAATCTCAGTTTAAGACAT TGGCAAGAAGTGGTAAAATG 27 GCAAGGAAAGAAACAATCTTG TGCTGGGAATTAAAAAGGAT 28 TCTGGCGAAGATGTTAGGTG CACCAACAAATCTAAAAATG 29 TTTTTGTTTGTGTGCTTCCC GAAACCCTTCAACAAAATGG 30 TGGATTGAAACTGGAAGTTGA AACCATGATCTGGAAATCTG 31 TCATTTGCATGTAAGATGTGA GAAAGGAAGGAAGGAAGGG
Genetic Analysis of Rare Eye Disorders in Pakistani Families 49 Materials and Methods Chapter 2
32 TGTCAATGTGAAATGTAAAAT AACTTTGTTCAAAGAAAAAT 33 TTCAGTGCAGTGTTGTGAACT TTCTGAACTCAAATTCTTGTA 34 TTGCTTTTTGTCTTTTCACCTT TTCCTTCTCTGGGTTCCTGTT 35 TGAGGTCATTTTCTTCTTTCCA CCACAAAGCACAACCAACTG 36 TTCCATTCCCTCAAAGATTTC TGCAGGATGAAAATTGTTGC 37 TGGTTATTTTATCTGTTTTCTT CACCAACTATTCTGGCAATG 38 TGTCTTTGAAAATAATGAAAT CTGAAACTGTGGCAATCCCT 39 TCATCTGAAAGCTATCATGTTT CTGAGGTCAGTCCACAGCAA 40 AACATTGTTTATATGACACTT GCACTCCAGTAAGTTTGAAG 41 TGTGCACAAACAAATGAAACA TTTTGCACGGAATGTCAAGA 42 TTGGGACACTTTTATGTAGGA TCTTACTTGTTCTGTCTCCCC 43 CCAACCAAGCAAGACGACTC TGACAAATACCCTTTCTTACC 44 TTCAAGCAATAGAATTTCATC GCAACCACATGCACAGAGAC 45 TTTCCCCTTTGTCATGTTCC TATGATCAGCCCTTTCCCAC 46 AAAAGCATAGTTTCTATTTGC TCATTGTTTCCCAGTGTAATG 47 TTGGGAAATTTTGGTTATTGA TTGAAAACACTCAAGAGAAA 48 TTGGCTCATCTTAATTGCTGTT TCATATGTGGCCAAACTGTA 49 TAATCCGATCCATGTTGGCT GCAGAAGAAATGAATCCCCA 50 GGAAAGGTTTTCCAGCAATG TGAATAATTAAGAGGTGTCT 51 TGAAGTCTGAATTGATGAAGC GAAAATTTCAATGGTAAAGC 52 CCAAACTGATGTATCTGTGCC AGAACAGGAAAGGTCAGAGT 53 GCTGGAATACTGCAACAAAGC CCCCCAGTGCAAGGTTACT 54 TCATCCACACACTGTCCCAT TGCACACACCACTTATGGTA 55 GCTTTCTCCTGCATGCAAAT TCTGTTAAGATCATAAACGC 56 CACCATGGAGGGATATTTGG AGACAGGTTAAGGGGATGGC 57 AATTGGTACTGTCCTGGCAGA CAGGGTTAGCTTTTCATTTGC 58 GCTAATGTGCTCTCTGCATTTT CCCTGCGACCATTGTATCTC 59 TTCCAGAGGAGAGAGCATTCA GAGACTTGGGGGACAGAACA 60 TGTTCTGTCCCCCAAGTCTC AAGGGCATTTTTCTTTGGGT 61 TGAATAGCCCGTACACATGG CATTATGTGGAGATGACAAA 62a AAAGAAAAGGTGAGTGGGGG CAGTGGTGAAGATGGGTCCT 62b AAATTTGCTCGTCAGCATCC AAGCGTGTCATTTCTACCCG 63 TTTGAGGTTTCAATCACCCC AAGGGAAGGAGTGAAGGCA 64 CTGAAACTACTGCCTTGGGG TCAGCCTGCTGGAGTACAGA 65 TGTTGCCTGACTTCTGAGGA AGTAACGTCTGGGTTGGCCT 66a GGATGGCTCTGAACAGATGA ATGTGGACTTCTGGTCTGCC 66b AGGTTGCCCCATTGGTAAAT CTGGCCAGCTAGTCTTGGTT
Genetic Analysis of Rare Eye Disorders in Pakistani Families 50 Materials and Methods Chapter 2
67a ACTCTCGTAAGGGTCTGGCA GCCTGGCCACATTCTATGAT 67b TTGCTCTATGACACTTGCAAA GGTAACAAGCTGTAGCCCCA 67c TTGGGTTACCAAGATGTCTTA GTGAAAATTTGCATTGTAAA 67d TTGTTTAAAATAAAAGGTGTC TGCGAGCAAAGTGATACTGG
Table 2.10: List of primers used for the amplification and sequencing of DNM1L
Exo Forward(5ˊ to 3ˊ) Reverse(5ˊ to 3ˊ) n 1 CCTCCGCTCCAGAACTACAA AAGGCCCTCCTCCCACAG 2 TGCATCAAGGCGGAGAAT GTTCTCGAAACCTGGTGGAA 3 TGTGTTAAGAAACTCATTTTG ATCAAAAATGAAGAGCTGTAA 4 GGGATAAGCACTAAACTTAT TGAACAGAACTCACAAAATGC 5 AGTGGCAACTCCTTACGCTG TACCCCATTCTTCTGCTTCC 6 TGTTGCCTTTTTGAATTCCT CCAATAAACAATTGTGGTTAG 7 CCCCCTCCAGCTTAAGAACT TATATTTACTGATGCTTATGCC 8 CAAGATGTTTAATTTATGTTG TGTTAGGCATATGCAGTCATTT 9 TTCCCATGTGTTTCATCAGG TGGGATGTCAACGAAGTGAA 10 TTGATAACGTTGAGCCCTCC TGAAATCATCAAAGGGAAAGT 11 CTATCGATTAAATGTGGGTA TTACCATTGTAAAATAAGCAT 12 TTTCTTTCTTTTCTTTGCCCTT TTGCTCTGAAGTGAGAATGCT 13 TGCTGTCATCATCTAAGGTA TGAACCCTCTCAGACACCAA 14 AAAAATTTGACTTGTTTAGG TGTGACAATTTTACTTTGCTTT 15 TTTTTGCAATGCCAGAAACC TGGGTAAGAAAAACTTTAACC 16 AACCCTTGGGAAGAACTGAA TTCCTTCCACCCAGTGAAAC 17 AGGTGGGAGGATGGCTTAGT AAAAAGCAGCCAAGCAAAAA 18 TTTAAAATTGCCCTCATGCC GAATCTGAGGGCTATCCTTGC 19 CAAAGTTGCATAAAGTGTTG TTACAACAGATTTTTCTACCTG 20 TTATGGCATGAGTCCCAACA GCATTTATGTCAGTGAATTCA 21 TGCATTTTTGCATCCTTGAT CCAAAGGTACCAACATTTCCA 22 GGTGGGAGAAGAGGAACGA TCCAGAAGTATTAAAGTCCGT 23 GAGGTTAGCATCTAAGCCCA CCAACAGGAAACAAGCCTAGC 23a TTGGAAAAATTACCCTGCGT AGTGCAAATGGACCCAGAAT 23b GAAAGCTGAATGCACAAGAG TGTGTATCTATCTGGGTGTTGT 23c GAGGTGGAGGTTGTGGTGAG TTCCGTTGTTTCTTGCCTCT 23d TGCACTTTTCTCCAGCACAT TTGTCTCCCTTTCTCTGGGA
Genetic Analysis of Rare Eye Disorders in Pakistani Families 51 Materials and Methods Chapter 2
Table 2.11: List of primers used for the amplification and sequencing of ATP1A2
Exon Forward(5ˊ to 3ˊ) Reverse(5ˊ to 3ˊ)
1 GAGAGGGGGAGAAGGACCTA CTTCATCCTTCCTCAGCAGC 2 CCCCTCTCTTCCCTGACTCT GGCCTCAGTTTCCTCATCTG 3 CATGGTGACTGGCTGGGT CAGGGTTGGAGGACAGTCAC 4 TGTCATCTTGGATGGCACTG CCTTACAGCCTAGCCCAGAG 5 AGGGGCAGAGACAAGCATTT AGCTCTGCACACAGCCTTCT 6 AGTGGCTCTGCCAGTCTGAT TTGGTTCTGAGCGTATGTGC 7 TGCTCAGGAAATAGGATGGG TAGTGAGACCCTCCCCTGGT 8 GCCACGGTCTAGGGTAAGGT CCCTCAGCCTCCTCTAATCC 9 AAGGCTCTAAAGGGAGCCAC GCAAGAGGCTTTGGAGACAC 10 ACCTGATCCTCCACTCCCTT ATGATTCCCCTTGGCTTTGT 11 TCCTTACCAGCTGCTGCTCT CTTGGGAATCCCCTTCTGAG 12 AAGCCACTCTGCGGATCTC CCACTGCAGCTCCTTGAACT 13 AGAGGAACAGGAGGGGGATA GTGTTGATTAGGGCACAGGG 14 AGGAGGGGCTGGTACAGGT TCACTCCATGCTTGTCTTGG 15 CCAAGACAAGCATGGAGTGA GTATCCTGCAAACCATCCCA 16 AAGAGTCCCTCTGACCTCCC CAGTGCACCTCTCCTCCCT 17 TCCTACGTCCCTTCAAATGC GAAAGCTGGGAAAAGAACCC 18 TTCTGCTTCCTGCTCTGACC TCAGCTTCCCGTACCTTCAC 19 GTCCTACCCTTTCCTCCGAC GGAAAGAAGGGAGGGAGAGA 20 GATCTCTGCCTCCATGATCC CCCCCGTATGACTACTCAGG 21 AACCTCTGATGCTGCTGACA GCAGGAACCAGTAGTGGGAG 22 TCTGAATTCGACTTCTCCTGAA GAAGGAGGTCCAGTGAGCTG 23 AAGCTCATGCTGCAATCTCC AATGTGGGACGTAGAGCTGG
Genetic Analysis of Rare Eye Disorders in Pakistani Families 52 Materials and Methods Chapter 2
Table 2.12: List of primers used for the amplification and sequencing of SLC19A2
Exon Forward(5ˊ to 3ˊ) Reverse(5ˊ to 3ˊ)
1 CAATGGAAGAGCAGGCAAGT GTCCTCTCTTCCTCCGCTG 2 TTCCAGGTCCTTTCATCACT CCAAGAGGGAGTTTGCTGTT 3 TGGGCCTGTAAATTGCTTTC GGCTGGCTTAACTACCAGAGG 4 GCAACAGCATTTGTGTAGCAA TCCTGTTACAATTTTTCCTAAG 5 TTTCATTTGGTTGGAAAGGC TCACCCTGATCAAGTCACACA 6 GAGGCTTTATGGACAAATTCT GAAATGATACGTACACCTTAA 6a TCACTGGCAATATTTGTTCTG CCCCAGTTAAAAGCACCTATC 6b ATCAGTCTACCAAGGGGCTG TAGGCAAGTTAGACCAGGGG
Table 2.13: List of primers used for the amplification and sequencing of KCNJ10
Exon Forward(5ˊ to 3ˊ) Reverse(5ˊ to 3ˊ)
1 TTGGTCTGTTCGGAGCCC GAGTTAGGGGGACAGGACC 2 ATGGGGTGAGGGTTAGGAGT TCACATTGACCTGGTTGAGC 2a ACCAAGGAAGGGGAGAACAT CCACTTCAGCCTAATCCCAC 2b GCTTCTGCCCCAATACACAT CCTCCCTTCTCCCAAAGAGT 2c TTCCTTTCCTGCTCAGCCTA AGTTGGTGGTGATCATGGGT 2d CAGAGCCTTGCAGAGAAACA AGTCCACAGTTGGTATGGGG 2e CAGGTCTGGTGAGAAATGGG CCCTGTGGAAGACGGAAATA 2f GCACCATTTTGTTTCCCTTT TGACAACCAAAGAGTCATCC 2g GGTGTGTAAGATTTGTTTTGTTT GAAGTTCTTCCAGCACAGCC
Genetic Analysis of Rare Eye Disorders in Pakistani Families 53 Materials and Methods Chapter 2
Table 2.14: List of primers used for the amplification and sequencing of CRYAA
Exon Forward(5ˊ to 3ˊ) Reverse(5ˊ to 3ˊ)
1 ACGCCTTTCCAGAGAAATCC CAAGACCAGAGTCCATCGCT 2 ACAAGGGAGCAGCCTGAAT CTGGGGAGGACCCTGTTTAT 3 GTGACCTCATTCCACAGGCT CGTGACCCCCTTGTCCTC 4 CAGCTTCTCTGGCATGGG CTGCTGTTTATTGATTGCCG 4a CCCTCTATGTAGTGCCGCTC GCTTGAGCTCAGGAGAAGGA
Table 2.15: List of primers used for the identification of deletion breakpoint in VPS13B
Oligo Forward Primer(5ˊ to 3ˊ) Reverse Primer(5ˊ to 3ˊ)
CAAGTTTCTTAGTGTCTGGA Set I GAACCAGGGAGGTAGAGGTT G
Set II AGCTATCCCATTCTGTGTCC GCAATCTTTCCATCCATGA
Set III AGATCATGCCACTGCACTC CACTGAACCCACCCAATTAT
GTGGTTATGATGTGTGAAGT CAGCACTTCTAGCTTACACA Set IV T CATTT TGCTGAAGAATAGATTGCTG Set V TCCTAAAATGTGCCATTGGTT AA
Genetic Analysis of Rare Eye Disorders in Pakistani Families 54 Achromatopsia Chapter 3
CHAPTER 3
ACHROMATOPSIA
Genetic Analysis of Rare Eye Disorders in Pakistani Families 55 Achromatopsia Chapter 3
3. ACHROMATOPSIA
Achromatopsia (ACHM) is a rare retinal disorder that is primarily known to affect cone photoreceptors. The estimated prevalence of ACHM is about 1 in 30,000 individuals worldwide and is generally considered as a stationary form of cone dysfunction, while a recent study also provide evidence for the slow progressive
ACHM in a few patients (Aboshiha et al., 2014). The characteristic features of ACHM include photophobia, nystagmus, color blindness, and severely reduced visual acuity (Poloschek and Kohl, 2010) with normal fundus and absent cone electroretinography (ERG) response. However, sometime rod ERG response may also be slightly abnormal (Khan et al., 2007) indicating the presence of rod dysfunction in certain cases. Similarly the presence of retinal pigment epithelial disturbance as well as atrophy is also observed in some ACHM patients (Sundaram et al., 2014). ACHM has been divided into incomplete and complete types on the basis of its severity and clinical presentations. The cone ERG response is totally absent in complete ACHM cases, whereas patients with incomplete ACHM have some residual cone ERG response. Similarly, color vision and visual acuity of incomplete ACHM cases are also comparatively better than complete ACHM cases (Nishiguchi et al., 2005).
To date, mutations in five genes are implicated in ACHM, which probably explains 93% of the cases worldwide (Roosing et al., 2014). The currently known ACHM genes; CNGA3, CNGB3, GNAT2, PDE6C and PDE6H encode protein products crucial for the phototransduction cascade, i.e. polarization and membrane depolarization. Previous studies revealed that CNGA3 and CNGB3 mutations are the major cause of ACHM worldwide (Kohl et al., 2005; Grau et al. 2011), whereas the remaining ACHM genes are only reported in a few patients (Schon et al., 2013). Earlier studies targeted European population only, but later a study on Middle East population also showed the involvement of CNGA3 in 60% of ACHM cases (Ahjua et al., 2008).
The data of ACHM from Pakistan is scanty and only one study has been reported to date (Azam et al., 2010). This study was initiated to follow earlier assumptions regarding the involvement of additional ACHM genes (Wiszniewski et al., 2007) in the Pakistani families. Here, we analyzed five ACHM families (Labeled as A, B, C, D and E) to identify the pathogenic variants responsible for the disease phenotype.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 56 Achromatopsia Chapter 3
3.1 Description of Families
Five multigenerational families presented here have three or more ACHM individuals and were collected from different cities of the Punjab province. These families reside in the rural areas and belong to community/ethnic groups with high preference towards consanguineous marriages. The pedigrees presented in figure 3.1 are clearly indicative of autosomal recessive inheritance.
3.2 Clinical Presentation of Families
The probands of these five families were initially diagnosed as ACHM on the basis of clinical presentation that included nystagmus, moderate photophobia, excessive flickering in sunlight and normal night vision. In most of the ACHM patients the onset of some of these symptoms was before the age of 2 years. The ophthalmological testing, i.e. visual acuity and Shinobu Ishihara 24 plate testing performed on the proband of each family indicate inability to discriminate colors, which led to the initial diagnosis of ACHM.
The affected individuals of family A presented with severe photophobia, nystagmus and absence of color discrimination from early childhood. They have a normal night vision, but in daylight they experience extreme discomfort and exhibit extensive blinking. Fundus examination of a 28 year old affected male individual (IV-1) showed nearly normal fundus (Figure 3.2a). The affected members of family B reported variation in clinical presentation as few had severe problems in day light while some had adopted this (especially the elder affected members) and were able to do their routine daily work. The younger female individual (IV-12; aged 15 years) was totally color blind, but her fundus examination showed essentially a normal retina except for the loss of foveal reflex, indicating the presence of a modest maculopathy or a foveal hypoplasia (Figure 3.2b).
The examination of affected individual, V-3 of family C showed bilateral total color blindness and his fundus examination showed the presence of maculopathy along with mild retinal changes (Figure 3.2c). Similarly a 50 year old (IV-4) ACHM patient from family D, presented total color blindness with very low visual acuity, i.e. 20/200 and the fundus examination showed discrete round-shaped macular chorioretinal atrophy (Figure 3.2d). In family E, the affected female individual (VI-4) showed bilateral nystagmus and was color blind on Shinobu Ishihara 24 plates test. The fundus
Genetic Analysis of Rare Eye Disorders in Pakistani Families 57 Achromatopsia Chapter 3 examination showed thin pigmented epithelia and prominent choroidal vessels with paler optic discs (Figure 3.2e). The visual field was also markedly reduced as compared to normal individuals (Table 3.1).
3.3 Homozygosity Mapping and Genetic Analysis
DNA samples from available affected and normal individuals of three families (A, B and C) were subjected to whole genome SNP analysis and the genotype data was analyzed with homozygositymapper to find homozygous genomic regions shared between the affected individuals of the respective families. On the other side, homozygosity mapping was performed in two families (D and E) by using STS markers flanking known ACHM genes. The detail of each family is given below;
For family A, DNA samples of four affected (III-1, III-4, III-5, IV-1) and seven normal (II-1, II-2, II-3, II-4, III-2, III-3, III-6) individuals were subjected to whole genome scan (500K array) and subsequent data analysis with homozygositymapper, revealed a single peak of homozygosity on chromosome 1 (Figure 3.3). A careful analysis of the genotype data indicated the presence of a 16.0 Mb homozygous region which was flanked by markers rs1183449 and rs3861948 (Table 3.2). A maximum multipoint LOD score of 3.5 was obtained for several markers in the homozygous region found on chromosome 1. Two-point linkage analysis performed with online version of the Superlink yielded a maximum LOD score of 3.06 at marker rs6700867 (Table 3.3). The minimum critical region identified by the linkage analysis and homozygous region detected by Homozygositymapper was flanked by markers rs1183449 and rs3861948 and was shared by all the affected individuals of the family A (Figure 3.4).
Seven DNA samples (III-3, III-4, IV-10, IV-11, IV-12, IV13 and IV-14) of family B were subjected to whole genome scan and data analysis with homozygositymapper showed peaks of homozygosity on chromosome 1, 2, 6, 8, 9, 11 and 12 (Figure 3.5). Detailed analysis of these detected homozygous regions showed that an 18.7 Mb region on chromosome 2 contains a known ACHM gene, i.e. CNGA3. This largest homozygous region was flanked by rs17041053and rs17652317 (Table 3.2) and was shared by all the affected individuals of family B. The two-point and multi-point linkage analysis with SNP markers on chromosome 2 yielded LOD scores of 1.75 and 2.6, respectively (Table 3.4).
Genetic Analysis of Rare Eye Disorders in Pakistani Families 58 Achromatopsia Chapter 3
For Family C, DNA samples of three affected (V-3, V-4, V-5) and their healthy parents (IV-1 and IV-2) were used for whole genome SNP, which led to the identification of homozygous regions on chromosome 7 and 8 (Figure 3.6). The homozygosity peak on chromosome 8 was bounded by markers rs4629903 to rs28624756 and corresponds to a region of 50.5 Mb (Table 3.2). The linkage analysis of the homozygous region was carried out by calculating multi-point and two-point LOD score with Merlin and Superlink respectively. A maximum multipoint and two point LOD score of 1.75 and 1.5 respectively was obtained for several markers in the homozygous region identified in this family (Table 3.5). The large homozygous region identified in family C contains a previously known ACHM gene, CNGB3, which was selected for further analysis to identify the disease causing variation.
Available DNA samples from the remaining two families (D and E) were genotyped with STRs markers flanking currently known ACHM genes which showed the presence of a homozygous region in both families on chromosome 2. The haplotype analysis revealed a 26.5 Mb homozygous region in family D (Figure 3.7), which was flanked by markers D2S2181 (chr2:88676581; hg19) and D2S308 (chr2: 115112691; hg19). Similarly, a 19.9 Mb homozygous region (Figure 3.8) of the family E was bounded by markers D2S2333 (chr2: 85388120; hg19) and D2S1343 (chr2: 105379483; hg19). The homozygous region identified in both families overlap with each other and contains CNGA3 gene (Table 3.2).
3.4 DNA Sequencing and Bioinformatic Analysis of Variants
The homozygous region identified in the family A contains 356 genes, but none of them have been previously implicated in any eye disorder. Based on the expression and functional aspects, three genes, i.e. ATPase, Na+/K+ transporting, alpha 2 polypeptide (ATP1A2), solute carrier family 19 (thiamine transporter) member 2(SLC19A2) and potassium inwardly-rectifying channel, subfamily J, member 10 (KCNJ10) were prioritized and sequenced but no disease causing mutation was identified. However, a synonymous variant, c.1119G>A was detected in ATP1A2 in the affected proband of this family. But detailed analysis of the public databases revealed that c.1119G>A is a commonly found variant (rs1063125) with a minor allele frequency of 0.2.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 59 Achromatopsia Chapter 3
The homozygous regions identified in families B, D and E harbor CNGA3, which led us to Sanger sequence all coding exons and splice sites in probands of these families. Analysis of the sequence data revealed the presence of variant c.937G>C in family B, c.827A>G in family D and c.1306C>T in family E. The identified variants were present in exon 8 and show segregation in the respective families (Figure 3.9)
The variant c.937G>C resides in exon 8 and results in a missense mutation which replaces glycine with arginine at amino acid position 331 in the protein (p.G331R). This variant was not present in the human genome mutation database (HGMD), exome variant server (http://evs.gs.washington.edu/EVS/) and 1000 SNPs project (http://www.1000genomes.org/). The conservation analysis showed that mutated amino acid remained highly conserved during the course of evolution with a high phyloP score, i.e. 5.4 (Figure 3.10).
The family D variant c.827A>G also results in a missense variation leading to the replacement of asparagine with serine residue at codon position 276 (p.N276S). The p.N276 is among the conserved residues in CNGA channel proteins of mammals (Figure 3.11). The motif finding indicated location of the p.N276 residue within the multiple functional patterns of protein like IIIHWnACIYF (311–321 AA) and YIYSLYWSTlTLTTIGET (351–368 AA) and thus can plausibly have functional importance. Similarly the hydropathy analysis showed drops of hydrophobicity values from -0.8 to -3.5 by N276S substitution resulting in a conformational change in the corresponding helix of CNGA3 protein (Figure 3.11).
In family E, the identified variant, i.e. c.1306C>T replaced the arginine with tryptophan in the polypeptide at position 436 (p.R436W) which is a highly conserved residue of the CNGA3 protein (Figure 3.10). The mutation has been previously reported in ACHM patients from different countries.
However, the homozygous region identified in families C contains CNGB3, and Sanger sequencing of all coding exons and splice sites showed the presence of a variant c.646C>T in exon 6 resulting in a non-sense mutation at codon R216 in the polypeptide (p.R216X) (Figure 3.12). The variant lead to early termination of protein and probably result in the production of null alleles.
Further, in silico analysis using mutation taster, Polyphene2 and SFIT showed that three CNGA3 variants (p.G331R, p.N276S, p.R436W) identified in families B, D and
Genetic Analysis of Rare Eye Disorders in Pakistani Families 60 Achromatopsia Chapter 3
E and a CNGB3 variant identified in family C are probably damaging, deleterious, and disease-causing.
3.5 Discussion
The present study described five Pakistani families (A, B, C, D and E) which were ascertained from different regions of Pakistan, showing presentations of ACHM, i.e. photophobia, nystagmus, color blindness and low visual acuity. The recessive mode of inheritance of ACHM in these families led to the application of homozygosity mapping approach as a tool to identify the genes responsible for disease phenotype. Our results indicate mapping of a novel ACHM locus in family A, whereas four families were mapped to already known ACHM genes. Three (B, D and E) families carry missense mutations in CNGA3 while one family has a nonsense mutation in CNGB3 gene.
The locus identified in the family A on chromosome 1q23.1-q24.3 overlapped with a previously mapped autosomal recessive cone-rod dystrophy (CORD8) locus in a large family of Pakistani origin. The CORD8 was initially mapped to chromosome 1q12- q24 with a region of homozygosity between D1S442 and D1S2681 and was mapped to a critical disease interval of 21 cM. Later this region was refined from 21 cM to 11.53 cM using new markers, but mutation screening of candidate genes CRABP2, GNAT2, and KCNJ10 could not result in the identification of any disease causing variation (Khaliq et al., 2000; Ismail et al., 2006). We also selected three genes, i.e. ATP1A2, SLC19A2 and KCNJ10 based on their expression and functional role in eye and sequenced in an affected individual from family but could not identify any pathogenic variant. Keeping in view the inheritance pattern in family A, the probability of presence of heterozygous mutation could not be overruled as it was reported that heterozygous mutation might help in solving the phenotypes in such families (Khan et al., 2014). However, further study is required using next generation sequencing to identify the pathogenic variant/gene in this family.
The affected individuals of both families (family A and CORD8) reported similar phenotype, i.e. presence of photophobia, color blindness and day vision problem. However, the affected of CORD8 family also had night blindness, which was absent in the affected individuals of family A. Similarly, the fundus of affected individuals of family A was also normal and did not show any other sign like pigmentation or
Genetic Analysis of Rare Eye Disorders in Pakistani Families 61 Achromatopsia Chapter 3 macular degradation while the fundoscopy of CORD8 patients showed marked macular degeneration along with attenuated retinal vessels and mild pigmentation in the periphery. This indicates that the phenotype of family A is different from CORD8 and thus may present an opportunity to identify a new ACHM gene.
Mutations in five genes CNGA3, CNGB3, GNAT2, PDE6H and PDE6D have been implicated in ACHM till to date. Among these, CNGA3 and CNGB3 genes encode A and B subunits of the CNG channels, which collectively form a functional tetramer in the outer segment of the retina (Peng et al., 2004). The structure of both A and B subunit of CNG channels is homologous and composed of six transmembrane helices (S1 to S6), a pore forming region between S5 and S6, a cyclic nucleotide binding domain (CNBD) and a C-linker region between S6 and CNBD. These channels are evolutionary highly conserved and mutations in these channels impair function of cone photoreceptors which cause either complete or incomplete ACHM (Koeppen et al., 2008).
CNGA3 is a highly conserved protein and the majority of mutations reported to date are missense in nature. Earlier functional studies of some CNGA3 mutations have shown a direct genotype and phenotype relationship (Koeppen et al. 2008). The expression of two CNGA3 mutations p.R427C and p.R563C in human embryonic kidney cell line (HEK293 cells) showed reduced cGMP current as compared to wild type. Further imaging experiments on CNG channels with the mutations (p.D252N, p.L433W, p.I433W, p.G525D and p.R569H) revealed abnormal calcium conductance providing strong evidence that these missense mutations are pathogenic and causative factor of ACHM (Koeppen et al. 2008). In another study, functional analysis of 39 missense mutations of different CNGA3 regions was done in HEK293 cells and interestingly patch-clamp (pCPT) recordings of 32 of 39 alleles did not reveal any cGMP-activated current, which further confirms that these mutations impair channel function (Muraki-Oda et al., 2007).
These studies have shown the importance of CNGA3 protein, especially between 162 to 593 residues, which are highly conserved at structural and functional levels (Wissinger et al., 2001). Three CNGA3 variants; p.N276S, p.G331R, p.R436W, identified in our study also reside in this region and most plausibly these variants affect the protein function by altering the protein structure. This assumption is further supported by the presence of a majority of the CNGA3 mutations in the central part of
Genetic Analysis of Rare Eye Disorders in Pakistani Families 62 Achromatopsia Chapter 3 the protein (Wissinger et al., 2001). For instance, p.N276S mutation resides in the S4 motif of the protein that surrounds the ion channel cavity. The in silico analysis of p.N276S mutation showed drops of hydrophobicity values (-0.8 to -3.5) due to the replacement of aspargine with serine residue, consequently resulting in a conformational change in the corresponding helix. This provides strong support that p.N276S mutation is likely to delocalize the channel by helix displacement and this plausibly results in the absence of cGMP activated current at the plasma membrane.
This was further supported by previous studies, which showed that missense variations in the S4 motif result in the abnormal processing and localization of the encoded protein in the plasma membrane. Functional analysis of missense mutations present in the S4 motif like p.R277C, p.R277H, p.R283W, p.R283Q and p.T291R in HEK293 cell lines showed the absence of cGMP-activated current which indicates reduced expression of protein at surface level, and plausibly represents the major reason of ACHM due to S4 mutations (Muraki-Oda et al., 2007).
Faillace et al. (2004) did a functional analysis of charged and neutral amino acid in the S4 motif of bCNGA3. They reported that replacement of charged residues with neutral residues (either single or all) result in failure of functional expression. However, in case of conserved neutral amino acids, replacement of some residue showed functional expression whereas other led to failure. When they replaced Asn295 of bCNGA3 (corresponds to Asn276 in hCNGA3) with Gln, no current at -75 mV was recorded using the patch clamp cGMP measurement while the wild-type measurements were -74.0 ± 50.5 mV. This shows that asparagine has a crucial role in the normal functioning of CNGA3 protein.
In the family E, we identified an already known mutation (CM014547) c.1306C>T in CNGA3, which resulted in an amino acid substitution, i.e. p.R436W in the coded protein. Initially, it was assumed that, the p.R436W mutation is confined to the German population (Wissinger et al., 2001) but later this was also reported in British and Japanese ACHM patients (Johson et al., 2004; Goto-Omoto, et al., 2006). The presence of this variant in the Pakistani population indicates that probably this variant is a universal cause of ACHM. Previously this variant was recorded in a compound heterozygous state and shown to be responsible for both complete and incomplete ACHM ((Johson et al., 2004). In the affected individuals of family E, this variant was found in homozygous state. However, the phenotypes of affected members of the
Genetic Analysis of Rare Eye Disorders in Pakistani Families 63 Achromatopsia Chapter 3 family E were consistent with previous reports. As this mutation accounts for about 55% of ACHM cases in the rest of the world, so it may be present in additional Pakistani ACHM patients/families.
In contrast to the missense mutation identified in CNGA3, for CNGB3 a nonsense (p.R216X) mutation was identified in family C. It is now well established that 50% of ACHM cases carried mutations in CNGB3 and the majority of these are nonsense mutations plausibly resulting in protein truncation, especially before the cGMP binding site. The mutation p.R216X is located in exon 6 leading to truncation of CNGB3 protein before cGMP binding site. The mutant mRNA likely undergoes nonsense mediated decay and probably represents a null allele (Kohl et al., 2005).
This study showed the identification of a novel ACHM locus indicating the presence of further genetic heterogeneity. Further study is being carried out to identify the pathogenic variant/gene in this family, which may help to resolve the undiagnosed ACHM cases. In the remaining four families, the involvement of CNGA3 (03 families) and CNGB3 (01 families) is consistent with the worldwide trend where the majority of ACHM cases carried mutations either in CNGA3 or CNGB3. However, the implication of CNGA3 in three families makes this major genetic player in the Pakistani population as compared to CNGB3. These findings further extend the knowledge of both clinical and genetics of ACHM in Pakistani population and may help in early diagnosis and genetic counseling of the families.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 64 Achromatopsia Chapter 3
Figure 3.1: Pedigrees of five ACHM families. Filled circles/squares represent affected individuals and hollow circles/squares show normal individuals. Consanguineous marriages are indicated with double lines, while deceased individuals are indicated by diagonal lines. The probands in each family have been indicated using an arrow.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 65 Achromatopsia Chapter 3
a b
c d
e
Figure 3.2: Fundus photographs of ACHM probands a: right eye of affected IV-1 of family A showing nearly normal fundus, b: right eye of affected IV-12 of family B showing essentially normal fundus except for the loss of foveal reflex, c: left eye of affected V-3 of family C indicating maculopathy along with mild retinal changes d: right eye of affected individualIV-4 from family D with discrete round-shaped macular chorioretinal atrophy, e: the affected VI-4 of family E present thin pigmented epithelia and prominent choroidal vessels with paler optic discs.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 66 Achromatopsia Chapter 3
Table 3.1: Clinical description of ACHM families
Clinical Family Family Family Family Family feature A B C D E
Probands IV-1 IV-12 V-3 IV-4 VI-4
Photophobia + + ++ +++ ++
Nystagmus + + + +++ ++
Color Vision - - - - -
NB - - - - -
VA 20/60 20/200 20/60 20/200 20/40
Fundus Normal Normal Maculopathy Discrete Pigmented loss of mild retinal round- epithelia, foveal changes shaped Choroidal reflex Macular vessels, atrophy Paler optic discs
NB: Night blindness, VA: Visual acuity, +/- indicates presence/absent of the symptom + mild, ++, moderate and +++ severe
Genetic Analysis of Rare Eye Disorders in Pakistani Families 67 Achromatopsia Chapter 3
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22
Homozygosity score
No of Chromosome
Figure 3.3: The output image of SNP data obtained from homozygositymapper presenting a single red bar pointing identified homozygosity-by-descent (HBD) on chromosome 1 in family A. The homozygosity score is given on X axis while the number of chromosomes, i.e. 1 to 22 are shown on Y axis.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 68 Achromatopsia Chapter 3
Table 3.2: Description of homozygous regions identified in five ACHM families
Homozygous Region Known RD Family ID Gene Region Chr Flanking SNPs/hg19 coordinates (Mb) (If any)
A 1 rs1183449-rs3861948 16.0 -
2 rs17041053-rs17652317 18.7 CNGA3
B 6 rs6596790-rs1887507 6.7 -
8 rs7006666-rs2705017 3.9 -
7 rs727531-rs764891 36.6 IMPDH1 C 8 rs4629903-rs28624756 50.5 CNGB3
D 2 g.88,676,581-115,212,944/hg19 26.5 CNGA3
E 2 g.85,488,120-105,479,784/hg19 19.9 CNGA3
Genetic Analysis of Rare Eye Disorders in Pakistani Families 69 Achromatopsia Chapter 3
Table 3.3: Two-point and multipoint LOD scores for several markers on chromosome 1 in family A
Marker hg19 Genetic Multipoint 2-point LOD Coordinate Position LOD (0.00 theta)
rs1183449 157,083,817 158.04 -5.81 -2.76
rs11265177 159,325,834 161.90 3.52 2.97
rs1538971 161,676,394 166.83 3.56 2.57
rs6700867 162,306,295 167.36 3.56 3.06
rs12043375 164,365,846 173.18 3.56 2.94
rs12562794 166,828,957 175.21 3.56 2.78
rs2280990 168,211,282 178.15 3.56 2.94
rs16863397 170,501,167 180.94 3.56 3.04
rs17350579 172,066,592 182.25 3.56 2.67
rs3861948 173,103,273 183.03 ∞ ∞
Genetic Analysis of Rare Eye Disorders in Pakistani Families 70 Achromatopsia Chapter 3
Figure 3.4: Haplotype of family A for several chromosome 1 markers show a homozygous region between rs1183449 to rs3861948.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 71 Achromatopsia Chapter 3
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22
Homozygosity score
No of Chromosome
Figure 3.5: Image of SNP data analyzed by homozygositymapper presenting the homozygosity peaks (red bars) on different chromosomes in family B. The homozygosity score is given on X axis while the number of chromosomes, i.e. 1 to 22 are shown on Y axis.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 72 Achromatopsia Chapter 3
Table 3.4: Two point and multipoint LOD score values for several markers on chromosome 2 in family B
Marker hg19 Multipoint LOD 02-point LOD Coordinates Score (0.00 theta)
rs13430105 87024914 ∞ ∞
rs9309641 88355735 2.6422 1.753
rs2693240 90106490 2.6432 1.753
rs4854251 96037247 2.6438 1.753
rs13034349 98329197 2.6452 1.753
rs17022653 100028289 2.6443 1.753
rs4851316 101052766 2.636 1.150
rs7565429 102036455 2.6206 1.150
rs11465670 103034440 2.5886 1.753
rs10177144 104415982 2.4874 1.753
rs11123997 105187436 2.3309 1.150
rs13412180 106128407 -2.0507 -1.09
Genetic Analysis of Rare Eye Disorders in Pakistani Families 73 Achromatopsia Chapter 3
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 Homozygosity score
No of Chromosome
Figure 3.6: The output of homozygositymapper for whole genome SNP analysis of family C. Red bar indicate the regions of homozygosity on chromosome 7 and 8. The homozygosity score is given on X axis while the number of chromosomes, i.e. 1 to 22 are shown on Y axis.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 74 Achromatopsia Chapter 3
Table 3.5: Two point and multipoint LOD score values for several markers on chromosome 8 in family C
Marker hg19 Multipoint 02-point LOD Coordinates LOD Score (0.00 theta)
rs3098891 71794876 ∞ ∞
rs7018254 72017177 1.4887 1.5031
rs6472819 75006830 1.7045 1.5031
rs7838627 80571630 1.7539 1.5031
rs10103661 83936116 1.7546 1.5031
rs443177 86426545 1.7545 1.5031
rs12550183 89941029 1.7545 1.5031
rs1805793 90990091 1.7545 1.5031
rs1443564 92942911 1.753 1.5031
rs1875882 93996721 1.7472 1.5031
rs3133976 94944609 1.7204 1.5031
rs10504941 96160914 ∞ ∞
Genetic Analysis of Rare Eye Disorders in Pakistani Families 75 Achromatopsia Chapter 3
Figure 3.7: Haplotype of family D showing pattern of homozygosity on chromosome 2 between markers D2S2181 and D2S308 which spans from 112.4 to 126.9 cM (26.5 Mb).
Genetic Analysis of Rare Eye Disorders in Pakistani Families 76 Achromatopsia Chapter 3
Figure 3.8: Haplotype representation of family E showing the segregation of a (19.9 Mb) homozygous region on chromosome 2, which was bounded by D2S2333 and D2S1343.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 77 Achromatopsia Chapter 3
a b c
c. 937G>C c. 827A>G c. 1306 C>T
Figure 3.9: Electropherogram of mutations identified in CNGA3 in ACHM families. DNA sequences from controls (top), carriers (middle) and patients (bottom) are shown for each variant indicated by the arrow. The mutations identified in family B (a), family D (b) and family E (c) are given below respective panel. Arrows indicate the site of missense variation in the sequence.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 78 Achromatopsia Chapter 3
Figure 3.10: The human CNGA3 protein sequence was aligned with orthologous protein using Homologene. The amino acid residues at the positions of the missense changes are colored and respective variants are also indicated.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 79 Achromatopsia Chapter 3
Figure 3.11: Predicted 3D structure of CNGA3 (240–460 AA). The upper panel show normal protein, while lower panel represent a structure after p.N276S mutation. The mutation alters α-helix which most probably abolishes CNGA3 localization in the plasma membrane.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 80 Achromatopsia Chapter 3
c.646C>T
Figure 3.12: Electropherogram of mutation identified in CNGB3 in ACHM family C. DNA sequences from controls (top), carriers (middle) and patients (bottom) are shown for each variant indicated by the arrow. The mutation identified is given below the panel. Arrows indicate the site of missense variation in the sequence.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 81 Retinitis Pigmentosa Chapter 4
CHAPTER 4
RETINITIS PIGMENTOSA
Genetic Analysis of Rare Eye Disorders in Pakistani Families 82 Retinitis Pigmentosa Chapter 4
4. RETINITIS PIGMENTOSA
Retinitis pigmentosa (RP) is a retinal disease which is characterized by degeneration of both rod and cone photoreceptors. Majority of the RP patients initially complains about night blindness, but also experience gradual day vision loss due to pigmentary changes in the retina. The prevalence of RP is about 1 in 3000 individuals causing visual loss of about 1.5 million people worldwide (Shintani et al., 2009). The clinical presentations and genetics of RP are heterogeneous and varied from patient to patient. RP exhibits all modes of inheritance which includes autosomal recessive, autosomal dominant or X- linked. In a few cases, rare mitochondrial and di-genic forms are also reported (Ferrari et al., 2011). A previous study indicates that 20-25% of all RP cases are autosomal recessive (arRP), 15-20% are autosomal dominant (adRP), 10-15% are X-linked (XLRP) while 40-55% cases are unknown (Wang et al., 2005). Recently, it has been also shown that about 50-60% cases are autosomal recessive followed by 30- 40% autosomal dominant and 5-15% are X-linked. Almost 30-35% RP cases are still undiagnosed (Anasagasti et al., 2012).
More than 90 genes have been implicated in RP and proteins encoded by these genes perform a diverse range of functions. These include genes responsible for phototransduction (RHO, PDE6A, PDE6B, CNGA1, CNGB1, GUCA1B, RDH12 and SAG), splicing (PRPF3, PRPF31, PRPF8 and PAP), transcription factors (CRX, NRL and NR2E3) and cilia related functions (ARL6, MAK, RP1, RP2, TTC8 and TULP1). Similarly few RP genes have key roles in the retinal metabolism like IMPDH1, RGR, LRAT, RPB3, RLBP1, RPE65 and several genes (ROMI1, FSCN2, PRPH2, SEMA4A, CERKL, CRB1, PROM1, TULIP) are responsible for the formation and maintenance of the retinal structures. A recent study reported the involvement of more than 3100 disease causing mutations in the non syndromic RP patients and the majority of these were identified in the above mentioned genes (Daiger, 2013). The RPGR, RHO and the RDS/peripherin are the most common disease causing RP genes. About 70% of XLRP cases carried mutations in RPGR while in 25% and 10% of adRP cases, mutations were reported in RHO and the RDS/peripherin, respectively (Petrs-Silva and Linden, 2014). In the present study four families (labeled as F, G, H and I) were analyzed to identify the causative genetic variants responsible for RP.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 83 Retinitis Pigmentosa Chapter 4
4.1 Description of Families
Four multigenerational families presenting RP were located and enrolled from different regions of Pakistan. Two families (G, I) were recruited from the rural areas of the Sindh province, while family H was collected from the Punjab province. The fourth family (F) was collected from the Bhimber district in Azad and Jammu Kashmir. These families were collected from regions which are historically known for a high rate of consanguineous marriages. The pedigrees of these families are given in figure 4.1 which show the autosomal recessive mode of inheritance. Each family has two or more affected individuals.
4.2 Clinical Presentations of RP Families
Initial examination of probands of these families during visits to their residence showed night blindness, slow dark adaptation and gradual day vision loss. The affected members of all these families initially presented symptoms of night blindness but subsequently experienced gradual loss of day vision. The probands from each family were examined by an ophthalmologist for a detailed physical and fundus examination. The detailed description of each family is given below;
The affected individuals of family F initially reported difficulties in night vision, which decreased over the time along with the onset of gradual loss of day vision. Fundus examination of the affected male individual IV-2 revealed attenuation of retinal vessels with typical bone-spicule deposits on the periphery (Figure 4.2a). The affected members of family G experienced night blindness before the age of 10 years, but rapid loss of vision resulted in legal blindness before reaching the age of 20 years. Fundus examination of a 24 year old male affected individual (IV-1) showed retinal degeneration with diffuse atrophy of the retinal pigment epithelium, scattered retinal pigment depositions, vascular attenuation, and a palor of the optic nerve head (Figure 4.2b). The affected individuals of family H reported night blindness at their early age. However, they were able to see and perform their routine tasks at day but could not see properly from longer distances. The fundus examination of individual IV-3 of family H showed attenuated vessels, modest disc pallor, and diffuse atrophy of the retina and the retinal pigment epithelium with occasional pigment deposits sparing the macular area (Figure 4.2c). Medical records of family I showed an onset of disease in the first decade of life. Affected male individual (V-1) attended his school, but
Genetic Analysis of Rare Eye Disorders in Pakistani Families 84 Retinitis Pigmentosa Chapter 4 discontinued at the age of 8 years due to the vision problems. However, fundus examination showed bone spicule shaped pigments covering almost the entire funds, but concentrated more in the periphery. Additionally, his retina also showed the presence of attenuated vessels (Figure 4.2d). None of the affected individual of the families presented here has additional symptoms associated with syndromic forms of RP (Table 4.1).
4.3 Homozygosity Mapping and Linkage Analysis of RP Families
DNA samples of all available affected and normal individuals of these families were subjected to whole genome scan using SNP microarray and genotype data was analyzed with homozygositymapper. The detail of each family is given below;
DNA samples of three affected (IV-2, IV-3 and IV-4) and two normal (III-2 and IV-1) members of family F were subjected to whole genome SNP analysis. The data analysis with homozygositymapper showed a single peak of homozygosity on chromosome 12 between markers rs244504 and rs296737 (Figure 4.3). However, further analysis showed that the region shared by all affected individuals of the family where normal individuals were heterozygous, was about 2.98 Mb and was spanned between markers rs244504 to rs2389197 (Table 4.2). The linkage analysis using selected SNPs showed a maximum value of 1.58 and 1.22 for multipoint and two points LOD scores, respectively (Table 4.3).
For family G, DNA samples of individuals III-1, III-2, IV-1, IV-2, IV-5 and IV-6 were subjected to whole genome scan. The data were analyzed with homozygositymapper which showed multiple peaks of homozygosity on chromosomes 4, 6, 7, 8, 9, 10, 13, 14 and 16 (Figure 4.4). The detailed analysis of these homozygosity peaks showed that the largest homozygous region of 47.25 Mb on chromosome 16, located between markers rs12596791 and rs11866632, was shared by all affected members of the family and contains a known RP gene, i.e. CNGB1 (Table 4.2). The linkage analysis of markers of this region yielded multipoint and two-point LOD score of 1.40 and 1.15respectively (Table 4.4).
In family H, six DNA samples including three affected (IV-3, IV-4, IV-5) and one normal sibling (IV-1) and parents (III-1 and III-2) were analyzed for whole genome scan. The analysis of data using homozygositymapper revealed several peaks of homozygosity on chromosome 3, 5, 6, 7, 10 and 12 (Figure 4.5). The careful
Genetic Analysis of Rare Eye Disorders in Pakistani Families 85 Retinitis Pigmentosa Chapter 4 examination of these peaks showed that the homozygous region on chromosome 5 harbor a known RP gene; PDE6A. This 2.43 Mb homozygous region was shared by all affected individuals and was delineated by markers rs3995091 to rs7724036 (Table 4.2). Linkage analysis also showed a maximum two-point LOD score of 1.63 at markers rs13177640 and rs4958728 (Table 4.5).
In the family I, the homozygosity mapping using whole genome SNP analysis revealed a single peak of homozygosity on chromosomes 3 (Figure 4.6). This homozygous region of 6.43 Mb was present between markers rs11923216 and rs17301766 and carries a known RP gene, i.e. RHO (Table 4.2). The multipoint and two point analysis with randomly selected markers of this region yielded a maximum LOD score of 2.37 and 1.98 respectively (Table 4.6).
4.4 DNA Sequencing and Bioinformatics Analysis of Variants
Analysis of the homozygous region identified in family F with GeneDistiller showed the presence of 37 genes between markers rs244504 to rs2389197, but none of them were previously associated with RP or any other eye disorder. Based on the expression and the involvement in different eye anomalies, the dynamin 1 like (DNM1L) was prioritized and subjected to sequencing. However, sequencing analysis did not reveal any pathogenic mutation ruling out the potential implication of this gene.
The homozygous regions identified in family G, H and I contained known RP genes CNGA1, PDE6A and RHO, thus were subjected to Sanger sequencing of all coding exons and splice sites in proband of the respective families. Sequence analysis showed the presence of pathogenic variants c.413-1G>A (IV6-1G>A) in CNGB1, c.1407-2 A>G (IVS10-2A>G) in PDE6A and c.448G>A (p.Glu150Lys) in RHO in families G, H and I, respectively. These pathogenic variants were sequenced in all available family members that showed their segregation in the respective families (Figure4.7)
The variant c.413-1G>A (IV6-1G>A) identified in family G was previously reported as a SNP (rs189234741) and has not been associated with any disease. The in-silico analysis using MutPred Splice (v1.3.2) (Mort et al., 2014), Human splice finder (v2.4.1) (Desmet et al., 2009) and SKIPPY (Woolfe et al., 2010) predicted the elimination of exon 6 splice acceptor site.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 86 Retinitis Pigmentosa Chapter 4
Similarly the variant c.1407-2 A>G (IVS10-2A>G) identified in family H was also a splice variant. This variant was already known and has been reported from another Pakistani family (Riazuddin et al., 2006). The in silico analysis of this variant using MutPred Splice (v1.3.2), Human splice finder (v2.4.1) and SKIPPY also predicted the impact of this variation on the normal splicing pattern by disrupting splice acceptor site of exon 11. This is expected to skip the exon 11 and deletion of 22 amino acids, i.e. (p.K470_L491del) from coded polypeptide.
However, the variant c.448G>A identified in the family I was a known homozygous missense mutation which results in the replacement of glutamic acid with lysine at codon 150 of the coded polypeptide (p.Glu150Lys). The in silico analysis using mutation taster, Polyphen2 and SIFT predicted this variant as probably damaging, deleterious, and disease-causing.
These variations were also sequenced in the available members of each family to confirm the segregation with RP phenotype. Additionally, the mutation c.413-1G>A identified in CNGB1 is not found in the human genome mutation database (HGMD) (http://www.hgmd.cf.ac.uk/ac/index.php) nor in the exome variant server (EVS) (http://evs.gs.washington.edu/EVS/). However, the variants identified in PDE6A (c.1407-2 A>G) and RHO (c.448G>A) have been already reported in HGMD but are not present in EVS.
4.5 In vivo Splicing Analysis of CNGB1 mutation
In order to confirm the pathogenicity of c.413-1G>A variation identified in family G, an in vivo analysis was carried out using minigene assay. For this purpose, cDNA was synthesized from total RNA extracted from the Hela cells transfected with mutant and wild type minigene constructs. The amplified product did not reveal any visible difference between wild type and mutant PCR products on 2% agarose gel (Figure 4.8a). However, the sequencing of amplified products obtained from the transfected Hela cells with mutant allele transcript clearly showed the deletion of the first nucleotide of 7th exon which was intact in the wild type allele transcript. The analysis showed that G>A (g.57996515) transition resulted in the creation of a new splice site with the loss of 1st nucleotide and shifted the splice site in exon 7 (Figure 4.8b). This deletion of 1st nucleotide of 7th exon ultimately leads to a frameshift mutation and a premature stop codon (C139Afs*132X).
Genetic Analysis of Rare Eye Disorders in Pakistani Families 87 Retinitis Pigmentosa Chapter 4
4.5 Discussion
In current study four families, i.e. F, G, H and I were analyzed using whole genome SNP scan. In family F, SNP analysis showed a region of homozygosity on chromosome 12 which did not contain any known RP gene. However, remaining families G, H and I were mapped to chromosomal regions containing known RP genes, i.e. CNGB1, PDE6A and RHO respectively. The sequencing of CNGB1 in family G showed a novel homozygous splice variant c.413-1G>A (IV6-1G>A) resulting in the creation of a new splice site leading to frameshift mutation and a premature stop codon (C139Afs*132X). However, the sequencing analysis of PDE6A and RHO showed co-segregation of known mutations, i.e. c.1407-2 A>G (IVS10- 2A>G) and c.448G>A (p.Glu150Lys) in family H and I respectively.
RP is genetically heterogeneous and about 56 and 29 genes for non syndromic and syndromic RP respectively have been reported to date. But more than 50% cases are still undiagnosed (Shintani et al., 2009; Daiger, 2013). RP is leading retinal dystrophy of Pakistan accounting for 62% of all retinal dystrophies and follows all three modes of inheritance. However, the frequency of arRP is higher than adRP and XLRP in Pakistan which is 59%, 2% and 1% respectively (Khan et al., 2014).
The homozygous region identified in the family F may potentially represent a genomic region with a new RP gene. The exploration of 2.5 Mb genomic region revealed the presence of 16 genes, but none of these apparently seem like a potential gene for RP phenotype in our family, except DNM1L. The DNM1L encoded protein belongs to dynamin superfamily of GTPases, which is responsible of mitochondrial and peroxisomal division. The DNM1L mutations are previously associated with different diseases like Alzheimer's disease, encephalopathy and diabetic retinopathy (Zhong and Kowluru, 2011). As these diseases present a broad spectrum phenotype also including retinal dystrophy, which led to the sequencing of DNM1L gene in the affected individuals of family F, but failed to identify any pathogenic variant. Further studies are required to identify disease causing gene in this family, which may include sequencing of additional genes or use of next generation sequencing.
In family G, the sequence analysis of CNGB1 showed a splice variation c.413-1G>A (IV6-1G>A) which co-segregated in the family. The CNGB1 encodes a rod specific channel protein that plays an important role in the phototransduction pathway.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 88 Retinitis Pigmentosa Chapter 4
Mutations in CNGB1 have been implicated in RP which accounts for 4% of worldwide RP cases (Hartong et al., 2006).Interestingly the nucleotide change observed in family G, was present in dbSNP (rs189234741) which was detected only in one of the many thousand individuals in the framework of the 1,000 Genomes project, genotyping phase 1, indicating a possible technical artifact as this phase data has 4X coverage. Further, this variation also affects the splice acceptor site of exon 6 but has not been associated with any disease yet. All in silico variant analysis tools predicted the impact of this variation on the normal splicing pattern of CNGB1 transcript and minigene assay also showed the altered splicing pattern in Hela cells. This was expected because the nucleotides at the donor and acceptor site of exons are highly conserved and variations in these nucleotide results in incorrect splicing (Burset et al., 2000; Thanaraj and Clark, 2001).
The in vivo analysis using a mini gene assay confirmed that IVS6-1G>A affected the canonical splicing site of exon 7 by knocking down its natural 5’ splice site and eliciting the use of a cryptic splice site after one base pair downstream of intron 6’s acceptor sequence. This creation of the new splice site led to the loss of the first nucleotide of exon 7 resulting in -1 frameshift and a premature stop codon 413 bases downstream of it (p.C139AfsX138/NP_001288.3). As the acquired stop codon occurs before the last exon, mutant mRNA likely undergoes nonsense mediated decay (NMD) and therefore produces no or very little protein (Hentze and Kulozik, 1999).
Earlier Kondo et al. (2004) reported a novel splice mutation (c.3444+1G>A) at the donor site of exon 32 in CNGB1. This mutation was identified during the genetic analysis of a 67 year old Japanese arRP case who noticed night blindness during his schooling while RP was diagnosed when he was at the age of 30 years. The fundoscopy showed typical bony spicule pigmentation along with non-remarkable macular changes in the left eye and degeneration of the macula of right eye. Although the affected individuals of current family also noticed night blindness before the age of 10 years (school going age) but the clinical course was more severe as they became legally blind before 20 years of age. Similarly, fundus examination of a patient of our family also showed severs retinal degeneration with diffuse atrophy of the retinal pigment epithelium.
Huttl et al. (2005) reported that CNGB1 knockout mice have impaired channel targeting resulting in retinal degeneration. It was also reported that the distal C-
Genetic Analysis of Rare Eye Disorders in Pakistani Families 89 Retinitis Pigmentosa Chapter 4 terminus of CNGB1 contains ankyrinG binding motif which is crucial for proper targeting of the protein in rod outer segments (Kizhatil et al., 2009). The functional analysis of c.3444+1G>A splice site mutation showed skipping of exon 32 resulting in replacement of the last 170 amino acids by 68 unrelated amino acids. This caused removal the C terminus of the encoded protein and absence ankyrin G binding motif, leading to RP (Becirovic et al., 2010). Since, the current p.C139AfsX138 mutation results in early termination, the NMD may lead to the absence of channel protein in the affected members of this family or even if encoded protein escapes NMD, the ankyrin G binding domain will not be present in mutant protein. The absence of this motif will ultimately affect the targeting of the mutant protein to rod outer segments in the affected individuals resulting in RP. Further the severity of the disease in patients from current family may also indicate the total absence of CNGB1 resulting in early retinal degeneration leading to blindness.
Mutation screening of PDE6A in family H also showed a splice site variant IVS10- 2A>G which also segregates in the family and was previously described in an arRP family of Pakistani origin (Riazuddin et al., 2006). The clinical presentation of the patients of this family is almost similar as recorded in the other Pakistani patients with PDE6A mutations (Riazuddin et al., 2006). This similarity in the phonotype may help in early clinical diagnosis and patient counseling. It was reported that the combination of phenotyping and genotyping data may provide opportunity for better patient counseling as well as for future planning of gene-based therapy in arRP (Stephen et al., 2008). PDE6A encodes the cyclic-GMP (cGMP)-specific phosphodiesterase 6A alpha subunit which is part of phosphodiesterase 6 holoenzyme. This is mainly expressed in outer segment of rod photoreceptors and plays a crucial role in phototransduction cascade as well as during transmission and amplification of the visual signal (Mohamed et al., 1998). PDE6A have been implicated in autosomal recessive RP and it was reported that about 5% of worldwide arRP cases carry PDE6A mutations. Similar finding was also recorded in Pakistani population showing PDE6A as a most commonly mutated gene (Khan et al., 2014).
In family H, a single nucleotide transition was identified, i.e. c.448G>A that replaces glutamate with lysine (p.Glu150Lys) residue. This mutation was initially reported from an Indian RP family (Kumaramanickavel et al., 1994) and later in two Pakistani families. Although these three families belong to different geographical regions and
Genetic Analysis of Rare Eye Disorders in Pakistani Families 90 Retinitis Pigmentosa Chapter 4 different ethnicities, but analysis performed by Azam et al. (2009) showed the presence of a common disease associated haplotype with these families. Occurrence of p.Glu150Lys in family H, originates from a different region of Pakistan, i.e. Sindh, further supports the finding by Azam et al. (2009), and indicates the potential utility of this mutation in the future diagnosis of new RP patients from the subcontinent. Although, RHO is one of common RP genes and is mainly known to be involved in adRP but occasionally mutations have also been identified in arRP patients (Ferarri et al., 2011). Currently available literature indicates that RHO mutations are common in Caucasians adRP cases (16.28-28.67%) but these are less frequent in Asian populations like 5.88% in Japan, 4.0% in China and 2.9% in Pakistan (Shiqiang et al., 2010; Khan et al., 2014).
Rhodopsin consists of seven transmembrane helices (H1-H7) which are linked by extracellular and cytoplasmic loops E1-E3 and C-C3 respectively (Palczewski et al., 2000). The Glutamate 150 is present in a C2 loop near the C terminal region and is embedded in the corner of a phospholipid bilayer. The C2 loop plays a role in protein folding and interaction with transducin which ultimately results in the initiation of phototransduction pathway. The p.Glu150Lys was the first RHO missense homozygous mutation associated with autosomal recessive RP. The functional characterization of p.Glu150Lys showed that mutant opsin was partially co-localized to cis/medial Golgi compartment, resulting in deficient export of protein into the plasma membrane resulting in retinal degeneration (Zhu et al., 2006). Pulagam and Palczewski (2010) analyzed the molecular basis of RHO retention in the Golgi apparatus and found that p.Glu150Lys mutation changed local electrostatic interactions of the protein that are essential for appropriate RHO export. Recently Zhang et al. (2013) reported that p.Glu150Lys caused disruption in the oligomerization resulting in the abnormal assembly of the ROS and ultimately photoreceptor disorganization.
In this study, a novel homozygous region has been identified which plausibly indicate the involvement of a new RP gene in family F. Further study is being carried out to identify the pathogenic variant/gene in this family, which may help to resolve the undiagnosed RP. In the remaining three families, implication of known RP genes and identification of a novel and two known pathogenic variants further strengthens the importance of homozygosity mapping for molecular diagnosis of retinal dystrophies in recessive RP cases.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 91 Retinitis Pigmentosa Chapter 4
Figure 4.1: Pedigrees of four RP families. Filled circles/square represents affected individuals, while hollow circles/squares show normal individuals. Consanguineous marriages are indicated with double line. Arrow identify proband in each family.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 92 Retinitis Pigmentosa Chapter 4
a b
c d
Figure 4.2: Fundus appearance of (a) individual IV-2 from family F showing attenuation of retinal vessels with typical bone-spicule deposits on the periphery (b) affected individual IV-1 (24 years old) of family G revealed retinal degeneration with diffuse atrophy of the retinal pigment epithelium, scattered retinal pigment depositions, vascular attenuation, and a palor of the optic nerve head presenting distorted fundi with narrowing blood vessels (c) individual IV-3 of family H (18 years old) showed attenuated vessels, modest disc pallor, and diffuse atrophy of the retina and the retinal pigment epithelium with occasional pigment deposits sparing the macular area (d) affected individual V-1 of family I presented bone spicule shaped pigments covering almost entire fundus with attenuated vessels.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 93 Retinitis Pigmentosa Chapter 4
Table 4.1: Summary of clinical presentation of probands of four RP families
Clinical Family F Family G Family H Family I Presentations
Probands IV-2 IV-1 IV-3 V-1
Photophobia - - - -
Nystagmus - - - -
NB + + + +
VA LP LP- 20/40 LP-
Age of Onset 2nd decade 1st decade 1st decade 1st Decade
Legal Blind + + - +
ARV, BS, ARV, DA, ARV, DA ARV, BS deposits on retinal modest DP Fundoscopy periphery pigment depositions, palor optic nerve head -/+ indicates absence and presence of the symptoms. NB: night blindness, VA: visual acuity, LP: light perception, LP-: no light perception ARV: attenuated retinal vessels, BS: bone spicule, DA: diffuse atrophy, DP: disc palor,
Genetic Analysis of Rare Eye Disorders in Pakistani Families 94 Retinitis Pigmentosa Chapter 4
19.3 Mb rs244504 rs296737
Figure 4.3: The output image of SNP data obtained from homozygositymapper depict a single red bar which shows the identified homozygosity-by-descent (HBD) region on chromosome 12 in family F. HBD was present between rs244504 to rs296737 and encompass a 19.3 Mb genomic region.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 95 Retinitis Pigmentosa Chapter 4
Table 4.2: Description of homozygosity regions identified in four RP families
Family Homozygous Region Known RD ID Gene Flanking SNPs/ genomic Chr Size (Mb) (if any) coordinates
F 12 rs244504-rs2389197 2.98 -
8 rs11984569-rs12542396 29.40 -
G 9 rs12344716-rs12236186 3.31 -
16 rs12596791-rs11866632 47.25 CNGB1
H 5 rs3995091-rs7724036 2.43 PDE6A
I 3 rs11923216-rs17301766 6.43 RHO
Genetic Analysis of Rare Eye Disorders in Pakistani Families 96 Retinitis Pigmentosa Chapter 4
Table 4.3: Two-point and multipoint LOD scores for several markers on chromosome 12 in family F
Marker hg19 coordinates Multipoint LOD 2- point LOD (0.00 theta)
rs244504 31,054,860 1.5792 -1.5572
rs35082 31,140,115 1.5807 1.2299
rs7136351 31,926,973 1.5807 1.2299
rs11051643 32,025,668 1.5807 1.2299
rs1259883 32,094,101 1.5807 1.2299
rs10771958 32,638,162 1.5811 1.2299
rs7308045 32,972,395 1.5813 1.2299
rs11830829 33,099,129 1.5814 1.2299
rs1392337 33,148,078 1.5815 1.2299
rs7973722 33,534,808 1.5823 1.2299
rs2389197 33,559,524 1.5818 -1.5572
Genetic Analysis of Rare Eye Disorders in Pakistani Families 97 Retinitis Pigmentosa Chapter 4
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 Homozygosity score
No of Chromosome
Figure 4.4: Image of SNP data analyzed by homozygositymapper depicts multiple homozygosity peaks (red bars) on different chromosomes in family G. The homozygosity score is given on X axis while the number of chromosomes, i.e. 1 to 22 are shown on Y axis.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 98 Retinitis Pigmentosa Chapter 4
Table 4.4: Two-point and multipoint LOD scores for several markers on chromosome 16 in family G
Marker hg19 coordinates Multipoint LOD 2- point LOD (0.00 theta)
rs12596791 26,115,562 1.3683 -1.6937
rs12102839 26,283,092 1.3725 1.1509
rs12325539 30,033,633 1.3775 1.1509
rs12445911 47,018,079 1.395 1.1509
rs11076496 49,733,063 1.3993 1.1509
rs11076320 52,097,552 1.4007 1.1509
rs10221121 56,840,328 1.4016 1.1509
rs12599038 61,069,341 1.401 1.1509
rs12162035 63,297,445 1.3943 1.1509
rs1094928 65,954,472 1.3548 1.1509
rs11866632 73,373,632 0.6508 -1.9018
Genetic Analysis of Rare Eye Disorders in Pakistani Families 99 Retinitis Pigmentosa Chapter 4
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 Homozygosity score
No of Chromosome
Figure 4.5: Image of SNP data analyzed by homozygositymapper show multiple homozygosity peaks (red bars) on different chromosomes in family H. The homozygosity score is given on X axis while the number of chromosomes, i.e. 1 to 22 are shown on Y axis.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 100 Retinitis Pigmentosa Chapter 4
Table 4.5: Two-point and multipoint LOD scores for several markers on chromosome 5 in family H
Marker hg19 coordinates Multipoint LOD 2- point LOD(0.00 theta)
rs3995091 147,849,759 ∞ ∞
rs7702840 147,865,882 1.4278 1.0256
rs13177640 148,074,640 1.4323 1.628
rs2112598 148,468,467 1.4335 1.0256
rs10062536 148,825,669 1.434 1.0256
rs4629585 149,001,551 1.4342 1.0256
rs2241695 149,602,824 1.4343 1.0256
rs4958728 150,010,099 1.4336 1.628
rs2112637 150,182,434 1.4312 1.0256
rs7724036 150,284,808 ∞ ∞
Genetic Analysis of Rare Eye Disorders in Pakistani Families 101 Retinitis Pigmentosa Chapter 4
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 Homozygosity score
No of Chromosome
Figure 4.6: The output image of SNP data obtained from homozygositymapper show a single significant red bar indicating identified homozygosity-by- descent (HBD) region on chromosome 3 in family I. The homozygosity score is given on X axis while the number of chromosomes, i.e. 1 to 22 are shown on Y axis.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 102 Retinitis Pigmentosa Chapter 4
Table 4.6: Two-point and multipoint LOD scores for several markers on chromosome 3 in family I
Marker hg19 coordinates Multipoint LOD 2- point LOD(0.00 theta)
rs11923216 126,923,982 1.9137 -0.9824
rs7610764 127,036,142 2.1748 1.9879
rs4857857 128,313,880 2.3723 1.9879
rs884697 129,674,580 2.3783 1.9879
rs9814702 130,539,871 2.3783 1.9879
rs2251178 131,271,439 2.3778 1.9879
rs17241868 132,066,160 2.3769 1.9879
rs6767920 132,899,962 2.375 1.9879
rs517255 133,118,054 2.3734 1.9879
rs17301766 133,356,790 2.3672 -0.8783
Genetic Analysis of Rare Eye Disorders in Pakistani Families 103 Retinitis Pigmentosa Chapter 4
a b c
c.413-1G>A c.1407-2 A>G c.448G>A
Figure 4.7: Electropherograms of mutations identified in RP families.DNA sequences from controls (top), carriers (middle) and patients (bottom) are shown for each variant indicated by the arrow. Mutations identified in CNGB1 (a), PDE6A (b) and RHO (c) in family G, H and I are given below the respective panel.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 104 Retinitis Pigmentosa Chapter 4
100bp Mt a Wt
200 198
b c
Figure4.8: (a)The 2% agarose gel showing the 100 bp ladder (Line A) and the RT- PCR product obtained from the mRNA extracted from Hela cells transfected with wild type (Wt) and mutant (Mt) alleles. The schematic presentation of the effect of the splice acceptor site mutation c.413-1G>A on CNGB1 messenger RNA and cDNA sequence from a construct obtained from control DNA (b) and cDNA from a construct bearing the IVS6-1G>A mutation (c) showing new splice site.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 105 Cone and Cone Rod Dystrophies Chapter 5
CHAPTER 5
CONE ROD DYSTROPHIES
Genetic Analysis of Rare Eye Disorders in Pakistani Families 106 Cone and Cone Rod Dystrophies Chapter 5
5. CONE ROD DYSTROPHIES
Inherited cone disorders (CDs) are a heterogeneous group of disorders that have a worldwide prevalence of 1 in 30,000-40,000 (Michaelides et al., 2004; Hamel, 2007). The CDs include cone dystrophy (COD) that usually starts in the childhood or in early adolescence and results in progressive loss of visual acuity and color vision. In the majority of the cases, COD affects cone photoreceptors, but a significant number of patients also exhibit additional rod dysfunction, which led to the diagnosis of cone rod dystrophy (CRD).
The presentation of both COD and CRD overlapped and difficult to differentiate clinically, however, these may be distinguished on the basis of presence or absence of few symptoms and detailed ERG examinations. In COD patients, the cone ERG response is usually diminished with normal rod response and their fundi show macular atrophy along with pigment deposition (Hamel, 2007). On the other hand, CRD patients have progressive loss of cone cells involving degeneration of rod cells at later stages of life. Although in start, patients have only day vision complaints, but later they develop night blindness. Generally in CRD cases, the ERG response is reduced for both cone and rod photoreceptors (Berger et al., 2010). Similarly the macular appearance of both COD and CRD shows close resemblance, but the CRD patients may also have peripheral pigmentation and retinal vascular attenuation (Roosing et al., 2014). The course of CRD is more severe due to its early onset and rapid disease progression resulting in legal blindness at the age of 40 (Thiadens et al., 2012).
COD and CRD follow all three modes of inheritance (autosomal recessive, autosomal dominant and X- linked) but X linked and autosomal dominant cases are more common than autosomal recessive. Khan et al. (2014) reviewed the data on reported retinal dystrophies families and found that 10% of them were autosomal recessive CRD. The genetic cause of about 90% CDs cases is still unknown (Roosing et al., 2013). Recently the implication of 08 genes in COD and 17 genes in CRD has been reported which represent the 25% and 21% of COD and CRD cases, respectively. ABCA4 and KCNV2 are the most commonly mutated genes for autosomal recessive CRD and COD, respectively. The mutations in ABCA4 are estimated to be responsible for 24%–65% Caucasian CRD cases (Thiadens et al., 2012). Similarly GUCY2D and RPGR have been frequently associated with both autosomal dominant and X linked
Genetic Analysis of Rare Eye Disorders in Pakistani Families 107 Cone and Cone Rod Dystrophies Chapter 5
COD and CRD respectively (Roosing et al., 2014). In this study, two families labeled as family J and K have been analyzed to identify the disease causing variants in CRD genes.
5.1 Description of Families
Two multigenerational CRD families were enrolled from the district Sargodha of the Punjab province. Both families lived in rural villages and belong to community/ethnic groups with high preference towards consanguineous marriages. Each family has two affected individuals and mode of inheritance of the disease was autosomal recessive (Figure 5.1).
5.2 Clinical Presentation of Families
The family history and clinical examination showed that affected members of both families have nystagmus, photophobia and color blindness with the onset of symptoms reported during the second decade of life. The detailed description of each family is given below;
In family J, the affected members were color blind and presented with reduced visual acuity, bilateral nystagmus and photophobia. They were able to do their routine daily tasks in shades but experience excessive flickering in sunlight. Similarly they could move around easily at night. The fundus examination of proband IV-1 (aged 47 years) showed maculopathy with slight pigmentation (Figure 5.2a). However the affected individuals of family K reported partial color blindness. The color vision testing of proband IV-2 showed severe defects in red-green color but blue-yellow vision was relatively normal. However, they all have nystagmus and photophobia. The fundus examination of proband IV-4 showed the beginning of macular degradation as well as retinal degradation. The vascular attenuation is there, but not so prominent (Figure 5.2b). None of the affected individuals from these families experience night blindness (Table 5.1), which helped to conclude the diagnosis of CRD in these families.
5.3 Homozygosity Mapping and Linkage Analysis of CRD Families
The DNA of available affected and normal individuals of both families was genotyped using whole genome SNP microarrays and data was analyzed with homozygositymapper. The detail of each family is as follows;
Genetic Analysis of Rare Eye Disorders in Pakistani Families 108 Cone and Cone Rod Dystrophies Chapter 5
The analysis of SNP data of two affected (IV-1, IV-2) and three normal (III-2, IV-3, IV-4) members of family J with homozygositymapper showed multiple peaks of homozygosity on chromosome 4, 8, 10, 14 and 20 (Figure 5.3). The detailed analysis of these peaks revealed a homozygous region of 4.96 Mb on chromosome 14 between markers rs7148898 and rs12892350 which was shared by both affected members of the family. This homozygous region contains a known RD gene, i.e. RPGRIP1 (Table 5.2).
Similarly, DNA samples of two affected (IV-3, IV-4) and two normal (III-1, IV-2) individuals of family K were subjected to whole genome SNP analysis. The SNP data analysis with homozygositymapper revealed two homozygous peaks on chromosome 2 and 9 (Figure 5.4). The careful analysis of these genomic regions showed that the largest homozygous region of 11.85 Mb on chromosome 9 spans between rs7860758 and rs10756524 and was shared by all affected members of family K. This autozygous region contains KCNV2 which have already been implicated in the CRD (Table 5.2).
5.4 DNA Sequencing and Bioinformatic Analysis of Variant
As homozygous regions identified in both families (J and K) contain RPGRIP1 and KCNV2 genes, so we postulated that mutations in these genes may harbor the disease causing mutation. For this purpose, probands from both families were subjected to Sanger sequencing of all exons and their intronic junctions, which showed the presence of a pathogenic variant c.2656C>T in RPGRIP1 in family J (Figure 5.5). This variant is present in exon 16 of RPGRIP1 and replaces a conserved leucine with phenylalanine (p.L886F) in the encoded protein. The conservation analysis using Homologene (http://www.ncbi.nlm.nih.gov/homologene/) showed that the p.L886 is highly conserved during the course of evolution (Figure 5.6) and plausibly plays an important role in RPGRIP1 function. This nucleotide change has not been previously reported and was not found in the human genome mutation database (http://www.hgmd.cf.ac.uk/ac/index.php) as well as in the exome variant server (http://evs.gs.washington.edu/EVS/). The in silico analysis using mutation taster, Polyphene2 and SFIT predicted this variant as probably damaging, deleterious, and disease-causing.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 109 Cone and Cone Rod Dystrophies Chapter 5
The sequencing of exons and their intronic junction of KCNV2 did not reveal any pathogenic variation, however a homozygous variant, i.e. c.795C>G was identified. The detailed analysis showed that this variant corresponds to a known SNP, rs12237048, which has very high allelic frequency, i.e. 0.49 and thus does not represent a pathogenic allele.
5.5 Discussion
In this study, two Pakistani families (J and K) recruited from rural areas of Pakistan have been described. The clinical presentation of families was consistent to CRD with onset of symptoms in the second decade of life. Keeping in view the autosomal recessive inheritance of disease in both families, SNP based homozygosity mapping was carried out which revealed multiple homozygous regions on different chromosomes. Sequencing of RPGRIP1 in family J identified a novel missense homozygous variant p.L886F while in family K, no pathogenic variant was found in the coding region of KCNV2.
RPGRIP1 consists of N terminal coiled- coil domain, a C terminal region with RPGR interacting domain (RID) and a central protein kinase C conserved region 2 (C2) motif. The expression of RPGRIP1 is limited to the retina and testis only showing its importance in the cilia (Arts et al., 2007). It was initially identified as interacting protein of RPGR (Boylan and Wright, 2000), but later studies showed RPGRIP1 interactions with NPPH4 (Roepman et al., 2005), which is associated with Senior- Loken Syndrome (SLS). Subsequent studies indicated that RPGRIP1 act as a protein scaffold for the assembly of retinal ciliopathy associated proteins like RPGR, NPHP4, SSCCAG8, IQCB1 and CEP290 (Rachel et al., 2012). It was reported that RPGRIP1 playsa key role for normal rod photoreceptor outer segment elaboration and morphogenesis (Won et al., 2009).
The mutations identified in RPGRIP1 have been associated with different retinal diseases like Leber congenital amaurosis (LCA), cone-rod dystrophy, and juvenile retinitis pigmentosa (Kuznetsova et al., 2011). Initially, it was reported that mutations in RPGRIP1 are only associated with LCA, however, later Hameed et al. (2003) identified two homozygous mutations in four Pakistani families suffering from cone rod dystrophies. The clinical examination of the affected members of these families showed the presence of color blindness, severe photophobia from an early age. They
Genetic Analysis of Rare Eye Disorders in Pakistani Families 110 Cone and Cone Rod Dystrophies Chapter 5 also reported deterioration in central vision resulting in rapid loss of vision (reduced visual acuity) at the ages of 14 and 16 years. The fundus examination of these patients revealed macular degeneration along with variable degree of fundus granularity. Similarly the characteristic bull’s eye maculopathy was also observed in one patient (aged 14 years). The affected members of current family also reported color blindness, photophobia and presented with reduced visual acuity and the fundus examination of proband (aged 47 years) showed maculopathy with slight pigmentation. However, the affected individuals of current family have slow loss of vision which is inconsistent to the patients of earlier families reported by Hameed et al. (2003).
The exact pathogenicity of RPGRIP1 mutations is unclear but probably these result either in differential expression or function of distinct RPGRIP1 isoforms, loss-of- function or gain-of-function (Patil et al., 2012). The missense mutations in RPGRIP1 have been shown to disrupt the interaction between RPGRIP1 and NPHP4 resulting in retinal dystrophies and the majority of them are clustered in the C2 domain (Fernandez-Martınez et al., 2011). Roepman et al. (2005) did a functional analysis of p.D876G p.G746E and p.V857fs and p.R890X mutations located in C2 domain. They reported that these alterations have severe impact on the interaction of RPGRIP1 and NPHP4 indicating the pathologic feature of these mutations. The homozygous missense mutation p.L886F identified in family J is also located in the C2 domain of RPGRIP1. It is presumed that probably p.L886F also has disrupted the interaction of RPGRIP1 and NPHP4 in the affected individuals of this family leading to cone dysfunction.
KCNV2 encodes a voltage-gated potassium channel subunit which is present in both rod and cone cells. The Kv8.2 is a silent subunit of KCNV2 which assembles with other K+ channel subunits like KCNB1, KCNC1, and KCNF1 making the functional complex which affects excitability potential of the cells by altering the potassium current in the cell (Czirják et al., 2007). KCNV2 has been implicated in the autosomal recessive CD and more than 35 mutations have been reported so far (Wissinger et al., 2011). However, sequencing of all coding exons and their intronic junctions of KCNV2 in family K did not reveal any pathogenic variation. The absence of any pathogenic variant in coding regions of KCNV2 may be due to the involvement of non coding regions or the presence of other potential genetic candidate in these
Genetic Analysis of Rare Eye Disorders in Pakistani Families 111 Cone and Cone Rod Dystrophies Chapter 5 homozygous regions. It was reported that mutations in non coding regions are responsible for a significant proportion of patients’ disease which are invisible to identify with standard screening methods (Nishiguchi et al., 2013).
The detailed analysis of the second homozygous region at chromosome 2 revealed the presence of visinin-like 1 (VSNL1) gene, which is highly expressed in retina and are considered as retina specific protein and belongs to calcium binding protein family. The VSNL1 peptide is believed to be part of the phototransduction cascade in cone photoreceptors (Gu et al., 1999). Ivanov et al. (2006) did microarray analysis of genes expressed in retinal ganglion cells and showed VSNL1 as predominantly expressed along with others genes. Therefore, the VSNL1 may be a potential candidate gene in this family, but additional studies are required to validate these assumptions.
In this study, identification of a novel homozygous missense mutation in RPGRIP1 in C2 domain is consistent with previous report and highlights the critical role of C2 domain in the normal functioning of this protein. This novel mutation further supports the finding of Khan et al. (2014) that RPGRIP1 is most commonly mutated gene in Pakistani population. The absence of any pathogenic variant in the coding region of KCNV2 is consistent to previous data where more than 90% cases of CDs are still unresolved. Further studies are required to identify the genetic defects in potential candidate genes present in either of two homozygous regions.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 112 Cone and Cone Rod Dystrophies Chapter 5
J K
Figure 5.1: Pedigrees of two CRD families. Filled circles/squares represent affected individuals and hollow circles/squares show normal individuals. Consanguineous marriages are indicated with double line, while deceased individuals are indicated by diagonal lines. Arrow indicates probands in the respective families.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 113 Cone and Cone Rod Dystrophies Chapter 5
a b
Figure 5.2: Fundus photographs of CRD probands a: presenting the fundus appearance of proband IV-2 (aged 47 years) of family J showing macular degeneration along with a widespread retinal degeneration. The vascular attenuation and waxy parlor of the optic nerve head is also visible, b: the fundus of proband IV-4 (age 23 years) showing beginning of macular degradation and retinal degradation with minor vascular attenuation.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 114 Cone and Cone Rod Dystrophies Chapter 5
Table 5.1: Clinical Description of CD families
Clinical Family J Family K Presentations
Probands IV-2 IV-4
Photophobia + +++
Nystagmus ++ +++
Color Vision - -
Visual Acuity 20/80 20/40
Night Blindness - -
Fundus Macular and widespread Beginning of macular retinal degeneration, and retinal degradation, vascular attenuation and minor vascular waxy parlor of the optic attenuation. nerve head
+/- indicating presence/absence of the symptom,
+ indicates mild, ++ moderate, +++ severe.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 115 Cone and Cone Rod Dystrophies Chapter 5
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 Homozygosity score
No of Chromosome
Figure 5.3- The output image of SNP data obtained from homozygositymapper. The identified homozygosity-by-descent (HBD) regions are pointed as red bars on different chromosomes in family J. The homozygosity score is given on X axis while the number of chromosomes, i.e. 1 to 22 are shown on Y axis.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 116 Cone and Cone Rod Dystrophies Chapter 5
Table 5.2: Description of homozygous regions identified in two CRD families
Family ID Homozygous Region Known Gene (if any) Chr Flanking SNPs Region (Mb)
4 rs6534397-rs11947641 2.41 -
8 rs4873772-rs11947641 2.40 - J 10 rs7093966-rs11592507 3.14 -
14 rs7148898-rs12892350 4.96 RPGRIP1
2 rs13384785-rs6708727 11.64 - K 9 rs7860758rs10756524 11.85 KCNV2
Genetic Analysis of Rare Eye Disorders in Pakistani Families 117 Cone and Cone Rod Dystrophies Chapter 5
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 Homozygosity score
No of Chromosome
Figure 5.4: The output image of SNP data obtained from homozygositymapper for family K. The identified homozygosity-by-descent (HBD) regions on chromosome 2 and 9 are shown as red bars. The homozygosity score is given on X axis while the number of chromosomes, i.e. 1 to 22 are shown on Y axis.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 118 Cone and Cone Rod Dystrophies Chapter 5
c.2656C>T (p.L886F)
Figure 5.5: Sequence analysis of RPGRIP1represents a homozygous variant c.2656C>T (p.L886F) in family J. The site of variation is indicated with arrow. The sequence chromatograms of normal sibling, obligate carrier and affected individuals are given at top, middle and bottom respectively.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 119 Cone and Cone Rod Dystrophies Chapter 5
p.L886F
Figure 5.6: The human RPGRIP1 protein sequence was aligned with several orthologous proteins. The amino acid at the position of change is indicated by a red box and variant is given below.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 120 Syndromic Retinal Dystrophies Chapter 6
CHAPTER 6
SYNDROMIC RETINAL DYSTROHIES
Genetic Analysis of Rare Eye Disorders in Pakistani Families 121 Syndromic Retinal Dystrophies Chapter 6
6. SYNDROMIC RETINAL DYSTROPHIES
Retinal dystrophies are frequently found as a part of the multi-system phenotype. In these syndromic conditions, ocular manifestations are frequently found with additional anomalies like hearing loss, mental retardation and obesity etc (Prokudin et al., 2014). Few of them are more common like Bardet-Biedl syndrome (BBS), Joubert syndrome (JBT) and Usher syndrome (USH) as compared to others, such as Senior Loken syndrome, Jalili syndrome and Cohen syndrome (CS) etc. which are relatively rare.
In BBS and USH, affected individuals usually present retinitis pigmentosa (RP) with additional non-ocular symptoms. BBS is characterized by RP along with polydactyly, obesity, mental retardation, renal anomalies, hypogenitalism and other associated symptoms (Agha et al., 2013). However, USH patients present congenital hearing loss and vestibular ataxia along with RP (Bonnet and El-Amraoui, 2012). The BBS is genetically heterogeneous and mutations in 18 genes have been identified which accounts for about 70- 80% of cases (M'hamdi et al., 2014). Similarly, genetics of USH is also complex and to date 16 loci have been reported. Among them, 12 genes have been identified including a modifier gene (Mathur and Yang, 2014).
The CS is characterized by postnatal microcephaly, mental retardation, facial dysmorphism, and retinal dystrophy along with short stature and obesity. The clinical presentation varied among patients belonging to different ethnic backgrounds (Douzgou and Petersen et al., 2011), but the majority of CS patients reported to date display consensus features described by Kivitie-Kallio and Norio (2001). This multisystem disorder is caused by homozygous or compound heterozygous mutations in VPS13B gene. Majority of VPS13B mutations are deletions along with point and duplication mutations and in about 70% of CS cases disease causing mutations were identified on both alleles. However, in remaining 30% cases, mutations were seen on either single allele or no mutation was detected (Parri et al., 2010).
In addition, few other syndromic retinal dystrophies have also been characterized where retinal degeneration may be either the primary clinical symptoms or appear at later stages of the disease which include Senior Loken syndrome (SLS), abetalipoproteinemia, Refsum disease, Joubert syndrome (JBTS), Meckel syndrome (MKS) and autosomal dominant cerebellar ataxia type II (Hamel, 2006; Ferrari et al.,
Genetic Analysis of Rare Eye Disorders in Pakistani Families 122 Syndromic Retinal Dystrophies Chapter 6
2011). It has been reported that RP is most frequently associated with non-ocular features, which may create problems for the accurate diagnosis (Xie et al., 2014). A recent review reported the highest frequency of USH syndrome, i.e. 36% followed by BBS (33%), MKS (13%), JBTS (10%), and SLS (8%) in Pakistani families (Khan et al.2014). The current study describes two Pakistani families (L and M) presenting retinal degeneration along with additional non ocular features.
6.1 Description of Families
Two multigenerational families were identified and enrolled from the remote areas of Sindh province of Pakistan and were living in the villages located far apart from each other. The pedigrees shown in figure 6.1 clearly depict autosomal recessive inheritance of the phenotype in four and eight affected individuals of the families L and M, respectively.
6.2 Clinical Description of Families
The clinical assessment of affected individuals of these families was done during visits to their residence which showed presence of retinal degeneration along with additional non ocular features. The proband from both families were then evaluated by clinicians for further clinical and fundus examinations. The detail of each family is as follows;
In the early childhood affected individuals of family L experience problems in night vision which worsen with age and eventually result in complete loss of night vision at the age of 10 years. At the same time all affected individuals also experience progressive loss of day vision. The fundus examination of a 20 year old male affected individual (V-1) showed bilateral retinitis pigmentosa with normal macular region.
Additionally, detailed interviews with the parents and healthy members of family L also indicated the presence of intellectual disability (ID) in the affected individuals. After suspecting the involvement of ID in this family, detailed interviews were conducted to gather information about social skills, behaviors and other associated neurological features. These interviews revealed the absence of self-care concept in all affected individuals. Additionally, these individuals lack qualitative and quantitative skills and never attended formal schooling. All affected individuals also exhibit aggressive fighting behavior and are dependent on parents for routine daily life activities. They also exhibited ambulation and speech delays and can only speak
Genetic Analysis of Rare Eye Disorders in Pakistani Families 123 Syndromic Retinal Dystrophies Chapter 6 in short sentences. The cranial computed tomographic (CT) scan of affected male individual (V-1) did not reveal any visible brain dysmorphology except the presence of a diffuse thick calvarium (Figure 6.2). Absence of the additional clinical features (especially skeletal) indicates the segregation of a retinitis pigmentosa intellectual disability syndrome in the affected individuals of family L (Table 6.1).
The evaluations of all affected members of family M also showed the presence of neurological, psychological, ophthalmological, skeletal, behavioral and dental features. The affected individuals have a prominent nasal bridge and bulbous tip, microcephaly, short stature, myopia as well as pigmentary retinopathy. The affected individuals of this extended family exhibit diverse clinical presentation which is summarized in table 6.2. Based on the available clinical information, affected individuals of family M were diagnosed as CS. The fundus examination of an affected individual IV-3 showed severe retinal degeneration, especially at the periphery (Figure 6.3a & b).
6.3 Homozygosity Mapping and Linkage Analysis of the Families
The DNA of available affected and normal individuals of both families was genotyped using whole genome SNP microarrays and data was analyzed with homozygositymapper/dChip. The detail of each family is as follows;
In family L, the DNA samples of four affected (V-1, V-3, V-4 and V-5) and three healthy members (IV-1, V-2 and V-6) were subjected to whole genome SNP analysis which showed the presence of 1.16 Mb and 6.65 Mb homozygous regions on chromosomes 11 and 21, respectively (Table 6.3). However, the fine mapping showed that a region on chromosome 21 is shared by all affected members of the family and is flanked by rs7282997 to rs2838715, which corresponds to a region of 3.22 Mb (GRCh37/hg19) (Figure 6.4). Linkage analysis of several informative SNPs from this region showed a maximum multipoint LOD score of 3.47 while the highest two point LOD score was 2.35 (Table 6.4). For large family M, nine DNA samples (IV-3, IV-4, IV-5, V-1, V-3, V-6, V-7, V-8, V-10) were subjected to whole genome scan which showed the co-segregation of a ~4.41 Mb homozygous region on 8q22. This region of homozygosity was delimited by rs11783149 and rs2679749 and contains a known CS gene, i.e. VPS13B (Table 6.3) which was selected for sequencing in this family.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 124 Syndromic Retinal Dystrophies Chapter 6
6.4 DNA Sequencing and Bioinformatics Analysis The GeneDistiller showed the presence of 98 genes in the homozygous region identified in family M but none of these has been previously implicated in either syndromic or non syndromic retinal dystrophies. Based on the functional characterization and expression, crystallin, alpha-A (CRYAA) was prioritized as potential gene and was subjected to Sanger sequencing of all coding regions and their intronic junctions. However, the sequencing analysis did not show any pathogenic variant.
The homozygous region identified in the family L contains VPS13B which was initially subjected to Sanger sequencing. During PCR amplification of exons and their intronic junctions for sequencing, it was observed that four consecutive exons (37, 38, 39 and 40) were not being specifically PCR amplified from the affected individuals, possibly indicating the presence of a large deletion in this genomic region.
6.4.1 Deletion Breakpoint Mapping
In order to confirm the deletion, primers were designed from last amplified exons, i.e. 36 and 41 on proximal and distal ends respectively and chromosomal walking was done to identify the exact breakpoint site. A pair of primers (forward primer5'- TCCTAAAATGTGCCATTGGTT-3'; reverse primer-R: 5'-TGCTGAAGAATAGAT TGCTGAA-3') amplified the breakpoint from the DNA samples of the affected individuals. In order to check the segregation of deletion in the complete family, multiplex PCR of junction fragment (450 bp) and VPS13B exon 36 (300 bp) was carried out which showed that all affected members were homozygous for this deletion. However, the normal individuals have intact VPS13B exon 36 either in homozygous or heterozygous state (Figure 6.5). The sequencing analysis revealed the exact site of deletion which happened between Chr8:100,728,884 and 100,779,911 (hg19) covering a region of 51,027 bp (g19:g.chr8:100728884_chr8:100779911 del) (Figure 6.6). It was assumed that if acceptor and donor splice sites were utilized as used in the wild type for the remaining part of the gene, this deletion might result in the truncated protein, i.e.p.Gly2177Alafs*16.
The genomic region of the deletion contains no known segmental duplications, large repeats or other sequences that may likely predispose this chromosome 8 region towards genomic instability (UCSC Genome Browser, hg19). Additionally, copy
Genetic Analysis of Rare Eye Disorders in Pakistani Families 125 Syndromic Retinal Dystrophies Chapter 6 number variations were absent in this region as per the Database of Genomic Variants (http://dgv.tcag.ca/dgv/app/home) and the identified deletion was not found in the Human Genome Mutation Database (http://www.hgmd.cf.ac.uk/ac/index.php) as well as the exome variant server (http://evs.gs.washington.edu/EVS/). The sequencing of 100 unrelated healthy Pakistani individuals also did not show this deletion.
6.5 Discussion
The current study describes the genetic analysis of two Pakistani families presenting different syndromic forms of retinal dystrophies. The homozygosity mapping showed the co-segregation of a novel region in family L, but family M mapped to a chromosome 8 region which contains a known CS gene; VPS13B. Later deletion breakpoint mapping and sequencing of VPS13B revealed the segregation of a novel deletion of 51,027 bp, which presumably results in a frameshift and early termination, i.e. p.Gly2177Alafs*16. Our data indicate that, the probable loss of VPS13B function due to the large deletion is the causative factor for CS in the affected individuals of family M. Although, the clinical presentation of affected individuals from family L bears close resemblance with the already reported RD syndromes like BBS, JS and CS but detailed clinical comparisons also revealed significant differences. RP is a common clinical feature in the majority of BBS, JS and CS patients and was also present in the affected members of family L. But additional clinical features, required to conclude the diagnosis of any one of the above mentioned syndromes, were absent in the affected members of family L. This may point towards the involvement of a new RD syndrome in this family and may be labeled as retinitis pigmentosa intellectual disability (RPID) syndrome. The homozygosity mapping of family L showed two regions of homozygosity with different genomic sizes, but fine mapping confirmed the segregation of a homozygous region of 3.22 Mb on chromosome 21. The detailed analysis with GeneDistiller showed the presence of 98 genes between markers rs728997 and rs2838715. None of these genes have been previously implicated in any syndromic retinal dystrophies like BBS, JS or CS as well as non syndromic retinal diseases indicating involvement of novel candidate, which led us to prioritize potential gene, i.e. CRYAA for sequencing in the affected individuals of family L. But sequencing failed to identify any pathogenic variation in this gene.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 126 Syndromic Retinal Dystrophies Chapter 6
In family M, the clinical presentation of the affected individuals was consistent to CS. However, few distinct features like night blindness, hypodontia and hyperactive behavior were also recorded. These observations were consistent with previous studies in which variations have been reported in the clinical presentations of CS patients. Gueneau et al. (2014) described a patient carrying two VPS13B splicing mutations who had microcephaly, retinopathy, and congenital neutropenia without obesity and mental retardation. Similarly, clinical variability has been reported in CS patient from different ethnic and geographical areas (Douzgouand Petersen, 2011).
The sequencing of VPS13B in family M identified a 51Kb homozygous deletion encompassing 4 coding exons. This large deletion probably removes 793 bp of the coding sequence in mRNA, which would lead to a frameshift mutation with the substitution glycine to alanine at amino acid 2177 and the addition of a premature stop codon. This is expected to produce a truncated protein consisting of 2191 residues as compared to 4022 for wild type (NM_017890) and will probably be subjected to nonsense mediated decay (NMD). However, if truncated protein escapes NMD, this will lead to a shortened protein (p.Gly2177Alafs*16) without DUF1162 and ATG_C (using SMART), and five predicted transmembrane domains (using TMPRED) required for the normal function of VPS13B protein.
The VPS13B protein is a peripheral membrane protein of 358 kDa and plays role in the cycling of transmembrane proteins between the trans-Golgi network and the prevacuolar compartment, spindle pole organization, prospore membrane morphogenesis and Golgi complex organization (Kilmartin,2003; Park and Neiman, 2012; Park et al., 2013). Based on VPS13B homology with the yeast vacuolar protein sorting-associatedprotein13 (Vps13p), it has been proposed that VPS13B may be involved in vesicle mediated protein sorting (VPS) and intracellular protein transportation (Balikova et al., 2009; El Chehadehet et al., 2010).
Initially, Seifert et al. (2011) did functional analysis of VPS13B and showed that VPS13B is a Golgi membrane protein and co-localizes strongly with the cis-Golgi matrix protein GM130. Recently Seifert et al. (2014) established the crucial role for RAB6-dependent function of VPS13B in neurogenesis by regulating Golgi complex organization which provides the possible mechanism of microcephaly (reduced postnatal brain size) and intellectual disability in CS cases. It was also shown that VPS13B mutations, responsible for Cohen syndrome, are associated with strong
Genetic Analysis of Rare Eye Disorders in Pakistani Families 127 Syndromic Retinal Dystrophies Chapter 6 protein glycosylation defects. This also supports the studies indicating role of VPS13B in Golgi glycosylation and morphology as well as in lysosomal–endosomal pathway maintenance (Duplomb et al., 2014).
The current study describes two Pakistani families suffering from the syndromic retinal dystrophies in which the clinical picture was suggestive of presence of two different syndromes. Genetic analysis of one family (L) showed co-segregation of novel homozygous region in which further work is required to identify the exact pathogenic variant. In the second family, the affected individuals were diagnosed as CS cases which were confirmed by the genetic analysis. This empathizes the early screening of children with CS based on features like facial dysmorphism, developmental delay and hypotonia which may help in the genetic counseling of the respective families.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 128 Syndromic Retinal Dystrophies Chapter 6
L M
Figure 6.1: Pedigrees of families (L and M) presenting syndromic retinal dystrophy. Filled circles/squares represent affected individuals and hollow circles/squares show normal individuals. Consanguineous marriages are indicated with double line, while deceased individuals are indicated by diagonal lines. The probands in each family have been indicated using an arrow.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 129 Syndromic Retinal Dystrophies Chapter 6
Figure 6.2: Computed tomographic images of proband V-1 of family L.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 130 Syndromic Retinal Dystrophies Chapter 6
Table 6.1: Clinical features of affected members of family L
Patient ID V-1 V-3 V-4 V-5
Gender M M F F
Age 20 27 17 24
Onset of Visual 3 yrs 18 months 4 yrs 5 yrs problem
Night Blindness + + + +
Photophobia - - - -
Nystagmus - - - -
Color Vision - - - -
Developmental Yes Yes Yes Yes delay Intellectual Severe Severe Severe Severe Disability Few Few Few Few Language sentences sentences sentences sentences
Behaviors Aggressive Aggressive Aggressive Aggressive
Coordination Poor Poor Poor Poor
Genetic Analysis of Rare Eye Disorders in Pakistani Families 131 Syndromic Retinal Dystrophies Chapter 6
Table 6.2: Clinical features of affected members of family M
Patient ID IV-3 IV-4 IV-5 V-1 V-3 V-6 V-7 V-8
Gender F M M M M M M F
Age (Yrs) 17 27 25 15 20 >50 >50 >50
Night Blindness + + + + + N/A N/A +
Retinitis + + + + + Blind Blind + Pigmentosa
Developmental Yes Yes Yes Yes Yes Yes Yes Yes Delay
Intellectual +++ +++ +++ +++ +++ +++ +++ +++ Disability
Age 1st walked <2 <2 <2 <2 <2 <2 <2 <2
OFC (cm) 47 49 49 NA NA 47.5 48 48
Total loss Dental ------of teeth NA: not assessed, N/A Not Applicable
Genetic Analysis of Rare Eye Disorders in Pakistani Families 132 Syndromic Retinal Dystrophies Chapter 6
a b
Figure 6.3: Fundus appearance (a & b) of affected individual IV-3 of family M showing wide spread retinal degeneration especially at the periphery.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 133 Syndromic Retinal Dystrophies Chapter 6
Table 6.3: Description of homozygous regions identified in family L and M
Homozygous Region Known Family Gene ID Chr Flanking SNPs Size (Mb) (if any)
11 rs6578752-rs7102418 1.16 -
L 21 rs2836245 - rs2838715 6.65 -
M 8 rs11783149- rs2679749 4.41 VPS13B
Genetic Analysis of Rare Eye Disorders in Pakistani Families 134 Syndromic Retinal Dystrophies Chapter 6
rs728997 2 1 2 1 rs220229 2 1 2 1 rs2051402 2 1 2 1 rs11700748 2 1 2 1 rs2010795 2 1 2 1 rs13048791 2 1 2 1 rs4818886 2 1 2 1 rs12627610 2 2 1 2 rs2838715 1 1 2 2
2 2 1 2 1 2 2 2 2 2 1 1
2 2 1 2 2 2 2 2 2 2 1 1
2 2 1 2 2 2 2 2 2 2 1 1 2 2 1 2 2 2 2 2 2 2 1 1
2 2 1 2 2 2 2 2 2 2 1 1 2 2 1 2 2 2 2 2 2 2 1 1 2 2 1 2 2 2 2 2 2 2 1 1 2 1 2 1 2 1 2 1 2 1 2 2 1 2 1 2 1 2 1 2 1 2 1 2
Figure 6.4: Haplotype of family L for several chromosome 21 markers show co- segregation of a homozygous region between rs1183449 to rs3861948.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 135 Syndromic Retinal Dystrophies Chapter 6
Table 6.4: Two-point and multipoint LOD scores for several markers on chromosome 21 in family L
2-point LOD Marker hg 19 Multipoint (0.00 theta) Coordinates LOD
rs7282997 43,059,884 ∞ ∞
rs220229 43,448,797 ∞ 2.35
rs2051402 44,172,809 3.47 2.35
rs11700748 44,473,062 3.45 1.74
rs2010795 45,172,628 3.44 2.35
rs13048791 45,421,406 3.37 2.35
rs4818886 45,589,727 3.26 2.35
rs12627610 45,895,759 -1.29 -1.05
rs2838715 46,283,558 -1.28 -1.52
Genetic Analysis of Rare Eye Disorders in Pakistani Families 136 Syndromic Retinal Dystrophies Chapter 6
L III-3 III-4 IV-3 IV-4 IV-5 IV-1 IV-2 V-2 V-1 IV-8 IV-9 V-6 V-7 V-8 V-10 L
450 bp 300 bp
Figure 6.5: The gel photograph of multiplex PCR product of family M; the lane having one band of size approximately 450 bp depicts junction fragment (affected) with 300 bp denotes exon 36 of VPS13B (homozygous normal) while lane having both bands are carrier (heterozygous normal).
Genetic Analysis of Rare Eye Disorders in Pakistani Families 137 Syndromic Retinal Dystrophies Chapter 6
Figure 6.6: (a) Ideogram of chromosome 8, indicating location of VPS13B at 8q22. The deleted exons are indicating on the genomic organization ofVPS13B/COH1, (b) the breakpoint is indicated by an arrow in the electropherogram from DNA sequence of an affected individual of family M.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 138 Conclusion Chapter 7
CHAPTER 7
CONCLUSION
Genetic Analysis of Rare Eye Disorders in Pakistani Families 139 Conclusion Chapter 7
7. CONCLUSION
The current study involved genetic analysis of 13 Pakistani families residing in the rural areas of Pakistan. All families have an autosomal recessive mode of inheritance and exhibited different types of retinal dystrophies. The detailed family and clinical history were collected and one individual from each family was tested by the ophthalmologist. Based on their clinical presentation and testing, five families were diagnosed as achromatopsia (ACHM), 04 retinitis pigmentosa (RP), 02 as cone rod dystrophies (CRD), while in 02 families; the presentation was consistent to syndromic retinal dystrophies. Genetic analysis of these 13 families indicated the successful resolution of the majority of the families through homozygosity mapping. These analyses revealed co- segregation of autozygous genomic regions harboring known RD genes in 10 families (04 ACHM, 03 RP, 02 CRD and 01 syndromic), which indicates that homozygosity mapping based candidate gene sequencing is still a useful technique to identify genetic defects in families with recessive disorders. Additionally, the identification of known mutations in RD genes also highlights their potential utility in the population based molecular diagnosis panels. Our study also supports the previous findings about prevalent genes and suggests the screening of CNGA3, RHO and RPGRIP1 genes in new ACHM, RP and CRD patients, respectively. Our inability to identify pathogenic mutation in one family mapped to a genomic region with known RD gene also signifies the importance of the use of alternative approaches for the unsolved families. The negative findings in this family does not only indicate the involvement of a novel gene, but may point towards other mechanisms like structural variations, deep intronic variations and variations in the regulatory regions that cannot be detected by techniques used in the current study. However, identification of three novel homozygous regions in 03 families (one each of ACHM, RP and syndromic family) also provides support for the existence of additional genetic heterogeneity for RD. As Sanger sequencing failed to identify the underlying genes in three families, so they can be subjected to next generation sequencing to identify the pathogenic variants. The use of next generation sequencing will also help to overcome limitations (e.g. compound heterozygosity) associated with homozygosity mapping. It is anticipated that identification of causative genes at the
Genetic Analysis of Rare Eye Disorders in Pakistani Families 140 Conclusion Chapter 7 mapped novel loci will expand our understanding about the pathogenesis of the retinal dystrophies. In nutshell, this study signifies the importance of homozygosity mapping based Sanger sequencing to identify the genetic variants in patients with recessive disorders. Our findings also suggest the screening of CNGA3, RHO and RPGRIP1 genes in retinal dystrophy patients from Pakistan before initiating attempts to identify novel genes.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 141 References Chapter 8
CHAPTER 8
REFERENCES
Genetic Analysis of Rare Eye Disorders in Pakistani Families 142 References Chapter 8
8. REFERENCES
Abbasi AH1, Garzozi HJ, Ben-Yosef T (2008). A novel splice-site mutation of TULP1 underlies severe early-onset retinitis pigmentosa in a consanguineous Israeli Muslim Arab family. Mol Vis. 14: 675-82.
Aboshiha J, Luong V, Cowing J, Dubis AM, Bainbridge JW, Ali RR, Webster AR, Moore AT, Fitzke FW, Michaelides M (2014). Dark-adaptation functions in molecularly confirmed achromatopsia and the implications for assessment in retinal therapy trials. Invest Ophthalmol Vis Sci. 55(10): 6340-6349.
Adzhubei IA, Schmidt S, Peshkin L, Ramensky VE, Gerasimova A, Bork P, Kondrashov AS, Sunyaev SR (2010). A method and server for predicting damaging missense mutations. Nat Methods. 7(4):248-249.
Agha Z, Iqbal Z, Azam M, Hoefsloot LH, van Bokhoven H, Qamar R (2013). A novel homozygous 10 nucleotide deletion in BBS10 causes Bardet–Biedl syndrome in a Pakistani family. Gene. 519(1): 177-181.
Ahuja Y, Kohl S, Traboulsi EI (2008). CNGA3 mutations in two United Arab Emirates families with achromatopsia. Mol Vis.14: 1293-1297.
Ajmal M, Khan MI, Micheal S, Ahmed W, Shah A, Venselaar H, Bokhari H, Azam A, Waheed NK, Collin RW, den Hollander AI, Qamar R, Cremers FP (2012). Identification of recurrent and novel mutations in TULP1 in Pakistani families with early-onset retinitis pigmentosa. Mol Vis.18: 1226-1237.
Ajmal M1, Khan MI, Neveling K, Tayyab A, Jaffar S, Sadeque A, Ayub H, Abbasi NM, Riaz M, Micheal S, Gilissen C, Ali SH, Azam M, Collin RW, Cremers FP, Qamar R (2013). Exome sequencing identifies a novel and a recurrent BBS1 mutation in Pakistani families with Bardet-Biedl syndrome. Mol Vis. 19: 644-53.
An J, Wang L, Guo Q, Li L, Xia F, Zhang Z (2012). Behavioral phenotypic properties of a natural occurring rat model of congenital stationary night blindness with CACNA1F mutation. J Neurogenet. 26(3): 363-373.
Anasagasti A, Irigoyen C, Barandika O, López de Munain A, Ruiz-Ederra J (2012). Current mutation discovery approaches in retinitis pigmentosa. Vision Res. 75: 117-29.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 143 References Chapter 8
Arts HH, Doherty D, van Beersum SE, Parisi MA, Letteboer SJ, Gorden NT, Roepman R (2007). Mutations in the gene encoding the basal body protein RPGRIP1L, a nephrocystin-4 interactor, cause Joubert syndrome. Nat Genet. 39(7): 882-888.
Athanasiou D, Aguilà M, Bevilacqua D, Novoselov SS, Parfitt DA, Cheetham ME (2013). The cell stress machinery and retinal degeneration. FEBS letters. 587(13): 2008-2017.
Audo I, Bujakowska K, Orhan E, Poloschek CM, Defoort-Dhellemmes S, Drumare I, Kohl S, Luu TD, Lecompte O, Zrenner E, Lancelot ME, Antonio A, Germain A, Michiels C, Audier C, Letexier M, Saraiva JP, Leroy BP, Munier FL, Mohand-Saïd S, Lorenz B, Friedburg C, Preising M, Kellner U, Renner AB, Moskova-Doumanova V, Berger W, Wissinger B, Hamel CP, Schorderet DF, De-Baere E, Sharon D, Banin E, Jacobson SG, Bonneau D, Zanlonghi X, Le- Meur G, Casteels I, Koenekoop R, Long VW, Meire F, Prescott K, de-Ravel T, Simmons I, Nguyen H, Dollfus H, Poch O, Léveillard T, Nguyen-Ba- Charvet K, Sahel JA, Bhattacharya SS, Zeitz C (2012). Whole-exome sequencing identifies mutations in GPR179 leading to autosomal-recessive complete congenital stationary night blindness. Am J Hum Genet. 90(2): 321- 330.
Audo I, Michaelides M, Robson AG, Hawlina M, Vaclavik V, Sandbach JM, Neveu MM, Hogg CR, Hunt DM, Moore AT, Bird AC, Webster AR, Holder GE (2008). Phenotypic variation in enhanced S-cone syndrome. Invest Ophthalmol Vis Sci. 29(5): 2082-2093.
Avila-Fernandez A, Corton M, Nishiguchi KM, Muñoz-Sanz N, Benavides-Mori B, Blanco-Kelly F, Riveiro-Alvarez R, Garcia-Sandoval B, Rivolta C, Ayuso C (2012). Identification of an RP1 prevalent founder mutation and related phenotype in Spanish patients with early-onset autosomal recessive retinitis. Ophthalmology. 119(12): 2616-21.
Azam M, Collin RW, Malik A, Khan MI, Shah ST, Shah AA, Hussain A, Sadeque A, Arimadyo K, Ajmal M, Azam A, Qureshi N, Bokhari H, Strom TM, Cremers FP, Qamar R, den Hollander AI (2011). Identification of novel mutations in
Genetic Analysis of Rare Eye Disorders in Pakistani Families 144 References Chapter 8
Pakistani families with autosomal recessive retinitis pigmentosa. Arch Ophthalmol. 129(10): 1377-8.
Azam M, Collin RW, Shah ST, Shah AA, Khan MI, Hussain A, Sadeque A, Strom TM, Thiadens AA, Roosing S, den Hollander AI, Cremers FP, Qamar R (2010). Novel CNGA3 and CNGB3 mutations in two Pakistani families with achromatopsia. Mol Vis.16: 774-781.
Azam M, Khan MI, Gal A, Hussain A, Shah ST, Khan MS, Sadeque A, Bokhari H, Collin RW, Orth U, van Genderen MM, den Hollander AI, Cremers FP, Qamar R (2009). A homozygous p.Glu150Lys mutation in the opsin gene of two Pakistani families with autosomal recessive retinitis pigmentosa. Mol Vis. 15: 2526-2534.
Balikova I, Lehesjoki AE, de-Ravel TJ, Thienpont B, Chandler KE, Clayton-Smith J, Träskelin AL, Fryns JP, Vermeesch JR (2009). Deletions in the VPS13B (COH1) gene as a cause of Cohen syndrome. Hum Mutat. 30(9): 845-854.
Bareil C, Hamel C, Delague V, Arnaud B, Demaille J, Claustres M (2001). Segregation of a mutation in CNGB1 encoding the β-subunit of the rod cGMP- gated channel in a family with autosomal recessive retinitis pigmentosa. Hum Genet. 108(4): 328-334.
Bech-Hansen NT, Naylor MJ, Maybaum TA, Pearce WG, Koop B, Fishman GA, Mets M, Musarella MA, Boycott KM (1998). Loss-of-function mutations in a calcium-channel alpha1-subunit gene in Xp11.23 cause incomplete X-linked congenital stationary night blindness. Nat Genet. 19(3):264-7.
Becirovic E, Nakova K, Hammelmann V, Hennel R, Biel M, Michalakis S (2010). The retinitis pigmentosa mutation c. 3444+1G>A in CNGB1 results in skipping of exon 32. PloS One. 5(1): 8969.
Bennett RL, Steinhaus KA, Uhrich SB, O'Sullivan CK, Resta RG, Lochner-Doyle D, Markel DS, Vincent V, Hamanishi J (1995). Recommendations for standardized human pedigree nomenclature. Pedigree standardization task force of the national society of genetic counselors. Am J Hum Genet. 56(3): 745-52.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 145 References Chapter 8
Berger W, Kloeckener-Gruissem B, Neidhardt J (2010). The molecular basis of human retinal and vitreoretinal diseases. Prog Retin Eye Res. 29(5): 335-375.
Biel M, Michalakis S (2007). Function and dysfunction of CNG channels: insights from channelopathies and mouse models. Mol Neurobiol. 35(3): 266-277.
Bijveld MM, Florijn RJ, Bergen AA, van-den-Born LI, Kamermans M, Prick L, Riemslag FC, van-Schooneveld MJ, Kappers AM, van-Genderen MM (2013). Genotype and phenotype of 101 dutch patients with congenital stationary night blindness. Ophthalmology. 120(10): 2072-2081.
Bonnet C, El-Amraoui A (2012). Usher syndrome (sensorineural deafness and retinitis pigmentosa): pathogenesis, molecular diagnosis and therapeutic approaches. Curr Opin Neurol. 25(1): 42-49.
Boycott KM, Vanstone MR, Bulman DE, MacKenzie AE (2013). Rare-disease genetics in the era of next-generation sequencing: discovery to translation. Nat Rev Genet. 14(10): 681-691.
Boylan JP, Wright AF (2000). Identification of a novel protein interacting with RPGR. Hum Mol Genet. 9(14): 2085-2093.
Bright SR, Brown TE, Varnum MD (2005). Disease-associated mutations in CNGB3 produce gain of function alterations in cone cyclic nucleotide-gated channels. Mol Vis. 19: 1141-1150.
Buch H, Vinding T, Cour ML, Appleyard M, Jensen GB, Nielsen NV (2004). Prevalence and causes of visual impairment and blindness among 9980 Scandinavian adults: the Copenhagen City Eye Study. Ophthalmology. 111(1): 53-61.
Burset M, Seledtsov IA, Solovyev VV (2000). Analysis of canonical and non- canonical splice sites in mammalian genomes. Nucleic Acids Res. 28(21): 4364-4375.
Cohen B, Chervinsky E, Jabaly-Habib H, Shalev SA, Briscoe D, Ben-Yosef T (2012). A novel splice site mutation of CDHR1 in a consanguineous Israeli Christian Arab family segregating autosomal recessive cone-rod dystrophy. Mol Vis. 18: 2915-2921.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 146 References Chapter 8
Cohen M1, Bitner-Glindzicz M, Luxon L (2007). The changing face of Usher syndrome: clinical implications. Int J Audiol. 46(2): 82-93.
Czirják G, Tóth ZE, Enyedi P (2007). Characterization of the heteromeric potassium channel formed by kv2. 1 and the retinal subunit kv8. 2 in Xenopus oocytes. J Neurophysiol.. 98(3): 1213-1222.
Dai G, Peng C, Liu C, Varnum MD (2013). Two structural components in CNGA3 support regulation of cone CNG channels by phosphoinositides. J Gen Physiol. 141(4): 413-430.
Daiger SP, Sullivan LS, Bowne SJ (2013). Genes and mutations causing retinitis pigmentosa. Clin Genet. 84(2): 10. den Hollander AI1, Black A, Bennett J, Cremers FP (2010). Lighting a candle in the dark: advances in genetics and gene therapy of recessive retinal dystrophies. J Clin Invest. 120(9): 3042-3053.
Desmet FO, Hamroun D, Lalande M, Collod-Béroud G, Claustres M, Béroud C (2009). Human Splicing Finder: an online bioinformatics tool to predict splicing signals. Nucleic Acids Res. 37(9):e67.
Dodge JA, Chigladze T, Donadieu J, Grossman Z, Ramos F, Serlicorni A, Siderius L, Stefanidis CJ, Tasic V, Valiulis A, Wierzba J (2011). The importance of rare diseases: from the gene to society. Arch Dis Child. 96(9):791-792.
Douzgou S, Petersen MB (2011). Clinical variability of genetic isolates of Cohen syndrome. Clin Genet. 76(6): 501-506.
Dryja TP, McGee TL, Berson EL, Fishman GA, Sandberg MA, Alexander KR, Derlacki DJ, Rajagopalan AS (2005). Night blindness and abnormal cone electroretinogram ON responses in patients with mutations in the GRM6 gene encoding mGluR6. Proc Natl Acad Sci. 102(13): 4884-4889.
Duplomb L, Duvet S, Picot D, Jego G, El-Chehadeh-Djebbar S, Marle N, Gigot N, Aral B, Carmignac V, Thevenon J, Lopez E, Rivière B, Klein A, Philippe C, Droin N, Blair E, Girodon F, Donadieu J, Bellanné-Chantelot C, Delva L, Michalski JC, Solary E, Faivre L, Foulquier F, Thauvin-Robinet C (2014). Cohen syndrome is associated with major glycosylation defects. Hum Mol Genet. 23(9): 2391-2399.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 147 References Chapter 8
Ebermann I, Wiesen MH, Zrenner E, Lopez I, Pigeon R, Kohl S, Löwenheim H, Koenekoop RK, Bolz HJ (2009). GPR98 mutations cause Usher syndrome type 2 in males. J Med Genet. 46(4): 277-280.
Eisenberger T, Slim R, Mansour A, Nauck M, Nürnberg G, Nürnberg P, Decker C, Dafinger C, Ebermann I, Bergmann C, Bolz HJ (2012). Targeted next- generation sequencing identifies a homozygous nonsense mutation in ABHD12, the gene underlying PHARC, in a family clinically diagnosed with Usher syndrome type 3. Orphanet J Rare Dis. 2;7: 59.
El-Chehadeh S, Aral B, Gigot N, Thauvin-Robinet C, Donzel A, Delrue MA, Lacombe D, David A, Burglen L, Philip N, Moncla A, Cormier-Daire V, Rio M, Edery P, Verloes A, Bonneau D, Afenjar A, Jacquette A, Heron D, Sarda P, Pinson L, Doray B, Vigneron J, Leheup B, Frances-Guidet AM, Dienne G, Holder M, Masurel-Paulet A, Huet F, Teyssier JR, Faivre L (2010). Search for the best indicators for the presence of a VPS13B gene mutation and confirmation of diagnostic criteria in a series of 34 patients genotyped for suspected Cohen syndrome. J Med Genet. 47(8): 549-553.
Estrada-Cuzcano A, Roepman R, Cremers FP, den-Hollander AI, Mans DA (2012). Non-syndromic retinal ciliopathies: translating gene discovery into therapy. Hum Mol Genet. 21: 111-124
Faillace MP, Bernabeu RO, Korenbrot JI (2004). Cellular processing of cone photoreceptor cyclic GMP-gated ion channels: a role for the S4 structural motif. J Biol Chem. 279(21): 22643-22653
Fernández-Martínez, L, Letteboer S, Mardin CY, Weisschuh N, Gramer E, Weber BH, Pasutto F (2011). Evidence for RPGRIP1 gene as risk factor for primary open angle glaucoma. Eur J Hum Genet. 19(4): 445-451.
Ferrari S, Di-Iorio E, Barbaro V, Ponzin D, Sorrentino FS, Parmeggiani F (2011). Retinitis pigmentosa: Genes and disease mechanisms. Curr Genomics. 12(4): 238–249.
Gao JJ1, Song PP, Tang W (2013). Rare disease patients in China anticipate the sunlight of legislation. Drug Discov Ther. 7(3): 126-8.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 148 References Chapter 8
Godara P, Wagner-Schuman M, Rha J, Jr TB Connor, Stepien KE, Carroll J (2012). Imaging the Photoreceptor Mosaic with Adaptive Optics: Beyond Counting Cones. AdvExp Med Biol. 723: 451-458.
Goto-Omoto S, Hayashi T, Gekka T, Kubo A, Takeuchi T, Kitahara K (2006). Compound heterozygous CNGA3 mutations (R436W, L633P) in a Japanese patient with congenital achromatopsia. Vis Neurosci. 23:395–402
Grau T, Artemyev NO, Rosenberg T, Dollfus H, Haugen OH, CumhurSener E, Jurklies B, Andreasson S, Kernstock C, Larsen M, Zrenner E, Wissinger B, Kohl S (2011). Decreased catalytic activity and altered activation properties of PDE6C mutants associated with autosomal recessive achromatopsia. Hum Mol Genet. 20(4): 719-730.
Gu S, Kumaramanickavel G, Srikumari CR, Denton MJ, Gal A (1999). Autosomal recessive retinitis pigmentosa locus RP28 maps between D2S1337 and D2S286 on chromosome 2p11-p15 in an Indian family. J Med Genet. 36(9): 705-7.
Gueneau L, Duplomb L, Sarda P, Hamel C, Aral B, Chehadeh SE, Gigot N, St-Onge J, Callier P, Thevenon J, Huet F, Carmignac V, Droin N, Faivre L, Thauvin- Robinet C (2014). Congenital neutropenia with retinopathy, a new phenotype without intellectual deficiency or obesity secondary to VPS13B mutations. Am J Med Genet. 164A(2): 522-527.
Hall TA (199). BioEdit: a user-friendly biological sequence alignment editor and analysis program for window 95/98/NT. Nucleic acids Symposium Ser. 41: 95-98.
Hameed A, Abid A, Aziz A, Ismail M, Mehdi SQ, Khaliq S (2003). Evidence of RPGRIP1 gene mutations associated with recessive cone-rod dystrophy. J Med Genet. 40(8): 616-9.
Hameed A, Khaliq S, Ismail M, Anwar K, Mehdi SQ, Bessant D, Payne AM, Bhattacharya S (2001). A new locus for autosomal recessive RP (RP29) mapping to chromosome 4q32-q34 in a Pakistani family. Invest Ophthal Vis Sci. 42: 1436-1438.
Hamel C (2006). Retinitis pigmentosa. Orphanet J Rare Dis. 1: 40.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 149 References Chapter 8
Hamel CP (2007). Cone rod dystrophies. Orphanet J Rare Dis. 2(7): 1750-1772.
Hamel CP (2013). Inherited retinal dystrophies: contributions of molecular genetics. Biol Aujourdhui. 207(2): 73-85.
Hartong DT, Berson EL, Dryja TP (2006). Retinitis pigmentosa. Lancet. 368(9549): 1795-1809
Hauke J, Schild A, Neugebauer A, Lappa A, Fricke J, Fauser S, Rösler S, Pannes A, Zarrinnam D, Altmüller J, Motameny S, Nürnberg G, Nürnberg P, Hahnen E, Beck BB (2013). A novel large in-frame deletion within the CACNA1F gene associates with a cone-rod dystrophy 3-like phenotype. PLoS One. 8(10): 76414.
Hennig AK1, Peng GH, Chen S (2008). Regulation of photoreceptor gene expression by Crx-associated transcription factor network. Brain Res. 4;1192: 114-33.
Hentze MW, Kulozik AE (1999). A perfect message: RNA surveillance and nonsense-mediated decay. Cell. 96(3): 307-310.
Hernan I, Gamundi MJ, Borràs E, Maseras M, García-Sandoval B, Blanco-Kelly F, Ayuso C, Carballo M (2012). Novel p.M96T variant of NRL and shRNA- based suppression and replacement of NRL mutants associated with autosomal dominant retinitis pigmentosa. Clin Genet. 82(5): 446-542.
Huang L, Zhang Q, Li S, Guan L, Xiao X, Zhang J, Zhang Q (2013). Exome sequencing of 47 Chinese families with cone-rod dystrophy: mutations in 25 known causative genes. PloS One. 8(6): e65546.
Hussain R, Bittles AH (1998). The prevalence and demographic characteristics of consanguineous marriages in Pakistan. J Biosoc Sci. 30(2): 261-275.
Hüttl S, Michalakis S, Seeliger M, Luo DG, Acar N, Geiger H, Hudl K, Mader R, Haverkamp S, Moser M, Pfeifer A, Gerstner A, Yau KW, Biel M (2005). Impaired channel targeting and retinal degeneration in mice lacking the cyclic nucleotide-gated channel subunit CNGB1. J Neurosci. 25(1):130-8.
Ian MM, Tran M, Musarella MA (2004). Ocular genetics: current understanding. Surv Ophthalmol.49(2): 159-196.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 150 References Chapter 8
Iqbal K, Jin SG, Pfeifer GP, Szabó PE (2011). Reprogramming of the paternal genome upon fertilization involves genome-wide oxidation of 5- methylcytosine. Proc Natl Acad Sci. 108(9):3642-3647.
Ismail M, Abid A, Anwar K, Mehdi SQ, Khaliq S (2006). Refinement of the locus for autosomal recessive cone rod dystrophy (CORD8) linked to chromosome 1q23–q24 in a Pakistani family and exclusion of candidate genes. J Hum Genet. 51(9): 827-831.
Ivanov D, Dvoriantchikova G, Nathanson L, McKinnon SJ, Shestopalov VI (2006). Microarray analysis of gene expression in adult retinal ganglion cells. FEBS Lett. 9;580(1): 331-5.
Jiang L, Baehr W (2010). GCAP1 mutations associated with autosomal dominant cone dystrophy. Adv Exp Med Biol. 664: 273-282.
Johnson S, Michaelides M, Aligianis IA, Ainsworth JR, Mollon JD, Maher ER, Hunt DM (2004). Achromatopsia caused by novel mutations in both CNGA3 and CNGB3. J Med Genet. 41:e20
Kajiwara K1, Berson EL, Dryja TP (1994). Digenic retinitis pigmentosa due to mutations at the unlinked peripherin/RDS and ROM1 loci. Science. 264(5165): 1604-8.
Khaliq S, Abid A, Hameed A, Anwar K, Mohyuddin A, Azmat Z, Shami SA, Ismail M, Mehdi SQ (2003). Mutation screening of Pakistani families with congenital eye disorders. Exp Eye Res. 76: 343–348.
Khaliq S, Abid A, Ismail M, Hameed A, Mohyuddin A, Lall P, Aziz A, Anwar K, Mehdi SQ (2005). Novel association of RP1 gene mutations with autosomal recessive retinitis pigmentosa. J Med Genet. 42: 436–438.
Khaliq S, Hameed A, Ismail M, Anwar K, Leroy BP, Mehdi SQ, Payne AM, Bhattacharya SS (2000). Novel locus for autosomal recessive cone-rod dystrophy CORD8 mapping to chromosome 1q12-Q24. Invest Ophthalmol Vis Sci. 41(12): 3709-3712.
Khan MI, Azam M, Ajmal M, Collin RW, den Hollander AI, Cremers FP, Qamar R (2014). The molecular basis of retinal dystrophies in Pakistan. Genes (Basel). 5(1):176-195.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 151 References Chapter 8
Khan MI, Kersten FF, Azam M, Collin RW, Hussain A, Shah ST, Keunen JE, Kremer H, Cremers FP, Qamar R, den Hollander AI (2011). CLRN1 mutations cause nonsyndromic retinitis pigmentosa. Ophthalmology. 118(7): 1444-1448.
Khan MI1, Collin RW, Arimadyo K, Micheal S, Azam M, Qureshi N, Faradz SM, den Hollander AI, Qamar R, Cremers FP (2010). Missense mutations at homologous positions in the fourth and fifth laminin A G-like domains of eyes shut homolog cause autosomal recessive retinitis pigmentosa. Mol Vis. 15;16: 2753-9.
Khan S, Ullah I, Irfanullah, Touseef M, Basit S, Khan MN, Ahmad W (2013). Novel homozygous mutations in the genes ARL6 and BBS10 underlying Bardet-Biedl syndrome. Gene. 515(1): 84-88.
Khan NW, Wissinger B, Kohl S, Sieving PA (2007). CNGB3 achromatopsia with progressive loss of residual cone function and impaired rod-mediated function. Invest Ophthalmol Vis Sci. 48(8):3864-3871.
Kilmartin JV (2003). SFI1P has conserved centrin-binding sites and an essential function in budding yeast spindle pole body duplication. J Cell Biol. 162(7): 1211-21.
Kim C, Kim KJ, Bok J, Lee EJ, Kim DJ, Oh JH, Park SP, Shin JY, Lee JY, Yu HG (2012). Microarray-based mutation detection and phenotypic characterization in Korean patients with retinitis pigmentosa. Mol Vis. 18: 2398-2410.
Kitiratschky VB, Behnen P, Kellner U, Heckenlively JR, Zrenner E, Jägle H, Koch KW (2009). Mutations in the GUCA1A gene involved in hereditary cone dystrophies impair calcium mediated regulation of guanylate cyclase. Hum mutat. 30(8): E782-E796.
Kitiratschky VB, Wilke R, Renner AB, Kellner U, Vadalà M, Birch DG, Wissinger B, Zrenner E, Kohl S (2008). Mutation analysis identifies GUCY2D as the major gene responsible for autosomal dominant progressive cone degeneration. Invest Ophthalmol Vis Sci. 49(11): 5015-23.
Kivitie-Kallio S1, Norio R (2001). Cohen syndrome: essential features, natural history, and heterogeneity. Am J Med Genet. 102(2): 125-35.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 152 References Chapter 8
Kizhatil K, Baker SA, Arshavsky VY, Bennett V (2009). Ankyrin-g promotes cyclic nucleotide–gated channel transport to rod photoreceptor sensory cilia. Science. 323(5921): 1614-1617.
Koeppen K, Reuter P, Kohl S, Baumann B, Ladewig T, Wissinger B (2008). Functional analysis of human CNGA3 mutations associated with colour blindness suggests impaired surface expression of channel mutants A3(R427C) and A3(R563C). Eur J Neurosci. 27:2391-2401.
Koeppen K, Reuter P, Ladewig T, Kohl S, Baumann B, Jacobson SG, Plomp AS, Hamel CP, Janecke AR, Wissinger B (2010). Dissecting the pathogenic mechanisms of mutations in the pore region of the human cone photoreceptor cyclic nucleotide-gated channel. Hum Mutat. 31(7): 830-839.
Kohl S (2009). Genetic causes of hereditary cone and cone-rod dystrophies. Ophthalmologe 106(2): 109-115.
Kohl S, Baumann B, Rosenberg T, Kellner U, Lorenz B, Vadalà M, Jacobson SG, Wissinger B (2002). Mutations in the cone photoreceptor G-protein alpha- subunit gene GNAT2 in patients with achromatopsia. Am J Hum Genet. 71(2): 422-425.
Kohl S, Coppieters F, Meire F, Schaich S, Roosing S, Brennenstuhl C, Wissinger B (2012). A nonsense mutation in PDE6H causes autosomal-recessive incomplete achromatopsia. Am J Hum Genet. 91(3): 527-532.
Kohl S, Varsanyi B, Antunes GA, Baumann B, Hoyng CB, Jägle H, Rosenberg T, Kellner U, Lorenz B, Salati R, Jurklies B, Farkas A, Andreasson S, Weleber RG, Jacobson SG, Rudolph G, Castellan C, Dollfus H, Legius E, Anastasi M, Bitoun P, Lev D, Sieving PA, Munier FL, Zrenner E, Sharpe LT, Cremers FP, Wissinger B (2005). CNGB3 mutations account for 50% of all cases with autosomal recessive achromatopsia. Eur J Hum Genet. 13(3): 302-308.
Kondo H1, Qin M, Mizota A, Kondo M, Hayashi H, Hayashi K, Oshima K, Tahira T, Hayashi K (2004). A homozygosity-based search for mutations in patients with autosomal recessive retinitis pigmentosa, using microsatellite markers. Invest Ophthalmol Vis Sci. 45(12): 4433-9.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 153 References Chapter 8
Korir PK, Roberts L, Ramesar R, Seoighe C (2014). A mutation in a splicing factor that causes retinitis pigmentosa has a transcriptome-wide effect on mRNA splicing. BMC Res Notes. 7(1): 401.
Kumar P, Henikoff S, Ng PC (2009). Predicting the effects of coding non- synonymous variants on protein function using the SIFT algorithm. Nat Protoc. 4(7): 1073-81.
Kumaramanickavel G, Maw M, Denton MJ, John S, Srikumari CR, Orth U, Oehlmann R, Gal A (1994). Missense rhodopsin mutation in a family with recessive RP. Nat Genet. 8(1):10-11.
Kuznetsova T, Iwabe S, Boesze-Battaglia K, Pearce-Kelling S, Chang-Min Y, McDaid K, Aguirre GD (2012). Exclusion of RPGRIP1 ins44 from Primary Causal Association with Early-Onset Cone–Rod Dystrophy in Dogs. Invest Ophthalmol Vis Sci. 53(9): 5486-5501.
Lam K, Guo H, Wilson GA, Kohl S, Wong F (2011). Identification of variants in CNGA3 as cause for achromatopsia by exome sequencing of a single patient. Arch Ophthalmol. 129(9): 1212-1217.
Li H, Liu LY, Xu HY, Xu F, Jiang RX, Sui RF (2012). Clinical features of congenital stationary night blindness. Zhonghua Yi Xue Za Zhi. 92(39): 2756-2759.
Li WS1, Zheng QX, Kong FS, Pang JJ (2010). Progress in gene studies of hereditary retinal diseases. Zhonghua Yan Ke Za Zhi. 46(2): 186-92.
Lifeng P, Mingjie Z (2012). Structures of usher syndrome 1 proteins and their complexes. Physiol. 27(1): 25-42.
Littink KW, Koenekoop RK, van den Born LI, Collin RW, Moruz L, Veltman JA, Roosing S, Zonneveld MN, Omar A, Darvish M, Lopez I, Kroes HY, van Genderen MM, Hoyng CB, Rohrschneider K, van Schooneveld MJ, Cremers FP, den Hollander AI (2010). Homozygosity mapping in patients with cone- rod dystrophy: novel mutations and clinical characterizations. Invest Ophthalmol Vis Sci. 51(11): 5943-5951.
Liu C, Sherpa T, Varnum MD (2013). Disease-associated mutations in CNGB3 promote cytotoxicity in photoreceptor-derived cells. Mol Vis 19: 1268-1281.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 154 References Chapter 8
Lodha N, Loucks CM, Beaulieu C, Parboosingh JS, Bech-Hansen NT (2012). Congenital stationary night blindness: mutation update and clinical variability. Adv Exp Med Biol. 723: 371-379.
Malaichamy S, Sen P, Sachidanandam R, Arokiasamy T, Lancelot ME, Audo I, Zeitz C, Soumittra N (2014). Molecular profiling of complete congenital stationary night blindness: a pilot study on an Indian cohort. Mol Vis. 20: 341-351.
Martínez-Gimeno M, Gamundi MJ, Hernan I, Maseras M, Millá E, Ayuso C, Carballo M (2003). Mutations in the pre-mRNA splicing-factor genes PRPF3, PRPF8, and PRPF31 in Spanish families with autosomal dominant retinitis pigmentosa. Invest Ophthalmol Vis Sci. 44(5): 2171-2177.
Masland RH (2001). The fundamental plan of the retina. Nat Neurosci. 4(9): 877-886.
Masland RH (2012). The neuronal organization of the retina. Neuron. 76(2): 266-280.
Mathur P, Yang J (2014). Usher syndrome: Hearing loss, retinal degeneration and associated abnormalities. Biochim Biophys Acta. 1852(3): 406-420.
McRory JE, Hamid J, Doering CJ, Garcia E, Parker R, Hamming K, Chen L, Hildebrand M, Beedle AM, Feldcamp L, Zamponi GW, Snutch TP (2004). The CACNA1F gene encodes an L-type calcium channel with unique biophysical properties and tissue distribution. J Neurosci. 24(7): 1707-18.
M'hamdi O, Ouertani I (2014). Chaabouni-Bouhamed H2. Update on the genetics of Bardet-Biedl syndrome. Mol Syndromol. 5(2): 51-56.
Michaelides M, Hunt DM, Moore AT (2004). The cone dysfunction syndromes. Br J Ophthalmol. 88: 291-297.
Mohamed MK , Taylor RE, Feinstein DS, Huang X, Pittler SJ (1998). Structure and upstream region characterization of the human gene encoding rod photoreceptor cGMP phosphodiesterase alpha-subunit. J Mol Neurosci. 10(3):235-50.
Moradi P, Moore AT (2007). Molecular genetics of infantile-onset retinal dystrophies. Eye 21(10): 1344-1351.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 155 References Chapter 8
Mort M, Sterne-Weiler T, Li B, Ball EV, Cooper DN, Radivojac P, Sanford JR, Mooney SD (2014). MutPred Splice: machine learning-based prediction of exonic variants that disrupt splicing.Genome Biol. 15(1):R19.
Muraki-Oda S, Toyoda F, Okada A, Tanabe S, Yamade S, Ueyama H, Ohji M (2007). Functional analysis of rod monochromacy-associated missense mutations in the CNGA3 subunit of the cone photoreceptor cGMP-gated channel. BiochemBiophys Res Commun. 362:88-93.
Naeem MA, Chavali VR, Ali S, Iqbal M, Riazuddin S, Khan SN, Husnain T, Sieving PA, Ayyagari R, Riazuddin S, Hejtmancik JF, Riazuddin SA (2012). GNAT1 associated with autosomal recessive congenital stationary night blindness. Invest Ophthalmol Vis Sci. 53(3): 1353-1361
Nakamura M, Sanuki R, Yasuma TR, Onishi A, Nishiguchi KM, Koike C, Kadowaki M, Kondo M, Miyake Y, Furukawa T (2010). TRPM1 mutations are associated with the complete form of congenital stationary night blindness. Mol Vis. 16: 425–443
Naz S1, Riazuddin SA, Li L, Shahid M, Kousar S, Sieving PA, Hejtmancik JF, Riazuddin S (2010). A novel locus for autosomal recessive retinitis pigmentosa in a consanguineous Pakistani family maps to chromosome 2p. Am J Ophthalmol. 149(5):861-6.
Nishiguchi KM, Rivolta C (2012). Genes associated with retinitis pigmentosa and allied diseases are frequently mutated in the general population. PLos One 7(7): 41902.
Nishiguchi KM, Sandberg MA, Gorji N, Berson EL, Dryja TP (2005). Cone cGMP gated channel mutations and clinical findings in patients with achromatopsia, macular degeneration, and other hereditary cone diseases.Hum Mutat. 25(3): 248-258.
Nishiguchi KM, Tearle RG, Liu YP, Oh EC, Miyake N, Benaglio P, Harper S, Koskiniemi-Kuendig H, Venturini G, Sharon D, Koenekoop RK, Nakamura M, Kondo M, Ueno S, Yasuma TR, Beckmann JS, Ikegawa S, Matsumoto N, Terasaki H, Berson EL, Katsanis N, Rivolta C (2013). Whole genome sequencing in patients with retinitis pigmentosa reveals pathogenic DNA
Genetic Analysis of Rare Eye Disorders in Pakistani Families 156 References Chapter 8
structural changes and NEK2 as a new disease gene. Proc Natl Acad Sci USA. 110(40):16139-44.
Ogino K, Otani A, Oishi A, Kurimoto M, Sekiya T, Yoshimura N (2013). Concentric division of 10 visual field tests in retinitis pigmentosa.Jpn J Ophthalmol 57(3): 268-274.
Ostergaard E, Batbayli M, Duno M, Vilhelmsen K, Rosenberg T (2010). Mutations in PCDH21 cause autosomal recessive cone-rod dystrophy. J Med Genet. 47(10): 665-669.
Ouechtati F, Merdassi A, Bouyacoub Y, Largueche L, Derouiche K, Ouragini H, Nouira S, Tiab L, Baklouti K, Rebai A, Schorderet DF, Munier FL, Zografos L, Abdelhak S, El-Matri L (2011). Clinical and genetic investigation of a large Tunisian family with complete achromatopsia: identification of a new nonsense mutation in GNAT2 gene. J Hum Genet. 56(1): 22-28.
Palczewski K, Kumasaka T, Hori T, Behnke CA, Motoshima H, Fox BA, Le Trong I, Teller DC, Okada T, Stenkamp RE, Yamamoto M, Miyano M (2000). Crystal structure of rhodopsin: A G protein-coupled receptor. Science.289(5480):739-45.
Park JS, Okumura Y, Tachikawa H, Neiman AM (2013). SPO71 encodes a developmental stage-specific partner for Vps13 in Saccharomyces cerevisiae. Eukaryot Cell. 12(11):1530-7.
Park JS1, Neiman AM (2012). VPS13 regulates membrane morphogenesis during sporulation in Saccharomyces cerevisiae. J Cell Sci. 15;125(Pt 12):3004-11.
Parri V, Katzaki E, Uliana V, Scionti F, Tita R, Artuso R, Longo I, Boschloo R, Vijzelaar R, Selicorni A, Brancati F, Dallapiccola B, Zelante L, Hamel CP, SardaP,Lalani SR, Grasso R, Buoni S, Hayek J, Servais L, de Vries BB, Georgoudi N, Nakou S, Petersen MB, Mari F, Renieri A, Ariani F (2010). High frequency of COH1 intragenic deletions and duplications detected by MLPA in patients with Cohen syndrome. Eur J Hum Genet. 18: 1133–1140.
Patil H, Tserentsoodol N, Saha A, Hao Y, Webb M, Ferreira PA (2012). Selective loss of RPGRIP1-dependent ciliary targeting of NPHP4, RPGR and SDCCAG8 underlies the degeneration of photoreceptor neurons.Cell death dis. 3(7): e355.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 157 References Chapter 8
Pawlik B, Mir A, Iqbal H, Li Y, Nürnberg G, Becker C, Qamar R, Nürnberg P, Wollnik B (2010). A novel familial BBS12 mutation associated with a mild phenotype: implications for clinical and molecular diagnostic strategies. Mol Syndromol. 1(1): 27-34.
Peachey NS, Pearring JN, Jr P Bojang, Hirschtritt ME, Sturgill-Short G, Ray TA, Furukawa T, Koike C, Goldberg AFX, Shen Y, McCall MA, Nawy S, Nishina PM, Gregg RG (2012). Depolarizing bipolar cell dysfunction due to a TRPM1 point mutation. J Neurophysiol. 108: 2442-2451.
Peng C, Rich ED, Varnum MD (2004). Subunit configuration of heteromeric cone cyclic nucleotide-gated channels. Neuron. 42(3):401-10.
Petrs-Silva H, Linden R (2014). Advances in gene therapy technologies to treat retinitis pigmentosa. Clin Ophthalmol. 8: 127-136.
Poloschek CM, Kohl S (2010). Achromatopsia. Ophthalmologe. 107(6):571-580
Prokudin I, Li D, He S, Guo Y, Goodwin L, Wilson M, Hakonarson H (2014). Value of whole exome sequencing for syndromic retinal dystrophy diagnosis in young patients. Clin Experiment Ophthalmol. doi: 10.1111/ceo.12391.
Pulagam LP, Palczewski K (2010). Electrostatic compensation restores trafficking of the autosomal recessive retinitis pigmentosa E150K opsin mutant to the plasma membrane. J Biol Chem. 285(38):29446-29456.
Rachel RA1, Li T, Swaroop A (2012). Photoreceptor sensory cilia and ciliopathies: focus on CEP290, RPGR and their interacting proteins. Cilia. 1(1):22.
Ray TA, Heath KM, Hasan N, Noel JM, Samuels IS, Martemyanov KA, Peachey NS, McCall MA, Gregg GR (2014). GPR179 is required for high sensitivity of the mGluR6 signaling cascade in depolarizing bipolar cells. J Neurosci. 34(18): 6334-6343.
Ray TA, Heath KM, Hasan N, Noel JM, Samuels IS, Martemyanov KA, Peachey NS, McCall MA, Gregg RG (2014). GPR179 is required for high sensitivity of the mGluR6 signaling cascade in depolarizing bipolar cells. J Neurosci. 34(18):6334-43.
Riazuddin SA, Shahzadi A, Zeitz C, Ahmed ZM, Ayyagari R, Chavali VR, Ponferrada VG, Audo I, Michiels C, Lancelot ME, Nasir IA, Zafar
Genetic Analysis of Rare Eye Disorders in Pakistani Families 158 References Chapter 8
AU, Khan SN,Husnain T, Jiao X, MacDonald IM, Riazuddin S, Sieving PA, Katsanis N, Hejtmancik JF (2010). A mutation in SLC24A1 implicated in autosomal-recessive congenital stationary night blindness. Am J Hum Genet. 87(4): 523-531.
Riazuddin SA, Zulfiqar F, Zhang Q, Sergeev YV, Qazi ZA, Husnain T, Caruso R, Riazuddin S, Sieving PA, Hejtmancik JF (2005). Autosomal recessive retinitis pigmentosa is associated with mutations in RP1 in three consanguineous Pakistani families. Invest Ophthalmol Vis Sci. 46(7): 2264- 2270.
Riazuddin SA, Zulfiqar F, Zhang Q, Yao W, Li S, Jiao X, Shahzadi A, Amer M, Iqbal M, Hussnain T, Sieving PA, Riazuddin S, Hejtmancik JF (2006). Mutations in the gene encoding the alpha-subunit of rod phosphodiesterase in consanguineous Pakistani families. Mol Vis. 12: 1283-1291.
Rim PH, Figueirêdo ES, Hirata FE, Steiner CE, Marques-de-Faria AP (2009). Ocular findings in Brazilian identical twins with Cohen syndrome: case report. Arq Bras Oftalmol. 72(6):815-8.
Rivolta C, Sharon D, DeAngelis MM, Dryja TP (2002). Retinitis pigmentosa and allied diseases: numerous diseases, genes, and inheritance patterns. Hum Mol Genet. 11(10):1219-27.
Roepman R, Letteboer SJ, Arts HH, van Beersum SE, Lu X, Krieger E, Cremers FP (2005). Interaction of nephrocystin-4 and RPGRIP1 is disrupted by nephronophthisis or Leber congenital amaurosis-associated mutations. Proc Natl Acad Sci USA. 102(51): 18520-18525.
Rojas CV, María LS, Santos JL, Cortés F, Alliende MA (2002). A frameshift insertion in the cone cyclic nucleotide gated cation channel causes complete achromatopsia in a consanguineous family from a rural isolate. Eur J Hum Genet. 10(10): 638-462.
Roorda A, Metha AB, Lennie P, Williams DR (2001). Packing arrangement of the three cone classes in primate retina. Vision Res. 41(10): 1291-1306.
Roosing S, Rohrschneider K, Beryozkin A, Sharon D, Weisschuh N, Staller J, den Hollander AI (2013). Mutations in RAB28 encoding a farnesylated small
Genetic Analysis of Rare Eye Disorders in Pakistani Families 159 References Chapter 8
GTPase, are associated with autosomal recessive cone-rod dystrophy. Am J Hum Genet. 93(1): 110-117.
Roosing S, Thiadens AA, Hoyng CB, Klaver CC, den-Hollander AI, Cremers FP (2014). Causes and consequences of inherited cone disorders. Prog Retin Eye Res. 42: 1-26.
Rosenberg T, Baumann B, Kohl S, Zrenner E, Jorgensen AL, Wissinger B (2004). Variant phenotypes of incomplete achromatopsia in two cousins with GNAT2 gene mutations. Invest Ophthalmol Vis Sci. 45(12): 4256-4262.
Roska B, Busskamp V, Sahel JA, Picaud S (2013). Retinitis pigmentosa: eye sight restoration by optogenetic therapy. Biol Aujourdhui. 207(2): 109-121.
Scheidecker S1, Etard C, Pierce NW, Geoffroy V, Schaefer E, Muller J, Chennen K, Flori E, Pelletier V, Poch O, Marion V, Stoetzel C, Strähle U, Nachury MV, Dollfus H (2014). Exome sequencing of Bardet-Biedl syndrome patient identifies a null mutation in the BBSome subunit BBIP1 (BBS18). J Med Genet. 51(2):132-6.
Schön C, Biel M, Michalakis S (2013). Gene replacement therapy for retinal CNG channelopathies. Mol Genet Genomics. 288(10):459-467.
Schulz HL, Goetz T, Kaschkoetoe J, Weber BH (2004). The Retinome–defining a reference transcriptome of the adult mammalian retina/retinal pigment epithelium. BMC genomics. 5(1): 50.
Schuster A, Weisschuh N, Jägle H, Besch D, Janecke AR, Zierler H, Tippmann S, Zrenner E, Wissinger B (2005). Novel rhodopsin mutations and genotype- phenotype correlation in patients with autosomal dominant retinitis pigmentosa. Br J Ophthalmol. 89(10): 1258-1264.
Schwarz JM, Cooper DN, Schuelke M, Seelow D (2014). Mutation Taster2: mutation prediction for the deep-sequencing age.Nat Methods. 11(4):361-2.
Seelow D, Schuelke M, Hildebrandt F, Nürnberg P (2009). HomozygosityMapper- an interactive approach to homozygosity mapping. Nucleic Acids Res. 37(Web Server issue):W593-599.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 160 References Chapter 8
Seifert W, Kühnisch J, Maritzen T, Horn D, Haucke V, Hennies HC (2011). Cohen syndrome-associated protein, COH1, is a novel, giant Golgi matrix protein required for Golgi integrity. J Biol Chem. 286(43): 37665-37675.
Seifert W, Kühnisch J, Maritzen T, Lommatzsch S, Hennies HC, Bachmann S, Haucke V (2014). Cohen syndrome-associated protein COH1 physically and functionally interacts with the small GTPase RAB6 at the golgi complex and directs neurite outgrowth. J Biol Chem. jbc. M114.608174.
Sergouniotis PI, Chakarova C, Murphy C, Becker M, Lenassi E, Arno G, Lek M, MacArthur DG, Bhattacharya SS, Moore AT, Holder GE, Robson AG, Wolfrum U, Webster AR, Plagnol V (2014). Biallelic variants in TTLL5, encoding a tubulin glutamylase, cause retinal dystrophy. Am J Hum Genet. 94(5): 760-769.
Shahzadi A, Riazuddin SA, Ali S, Li D, Khan SN, Husnain T, Akram J, Sieving PA, Hejtmancik JF, Riazuddin S (2010). Nonsense mutation in MERTK causes autosomal recessive retinitis pigmentosa in a consanguineous Pakistani family. Br J Ophthalmol. 94(8): 1094-1099.
Shintani K, Shechtman DL, Gurwood AS (2009). Review and update: current treatment trends for patients with retinitis pigmentosa. Optometry. 80(7): 384- 401.
Siemiatkowska AM, Astuti GD, Arimadyo K, den-Hollander AI, Faradz SM, Cremers FP, Collin RW (2012). Identification of a novel nonsense mutation in RP1 that causes autosomal recessive retinitis pigmentosa in an Indonesian family. Mol Vis. 18: 2411-2419.
Siemiatkowska AM1, Astuti GD, Arimadyo K, den Hollander AI, Faradz SM, Cremers FP, Collin RW (2012). Identification of a novel nonsense mutation in RP1 that causes autosomal recessive retinitis pigmentosa in an Indonesian family. Mol Vis. 18:2411-9.
Simpson DA, Clark GR, Alexander S, Silvestri G, Willoughby CE (2011). Molecular diagnosis for heterogeneous genetic diseases with targeted high-throughput DNA sequencing applied to retinitis pigmentosa. J Med Genet. 48(3): 145- 151.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 161 References Chapter 8
Singhal A, MK MK Ostermaier, Vishnivetskiy SA, Panneels V, Homan KT, Tesmer JJ, Veprintsev D, Deupi X, Gurevich VV, Schertler GF, Standfuss J (2013). Insights into congenital stationary night blindness based on the structure of G90D rhodopsin. EMBO Rep. 14(6): 520-526.
Small KW, Silva-Garcia R, Udar N, Nguyen EV, Heckenlively JR (2008). New mutation, P575L, in the GUCY2D gene in a family with autosomal dominant progressive cone degeneration. Arch Ophthalmol. 126(3): 397-403.
Song P, Gao J, Inagaki Y, Kokudo N, Tang W (2012). Rare diseases, orphan drugs, and their regulation in Asia: Current status and future perspectives. Intractable Rare Dis Res. 1(1):3-9.
Stephen TH, Tsui I, Chou CL, Zernant J, Haamer E, Iranmanesh R, Allikmets R (2008). A novel mutation and phenotypes in phosphodiesterase 6 deficiency. Am J Ophthalmol. 146(5): 780-788.
Sundaram V, Wilde C, Aboshiha J, Cowing J, Han C, Langlo CS, Chana R, Davidson AE, Sergouniotis PI, Bainbridge JW, Ali RR, Dubra A, Rubin G, Webster AR, Moore AT, Nardini M, Carroll J, Michaelides M (2014). Retinal structure and function in achromatopsia: implications for gene therapy. Ophthalmology.121(1):234-245
Tanackovic G, Ransijn A, Ayuso C, Harper S, Berson EL, Rivolta C (2011). A missense mutation in PRPF6 causes impairment of pre-mRNA splicing and autosomal-dominant retinitis pigmentosa. Am J Hum Genet. 88(5): 643-649.
Tang W, Makuuchi M (2012). Intractable and rare diseases research. Intractable Rare Dis Res. 1(1):1-2.
Thanaraj TA, Clark F (2001). Human GC-AG alternative intron isoforms with weak donor sites show enhanced consensus at acceptor exon positions.Nucleic Acids Res. 29(12): 2581-2593.
Thiadens AA, Slingerland NW, Roosing S, van Schooneveld MJ, van Lith-Verhoeven JJ, van Moll-Ramirez N, Klaver CC (2009). Genetic etiology and clinical consequences of complete and incomplete achromatopsia. Ophthalmology. 116(10): 1984-1989.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 162 References Chapter 8
Thiadens AA1, Phan TM, Zekveld-Vroon RC, Leroy BP, van den Born LI, Hoyng CB, Klaver CC; Writing Committee for the Cone Disorders Study Group Consortium, Roosing S, Pott JW, van Schooneveld MJ, van Moll-Ramirez N, van Genderen MM, Boon CJ, den Hollander AI, Bergen AA, De Baere E, Cremers FP, Lotery AJ (2012). Clinical course, genetic etiology, and visual outcome in cone and cone-rod dystrophy. Ophthalmology. 119(4):819-26.
Tsang SH, Tsui I, Chou CL, Zernant J, Haamer E, Iranmanesh R, Tosi J, Allikmets R (2008). A novel mutation and phenotypes in phosphodiesterase 6 deficiency. Am J Ophthalmol. 146(5):780-8.
Ugur Iseri SA, Durlu YK, Tolun A (2010). A novel recessive GUCY2D mutation causing cone-rod dystrophy and not Leber's congenital amaurosis. Eur J Hum Genet. 18(10): 1121-1126.
Wang Q, Gao Y, Li S, Guo X, Zhang Q (2012). Mutation screening of TRPM1, GRM6, NYX and CACNA1F genes in patients with congenital stationary night blindness. Int J Mol Med. 30(3): 521-526.
Wang DY, Fan BJ, Chan WM, Tam OS, Chiang WY, Lam SC, Pang CP (2005). Digenic association of RHO and RP1 genes with retinitis pigmentosa among Chinese population in Hong Kong. Zhonghua Yi XueZaZhi. 85(23):1613-7.
Waseem NH, Vaclavik V, Webster A, Jenkins SA, Bird AC, Bhattacharya SS (2007). Mutations in the gene coding for the pre-mRNA splicing factor, PRPF31, in patients with autosomal dominant retinitis pigmentosa. Invest Ophthalmol Vis Sci. 48(3): 1330-1334.
Wissinger B, Gamer D, Jägle H, Giorda R, Marx T, Mayer S, Tippmann S, Broghammer M, Jurklies B, Rosenberg T, Jacobson SG, Sener EC, Tatlipinar S, Hoyng CB, Castellan C, Bitoun P, Andreasson S, Rudolph G, Kellner U, Lorenz B, Wolff G, Verellen-Dumoulin C, Schwartz M, Cremers FP, Apfelstedt-Sylla E, Zrenner E, Salati R, Sharpe LT, Kohl S (2001). CNGA3 mutations in hereditary cone photoreceptor disorder. Am J Hum Genet. 69(4): 722-737.
Wissinger B, Schaich S, Baumann B, Bonin M, Jägle H, Friedburg C, Kohl S (2011). Large deletions of the KCNV2 gene are common in patients with cone dystrophy with supernormal rod response. Hum Mutat. 32(12): 1398-1406.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 163 References Chapter 8
Wiszniewski W, Lewis RA, Lupski JR (2007). Achromatopsia: the CNGB3 p.T383fsX mutation results from a founder effect and is responsible for the visual phenotype in the original report of uniparental disomy 14. Hum Genet. 121(3): 433-439.
Won J, Gifford E, Smith RS, Yi H, Ferreira PA, Hicks WL, Nishina PM (2009). RPGRIP1 is essential for normal rod photoreceptor outer segment elaboration and morphogenesis. Hum Mol Genet. 18(22): 4329-4339.
Woolfe A, Mullikin JC, Elnitski L (2010). Genomic features defining exonic variants that modulate splicing. Genome Biol. 11(2):R20.
Xiao X, Guo X, Jia X, Li S, Wang P, Zhang Q (2011). A recurrent mutation in GUCY2D associated with autosomal dominant cone dystrophy in a Chinese family. Mol vis. 17: 3271.
Xie YA, Lee W, Cai C, Gambin T, Nõupuu K, Sujirakul T, Allikmets R (2014). New syndrome with retinitis pigmentosa is caused by nonsense mutations in retinol dehydrogenase RDH11. Hum Mol Genet. 23(21): 5774-5780.
Xu F, Dong F, Li H, Li X, Jiang R, Sui R (2013). Phenotypic characterization of a Chinese family with autosomal dominant cone-rod dystrophy related to GUCY2D. Doc Ophthalmol. 126(3):233-40.
Zeitz C, Kloeckener-Gruissem B, Forster U, Kohl S, Magyar I, Wissinger B, Mátyás G, Borruat FX, Schorderet DF, Zrenner E, Munier FL, Berger W (2006). Mutations in CABP4, the gene encoding the Ca2+-binding protein 4, cause autosomal recessive night blindness. Am J Hum Genet. 79(4):657-67.
Zeitz C, Robson AG, Audo I (2014). Congenital stationary night blindness: An analysis and update of genotype-phenotype correlations and pathogenic mechanisms. Prog Retin Eye Res. pii:S1350-9462(14)00062-7.
Zeitz C, van-Genderen M, Neidhardt J, Luhmann UF, Hoeben F, Forster U, Wycisk K, Mátyás G, Hoyng CB, Riemslag F, Meire F, Cremers FP, Berger W (2005). Mutations in GRM6 cause autosomal recessive congenital stationary night blindness with a distinctive scotopic 15-Hz flicker electroretinogram. Invest Ophthalmol Vis Sci. 46(11): 4328-4835.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 164 References Chapter 8
Zelinger L, Greenberg A, Kohl S, Banin E, Sharon D (2010). An ancient autosomal haplotype bearing a rare achromatopsia-causing founder mutation is shared among Arab Muslims and Oriental Jews. Hum Genet. 128(3): 261-267.
Zhang Q, Nishimura D, Vogel T, Shao J, Swiderski R, Yin T, Sheffield VC (2013). BBS7 is required for BBSome formation and its absence in mice results in Bardet-Biedl syndrome phenotypes and selective abnormalities in membrane protein trafficking. J cell sci. 126(11): 2372-2380.
Zhang Q, Zulfiqar F, Riazuddin SA, Xiao X, Ahmad Z, Riazuddin S, Hejtmancik JF (2004). Autosomal recessive retinitis pigmentosa in a Pakistani family mapped to CNGA1 with identification of a novel mutation. Mol Vis. 10: 884-889.
Zhang Q, Zulfiqar F, Xiao X, Riazuddin SA, Ahmad Z, Caruso R, MacDonald I, Sieving P, Riazuddin S, Hejtmancik JF (2007). Severe retinitis pigmentosa mapped to 4p15 and associated with a novel mutation in the PROM1 gene. Hum Genet. 122(3-4): 293-299.
Zhang N, Kolesnikov AV, Jastrzebska B, Mustafi D, Sawada O, Maeda T, Genoud C, Engel A, Kefalov VJ, Palczewski K (2013). Autosomal recessive retinitis pigmentosa E150K opsin mice exhibit photoreceptor disorganization. J Clin Invest. 123(1):121-37.
Zhao X, Ren Y, Zhang X, Chen C, Dong B, Li Y (2013). A novel GUCY2D mutation in a Chinese family with dominant cone dystrophy. Mol Vis. 19: 1039-1046.
Zhong Q, Kowluru RA (2011). Diabetic retinopathy and damage to mitochondrial structure and transport machinery. Invest Ophthalmol Vis Sci.52(12):8739- 8746.
Zhu L, Imanishi Y, Filipek S, Alekseev A, Jastrzebska B, Sun W, Saperstein DA, Palczewski K (2006). Autosomal recessive retinitis pigmentosa and E150K mutation in the opsin gene. J Biol Chem. 281(31):22289-22298.
Genetic Analysis of Rare Eye Disorders in Pakistani Families 165 References Chapter 8
Electronic References:
Database of Genomic Variant http://projects.tcag.ca/variation/ Ensembl Genome Browser http://www.ensembl.org 1000 Genome http://www.1000genomes.org/ Exome Variant Server http://evs.gs.washington.edu/EVS/ dbSNP (Short genetic variations) http://www.ncbi.nlm.nih.gov/SNP/ Primer3 software (version 0.4.0) (For primer designing) http://frodo.wi.mit.edu/primer3/ Homologene http://www.ncbi.nlm.nih.gov/homologene UCSC Genome Browser http://genome .ucsc.edu/cgi-bin The Human Gene Mutation Database http://www.hgmd.cf.ac.uk/ac/index.php
Genetic Analysis of Rare Eye Disorders in Pakistani Families 166 Appendix
Annex I
QUESTIONNAIRE
Family ID: ______
: a. Parent’s cousin marriage: YES / NO b. Relation of Parents: ______c. Number of affected: ______(If 2 or more than two affected, draw pedigree on separate page and fill following information of all affected)
Affected ID: ______
1. Demographic characteristics a. Age: ______b. Gender: ______c. Weight ______d. Height ______e. Head circumference ______2. Patient’s disease History a. Initial/ early complaint: ______b. Age of onset of disease ______c. Current vision status ______d. Any diagnostic tests of eye done? YES / NO e. If yes please indicate the results: ______If yes, what did physician/health care provider informed you. ______f. Any medical/ surgical treatments done? YES / NO 3. Ocular finding/observations: a. Night Blindness YES/NO(Age of onset ______) b. Photophobia: YES/NO(Age of onset ______) c. Nystagmus YES/NO d. Color perception: YES/NO e. Light perception: YES/NO f. Cataract: YES/NO
Genetic Analysis of Rare Eye Disorders in Pakistani Families 167 Appendix
g. Microphthalmia: YES/NO h. Anophthalmia: YES/NO i. Corneal opacity: YES/NO j. History of any infectious eye disease in past? ______k. Currently any infectious eye disease? ______4. Non Ocular Finding a. Hearing: Normal / Abnormal b. Speaking: Normal / Abnormal c. Facial dysmorphism: Present / Absent (Normal) d. Teeth structure and count: Normal/ Abnormal e. Bone deformities: Present/ Absent f. Infertility Present/ Absent g. Number and structure of hands’ fingers ______h. Number and structure of foot’s fingers ______i. Any other diseases: ______j. Other assessments (Speech, Intellectual, behavior etc) ______
5. Diagnostic test Record (Available/not available): a. Visual Acuity: YES / NO b. Visual Field: YES / NO c. Fundoscopy: YES / NO d. ERG: YES / NO e. MRI/CT Scan: YES / NO 6. Diagnosis by Ophthalmologist (if done): ______7. Remarks/Probable Diagnosis
Genetic Analysis of Rare Eye Disorders in Pakistani Families 168